We thank Reine Protacio for helpful comments during the preparation of this manuscript. We express our gratitude to the National Science Foundation (grants nos. 1243680 and 1613754) and the Hendrix College Odyssey Program for funding support.

<ol>
	<li>Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., Richmond, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+nucleosome+core+particle+at+2.8+A+resolution.">Crystal structure of the nucleosome core particle at 2.8 A resolution.</a> Nature. 389 (6648), 251-260 (1997).</li><li>Campos, E. I., Reinberg, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histones:+annotating+chromatin.">Histones: annotating chromatin.</a> Annu Rev Genet. 43, 559-599 (2009).</li><li>Rando, O. J., Winston, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+and+transcription+in+yeast.">Chromatin and transcription in yeast.</a> Genetics. 190 (2), 351-387 (2012).</li><li>Duina, A. A., Miller, M. E., Keeney, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Budding+yeast+for+budding+geneticists:+a+primer+on+the+Saccharomyces+cerevisiae+model+system.">Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system.</a> Genetics. 197 (1), 33-48 (2014).</li><li>Storici, F., Resnick, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delitto+perfetto+targeted+mutagenesis+in+yeast+with+oligonucleotides.">Delitto perfetto targeted mutagenesis in yeast with oligonucleotides.</a> Genet Eng (N Y). 25, 189-207 (2003).</li><li>Gray, M., Kupiec, M., Honigberg, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Site-specific+genomic+(SSG)+and+random+domain-localized+(RDL)+mutagenesis+in+yeast.">Site-specific genomic (SSG) and random domain-localized (RDL) mutagenesis in yeast.</a> BMC Biotechnol. 4, 7 (2004).</li><li>Erdeniz, N., Mortensen, U. H., Rothstein, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning-free+PCR-based+allele+replacement+methods.">Cloning-free PCR-based allele replacement methods.</a> Genome Res. 7 (12), 1174-1183 (1997).</li><li>Brachmann, C. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Designer+deletion+strains+derived+from+Saccharomyces+cerevisiae+S288C:+a+useful+set+of+strains+and+plasmids+for+PCR-mediated+gene+disruption+and+other+applications.">Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications.</a> Yeast. 14 (2), 115-132 (1998).</li><li>Lundblad, V., Hartzog, G., Moqtaderi, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Manipulation+of+cloned+yeast+DNA.">Manipulation of cloned yeast DNA.</a> Curr Protoc Mol Biol. Chapter 13, (2001).</li><li>Hoffman, C. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+yeast+DNA.">Preparation of yeast DNA.</a> Curr Protoc Mol Biol. Chapter 13, (2001).</li><li>Treco, D. A., Lundblad, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+yeast+media.">Preparation of yeast media.</a> Curr Protoc Mol Biol. Chapter 13, (2001).</li><li>Lederberg, J., Lederberg, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replica+plating+and+indirect+selection+of+bacterial+mutants.">Replica plating and indirect selection of bacterial mutants.</a> J Bacteriol. 63 (3), 399-406 (1952).</li><li>Sikorski, R. S., Hieter, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+system+of+shuttle+vectors+and+yeast+host+strains+designed+for+efficient+manipulation+of+DNA+in+Saccharomyces+cerevisiae.">A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.</a> Genetics. 122 (1), 19-27 (1989).</li><li>Johnson, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+systematic+mutational+analysis+of+a+histone+H3+residue+in+budding+yeast+provides+insights+into+chromatin+dynamics.">A systematic mutational analysis of a histone H3 residue in budding yeast provides insights into chromatin dynamics.</a> G3 (Bethesda). 5 (5), 741-749 (2015).</li><li>DiCarlo, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+in+Saccharomyces+cerevisiae+using+CRISPR-Cas+systems.">Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems.</a> Nucleic Acids Res. 41 (7), 4336-4343 (2013).</li><li>Cross, S. L., Smith, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+the+structure+and+cell+cycle+expression+of+mRNAs+encoded+by+two+histone+H3-H4+loci+in+Saccharomyces+cerevisiae.">Comparison of the structure and cell cycle expression of mRNAs encoded by two histone H3-H4 loci in Saccharomyces cerevisiae.</a> Mol Cell Biol. 8 (2), 945-954 (1988).</li><li>Libuda, D. E., Winston, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amplification+of+histone+genes+by+circular+chromosome+formation+in+Saccharomyces+cerevisiae.">Amplification of histone genes by circular chromosome formation in Saccharomyces cerevisiae.</a> Nature. 443 (7114), 1003-1007 (2006).</li></ol>

The authors declare that they have no competing financial interests.

