Financiamento apoio para este projeto foi fornecido pelo programa de pesquisa de ciência básica através da nacional Research Foundation de Coreia (NRF) financiado pelo Ministério da ciência e TIC (2016R1A2B2006354).

1. preparação dos meios de comunicação
<ol><li>Prepare extracto de levedura com suplementos (Sim), sim sem adenina (Sim Ade de Low), média de Pombe Glutamate (PMG12) e PMG sem adenina (PMG-Ade) misturando os componentes conforme descrito na tabela 1. Sim-Ade (Ade de baixo) e placas de PMG-Ade têm todos os mesmos componentes, mas a adenina é omitida do último.<ol>
<li>Usar o estoque de sal (50 x) a seguir: 52,5 g/L MgCl2·6H2O, 2G/L CaCl2·2H2O, 50 g/L de KCl, 2G/L at2para4 em água destilada. Filtro de esterilizar usando um filtro de tamanho de poros de 0,22 µm e armazenar a 4 ° C.</li>
		<li>Use a seguinte vitamina (1, 000 x) estoque: pantotenato de 1 g/L, inositol 10 g/L, 10 g/L ácido nicotínico, biotina 10 mg/L em água destilada. Filtro de esterilizar usando um filtro de tamanho de poros de 0,22 µm e armazenar a 4 ° C.</li>
		<li>Use o seguinte mineral (10, 000 x) estoque: 5 g/L ácido bórico, 4G/L MnSO4, 4G/L ZnSO4·7H2O, 2G/L FeCl2·4H2O, 0,4 g/L MoO3, 1G/L de KI, 0,4 g/L de CuSO4·5H2O , 10 g/L ácido cítrico em água destilada. Filtro de esterilizar usando um filtro de tamanho de poros de 0,22 µm e armazenar a 4 ° C. Nota: Sim líquido de cobertura pode ser feito omitindo o ágar-ágar.</li>
	</ol>
</li>
	<li>Autoclave a médio e resfriá-lo para abaixo de 60 ° C, agitando com uma barra de agitação, à taxa de 200 rpm.</li>
	<li>Para placas de Sim + G418 (geneticin), adicione 1 mL/L G418 de solução para o meio de Sim.<ol>
<li>Use o seguinte G418 (1, 000 x) estoque: 100 mg/mL G418 em água destilada. Filtro de esterilizar usando um filtro de tamanho de poros de 0,22 µm, alíquota para tubos de centrífuga de 1,5 mL e loja a-20 ° C.</li>
	</ol>
</li>
	<li>Mexa por mais 5-10 min e alíquota da mídia em pratos de Petri-90mm (1L de alíquotas médias de aproximadamente 40 pratos de Petri. Armazenar as placas a 4 ° C.</li>
</ol>2. clonagem de rpt4 + e seus 5' / 3' UTRs
<ol><li>Realizar PCR com primers p1 e p2 (figura 1A) usando fissão fermento DNA genômico (gDNA) como o modelo em um volume total de 50 µ l (~ 1 µ g DNA, enzima de U 20, tampão de reação 1x), e aplicando os ciclos de reação descritos na tabela 2 para amplificar uma 3.315-base fragmento de par (bp) compreendendo rpt4 + e seus 5' / 3' UTRs. Purifica o produto do PCR usando um kit de purificação13 conforme indicado pelo fabricante (figura 1A).</li>
	<li>Digerir o pBlueScript KS(-) vector14 e o fragmento de DNA amplificado contendo rpt4 + com sua 5' / 3' UTRs com BamH1 e Xho1 em um volume total de 20 µ l (~ 1 µ g DNA, enzima de U 20, 1 tampão de digestão x) a 37 ° C em banho-maria para 16-18 h (figura 1B).</li>
	<li>Gel de purificar o vetor digerido (gel de agarose 1,2%) e DNA inserir pela realização de eletroforese em gel de agarose TAE-baseado (100 V, 1 h), extirpando as bandas de DNA dos tamanhos desejados e isolar o DNA com um gel de extração kit15.</li>
	<li>Ligam o vetor e inserção de DNA usando T4 DNA ligase realizando uma reação de ligadura de 20 µ l contendo 50-100 ng de DNA, vetor um ~ 3 vezes excesso molar de ligadura tampão 1x, 400 ligase do DNA de T4 U e o DNA de inserção. Incube a mistura a 18 ° C, durante 16-18 h.</li>
	<li>Transformar o DNA ligado em 100 µ l de e. coli DH5α aplicando choque térmico para 70 s a 42 ° C. Adicionar 1 mL de LB e incubar durante 1 h a 37 ° C, para a recuperação. Realizar a centrifugação (13.800 x g), descartar a sobrenadante, placa todos os transformado Escherichia coli células em placas LB-ampicilina (LA) e incubar a 37 ° C, durante 16 h.</li>
