We thank Reine Protacio for helpful comments during the preparation of this manuscript. We express our gratitude to the National Science Foundation (grants nos. 1243680 and 1613754) and the Hendrix College Odyssey Program for funding support.

<ol>
	<li>Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., Richmond, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+nucleosome+core+particle+at+2.8+A+resolution.">Crystal structure of the nucleosome core particle at 2.8 A resolution.</a> Nature. 389 (6648), 251-260 (1997).</li><li>Campos, E. I., Reinberg, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histones:+annotating+chromatin.">Histones: annotating chromatin.</a> Annu Rev Genet. 43, 559-599 (2009).</li><li>Rando, O. J., Winston, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+and+transcription+in+yeast.">Chromatin and transcription in yeast.</a> Genetics. 190 (2), 351-387 (2012).</li><li>Duina, A. A., Miller, M. E., Keeney, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Budding+yeast+for+budding+geneticists:+a+primer+on+the+Saccharomyces+cerevisiae+model+system.">Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system.</a> Genetics. 197 (1), 33-48 (2014).</li><li>Storici, F., Resnick, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delitto+perfetto+targeted+mutagenesis+in+yeast+with+oligonucleotides.">Delitto perfetto targeted mutagenesis in yeast with oligonucleotides.</a> Genet Eng (N Y). 25, 189-207 (2003).</li><li>Gray, M., Kupiec, M., Honigberg, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Site-specific+genomic+(SSG)+and+random+domain-localized+(RDL)+mutagenesis+in+yeast.">Site-specific genomic (SSG) and random domain-localized (RDL) mutagenesis in yeast.</a> BMC Biotechnol. 4, 7 (2004).</li><li>Erdeniz, N., Mortensen, U. H., Rothstein, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning-free+PCR-based+allele+replacement+methods.">Cloning-free PCR-based allele replacement methods.</a> Genome Res. 7 (12), 1174-1183 (1997).</li><li>Brachmann, C. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Designer+deletion+strains+derived+from+Saccharomyces+cerevisiae+S288C:+a+useful+set+of+strains+and+plasmids+for+PCR-mediated+gene+disruption+and+other+applications.">Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications.</a> Yeast. 14 (2), 115-132 (1998).</li><li>Lundblad, V., Hartzog, G., Moqtaderi, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Manipulation+of+cloned+yeast+DNA.">Manipulation of cloned yeast DNA.</a> Curr Protoc Mol Biol. Chapter 13, (2001).</li><li>Hoffman, C. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+yeast+DNA.">Preparation of yeast DNA.</a> Curr Protoc Mol Biol. Chapter 13, (2001).</li><li>Treco, D. A., Lundblad, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+yeast+media.">Preparation of yeast media.</a> Curr Protoc Mol Biol. Chapter 13, (2001).</li><li>Lederberg, J., Lederberg, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replica+plating+and+indirect+selection+of+bacterial+mutants.">Replica plating and indirect selection of bacterial mutants.</a> J Bacteriol. 63 (3), 399-406 (1952).</li><li>Sikorski, R. S., Hieter, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+system+of+shuttle+vectors+and+yeast+host+strains+designed+for+efficient+manipulation+of+DNA+in+Saccharomyces+cerevisiae.">A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.</a> Genetics. 122 (1), 19-27 (1989).</li><li>Johnson, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+systematic+mutational+analysis+of+a+histone+H3+residue+in+budding+yeast+provides+insights+into+chromatin+dynamics.">A systematic mutational analysis of a histone H3 residue in budding yeast provides insights into chromatin dynamics.</a> G3 (Bethesda). 5 (5), 741-749 (2015).</li><li>DiCarlo, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+in+Saccharomyces+cerevisiae+using+CRISPR-Cas+systems.">Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems.</a> Nucleic Acids Res. 41 (7), 4336-4343 (2013).</li><li>Cross, S. L., Smith, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+the+structure+and+cell+cycle+expression+of+mRNAs+encoded+by+two+histone+H3-H4+loci+in+Saccharomyces+cerevisiae.">Comparison of the structure and cell cycle expression of mRNAs encoded by two histone H3-H4 loci in Saccharomyces cerevisiae.</a> Mol Cell Biol. 8 (2), 945-954 (1988).</li><li>Libuda, D. E., Winston, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amplification+of+histone+genes+by+circular+chromosome+formation+in+Saccharomyces+cerevisiae.">Amplification of histone genes by circular chromosome formation in Saccharomyces cerevisiae.</a> Nature. 443 (7114), 1003-1007 (2006).</li></ol>

The authors declare that they have no competing financial interests.