O nível elevado de homologia de sequências entre os dois genes não alélicos que codificam para cada uma das quatro proteínas histona de núcleo em células haplóides de S. cerevisiae pode representar um desafio para os investigadores que desejam atingir especificamente um dos dois genes para a mutagénese. Anteriormente descreveu metodologias de mutagénese de levedura, incluindo a Delitto Perfetto, genómico de mutagénese específica do local (SSG), e métodos de substituição alelo baseada em PCR livre de clonagem 5, 6, 7, bem como técnicas baseadas em CRISPR mais de levedura recente 15, muitas vezes dependem pelo menos em parte, em sequências dentro do ORF de um gene alvo para recrutar a recombinação ou de reparação de máquinas para o local genómico desejado para gerar finalmente o alelo mutante final. Por outro lado, a estratégia que se apresentou aqui faz uso de sequências de ADN que flanqueia o ORF alvo para dirigir o homólogonos evento de recombinação necessário para a integração da mutação, e, como resultado, permite uma segmentação mais específica de um gene sobre o outro, apesar dos dois genes que possuem ORFs altamente homólogas. Esta característica faz com que a nossa estratégia particularmente bem adequada para a mutagénese de histona. No entanto, esta estratégia também pode ser adaptado para a mutagénese de outros genes no genoma da levedura. As características adicionais da nossa estratégia incluem o facto de os comprimentos das regiões que dirigem a recombinação homóloga dos genes mutantes pode ser concebido para ser muito grande, aumentando assim a eficiência da integração no local genómico alvo, e que, além da mutação desejada (s ) não há sequências de DNA adicionais são introduzidas no genoma. Uma vantagem adicional deste sistema é que uma vez que uma estirpe portadora substituição de um gene específico com histona URA3 foi construído, ele pode ser usado para a geração de qualquer versão mutante desejada desse Hist nomeadamenteum gene. Assim, por exemplo, a estirpe yAAD156, que está disponível para a comunidade de pesquisa a pedido, pode ser usado para fazer qualquer mutação hht2 desejado, sem a necessidade de construção de um novo alelo de hht2Δ :: URA3. Finalmente, utilizando iniciadores de PCR adequadamente desenhadas, esta estratégia pode também ser utilizada para gerar alelos histonas com deleções internas ou com mutações em vários codões, contanto que eles são relativamente perto um do outro (por exemplo, nós geramos um alelo hht2 que codifica um H3-K56R, L61W proteína mutante dupla usando esta estratégia). A capacidade de visar especificamente um dos dois genes da histona altamente homólogas para mutagénese poderia ser útil num número de diferentes configurações experimentais. Por exemplo, uma vez que os genes HHT1-HHF1 são expressos em diferentes níveis em relação aos genes HHT2 HHF2-16, pode ser de interesse para determinar se um particular, H3 ou H4 mutação di conferefenótipos fferent dependendo do gene que é expresso a partir. Outro exemplo é um cenário em que um investigador pretende gerar células haplóides que expressam um mutante de histona em particular a partir de ambos os genes da histona correspondentes - isto pode ser alcançado por primeiro mutagénese de cada gene de forma independente em duas estirpes diferentes, e, em seguida, a obtenção de células haplóides mutantes duplos por meio de uma cruz e subsequente isolamento dos produtos desejados meióticas. Ainda um outro exemplo refere-se a mutagénese de histonas H2A e H2B: devido ao facto de duas isoformas ligeiramente diferentes de cada uma das proteínas são codificadas pelo correspondente conjunto de genes não alélicos, um investigador pode querer avaliar os efeitos de um H2A específico ou mutação H2B em no contexto de qualquer isoforma. Ao projetar experimentos para induz mutações do HTA1 e loci HTB1 (codificação H2A e H2B, respectivamente), os investigadores devem estar cientes das descobertas recentes mostram que as estirpes transportando um (hta1-htb1) Δ são viável apenas if terem amplificado o locus HTA2-HTB2 (e nas proximidades lócus HHT1-HHF1 bem) através da geração de um pequeno cromossoma circular 17, o que poderia complicar a interpretação dos resultados. Nós temos utilizado recentemente uma versão desta estratégia de mutagénese para gerar proteínas histona H3 histonas que expressam todas as possíveis substituições de aminoácidos na posição 61, o que é normalmente ocupado por o aminoácido leucina 14. Para os experimentos, em vez de usar o yAAD156 como estirpe de partida para a mutagénese, foi utilizado estirpe yADP106, o qual contém um substituto da ORF HHT2 tanto com o gene URA3 trp1 e marcadores nutricionais (em vez de apenas URA3). A presença de ambos os genes marcadores facilitou a identificação de candidatos para a integração dos produtos de PCR mutante seguintes tela e purificação passo 5-FOA (etapas 5 e 6 do protocolo), como tal candidatES tornou-se fenotipicamente Ura - e Trp -, ao passo que a mutação espontânea URA3 resultou em células com um Ura - fenótipo Trp +. yADP106 também está disponível, mediante pedido, como é a sequência da cassete URA3-TRP1, o qual pode ser amplificado como uma unidade e utilizado para mutagénese de outros genes de histonas utilizando a estratégia aqui descrita. A incapacidade de obter os mutantes histona desejados utilizando esta estratégia pode ser atribuído a um número de possíveis razões, incluindo a quantidade insuficiente de produtos de PCR de tamanho completo usado para o passo de integração ou um número insuficiente de transformantes após a etapa de co-transformação. O primeiro problema poderia ser resolvido através da partilha de conjuntos juntos maiores de reacções de PCR ou através da concepção de diferentes conjuntos de iniciadores que produzem um maior rendimento de produto, enquanto que este último problema pode ser resolvido usando quantidades mais elevadas de plasmídeo de esqueleto na experiência de co-transformação. althourg, como indicado anteriormente, pode-se usar este procedimento para gerar mutantes de histona que albergam duas ou mais substituições de aminoácidos, os aminoácidos-alvo tem que ser relativamente perto uns dos outros uma vez que os respectivos codões precisam estar localizados dentro da mesma molécula de iniciador. Assim, esta estratégia não pode ser facilmente adaptado para a geração de histonas com múltiplas mutações localizadas distantes um do outro em todo o comprimento das proteínas.