	<li>Escolha 4-8 colônias com palitos de dente e crescer durante a noite a 37 ° C, no meio de 3 mL de LA.</li>
	<li>Isolar o plasmídeo com um plasmídeo purificação kit16 usado de acordo com o protocolo do fabricante e executar analítica enzima de restrição digestões com 5 µ l do plasmídeo isolado, 5 U de cada enzima de restrição (BamH1 e Xho1) e 1 x buffer de restrição. Incube a mistura a 37 ° C em banho-maria por 3 h. confirmar a clonagem por sequenciamento plasmídeos de candidato.</li>
</ol>3. introdução da mutação silenciosa (Xho1 Site de restrição)
<ol><li>Desenha um par de primers 33-bp (p3 e p4) que contêm a mutação desejada na sequência de outra forma complementar.</li>
	<li>Realizar o PCR com alta fidelidade do polymerase17 (Figura 1) em um volume total de 25 µ l (10 ng de plasmídeo clonado, 2 µ l de 10 pmol cartilha mix, enzima de U 2, tampão de reação 1x) usar os ciclismo parâmetros listados na tabela 3.</li>
	<li>Digeri o plasmídeo de modelo com DpnI em um volume total de 20 µ l (20 U enzima, 1x tampão de digestão) a 37 ° C em uma água de banho para 1 h.</li>
	<li>Transformar, propagar, isolar e sequenciar o plasmídeo contendo a mutação silenciosa, conforme descrito nas etapas 2.5-2.7. Nota: A mutação silenciosa também pode ser introduzida usando um método de clonagem que permite a junção de vários fragmentos de DNA em uma única reação de18.</li>
</ol>4. random Mutagenesis de rpt4 + pelo PCR propensa
<ol><li>Realizar PCR propensa, usando o plasmídeo com a mutação silenciosa (Xho1 site) como o modelo de primeiras demão p5 e p6, um volume total de 50 µ l (a quantidade de modelo definido na etapa 4.1.1, 2 µ l de mistura de primeira demão 10 pmol, enzima de U 2.5, 1 amortecedor da reação x) , e uma polimerase especial que foi projetada para gerar um erro de alto taxa19 (Figura 1). Realize PCR conforme descrito na tabela 2.<ol>
<li>Use 4-5 µ g de plasmídeo de modelo para controlar a frequência de mutação para 1 bp/kb (quilobase). Nota: Uma alta concentração (> 500 ng / µ l) de plasmídeo, que pode ser obtido usando um prep mini kit20, é necessário.</li>
	</ol>
</li>
	<li>Use a electroforese do gel para confirmar um produto do PCR da bp 2670 (gel de agarose 1,2%). Gel de purificar este produto PCR conforme descrito na etapa 2.5.</li>
</ol>5. preparação de fragmentos PCR de fusão (KAN, 3' UTR)
<ol><li>Realizar PCR usando pFA6a-KANMX621 como o modelo, as primeiras demão p7 e p8, e as condições listadas na tabela 4 para obter o fragmento de marcador (KAN). Gel de purificar o fragmento resultante de 1.480-bp, conforme descrito na etapa 2.5 (Figura 1E).<ol>
<li>Verifique se o códon de parada do gene alvo de mutação e região codificante do gene sua adjacente são separados por mais de 500 bp. O terminador endógeno não pode ser utilizado quando esta região é inferior a 500 bp; em vez disso, o exterminador de ADH deve ser usado em vez do Exterminador do futuro endógena. As mudanças de protocolo necessárias para usar o terminador de ADH são apresentadas na tabela 5. Nota: Essas alterações só se aplicam quando o exterminador de ADH , que está disponível no plasmídeo pFA6a-3HA-KANMX6, é usado em vez do Exterminador do futuro endógena.</li>
	</ol>
</li>
	<li>Realizar PCR com o clonado rpt4 +-contendo o vetor como o modelo e as primeiras demão p9 e p10 em um volume total de 50 µ l (20 ng do plasmídeo clonado, 2 µ l de 10 pmol cartilha mix, enzima de U 2, tampão de reação 1x), usando as condições apresentadas na tabela 6. Gel de purificar obtidos 506-bp 3' UTR fragmento (Figura 1E).</li>