The high level of sequence homology between the two non-allelic genes that code for each of the four core histone proteins in haploid S. cerevisiae cells can represent a challenge for investigators who wish to specifically target one of the two genes for mutagenesis. Previously described yeast mutagenesis methodologies, including the Delitto Perfetto, site-specific genomic (SSG) mutagenesis, and cloning-free PCR-based allele replacement methods5,6,7, as well as more recent yeast CRISPR-based techniques15, often rely at least in part on sequences within the ORF of a target gene to recruit the recombination or repair machineries to the desired genomic site to eventually generate the final mutant allele. On the other hand, the strategy we have presented here makes use of DNA sequences flanking the targeted ORF to drive the homologous recombination event required for the integration of the mutation, and, as a result, allows for more specific targeting of a gene over another despite the two genes having highly homologous ORFs. This feature makes our strategy particularly well-suited for histone mutagenesis. However, this strategy can also be adapted for mutagenesis of other genes in the yeast genome.
Additional features of our strategy include the facts that the lengths of the regions that drive homologous recombination of the mutant genes can be designed to be very extensive, thus increasing the efficiency of integration at the target genomic location, and that besides the desired mutation(s) no additional DNA sequences are introduced into the genome. An additional advantage of this system is that once a strain harboring replacement of a specific histone gene with URA3 has been constructed, it can be used for the generation of any desired mutant version of that particular histone gene. Thus, for example, strain yAAD156, which is available to the research community upon request, can be used to make any desired hht2 mutation without the need of constructing a de novo hht2&#916;::URA3 allele. Finally, by using properly designed PCR primers, this strategy can also be used to generate histone alleles with internal deletions or with mutations at multiple codons, as long as they are relatively near each other (for example, we have generated an hht2 allele encoding an H3-K56R,L61W double mutant protein using this strategy).
The ability to specifically target one of two highly homologous histone genes for mutagenesis could be useful in a number of different experimental settings. For example, since the HHT1-HHF1 genes are expressed at different levels compared to the HHT2-HHF2 genes16, it could be of interest to determine whether a particular H3 or H4 mutation confers different phenotypes depending on which gene it is expressed from. Another example is a scenario in which an investigator wishes to generate haploid cells expressing a particular histone mutant from both corresponding histone genes - this could be achieved by first mutagenizing each gene independently in two different strains, and then obtaining double mutant haploid cells through a cross and subsequent isolation of the desired meiotic products. Yet another example relates to mutagenesis of histones H2A and H2B: given the fact that two slightly different isoforms of each protein are encoded by the corresponding non-allelic gene set, an investigator may want to assess the effects of a specific H2A or H2B mutation in the context of either isoform. When designing experiments to mutagenize the HTA1 and HTB1 loci (encoding H2A and H2B, respectively), investigators should be aware of recent findings showing that strains carrying an (hta1-htb1)&#916; are viable only if they have amplified the HTA2-HTB2 locus (and nearby HHT1-HHF1 locus as well) through the generation of a small circular chromosome17, as this could complicate the interpretation of the results.
We have recently used a version of this histone mutagenesis strategy to generate histone H3 proteins expressing all possible amino acid substitutions at position 61, which is normally occupied by the amino acid leucine14. For those experiments, instead of using yAAD156 as the starting strain for the mutagenesis, we used strain yADP106, which harbors a replacement of the HHT2 ORF with both the URA3 and TRP1 nutritional markers (instead of just URA3). The presence of both marker genes facilitated the identification of candidates for integration of the mutant PCR products following the 5-FOA screen and purification step (steps 5 and 6 of the protocol), as such candidates became phenotypically Ura- and Trp-, whereas spontaneous URA3 mutation resulted in cells with a Ura- Trp+ phenotype. yADP106 is also available upon request, as is the sequence of the URA3-TRP1 cassette, which could be amplified as a unit and used for mutagenesis of other histone genes using the strategy described herein.
Inability to obtain the desired histone mutants using this strategy could be attributable to a number of possible reasons, including insufficient amount of full-size PCR products used for the integration step or an insufficient number of transformants following the co-transformation step. The former problem could be addressed by pooling together larger sets of PCR reactions or by designing different primer sets that produce a higher yield of product, whereas the latter problem could be solved by using higher amounts of backbone plasmid in the co-transformation experiment. Although, as indicated earlier, one can use this procedure to generate histone mutants harboring two or more amino acid substitutions, the targeted amino acids have to be relatively close to each other since the respective codons need to be located within the same primer molecule. Thus, this strategy cannot be easily adapted for the generation of histones with multiple mutations located distantly from each other across the length of the proteins.