Os quatro proteínas histonas centrais H2A, H2B, H3, H4 e desempenham papéis centrais na compactação, organização e função dos cromossomas eucarióticos. Dois conjuntos de cada uma destas histonas formar o octâmero da histona, um carretel molecular que dirige o invólucro de ~ 147 pares de bases de ADN em torno de si, resultando na formação de um nucleossoma 1. Nucleossomas são agentes activos numa variedade de processos à base de cromossomas, tais como a regulação da transcrição de genes e a formação de eucromatina e heterocromatina entre cromossomas, e, como tal, têm sido o foco de intensa investigação ao longo de várias décadas passadas. Um número de mecanismos têm sido descritos por nucleossomas que podem ser manipulados em formas que podem facilitar a execução dos processos específicos - estes mecanismos de modificação pós-tradução incluem os resíduos de histonas, remodelar nucleossoma dependente de ATP, e reorganização nucleossoma ATP-independentee montagem / desmontagem 2, 3. A levedura de germinação Saccharomyces cerevisiae é um organismo particularmente poderoso modelo para a compreensão da função da histona em eucariotas. Isto pode ser em grande parte atribuído ao elevado grau de conservação evolutiva das proteínas histona eukarya todo o domínio e a receptividade de levedura para uma variedade de genética e bioquímica experimental aproxima 4. abordagens Reverse-genéticos nas leveduras têm sido amplamente utilizada para estudar os efeitos de mutações específicas de histona sobre vários aspectos da biologia da cromatina. Para estes tipos de experiências é frequentemente preferível a utilização de células em que as histonas mutantes são expressos a partir de loci genómico nativo, como a expressão a partir de plasmídeos autónomos podem levar a níveis anormais intracelular de proteínas histona (devido a diferentes números de plasmídeos em células) e alteração concomitante da cromatina enam-, que em última instância pode confundir a interpretação dos resultados. Aqui, nós descrevemos uma técnica baseada em PCR que permite a mutagénese direccionada de genes de histonas nas suas localizações genómicas nativas, que não requerem um passo de clonagem e resulta na produção da mutação (ões) desejada, sem sequências de ADN exógeno que sobram no genoma. Esta técnica tira proveito do sistema de recombinação homóloga eficiente em levedura e tem várias características em comum com outras técnicas semelhantes desenvolvidas por outros grupos - mais notavelmente o Delitto Perfetto, genômica mutagénese específica (SSG), e alelo à base de PCR clonagem-livre métodos de reposição de 5, 6, 7. No entanto, a técnica que descrevem tem um aspecto que o torna particularmente adequado para a mutagénese de genes de histonas. Em células de levedura haplóides, cada um dos quatro histonas nucleares é codificada por dois não-Agenes llelic e altamente homólogas: por exemplo, histona H3 é codificado pelos genes HHT1 e HHT2, e as grelhas de leitura abertas (ORFs) dos dois genes são mais de 90% idênticos na sequência. Este elevado grau de homologia pode complicar experiências concebidas para visar especificamente um dos dois genes codificadores de histonas para mutagénese. Considerando que os métodos acima mencionados exigem frequentemente a utilização de, pelo menos, algumas sequências dentro da ORF do gene alvo para dirigir recombinação homóloga, a técnica aqui descrita faz uso das sequências que flanqueiam as ORFs dos genes de histonas (que partilhem menos homologia de sequência) para o passo de recombinação, aumentando assim a probabilidade de sucesso de mutagénese direccionamento ao local desejado. Além disso, as regiões homólogas que impulsionam a recombinação pode ser muito extensa, contribuindo para a eficiente recombinação homóloga alvo.

<table border="0" cellpadding="0" cellspacing="0" width="1091">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:517px;">1 kb DNA Ladder (DNA standards)</td>
			<td style="width:177px;">New England BioLabs</td>
			<td style="width:128px;">N3232L</td>
			<td style="width:269px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Agarose&#160;</td>
			<td>Sigma</td>
			<td>A5093-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Boric Acid</td>
			<td>Sigma</td>
			<td>B0394-500G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">dNTP mix (10 mM each)</td>
			<td>ThermoFisher Scientific</td>
			<td>R0192</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EDTA solution (0.5M, pH 8.0)</td>
			<td>AmericanBio</td>
			<td>AB00502-01000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ethanol (200 Proof)</td>
			<td>Fisher Scientific</td>
			<td>16-100-824</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:517px;">Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA)</td>
			<td>Sigma</td>
			<td>E4884-500G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Lithium acetate dihydrate</td>
			<td>Sigma</td>
			<td>L6883-250G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MyCycler Thermal Cycler</td>
			<td>BioRad</td>
			<td>170-9703</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Poly(ethylene glycol) (PEG)</td>
			<td>Sigma</td>
			<td>P3640-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PrimeSTAR HS DNA Polymerase (high fidelity DNA polymerase)&#160; and 5X buffer</td>
			<td>Fisher Scientific</td>
			<td>50-443-960</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Salmon sperm DNA solution</td>
			<td>ThermoFisher Scientific</td>
			<td>15632-011</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sigma 7-9 (Tris base, powder form)</td>
			<td>Sigma</td>
			<td>T1378-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sodium acetate trihydrate</td>
			<td>Sigma</td>
			<td>236500-500G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Supra Sieve GPG Agarose (low metling temperature agarose)</td>
			<td>AmericanBio</td>
			<td>AB00985-00100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Taq Polymerase and 10X Buffer</td>
			<td>New England BioLabs</td>
			<td>M0273X</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Toothpicks</td>
			<td>Fisher Scientific</td>
			<td>S67859</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tris-HCl (1M, pH 8.0)</td>
			<td>AmericanBio</td>
			<td>AB14043-01000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">a-D(+)-Glucose</td>
			<td>Fisher Scientific</td>
			<td>AC170080025</td>
			<td>for yeast media</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Agar</td>
			<td>Fisher Scientific</td>
			<td>DF0140-01-0</td>
			<td>for yeast media</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Peptone</td>
			<td>Fisher Scientific</td>
			<td>DF0118-07-2</td>
			<td>for YPD medium</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Yeast Extract</td>
			<td>Fisher Scientific</td>
			<td>DF0127-17-9</td>
			<td>for YPD medium</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">4-aminobenzoic acid</td>
			<td>Sigma</td>
			<td>A9878-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Adenine</td>
			<td>Sigma</td>
			<td>A8626-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glycine hydrochloride</td>
			<td>Sigma</td>
			<td>G2879-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Alanine</td>
			<td>Sigma</td>
			<td>A7627-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Arginine monohydrochloride</td>
			<td>Sigma</td>
			<td>A5131-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Asparagine monohydrate</td>
			<td>Sigma</td>
			<td>A8381-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Aspartic acid sodium salt monohydrate</td>
			<td>Sigma</td>
			<td>A6683-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Cysteine hydrochloride monohydrate</td>
			<td>Sigma</td>
			<td>C7880-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Glutamic acid hydrochloride</td>
			<td>Sigma</td>
			<td>G2128-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Glutamine</td>
			<td>Sigma</td>
			<td>G3126-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Histidine monohydrochloride monohydrate</td>
			<td>Sigma</td>
			<td>H8125-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:517px;">L-Isoleucine</td>
			<td>Sigma</td>
			<td>I2752-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Leucine</td>
			<td>Sigma</td>
			<td>L8000-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Lysine monohydrochloride</td>
			<td>Sigma</td>
			<td>L5626-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Methionine</td>
			<td>Sigma</td>
			<td>M9625-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Phenylalanine</td>
			<td>Sigma</td>
			<td>P2126-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Proline</td>
			<td>Sigma</td>
			<td>P0380-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Serine</td>
			<td>Sigma</td>
			<td>S4500-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:517px;">L-Threonine</td>
			<td>Sigma</td>
			<td>T8625-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Tryptophan</td>
			<td>Sigma</td>
			<td>T0254-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Tyrosine</td>
			<td>Sigma</td>
			<td>T3754-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Valine</td>
			<td>Sigma</td>
			<td>V0500-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">myo-Inositol</td>
			<td>Sigma</td>
			<td>I5125-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Uracil</td>
			<td>Sigma</td>
			<td>U0750-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ammonium Sulfate</td>
			<td>Fisher Scientific</td>
			<td>A702-500</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="18">
			<td height="18" style="height:19px;">Yeast Nitrogen Base</td>
			<td>Fisher Scientific</td>
			<td>DF0919-07-3</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">5-Fluoroorotic acid (5-FOA)</td>
			<td>AmericanBio</td>
			<td>AB04067-00005</td>
			<td>for&#160; 5-FOA medium</td>
		</tr>
	</tbody>
</table>