</ol>6. geração de construção de transformação pela fusão do PCR (Figura 1E)
<ol><li>Prepare os 3 fragmentos (mutagenized + rpt4, KAN e os 3' UTR) em 50 ng / µ l.</li>
	<li>Realize fusão que PCR dos três fragmentos usando as primeiras demão p11 e p12, conforme descrito na tabela 7. (O protocolo para fusão do PCR é uma modificação do protocolo original22). Purifica o principal produto do PCR 4.398-bp.<ol>
<li>Usar rpt4 +: KAN:3'UTR fragmentos na proporção de 1:3:1 para obter melhores resultados. Nota: A quantidade total de DNA da inserção não deve exceder 500 ng. A quantidade recomendada de rpt4 +: KAN:3'UTR é 50 ng:150 ng:50 ng. A região mutagenized é aproximadamente 1,6 kb, então o número mínimo de colônias de levedura que seriam responsáveis por todas as combinações possíveis de cada base, sendo uma mutação para os outros três é 1.600 x 3 = 4.800 colônias. Como uma reação de transformação normalmente produz colônias de 400-500, pelo menos 10 reações vale de fusão PCR construir é necessária. Esta necessidade pode ser satisfeita, simplesmente aumentando a quantidade de reação (isto é, o número de tubos PCR) por um fator de dez.</li>
	</ol>
</li>
</ol>7. transformação de leveduras de fissão por eletroporação (Figura 1F)
<ol><li>Inocule o fermento para 10 mL de meio de sim a saturação incubando-o por mais de 16 h.</li>
	<li>Diluir as células de uma densidade óptica em 600 nm (OD600) de 0,2 em 200 mL de meio de Sim e incubar a 30 ° C, com agitação por 5-6 h, a OD600 = 0.6 - 0.8.</li>
	<li>Concentre-se em células para OD600 = 30, dispense a quatro tubos de Erlenmeyer de 50 mL e relaxar no gelo por 10 min.</li>
	<li>As células da colheita, realizando a centrifugação a 1.050 x g por 3 min a 4 ° C. Coloque os tubos e 10 electro-cubetas no gelo. Execute as etapas 7.3-7,8 no gelo.</li>
	<li>Desprezar o sobrenadante e adicionar 15 mL de sorbitol de 1,2 M. Agite os tubos para Ressuspender as células.</li>
	<li>Centrifugar as células a 1050 x g, durante 3 min a 4 ° C.</li>
	<li>Repita os passos de 7.4 e 7.5. Desprezar o sobrenadante. Adicionar 500 µ l de sorbitol 1,2 M para cada tubo, Ressuspender as células e coletar todas as células em um tubo cônico de 15 ml.</li>
	<li>Adicionar o sorbitol 1,2 M a 2,4 mL (OD600 = 10 / 0,2 mL). Mantenha o tubo no gelo.</li>
	<li>Adicionar 200 µ l de células de sorbitol-suspenso (certifique-se que eles são totalmente suspensos) para um tubo novo EP contendo a fusão do PCR construir, misture bem e transferir a amostra para um electro-cubeta.</li>
	<li>Electroporate as células com as seguintes opções: fungos, ShS (2.00kV, 1 pulso).</li>
	<li>Adicionar 600 µ l de sorbitol 1,2 M para cada electro-cubeta para um volume total de 800 µ l e em seguida, espalhe as células em quatro placas Sim (200 µ l/placa). Electro-10 cubetas dispensará a 40 sim placas.</li>
	<li>Incube as placas a 30 ° C por 24 h.</li>
	<li>Executar o chapeamento de réplica para Sim + G418 e incubar as placas a 30 ° C durante 3 dias.</li>
</ol>8. seleção de heterocromatina-desestabilizando mutantes e verificação de falsos positivos
<ol><li>Para cada placa de Sim + G418, execute o chapeamento de réplica para Sim-Ade (Ade baixo) e placas de PMG-Ade (Ade n). Incube as placas réplica por 1-2 dias a 30 ° C, até algumas das colônias nas placas Sim-Ade mostram uma coloração vermelha (Figura 1).</li>