The four core histone proteins H2A, H2B, H3, and H4 play central roles in the compaction, organization, and function of eukaryotic chromosomes. Two sets of each of these histones form the histone octamer, a molecular spool that directs the wrapping of ~147 base pairs of DNA around itself, ultimately resulting in the formation of a nucleosome1. Nucleosomes are active participants in a variety of chromosome-based processes, such as the regulation of gene transcription and the formation of euchromatin and heterochromatin across chromosomes, and as such have been the focus of intense research over the course of the past several decades. A number of mechanisms have been described by which nucleosomes can be manipulated in ways that can facilitate execution of specific processes &#8211; these mechanisms include posttranslational modification of histone residues, ATP-dependent nucleosome remodeling, and ATP-independent nucleosome reorganization and assembly/disassembly2,3.
The budding yeast Saccharomyces cerevisiae is a particularly powerful model organism for the understanding of histone function in eukaryotes. This can be largely attributed to the high degree of evolutionary conservation of the histone proteins throughout the domain eukarya and the amenability of yeast to a variety of genetic and biochemical experimental approaches4. Reverse-genetic approaches in yeast have been widely used to study the effects of specific histone mutations on various aspects of chromatin biology. For these types of experiments it is often preferable to use cells in which the mutant histones are expressed from their native genomic loci, as expression from autonomous plasmids can lead to abnormal intracellular levels of histone proteins (due to varying numbers of plasmids in cells) and concomitant alteration of chromatin environments, which can ultimately confound the interpretation of results.
Here, we describe a PCR-based technique that allows for targeted mutagenesis of histone genes at their native genomic locations that does not require a cloning step and results in the generation of the desired mutation(s) without leftover exogenous DNA sequences in the genome. This technique takes advantage of the efficient homologous recombination system in yeast and has several features in common with other similar techniques developed by other groups - most notably the Delitto Perfetto, site-specific genomic (SSG) mutagenesis, and cloning-free PCR-based allele replacement methods5,6,7. However, the technique we describe has an aspect that makes it particularly well-suited for mutagenesis of histone genes. In haploid yeast cells, each of the four core histones is encoded by two non-allelic and highly homologous genes: for example, histone H3 is encoded by the HHT1 and HHT2 genes, and the open reading frames (ORFs) of the two genes are over 90% identical in sequence. This high degree of homology can complicate experiments designed to specifically target one of the two histone-encoding genes for mutagenesis. Whereas the aforementioned methods often require the use of at least some sequences within the ORF of the target gene to drive homologous recombination, the technique we describe here makes use of sequences flanking the ORFs of the histone genes (which share much less sequence homology) for the recombination step, thus increasing the likelihood of successful targeting of mutagenesis to the desired locus. Moreover, the homologous regions that drive recombination can be very extensive, further contributing to efficient targeted homologous recombination.

<table border="0" cellpadding="0" cellspacing="0" width="1091">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:517px;">1 kb DNA Ladder (DNA standards)</td>
			<td style="width:177px;">New England BioLabs</td>
			<td style="width:128px;">N3232L</td>
			<td style="width:269px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Agarose&#160;</td>
			<td>Sigma</td>
			<td>A5093-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Boric Acid</td>
			<td>Sigma</td>
			<td>B0394-500G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">dNTP mix (10 mM each)</td>
			<td>ThermoFisher Scientific</td>
			<td>R0192</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EDTA solution (0.5M, pH 8.0)</td>
			<td>AmericanBio</td>
			<td>AB00502-01000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ethanol (200 Proof)</td>
			<td>Fisher Scientific</td>
			<td>16-100-824</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:517px;">Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA)</td>
			<td>Sigma</td>
			<td>E4884-500G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Lithium acetate dihydrate</td>
			<td>Sigma</td>
			<td>L6883-250G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MyCycler Thermal Cycler</td>
			<td>BioRad</td>
			<td>170-9703</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Poly(ethylene glycol) (PEG)</td>
			<td>Sigma</td>
			<td>P3640-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PrimeSTAR HS DNA Polymerase (high fidelity DNA polymerase)&#160; and 5X buffer</td>
			<td>Fisher Scientific</td>
			<td>50-443-960</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Salmon sperm DNA solution</td>
			<td>ThermoFisher Scientific</td>
			<td>15632-011</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sigma 7-9 (Tris base, powder form)</td>
			<td>Sigma</td>
			<td>T1378-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sodium acetate trihydrate</td>
			<td>Sigma</td>
			<td>236500-500G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Supra Sieve GPG Agarose (low metling temperature agarose)</td>
			<td>AmericanBio</td>
			<td>AB00985-00100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Taq Polymerase and 10X Buffer</td>
			<td>New England BioLabs</td>
			<td>M0273X</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Toothpicks</td>
			<td>Fisher Scientific</td>
			<td>S67859</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tris-HCl (1M, pH 8.0)</td>
			<td>AmericanBio</td>
			<td>AB14043-01000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">a-D(+)-Glucose</td>
			<td>Fisher Scientific</td>
			<td>AC170080025</td>
			<td>for yeast media</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Agar</td>
			<td>Fisher Scientific</td>
			<td>DF0140-01-0</td>
			<td>for yeast media</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Peptone</td>
			<td>Fisher Scientific</td>
			<td>DF0118-07-2</td>
			<td>for YPD medium</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Yeast Extract</td>
			<td>Fisher Scientific</td>
			<td>DF0127-17-9</td>
			<td>for YPD medium</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">4-aminobenzoic acid</td>
			<td>Sigma</td>
			<td>A9878-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Adenine</td>
			<td>Sigma</td>
			<td>A8626-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glycine hydrochloride</td>
			<td>Sigma</td>
			<td>G2879-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Alanine</td>
			<td>Sigma</td>
			<td>A7627-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Arginine monohydrochloride</td>
			<td>Sigma</td>
			<td>A5131-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Asparagine monohydrate</td>
			<td>Sigma</td>
			<td>A8381-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Aspartic acid sodium salt monohydrate</td>
			<td>Sigma</td>
			<td>A6683-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Cysteine hydrochloride monohydrate</td>
			<td>Sigma</td>
			<td>C7880-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Glutamic acid hydrochloride</td>
			<td>Sigma</td>
			<td>G2128-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Glutamine</td>
			<td>Sigma</td>
			<td>G3126-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Histidine monohydrochloride monohydrate</td>
			<td>Sigma</td>
			<td>H8125-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:517px;">L-Isoleucine</td>
			<td>Sigma</td>
			<td>I2752-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Leucine</td>
			<td>Sigma</td>
			<td>L8000-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Lysine monohydrochloride</td>
			<td>Sigma</td>
			<td>L5626-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Methionine</td>
			<td>Sigma</td>
			<td>M9625-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Phenylalanine</td>
			<td>Sigma</td>
			<td>P2126-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Proline</td>
			<td>Sigma</td>
			<td>P0380-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Serine</td>
			<td>Sigma</td>
			<td>S4500-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:517px;">L-Threonine</td>
			<td>Sigma</td>
			<td>T8625-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Tryptophan</td>
			<td>Sigma</td>
			<td>T0254-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Tyrosine</td>
			<td>Sigma</td>
			<td>T3754-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Valine</td>
			<td>Sigma</td>
			<td>V0500-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">myo-Inositol</td>
			<td>Sigma</td>
			<td>I5125-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Uracil</td>
			<td>Sigma</td>
			<td>U0750-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ammonium Sulfate</td>
			<td>Fisher Scientific</td>
			<td>A702-500</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="18">
			<td height="18" style="height:19px;">Yeast Nitrogen Base</td>
			<td>Fisher Scientific</td>
			<td>DF0919-07-3</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">5-Fluoroorotic acid (5-FOA)</td>
			<td>AmericanBio</td>
			<td>AB04067-00005</td>
			<td>for&#160; 5-FOA medium</td>
		</tr>
	</tbody>
</table>