targeted in situ mutagenesis of histone genes in budding yeast

We describe a PCR- and homologous recombination-based system for generating targeted mutations in histone genes in budding yeast cells. The resulting mutant alleles reside at their endogenous genomic sites and no exogenous DNA sequences are left in the genome following the procedure. Since in haploid yeast cells each of the four core histone proteins is encoded by two non-allelic genes with highly homologous open reading frames (ORFs), targeting mutagenesis specifically to one of two genes encoding a particular histone protein can be problematic. The strategy we describe here bypasses this problem by utilizing sequences outside, rather than within, the ORF of the target genes for the homologous recombination step. Another feature of this system is that the regions of DNA driving the homologous recombination steps can be made to be very extensive, thus increasing the likelihood of successful integration events. These features make this strategy particularly well-suited for histone gene mutagenesis, but can also be adapted for mutagenesis of other genes in the yeast genome.

Descrevemos a geração de um alelo hht2 expressando uma proteína mutante da histona H3 abrigando uma substituição na posição 53 a partir de uma arginina para um ácido glutâmico (H3-R53E mutante) como um exemplo representativo do alvo na estratégia de mutagénese in situ. Geramos uma estirpe em que toda a ORF de HHT2 é substituído pelo gene URA3 (veja o passo 1 do protocolo). Esta estirpe, yAAD156, também abriga um alelo his3Δ200, o que faz com que as células a ser auxotrófica para a histidina. Seguindo o procedimento indicado no passo 2 do protocolo, que, em seguida, gerou os dois fragmentos que se sobrepõem parcialmente de HHT2. Os seguintes iniciadores foram utilizados para o primeiro fragmento: Iniciador para a frente (OAD20): 5 &#39;GCGTTCATTATCGCCCAATGTG 3&#39; e o iniciador inverso (R53Erev): 5 &#39;GTTCAGTAGATTTTTGGAATtcTCTAATTTCTCTCAAG 3&#39;. A sequência PRIMers foram utilizados para o segundo fragmento: Iniciador para a frente (R53Efor): 5 &#39;CTTGAGAGAAATTAGAgaATTCCAAAAATCTACTGAAC 3&#39; e o iniciador inverso (OAD21): 5 &#39;GCGCTTGATCAGCAGTTCATCG 3&#39;. Note-se que o iniciador reverso na primeira reação ea Atacante Primer na segunda reação contêm os nucleótidos desejadas mutado (em minúsculas) - estes nucleotídeos mutantes são aninhado entre duas longas extensões de sequências do tipo selvagem, pois isso permite para o recozimento eficiente do iniciador com o molde de ADN, apesar do desfasamento nas posições mutantes. Além disso, note que os nucleótidos mutado na estes dois iniciadores são complementares inversa uns aos outros e causar uma mutação AG para GA na cadeia com sentido, o que resulta em uma mudança AGA GAA codão, que em última análise produzem a mutação R53E na proteína codificada. Os resultados destas reacções de PCR são mostrados na Figura 2A. Utilizando o procedimento descrito no passo 3, que, em seguida, Gener<html> ciado os produtos de PCR de tamanho completo. Os iniciadores utilizados foram: Iniciador para a frente (OAD479): 5&#39;TATGGCTCGGTGTCAAAACA 3 &#39;e iniciador reverso (OAD480): 5&#39; CATGGTTTCTTGCCGGTTAT 3 &#39;. Ao conceber estes iniciadores, é importante ter a certeza que a fusão produtos de PCR resultantes incluem, pelo menos, 40 pares de bases em cada termina para conduzir a reacção de recombinação homóloga (quanto mais as regiões de homologia, os mais eficazes e específicos os eventos de recombinação homóloga será estar). Na nossa experiência, os produtos de PCR de tamanho completo continha uma região de 195 pares de bases e 220 pares de base região homóloga às regiões a montante e a jusante do ORF HHT2, respectivamente. Um exemplo destes produtos de PCR foi analisada por electroforese em gel de agarose (Figura 2B). Os produtos de PCR de tamanho completo foram então co-transformado juntamente com pRS413 plasmídeo (a centromérica, HIS3- marcada plasmídeof &quot;&gt; 13) e os transformantes foram seleccionados em placas sem histidina (SC-suas placas) como descrito no passo 4 do protocolo. colónias His + foram então pesquisados quanto a resistência 5-FOA seguindo os procedimentos descritos no passo 5 do protocolo. a Figura 3 mostra um exemplo de uma placa de transformação (SC-His) e 5-FOA placas seguintes de SC-suas placas-plaqueamento de réplicas. Exemplos de amostras aderentes, bem como amostras pouco provável para representar os eventos de integração desejados também são apresentadas na Figura 3 . em nosso experimento, foram identificados doze amostras de candidatos fora do ~ 90.000 transformantes selecionados. Estes candidatos foram então purificado como descrito no passo 6 do protocolo. Os doze candidatos foram então submetidos à análise de PCR descrito no passo 7 do protocolo para avaliar se refletido substituições autênticas do gene URA3 com produtos de PCR mutantes. Para os nossos experimenT, foi utilizado um iniciador directo que hibridiza 89 pares de bases a montante do local de integração do produto de PCR e um iniciador reverso que hibridiza 302 pares de bases a jusante do local de integração do produto de PCR. Estes iniciadores gerar produtos de PCR de 1217 pares de bases de tamanho, se o locus HHT2 é ocupada por HHT2 (ou versões mutantes de HHT2 albergando substituições de pares de bases), ou produtos de PCR de 2188 pares de bases de tamanho, se o locus ocupado pelo gene marcador URA3 . A sequência do iniciador utilizado para a frente (OAD476) é: 5 &#39;GAAACTATTGGCACGCCCTA e que de o iniciador inverso utilizado (OAD477) é: 5&#39; CCTGCGAATCAACCGATACT 3 &#39;. Dos doze candidatos tínhamos identificados, quatro apresentaram integração de um produto de PCR no local correto (veja a Figura 4A para um exemplo). Finalmente, uma vez que a mutação de AG GA gera um novo sítio de restrição Eco RI, que submetido produtos de PCR a partir de uma das