	<li>Compare placas Sim-Ade e PMG-Ade e selecione células que mostram rosa ou branco na placa sim-Ade e também crescem na placa PMG-Ade. Não selecione colônias sem crescimento na PMG-Ade, como eles são falsos positivos (por exemplo, refletindo que a gaveta de KAN foi integrada em um local não-alvo Noutras partes do genoma).</li>
	<li>Pegue aproximadamente 1 x 105 células de cada colônia e incubar em 10 µ l de solução SPZ contendo 2,5 mg/mL zymolyase 100 T a 37 ° C durante pelo menos 30 min. utilizar 1 µ l desta solução para executar como o modelo inicial para colônia PCR (Figura 1 H).<ol>
<li>Fazer SPZ (50 mL) pela mistura de 30 mL de sorbitol 2m, 4,05 mL de 1 M Na2HPO4, 0,95 mL NaH2PO4 e 15 mL de água destilada (pH final, 7,5). Amostras (5 mL) podem ser suplementadas com zymolyase e armazenadas em alíquotas de 500 µ l a-20 ° C até o uso.</li>
	</ol>
</li>
	<li>Realize a eletroforese em gel (gel de agarose 1,2%, 180V, 20 min) para visualizar os resultados de + a PCR de colônia. Selecione as reações que apresentam bandas PCR de tamanho adequado e digerem 5 µ l de cada produto da reação com XhoI (4 enzima U, 1 tampão de digestão x, banho-maria a 37 ° C, 1 h) para filtrar falsos positivos (Figura 1 H).</li>
	<li>Realize a eletroforese em gel para visualizar os sumários de XhoI (gel de Agarose 1,2%, 180 V, 20 min). Marca as colônias cujos produtos PCR são cortados por XhoIe passe-os para Sim + G418 placas (Figura 1I).</li>
	<li>Isolar gDNA partir de células de levedura de fissão e realizar o sequenciamento da PCR produtos23. Compare a sequência obtida com sequência de tipo selvagem para identificar mutações (Figura 1I).</li>
	<li>Diretamente Re-Introduza o mutation(s) de células de tipo selvagem, transformando-os com construções de fusão amplificadas por PCR de células mutantes23. Use a mancha para confirmar o fenótipo nas células mutantes recém-feitos (Figura 1J).<ol>
<li>Construção de transformação de fusão pode ser facilmente amplificada por PCR com primers p1 e p10 usando o DNA genômico de mutantes como o modelo em um volume total de 50 µ l (~ 1 µ g DNA, enzima de U 20, tampão de reação 1x) e aplicando os ciclos de reação descritos no tabela 2 . Transformação da construção pode ser feita seguindo as etapas 7.1-7.13.</li>
	</ol>
</li>
</ol>

<ol>
	<li>Pritchard, L., Corne, D., Kell, D., Rowland, J., Winson, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+general+model+of+error-prone+PCR.">A general model of error-prone PCR.</a> J Theor Biol. 234 (4), 497-509 (2005).</li><li>Pfeifer, G. P., You, Y. H., Besaratinia, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+induced+by+ultraviolet+light.">Mutations induced by ultraviolet light.</a> Mutat Res. 571 (1-2), 19-31 (2005).</li><li>Moreno, S., Klar, A., Nurse, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+genetic+analysis+of+fission+yeast+Schizosaccharomyces+pombe.">Molecular genetic analysis of fission yeast Schizosaccharomyces pombe.</a> Methods Enzymol. 194, 795-823 (1991).</li><li>Selifonova, O., Valle, F., Schellenberger, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+evolution+of+novel+traits+in+microorganisms.">Rapid evolution of novel traits in microorganisms.</a> Appl Environ Microbiol. 67 (8), 3645-3649 (2001).</li><li>Cohen, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+DNA+shuffling+works.">How DNA shuffling works.</a> Science. 293 (5528), 237 (2001).</li><li>Sahu, P. P., Sharma, N., Puranik, S., Chakraborty, S., Prasad, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tomato+26S+Proteasome+subunit+RPT4a+regulates+ToLCNDV+transcription+and+activates+hypersensitive+response+in+tomato.">Tomato 26S Proteasome subunit RPT4a regulates ToLCNDV transcription and activates hypersensitive response in tomato.