targeted in situ mutagenesis of histone genes in budding yeast

We describe a PCR- and homologous recombination-based system for generating targeted mutations in histone genes in budding yeast cells. The resulting mutant alleles reside at their endogenous genomic sites and no exogenous DNA sequences are left in the genome following the procedure. Since in haploid yeast cells each of the four core histone proteins is encoded by two non-allelic genes with highly homologous open reading frames (ORFs), targeting mutagenesis specifically to one of two genes encoding a particular histone protein can be problematic. The strategy we describe here bypasses this problem by utilizing sequences outside, rather than within, the ORF of the target genes for the homologous recombination step. Another feature of this system is that the regions of DNA driving the homologous recombination steps can be made to be very extensive, thus increasing the likelihood of successful integration events. These features make this strategy particularly well-suited for histone gene mutagenesis, but can also be adapted for mutagenesis of other genes in the yeast genome.

We describe the generation of an hht2 allele expressing a histone H3 mutant protein harboring a substitution at position 53 from an arginine to a glutamic acid (H3-R53E mutant) as a representative example of the targeted in situ mutagenesis strategy.
We generated a strain in which the entire ORF of HHT2 is replaced by the URA3 gene (see step 1 of the protocol). This strain, yAAD156, also harbors a his3&#916;200 allele, which causes the cells to be auxotrophic for histidine. Following the procedure indicated in step 2 of the protocol, we then generated the two partially overlapping fragments of HHT2. The following primers were used for the first fragment: Forward Primer (OAD20): 5&#39; GCGTTCATTATCGCCCAATGTG 3&#39; and the Reverse Primer (R53Erev): 5&#39; GTTCAGTAGATTTTTGGAATtcTCTAATTTCTCTCAAG 3&#39;. The following primers were used for the second fragment: Forward Primer (R53Efor): 5&#39; CTTGAGAGAAATTAGAgaATTCCAAAAATCTACTGAAC 3&#39; and the Reverse Primer (OAD21): 5&#39; GCGCTTGATCAGCAGTTCATCG 3&#39;. Note that the Reverse Primer in the first reaction and the Forward Primer in the second reaction contain the desired mutated nucleotides (in lower case) - these mutated nucleotides are nestled in between two long stretches of wild-type sequences, as this allows for efficient annealing of the primer to the template DNA despite the mismatch at the mutated positions. Also note that the mutated nucleotides in these two primers are reverse complementary to each other and cause an AG to GA mutation in the sense strand, which results in a AGA to GAA codon change, which ultimately produces the R53E mutation in the encoded protein. Results from these PCR reactions are shown in Figure 2A.
Using the procedure in step 3, we then generated the full-size PCR products. The primers used were Forward Primer (OAD479): 5&#39;TATGGCTCGGTGTCAAAACA 3&#39; and Reverse Primer (OAD480): 5&#39; CATGGTTTCTTGCCGGTTAT 3&#39;. When designing these primers, it is important to make sure that the resulting fusion PCR products include at least 40 base pairs on either ends to drive the homologous recombination reaction (the longer the regions of homology, the more efficient and specific the homologous recombination events will be). In our experiment, the full-size PCR products contained a 195 base pair region and 220 base pair region homologous to the regions upstream and downstream of the HHT2 ORF, respectively. A sample of these PCR products was analyzed by agarose gel electrophoresis (Figure 2B).
The full-size PCR products were then co-transformed along with plasmid pRS413 (a centromeric, HIS3-marked plasmid13) and transformants were selected on plates lacking histidine (SC-his plates) as described in step 4 of the protocol. His+ colonies were then screened for 5-FOA resistance following the procedures described in step 5 of the protocol. Figure 3 shows an example of a transformation plate (SC-his) and 5-FOA plates following replica-plating from SC-his plates. Examples of candidate samples as well as samples unlikely to represent the desired integration events are also presented in Figure 3. In our experiment, we identified twelve candidate samples out of ~90,000 transformants screened. These candidates were then purified as described in step 6 of the protocol.
The twelve candidates were then subjected to the PCR analysis described in step 7 of the protocol to assess if they reflected authentic replacements of the URA3 gene with mutant PCR products. For our experiment, we used a Forward Primer that anneals 89 base pairs upstream from the integration site of the PCR product and a Reverse Primer that anneals 302 base pairs downstream from the integration site of the PCR product. These primers generate PCR products of 1217 base pairs in size if the HHT2 locus is occupied by HHT2 (or mutant versions of HHT2 harboring base pair substitutions), or PCR products of 2188 base pairs in size if the locus is occupied by the URA3 marker gene. The sequence of the Forward Primer used (OAD476) is: 5&#39; GAAACTATTGGCACGCCCTA and that of the Reverse Primer used (OAD477) is: 5&#39; CCTGCGAATCAACCGATACT 3&#39;. Of the twelve candidates we had identified, four showed integration of a PCR product at the correct location (see Figure 4A for an example). Finally, since the AG to GA mutation generates a new EcoRI restriction site, we subjected PCR products from one of the successful integration samples to an EcoRI digestion and were able to demonstrate that the mutant sequence had indeed been integrated into the genome (see Figure 4B). In this particular case we did not sequence the PCR products to ensure that additional unwanted mutations had not been incorporated into the genome: however, we have used a procedure very similar to this to generate a large number of HHT2 mutations in a past study14, and found that the majority of the integrated mutant alleles carry no mutations other than the desired ones.