amostras de integração bem sucedidas para uma <em&gt; digestão com EcoRI e foram capazes de demonstrar que a sequência mutante na verdade tinha sido integrado no genoma (ver Figura 4B). Neste caso particular, não sequenciar os produtos de PCR para assegurar que as mutações indesejadas adicionais não tinha sido incorporado no genoma: no entanto, utilizou-se um procedimento muito semelhante a esta para gerar um grande número de mutações HHT2 num estudo passado 14, e constataram que a maioria dos alelos mutantes integrados realizar nenhum outro do que as desejadas mutações. <img alt="Figura 2" src="/files/ftp_upload/55263/55263fig2.jpg" /> Figura 2: Geração de PCR produtos Harboring desejado Mutações para a integração no genoma da levedura. Reacção (a) de PCR para gerar os fragmentos que se sobrepõem parcialmente de HHT2 albergando as mutações desejadas. representação dos desenhos animados t: Topele duas reacções de PCR para a obtenção dos dois fragmentos HHT2 (consulte a Figura 1B-1). círculos vermelhos representam os nucleótidos desemparelhados nos iniciadores utilizados para introduzir a mutação AG para GA na cadeia de sentido do gene. Análise de eletroforese em gel de produtos de PCR a e b (pistas 2 e 3, respectivamente): inferior. Padrões de ADN são mostradas na pista 1. (B) reacção de fusão de PCR para gerar produtos de PCR de tamanho completo para a integração no genoma da levedura (consulte a Figura 1B-2 e 3). Topo: representação dos desenhos animados e a reacção de PCR esperado produto de PCR (produto C). círculos vermelhas representam mutação desejada como descrito em (A) acima. Análise de gel de eletroforese de PCR produtos c (pista 2): inferior. Padrões de DNA são apresentados na pista 1. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55263/55263fig2large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> Figura 3: Os resultados representativos da experiência Co-transformação e tela de 5 FOA. Esquerda: SC-o seu representante placa revestida com células submetidas ao processo de co-transformação, após um período de incubação de 3 dias a 30ºC. Aproximadamente 5000 colónias foram contadas. Médio: Representante placa 5-FOA seguinte replica-plating a partir de uma placa SC-a co-transformação, após um período de incubação de 2 dias a 30 ° C. As amostras 1 e 2 foram considerados candidatos para ter passado por um evento de integração bem sucedida, devido às suas morfologias assimétricas. Isto é porque uma verdadeira substituição do gene URA3 com o alelo hht2 é provável que ocorra antes (ou pouco depois) uma célula transformada é colocada em SC-o prato e, como resultado, a colónia que vai surgir no local conterá principalmente, se não exclusivamente, 5-FOA-resistanAs células T - quando essa colônia é posteriormente a uma placa 5-FOA será esmagado, dando origem a uma mancha assimétrica aparência das células na placa banhada a réplica. Por outro lado, espontânea mutações no gene URA3 que podem surgir durante a formação de colónias são mais susceptíveis de ser confinado dentro de uma pequena região de uma colónia, e assim mais provável de dar origem a papilas quando réplica-plaqueadas a uma placa de 5-FOA. Direita: uma placa representativa diferente de 5-FOA seguinte réplica-chapeamento de uma placa-SC seu co-transformação após uma incubação de 3 dias a 30 ° C. Um candidato adicional (amostra 3), bem como duas pequenas papilas são visíveis nesta placa (amostras 4 e 5) - tais papilas, que são mais claramente visíveis depois de 3 ou mais dias de incubação, são provavelmente para representar mutações URA3 espontâneas e não o evento de integração desejada. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55263/55263fig3large.jpg" target="_blank">por favor clique aqui para visualizar</a>uma versão maior desta figura. <img alt="Figura 4" src="/files/ftp_upload/55263/55263fig4.jpg" /> Figura 4: As análises moleculares de amostras Candidato integração. Ensaio (A) por PCR para identificar eventos de integração bem sucedida. Representações dos desenhos animados de as reacções de PCR utilizados para avaliar a integração bem sucedida do alelo mutante hht2 no genoma: superior. Parte inferior: análise de electroforese em gel de reacções de PCR utilizando o DNA genómico derivado de uma estirpe de tipo selvagem HHT2 (utilizado como um controlo, pista 2), a estirpe que alberga o yAAD156 substituição hht2Δ :: URA3 (utilizado como um controlo, pista 3), um candidato amostra de integração (pista 4), e uma amostra papilas resistente a 5-FOA (e, portanto, pouco provável que representam um evento de integração correcta, pista 5). padrões de ADN são mostradas na pista 1. Note-se que os tamanhos dos produtos de PCR para a amostra são integração candidato consiste dont com um evento de integração bem sucedida, enquanto que o tamanho dos produtos de PCR para a amostra papilas é consistente com um locus hht2Δ :: URA3 intacta. (B) digestão com EcoRI para confirmar a presença do alelo mutante. Topo: representação dos desenhos animados de os fragmentos da digestão esperados derivados a partir de uma reacção de digestão de Eco RI de produtos de PCR contendo tanto o gene de tipo selvagem HHT2 ou o alelo mutante hht2. A análise de electroforese em gel de reacções de digestão dos produtos de PCR derivados de uma estirpe de tipo selvagem HHT2 (pista 2; os produtos de PCR aqui utilizados foram derivados a partir da mesma amostra que o utilizado na pista 2 do painel a) e uma amostra de integração candidato (: Parte inferior pista 3, os produtos de PCR aqui utilizados foram derivados a partir da mesma amostra que o utilizado na pista 4 do painel a). padrões de ADN são mostradas na pista 1. Note-se que os padrões de digestão confirmar que o AG a mutação GA foi introduzido com sucesso no genoma do candidatoamostra de integração. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55263/55263fig4large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a>