<img alt="Figure 2" src="/files/ftp_upload/55263/55263fig2.jpg" /> 
Figure 2: Generation of PCR Products Harboring Desired Mutations for Integration into the Yeast Genome. (A) PCR reaction to generate the partially overlapping fragments of HHT2 harboring the desired mutations. Top: cartoon representation of the two PCR reactions to obtain the two HHT2 fragments (refer to Figure 1B-1). Red circles represent the mismatched nucleotides on the primers used to introduce the AG to GA mutation in the sense strand of the gene. Bottom: gel electrophoresis analysis of PCR products a and b (lanes 2 and 3, respectively). DNA standards are shown in lane 1. (B) Fusion PCR reaction to generate full size PCR product for integration into yeast genome (refer to Figure 1B-2 and 3). Top: cartoon representation of the PCR reaction and expected PCR product (product c). Red circles represent desired mutation as described in (A) above. Bottom: gel electrophoresis analysis of PCR products c (lane 2). DNA standards are shown in lane 1. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55263/55263fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/55263/55263fig3.jpg" /> 
Figure 3: Representative Results from the Co-transformation Experiment and 5-FOA Screen. Left: representative SC-his plate plated with cells subjected to the co-transformation procedure after a 3-day incubation at 30&#730;C. Approximately 5,000 colonies were counted. Middle: representative 5-FOA plate following replica-plating from an SC-his co-transformation plate after a 2-day incubation at 30&#730;C. Samples 1 and 2 were considered candidates for having gone through a successful integration event due to their asymmetric morphologies. This is because a true replacement of the URA3 gene with the hht2 allele is likely to occur before (or very soon after) a transformed cell is plated on the SC-his plate and, as a result, the colony that will arise at that location will contain mostly, if not exclusively, 5-FOA-resistant cells &#8211; when such a colony is then subsequently replica-plated to a 5-FOA plate it will be squashed, giving rise to an asymmetric-looking patch of cells on the plate. Conversely, spontaneous mutations in the URA3 gene that can arise during colony formation are more likely to be confined within a small region of a colony, and thus more likely to give rise to papillae when replica-plated to a 5-FOA plate. Right: a different representative 5-FOA plate following replica-plating from an SC-his co-transformation plate after a 3-day incubation at 30 &#176;C. An additional candidate (sample 3) as well as two small papillae are visible on this plate (samples 4 and 5) &#8211; such papillae, which are most clearly visible after 3 or more days of incubation, are likely to represent spontaneous URA3 mutations and not the desired integration event. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55263/55263fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" src="/files/ftp_upload/55263/55263fig4.jpg" /> 
Figure 4: Molecular Analyses of Candidate Integration Samples. (A) PCR assay to identify successful integration events. Top: cartoon representations of the PCR reactions used to assess successful integration of the hht2 mutant allele into the genome. Bottom: gel electrophoresis analysis of PCR reactions using genomic DNA derived from an HHT2 wild-type strain (used as a control, lane 2), strain yAAD156 harboring the hht2&#916;::URA3 replacement (used as a control, lane 3), a candidate integration sample (lane 4), and a 5-FOA-resistant papillae sample (and thus unlikely to represent a correct integration event, lane 5). DNA standards are shown in lane 1. Note that the sizes of the PCR products for the candidate integration sample are consistent with a successful integration event, whereas the size of the PCR products for the papillae sample is consistent with an intact hht2&#916;::URA3 locus. (B) EcoRI digestion to confirm presence of mutant allele. Top: cartoon representation of the expected digestion fragments derived from an EcoRI digestion reaction of PCR products containing either the wild-type HHT2 gene or the mutant hht2 allele. Bottom: gel electrophoresis analysis of digestion reactions of PCR products derived from a wild-type HHT2 strain (lane 2; the PCR products used here were derived from the same sample as that used in lane 2 of panel A) and a candidate integration sample (lane 3; the PCR products used here were derived from the same sample as that used in lane 4 of panel A). DNA standards are shown in lane 1. Note that the digestion patterns confirm that the AG to GA mutation has been successfully introduced into the genome of the candidate integration sample. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55263/55263fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast at JoVE.com

Ukierunkowana mutageneza in situ genów histonów w pączkujących drożdżach | Genetyka | Wideo

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

A strategy for generating mutations in histone genes at their endogenous location in Saccharomyces cerevisiae is presented.