Watch this Scientific Journal Video about Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast at JoVE.com

Mutagênese in situ direcionada de genes de histonas em leveduras em brotamento | Genética | Vídeo

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

A strategy for generating mutations in histone genes at their endogenous location in Saccharomyces cerevisiae is presented.

Visadas<em&gt; In Situ</em&gt; mutagénese de histona Genes em brotamento Yeast

We describe a PCR- and homologous recombination-based system for generating targeted mutations in histone genes in budding yeast cells. The resulting ...

targeted-in-situ-mutagenesis-of-histone-genes-in-budding-yeast

Nanyang Technological University

Research

Education

JoVE Journal

JoVE Core

Biology

Genetics

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

DNA Structure and Function

SCIENTISTS IN ACTION

15.2K visualizações.  Hendrix College. A strategy for generating mutations in histone genes at their endogenous location in Saccharomyces cerevisiae is presented. 

Vídeo: Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most mutagenesis-based screens, researchers have relied on the use of toxic chemicals, carcinogens, or irradiation, which requires designated equipment, safety setup, and/or disposal of hazardous materials. We have developed a simple approach to induce heritable mutations in C. elegans using germline-expressed histone-miniSOG, a light-inducible potent generator of reactive oxygen species. This mutagenesis method is free of toxic chemicals and requires minimal laboratory safety and waste management. The induced DNA modifications include single-nucleotide changes and small deletions, and complement those caused by classical chemical mutagenesis. This methodology can also be used to induce integration of extrachromosomal transgenes. Here, we provide the details of the LED setup and protocols for standard mutagenesis and transgene integration.

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Genetically-encoded histone-miniSOG induces genome-wide heritable mutations in a blue&#160;light-dependent manner. This mutagenesis method is simple, fast, free of toxic chemicals, and well-suited for forward genetic screening and transgene integration.

A mutagénese aleatória optogenetic Usando Histona-miniSOG em<em&gt; C. elegans</em

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most ...

Genética

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

As a promising genome editing platform, the CRISPR/Cas9 system has great potential for efficient genetic manipulation, especially for targeted integration of transgenes. However, due to the low efficiency of homologous recombination (HR) and various indel mutations of non-homologous end joining (NHEJ)-based strategies in non-dividing cells, in vivo genome editing remains a great challenge. Here, we describe a homology-mediated end joining (HMEJ)-based CRISPR/Cas9 system for efficient in vivo precise targeted integration. In this system, the targeted genome and the donor vector containing homology arms (~800 bp) flanked by single guide RNA (sgRNA) target sequences are cleaved by CRISPR/Cas9. This HMEJ-based strategy achieves efficient transgene integration in mouse zygotes, as well as in hepatocytes in vivo. Moreover, a HMEJ-based strategy offers an efficient approach for correction of fumarylacetoacetate hydrolase (Fah) mutation in the hepatocytes and rescues Fah-deficiency induced liver failure mice. Taken together, focusing on targeted integration, this HMEJ-based strategy provides a promising tool for a variety of applications, including generation of genetically modified animal models and targeted gene therapies.

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

The clustered regularly interspaced short palindromic repeats/CRISPR associated protein 9 (CRISPR/Cas9) system provides a promising tool for genetic engineering, and opens up the possibility of targeted integration of transgenes. We describe a homology-mediated end joining (HMEJ)-based strategy for efficient DNA targeted integration in vivo and targeted gene therapies using CRISPR/Cas9.

Integração de alvo CRISPR/Cas9-mediada na Vivo usando uma estratégia de baseada em juntar-se mediada por homologia final

As a promising genome editing platform, the CRISPR/Cas9 system has great potential for efficient genetic manipulation, especially for targeted integration ...

Gene-targeted Random Mutagenesis to Select Heterochromatin-destabilizing Proteasome Mutants in Fission Yeast

Random mutagenesis of a target gene is commonly used to identify mutations that yield the desired phenotype. Of the methods that may be used to achieve random mutagenesis, error-prone PCR is a convenient and efficient strategy for generating a diverse pool of mutants (i.e., a mutant library). Error-prone PCR is the method of choice when a researcher seeks to mutate a pre-defined region, such as the coding region of a gene while leaving other genomic regions unaffected. After the mutant library is amplified by error-prone PCR, it must be cloned into a suitable plasmid. The size of the library generated by error-prone PCR is constrained by the efficiency of the cloning step. However, in the fission yeast, Schizosaccharomyces pombe, the cloning step can be replaced by the use of a highly efficient one-step fusion PCR to generate constructs for transformation. Mutants of desired phenotypes may then be selected using appropriate reporters. Here, we describe this strategy in detail, taking as an example, a reporter inserted at centromeric heterochromatin.

This article describes a detailed methodology for random mutagenesis of a target gene in fission yeast. As an example, we target rpt4+, which encodes a subunit of the 19S proteasome, and screen for mutations that destabilize heterochromatin.

Gene-alvo Mutagenesis aleatório para selecionar heterocromatina-desestabilizando Proteassoma mutantes no fermento de fissão

Random mutagenesis of a target gene is commonly used to identify mutations that yield the desired phenotype. Of the methods that may be used to achieve ...

Visualization of Microbiota in Tick Guts by Whole-mount In Situ Hybridization

Infectious diseases transmitted by arthropod vectors continue to pose a significant threat to human health worldwide. The pathogens causing these diseases, do not exist in isolation when they colonize the vector; rather, they likely engage in interactions with resident microorganisms in the gut lumen. The vector microbiota has been demonstrated to play an important role in pathogen transmission for several vector-borne diseases. Whether resident bacteria in the gut of the Ixodes scapularis tick, the vector of several human pathogens including Borrelia burgdorferi, influence tick transmission of pathogens is not determined. We require methods for characterizing the composition of the bacteria associated with the tick gut to facilitate a better understanding of potential interspecies interactions in the tick gut. Using whole-mount in situ hybridization to visualize RNA transcripts associated with particular bacterial species allows for the collection of qualitative data regarding the abundance and distribution of the microbiota in intact tissue. This technique can be used to examine changes in the gut microbiota milieu over the course of tick feeding and can also be applied to analyze expression of tick genes. Staining of whole tick guts yield information about the gross spatial distribution of target RNA in the tissue without the need for three-dimensional reconstruction and is less affected by environmental contamination, which often confounds the sequencing-based methods frequently used to study complex microbial communities. Overall, this technique is a valuable tool that can be used to better understand vector-pathogen-microbiota interactions and their role in disease transmission.

Visualization of Microbiota in Tick Guts by Whole-mount In Situ Hybridization

Here, we present a protocol to spatially and temporally assess the presence of viable microbiota in tick guts using a modified whole-mount in situ hybridization approach.

Visualização da Microbiota nas entranhas do carrapato por toda a montagem In Situ da hibridação

Infectious diseases transmitted by arthropod vectors continue to pose a significant threat to human health worldwide. The pathogens causing these ...

Single Molecule Fluorescence In Situ Hybridization (smFISH) Analysis in Budding Yeast Vegetative Growth and Meiosis

Single molecule fluorescence in situ hybridization (smFISH) is a powerful technique to study gene expression in single cells due to its ability to detect and count individual RNA molecules. Complementary to deep sequencing-based methods, smFISH provides information about the cell-to-cell variation in transcript abundance and the subcellular localization of a given RNA. Recently, we have used smFISH to study the expression of the gene&#160;NDC80&#160;during meiosis in budding yeast, in which two transcript isoforms exist and the short transcript isoform has its entire sequence shared with the long isoform. To confidently identify each transcript isoform, we optimized known smFISH protocols and obtained high consistency and quality of smFISH data for the samples acquired during budding yeast meiosis. Here, we describe this optimized protocol, the criteria that we use to determine whether high quality of smFISH data is obtained, and some tips for implementing this protocol in&#160;other yeast strains and growth conditions.

Single Molecule Fluorescence In Situ Hybridization smFISH Analysis in Budding Yeast Vegetative Growth and Meiosis

This single molecule fluorescence in situ hybridization protocol is optimized to quantify the number of RNA molecules in budding yeast during vegetative growth and meiosis.

Única molécula fluorescência In Situ Hybridization (smFISH) análise em Budding fermento crescimento vegetativo e meiose

Single molecule fluorescence in situ hybridization (smFISH) is a powerful technique to study gene expression in single cells due to its ability to detect ...

Mating-based Overexpression Library Screening in Yeast

Budding yeast has been widely used as a model in studying proteins associated with human diseases. Genome-wide genetic screening is a powerful tool commonly used in yeast studies. The expression of a number of neurodegenerative disease-associated proteins in yeast causes cytotoxicity and aggregate formation, recapitulating findings seen in patients with these disorders. Here, we describe a method for screening a yeast model of the Amyotrophic Lateral Sclerosis-associated protein FUS for modifiers of its toxicity. Instead of using transformation, this new screening platform relies on the mating of yeast to introduce an arrayed library of plasmids into the yeast model. The mating method has two clear advantages: first, it is highly efficient; second, the pre-transformed arrayed library of plasmids can be stored for long-term as a glycerol stock, and quickly applied to other screens without the labor-intensive step of transformation into the yeast model each time. We demonstrate how this method can successfully be used to screen for genes that modify the toxicity of FUS.

This article presents a mating-based method to facilitate overexpression screening in budding yeast using an arrayed plasmid library.

Rastreio de biblioteca superexpressão de acasalamento-baseado no fermento

Budding yeast has been widely used as a model in studying proteins associated with human diseases. Genome-wide genetic screening is a powerful tool ...

Characterizing Histone Post-translational Modification Alterations in Yeast Neurodegenerative Proteinopathy Models

Neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and Parkinson&#39;s disease (PD), cause the loss of hundreds of thousands of lives each year. Effective treatment options able to halt disease progression are lacking. Despite the extensive sequencing efforts in large patient populations, the majority of ALS and PD cases remain unexplained by genetic mutations alone. Epigenetics mechanisms, such as the post-translational modification of histone proteins, may be involved in neurodegenerative disease etiology and progression and lead to new targets for pharmaceutical intervention. Mammalian in vivo and in vitro models of ALS and PD are costly and often require prolonged and laborious experimental protocols. Here, we outline a practical, fast, and cost-effective approach to determining genome-wide alterations in histone modification levels using Saccharomyces cerevisiae as a model system. This protocol allows for comprehensive investigations into epigenetic changes connected to neurodegenerative proteinopathies that corroborate previous findings in different model systems while significantly expanding our knowledge of the neurodegenerative disease epigenome.