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

We describe a PCR- and homologous recombination-based system for generating targeted mutations in histone genes in budding yeast cells. The resulting ...

targeted-in-situ-mutagenesis-of-histone-genes-in-budding-yeast

Nanyang Technological University

Research

Education

JoVE Journal

JoVE Core

Biology

Genetics

DNA Structure and Function

SCIENTISTS IN ACTION

15.2K Views.  Hendrix College. A strategy for generating mutations in histone genes at their endogenous location in Saccharomyces cerevisiae is presented. 

Video: Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most mutagenesis-based screens, researchers have relied on the use of toxic chemicals, carcinogens, or irradiation, which requires designated equipment, safety setup, and/or disposal of hazardous materials. We have developed a simple approach to induce heritable mutations in C. elegans using germline-expressed histone-miniSOG, a light-inducible potent generator of reactive oxygen species. This mutagenesis method is free of toxic chemicals and requires minimal laboratory safety and waste management. The induced DNA modifications include single-nucleotide changes and small deletions, and complement those caused by classical chemical mutagenesis. This methodology can also be used to induce integration of extrachromosomal transgenes. Here, we provide the details of the LED setup and protocols for standard mutagenesis and transgene integration.

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Genetically-encoded histone-miniSOG induces genome-wide heritable mutations in a blue&#160;light-dependent manner. This mutagenesis method is simple, fast, free of toxic chemicals, and well-suited for forward genetic screening and transgene integration.

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most ...

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

As a promising genome editing platform, the CRISPR/Cas9 system has great potential for efficient genetic manipulation, especially for targeted integration of transgenes. However, due to the low efficiency of homologous recombination (HR) and various indel mutations of non-homologous end joining (NHEJ)-based strategies in non-dividing cells, in vivo genome editing remains a great challenge. Here, we describe a homology-mediated end joining (HMEJ)-based CRISPR/Cas9 system for efficient in vivo precise targeted integration. In this system, the targeted genome and the donor vector containing homology arms (~800 bp) flanked by single guide RNA (sgRNA) target sequences are cleaved by CRISPR/Cas9. This HMEJ-based strategy achieves efficient transgene integration in mouse zygotes, as well as in hepatocytes in vivo. Moreover, a HMEJ-based strategy offers an efficient approach for correction of fumarylacetoacetate hydrolase (Fah) mutation in the hepatocytes and rescues Fah-deficiency induced liver failure mice. Taken together, focusing on targeted integration, this HMEJ-based strategy provides a promising tool for a variety of applications, including generation of genetically modified animal models and targeted gene therapies.

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

The clustered regularly interspaced short palindromic repeats/CRISPR associated protein 9 (CRISPR/Cas9) system provides a promising tool for genetic engineering, and opens up the possibility of targeted integration of transgenes. We describe a homology-mediated end joining (HMEJ)-based strategy for efficient DNA targeted integration in vivo and targeted gene therapies using CRISPR/Cas9.

As a promising genome editing platform, the CRISPR/Cas9 system has great potential for efficient genetic manipulation, especially for targeted integration ...

Gene-targeted Random Mutagenesis to Select Heterochromatin-destabilizing Proteasome Mutants in Fission Yeast

Random mutagenesis of a target gene is commonly used to identify mutations that yield the desired phenotype. Of the methods that may be used to achieve random mutagenesis, error-prone PCR is a convenient and efficient strategy for generating a diverse pool of mutants (i.e., a mutant library). Error-prone PCR is the method of choice when a researcher seeks to mutate a pre-defined region, such as the coding region of a gene while leaving other genomic regions unaffected. After the mutant library is amplified by error-prone PCR, it must be cloned into a suitable plasmid. The size of the library generated by error-prone PCR is constrained by the efficiency of the cloning step. However, in the fission yeast, Schizosaccharomyces pombe, the cloning step can be replaced by the use of a highly efficient one-step fusion PCR to generate constructs for transformation. Mutants of desired phenotypes may then be selected using appropriate reporters. Here, we describe this strategy in detail, taking as an example, a reporter inserted at centromeric heterochromatin.

This article describes a detailed methodology for random mutagenesis of a target gene in fission yeast. As an example, we target rpt4+, which encodes a subunit of the 19S proteasome, and screen for mutations that destabilize heterochromatin.

Random mutagenesis of a target gene is commonly used to identify mutations that yield the desired phenotype. Of the methods that may be used to achieve ...