This protocol outlines experimental procedures to characterize genome-wide changes in the levels of histone post-translational modifications (PTM) occurring in connection with the overexpression of proteins associated with ALS and Parkinson&#39;s disease in Saccharomyces cerevisiae models. After SDS-PAGE separation, individual histone PTM levels are detected with modification-specific antibodies via Western blotting.

Caracterizando a histona modificação pós-traducional alterações nos modelos de Neurodegenerative Proteinopathy de levedura

Neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and Parkinson&#39;s disease (PD), cause the loss of hundreds of thousands of lives ...

In Vivo Forward Genetic Screen to Identify Novel Neuroprotective Genes in Drosophila melanogaster

There is much to understand about the onset and progression of neurodegenerative diseases, including the underlying genes responsible. Forward genetic screening using chemical mutagens is a useful strategy for mapping mutant phenotypes to genes among Drosophila and other model organisms that share conserved cellular pathways with humans. If the mutated gene of interest is not lethal in early developmental stages of flies, a climbing assay can be conducted to screen for phenotypic indicators of decreased brain functioning, such as low climbing rates. Subsequently, secondary histological analysis of brain tissue can be performed in order to verify the neuroprotective function of the gene by scoring neurodegeneration phenotypes. Gene mapping strategies include meiotic and deficiency mapping that rely on these same assays can be followed by DNA sequencing to identify possible nucleotide changes in the gene of interest.

In Vivo Forward Genetic Screen to Identify Novel Neuroprotective Genes in Drosophila melanogaster

We present a protocol using a forward genetic approach to screen for mutants exhibiting neurodegeneration in Drosophila melanogaster. It incorporates a climbing assay, histology analysis, gene mapping and DNA sequencing to ultimately identify novel genes related to the process of neuroprotection.

In vivo Forward genética Screen para identificar novos genes neuroprotetores em Drosophila melanogaster

There is much to understand about the onset and progression of neurodegenerative diseases, including the underlying genes responsible. Forward genetic ...

Expression, Purification, and Liposome Binding of Budding Yeast SNX-BAR Heterodimers

SNX-BAR proteins are an evolutionarily conserved class of membrane remodeling proteins that play key roles in sorting and trafficking of protein and lipids during endocytosis, sorting within the endosomal system, and autophagy. Central to SNX-BAR protein function is the ability to form homodimers or heterodimers that bind membranes using highly conserved phox-homology (PX) and BAR (Bin/Amphiphysin/Rvs) domains. In addition, oligomerization of SNX-BAR dimers on membranes can elicit the formation of membrane tubules and vesicles and this activity is thought to reflect their functions as coat proteins for endosome-derived transport carriers. Researchers have long utilized in vitro binding studies using recombinant SNX-BAR proteins on synthetic liposomes or giant unilamellar vesicles (GUVs) to reveal the precise makeup of lipids needed to drive membrane remodeling, thus revealing their mechanism of action. However, due to technical challenges with dual expression systems, toxicity of SNX-BAR protein expression in bacteria, and poor solubility of individual SNX-BAR proteins, most studies to date have examined SNX-BAR homodimers, including non-physiological dimers that form during expression in bacteria. Recently, we have optimized a protocol to overcome the major shortcomings of a typical bacterial expression system. Using this workflow, we demonstrate how to successfully express and purify large amounts of SNX-BAR heterodimers and how to reconstitute them on synthetic liposomes for binding and tubulation assays.

Here, we present a workflow for the expression, purification and liposome binding of SNX-BAR heterodimers in yeast.

Expressão, purificação e ligação lipossoma dos heterodimers brotamentos do SNX-BAR do fermento

SNX-BAR proteins are an evolutionarily conserved class of membrane remodeling proteins that play key roles in sorting and trafficking of protein and ...

Identification of Host Pathways Targeted by Bacterial Effector Proteins using Yeast Toxicity and Suppressor Screens

Intracellular bacteria secrete virulence factors called effector proteins into the host cytosol that act to subvert host proteins and/or their associated biological pathways to the benefit of the bacterium. Identification of putative bacterial effector proteins has become more manageable due to advances in bacterial genome sequencing and the advent of algorithms that allow in silico identification of genes encoding secretion candidates and/or eukaryotic-like domains. However, identification of these important virulence factors is only an initial step. Naturally, the goal is to determine the molecular function of effector proteins and elucidate how they interact with the host. In recent years, techniques like the yeast two-hybrid screen and large-scale immunoprecipitations coupled with mass spectrometry have aided in the identification of protein-protein interactions. Although identification of a host binding partner is the crucial first step toward elucidating the molecular function of a bacterial effector protein, sometimes the host protein is found to have multiple biological functions (e.g., actin, clathrin, tubulin), or the bacterial protein may not physically bind host proteins, depriving the researcher of crucial information about the precise host pathway being manipulated. A modified yeast toxicity screen coupled with a suppressor screen has been adapted to identify host pathways impacted by bacterial effector proteins. The toxicity screen relies on a toxic effect in yeast caused by the effector protein interfering with the host biological pathways, which often manifests as a growth defect. Expression of a yeast genomic library is used to identify host factors that suppress the toxicity of the bacterial effector protein and thus identify proteins in the pathway that the effector protein targets. This protocol contains detailed instructions for both the toxicity and suppressor screens. These techniques can be performed in any lab capable of molecular cloning and cultivation of yeast and Escherichia coli.

Bacterial pathogens secrete proteins into the host that target crucial biological processes. Identifying the host pathways targeted by bacterial effector proteins is key to addressing molecular pathogenesis. Here, a method using a modified yeast suppressor and toxicity screen to elucidate host pathways targeted by toxic bacterial effector proteins is described.

Identificação de vias hospedeiras alvo de proteínas efetoras bacterianas usando toxicidade de levedura e telas supressoras

Intracellular bacteria secrete virulence factors called effector proteins into the host cytosol that act to subvert host proteins and/or their associated ...