Visualization of Microbiota in Tick Guts by Whole-mount In Situ Hybridization

Infectious diseases transmitted by arthropod vectors continue to pose a significant threat to human health worldwide. The pathogens causing these diseases, do not exist in isolation when they colonize the vector; rather, they likely engage in interactions with resident microorganisms in the gut lumen. The vector microbiota has been demonstrated to play an important role in pathogen transmission for several vector-borne diseases. Whether resident bacteria in the gut of the Ixodes scapularis tick, the vector of several human pathogens including Borrelia burgdorferi, influence tick transmission of pathogens is not determined. We require methods for characterizing the composition of the bacteria associated with the tick gut to facilitate a better understanding of potential interspecies interactions in the tick gut. Using whole-mount in situ hybridization to visualize RNA transcripts associated with particular bacterial species allows for the collection of qualitative data regarding the abundance and distribution of the microbiota in intact tissue. This technique can be used to examine changes in the gut microbiota milieu over the course of tick feeding and can also be applied to analyze expression of tick genes. Staining of whole tick guts yield information about the gross spatial distribution of target RNA in the tissue without the need for three-dimensional reconstruction and is less affected by environmental contamination, which often confounds the sequencing-based methods frequently used to study complex microbial communities. Overall, this technique is a valuable tool that can be used to better understand vector-pathogen-microbiota interactions and their role in disease transmission.

Visualization of Microbiota in Tick Guts by Whole-mount In Situ Hybridization

Here, we present a protocol to spatially and temporally assess the presence of viable microbiota in tick guts using a modified whole-mount in situ hybridization approach.

Infectious diseases transmitted by arthropod vectors continue to pose a significant threat to human health worldwide. The pathogens causing these ...

Single Molecule Fluorescence In Situ Hybridization (smFISH) Analysis in Budding Yeast Vegetative Growth and Meiosis

Single molecule fluorescence in situ hybridization (smFISH) is a powerful technique to study gene expression in single cells due to its ability to detect and count individual RNA molecules. Complementary to deep sequencing-based methods, smFISH provides information about the cell-to-cell variation in transcript abundance and the subcellular localization of a given RNA. Recently, we have used smFISH to study the expression of the gene&#160;NDC80&#160;during meiosis in budding yeast, in which two transcript isoforms exist and the short transcript isoform has its entire sequence shared with the long isoform. To confidently identify each transcript isoform, we optimized known smFISH protocols and obtained high consistency and quality of smFISH data for the samples acquired during budding yeast meiosis. Here, we describe this optimized protocol, the criteria that we use to determine whether high quality of smFISH data is obtained, and some tips for implementing this protocol in&#160;other yeast strains and growth conditions.

Single Molecule Fluorescence In Situ Hybridization smFISH Analysis in Budding Yeast Vegetative Growth and Meiosis

This single molecule fluorescence in situ hybridization protocol is optimized to quantify the number of RNA molecules in budding yeast during vegetative growth and meiosis.

Single molecule fluorescence in situ hybridization (smFISH) is a powerful technique to study gene expression in single cells due to its ability to detect ...

Mating-based Overexpression Library Screening in Yeast

Budding yeast has been widely used as a model in studying proteins associated with human diseases. Genome-wide genetic screening is a powerful tool commonly used in yeast studies. The expression of a number of neurodegenerative disease-associated proteins in yeast causes cytotoxicity and aggregate formation, recapitulating findings seen in patients with these disorders. Here, we describe a method for screening a yeast model of the Amyotrophic Lateral Sclerosis-associated protein FUS for modifiers of its toxicity. Instead of using transformation, this new screening platform relies on the mating of yeast to introduce an arrayed library of plasmids into the yeast model. The mating method has two clear advantages: first, it is highly efficient; second, the pre-transformed arrayed library of plasmids can be stored for long-term as a glycerol stock, and quickly applied to other screens without the labor-intensive step of transformation into the yeast model each time. We demonstrate how this method can successfully be used to screen for genes that modify the toxicity of FUS.

This article presents a mating-based method to facilitate overexpression screening in budding yeast using an arrayed plasmid library.

Budding yeast has been widely used as a model in studying proteins associated with human diseases. Genome-wide genetic screening is a powerful tool ...

Characterizing Histone Post-translational Modification Alterations in Yeast Neurodegenerative Proteinopathy Models

Neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and Parkinson&#39;s disease (PD), cause the loss of hundreds of thousands of lives each year. Effective treatment options able to halt disease progression are lacking. Despite the extensive sequencing efforts in large patient populations, the majority of ALS and PD cases remain unexplained by genetic mutations alone. Epigenetics mechanisms, such as the post-translational modification of histone proteins, may be involved in neurodegenerative disease etiology and progression and lead to new targets for pharmaceutical intervention. Mammalian in vivo and in vitro models of ALS and PD are costly and often require prolonged and laborious experimental protocols. Here, we outline a practical, fast, and cost-effective approach to determining genome-wide alterations in histone modification levels using Saccharomyces cerevisiae as a model system. This protocol allows for comprehensive investigations into epigenetic changes connected to neurodegenerative proteinopathies that corroborate previous findings in different model systems while significantly expanding our knowledge of the neurodegenerative disease epigenome.

This protocol outlines experimental procedures to characterize genome-wide changes in the levels of histone post-translational modifications (PTM) occurring in connection with the overexpression of proteins associated with ALS and Parkinson&#39;s disease in Saccharomyces cerevisiae models. After SDS-PAGE separation, individual histone PTM levels are detected with modification-specific antibodies via Western blotting.

Neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and Parkinson&#39;s disease (PD), cause the loss of hundreds of thousands of lives ...

In Vivo Forward Genetic Screen to Identify Novel Neuroprotective Genes in Drosophila melanogaster

There is much to understand about the onset and progression of neurodegenerative diseases, including the underlying genes responsible. Forward genetic screening using chemical mutagens is a useful strategy for mapping mutant phenotypes to genes among Drosophila and other model organisms that share conserved cellular pathways with humans. If the mutated gene of interest is not lethal in early developmental stages of flies, a climbing assay can be conducted to screen for phenotypic indicators of decreased brain functioning, such as low climbing rates. Subsequently, secondary histological analysis of brain tissue can be performed in order to verify the neuroprotective function of the gene by scoring neurodegeneration phenotypes. Gene mapping strategies include meiotic and deficiency mapping that rely on these same assays can be followed by DNA sequencing to identify possible nucleotide changes in the gene of interest.

In Vivo Forward Genetic Screen to Identify Novel Neuroprotective Genes in Drosophila melanogaster

We present a protocol using a forward genetic approach to screen for mutants exhibiting neurodegeneration in Drosophila melanogaster. It incorporates a climbing assay, histology analysis, gene mapping and DNA sequencing to ultimately identify novel genes related to the process of neuroprotection.

There is much to understand about the onset and progression of neurodegenerative diseases, including the underlying genes responsible. Forward genetic ...

Expression, Purification, and Liposome Binding of Budding Yeast SNX-BAR Heterodimers

SNX-BAR proteins are an evolutionarily conserved class of membrane remodeling proteins that play key roles in sorting and trafficking of protein and lipids during endocytosis, sorting within the endosomal system, and autophagy. Central to SNX-BAR protein function is the ability to form homodimers or heterodimers that bind membranes using highly conserved phox-homology (PX) and BAR (Bin/Amphiphysin/Rvs) domains. In addition, oligomerization of SNX-BAR dimers on membranes can elicit the formation of membrane tubules and vesicles and this activity is thought to reflect their functions as coat proteins for endosome-derived transport carriers. Researchers have long utilized in vitro binding studies using recombinant SNX-BAR proteins on synthetic liposomes or giant unilamellar vesicles (GUVs) to reveal the precise makeup of lipids needed to drive membrane remodeling, thus revealing their mechanism of action. However, due to technical challenges with dual expression systems, toxicity of SNX-BAR protein expression in bacteria, and poor solubility of individual SNX-BAR proteins, most studies to date have examined SNX-BAR homodimers, including non-physiological dimers that form during expression in bacteria. Recently, we have optimized a protocol to overcome the major shortcomings of a typical bacterial expression system. Using this workflow, we demonstrate how to successfully express and purify large amounts of SNX-BAR heterodimers and how to reconstitute them on synthetic liposomes for binding and tubulation assays.

Here, we present a workflow for the expression, purification and liposome binding of SNX-BAR heterodimers in yeast.

SNX-BAR proteins are an evolutionarily conserved class of membrane remodeling proteins that play key roles in sorting and trafficking of protein and ...

Identification of Host Pathways Targeted by Bacterial Effector Proteins using Yeast Toxicity and Suppressor Screens

Intracellular bacteria secrete virulence factors called effector proteins into the host cytosol that act to subvert host proteins and/or their associated biological pathways to the benefit of the bacterium. Identification of putative bacterial effector proteins has become more manageable due to advances in bacterial genome sequencing and the advent of algorithms that allow in silico identification of genes encoding secretion candidates and/or eukaryotic-like domains. However, identification of these important virulence factors is only an initial step. Naturally, the goal is to determine the molecular function of effector proteins and elucidate how they interact with the host. In recent years, techniques like the yeast two-hybrid screen and large-scale immunoprecipitations coupled with mass spectrometry have aided in the identification of protein-protein interactions. Although identification of a host binding partner is the crucial first step toward elucidating the molecular function of a bacterial effector protein, sometimes the host protein is found to have multiple biological functions (e.g., actin, clathrin, tubulin), or the bacterial protein may not physically bind host proteins, depriving the researcher of crucial information about the precise host pathway being manipulated. A modified yeast toxicity screen coupled with a suppressor screen has been adapted to identify host pathways impacted by bacterial effector proteins. The toxicity screen relies on a toxic effect in yeast caused by the effector protein interfering with the host biological pathways, which often manifests as a growth defect. Expression of a yeast genomic library is used to identify host factors that suppress the toxicity of the bacterial effector protein and thus identify proteins in the pathway that the effector protein targets. This protocol contains detailed instructions for both the toxicity and suppressor screens. These techniques can be performed in any lab capable of molecular cloning and cultivation of yeast and Escherichia coli.

Bacterial pathogens secrete proteins into the host that target crucial biological processes. Identifying the host pathways targeted by bacterial effector proteins is key to addressing molecular pathogenesis. Here, a method using a modified yeast suppressor and toxicity screen to elucidate host pathways targeted by toxic bacterial effector proteins is described.

Intracellular bacteria secrete virulence factors called effector proteins into the host cytosol that act to subvert host proteins and/or their associated ...