</a> Sci Rep. 6, 27078 (2016).</li><li>Xu, Q., Singer, R. A., Johnston, G. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sug1+modulates+yeast+transcription+activation+by+Cdc68.">Sug1 modulates yeast transcription activation by Cdc68.</a> Mol Cell Biol. 15 (11), 6025-6035 (1995).</li><li>Bhat, K. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+19S+proteasome+ATPase+Sug1+plays+a+critical+role+in+regulating+MHC+class+II+transcription.">The 19S proteasome ATPase Sug1 plays a critical role in regulating MHC class II transcription.</a> Mol Immunol. 45 (8), 2214-2224 (2008).</li><li>Chang, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Gal4+activation+domain+binds+Sug2+protein,+a+proteasome+component,+in+vivo+and+in+vitro.">The Gal4 activation domain binds Sug2 protein, a proteasome component, in vivo and in vitro.</a> J Biol Chem. 276 (33), 30956-30963 (2001).</li><li>Ekwall, K., Cranston, G., Allshire, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fission+yeast+mutants+that+alleviate+transcriptional+silencing+in+centromeric+flanking+repeats+and+disrupt+chromosome+segregation.">Fission yeast mutants that alleviate transcriptional silencing in centromeric flanking repeats and disrupt chromosome segregation.</a> Genetics. 153 (3), 1153-1169 (1999).</li><li>Grewal, S. I., Jia, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterochromatin+revisited.">Heterochromatin revisited.</a> Nat Rev Genet. 8 (1), 35-46 (2007).</li><li>Forsburg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Forsburg Lab Recipes: Fission Yeast Media. , (2011).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> QIAquick PCR Purification Kit. , (2013).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> pBlueScript II Vector. , (2005).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> QIAquick Gel Extraction Kit. , (2013).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> QuickGene SP Kit Plasmid Kit II (SP-PL2). , (2016).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> PfuUltra High-fidelity DNA Polymerase. , (2004).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Gibson Assembly Master Mix. , (2017).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> GeneMorph II Random Mutagenesis Kits. , (2012).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Plasmid Plus Midi Kit. , (1999).</li><li>Bahler, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterologous+modules+for+efficient+and+versatile+PCR-based+gene+targeting+in+Schizosaccharomyces+pombe.">Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe.</a> Yeast. 14 (10), 943-951 (1998).</li><li>Szewczyk, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fusion+PCR+and+gene+targeting+in+Aspergillus+nidulans.">Fusion PCR and gene targeting in Aspergillus nidulans.</a> Nat Protoc. 1 (6), 3111-3120 (2006).</li><li>Nurse, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Fission Yeast Handbook. , (2000).</li><li>Seo, H. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+19S+proteasome+is+directly+involved+in+the+regulation+of+heterochromatin+spreading+in+fission+yeast.">The 19S proteasome is directly involved in the regulation of heterochromatin spreading in fission yeast.</a> J Biol Chem. , (2017).</li><li>Tang, N. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+and+characterisation+of+temperature+sensitive+mutants+of+genes+encoding+the+fission+yeast+spindle+pole+body.">Generation and characterisation of temperature sensitive mutants of genes encoding the fission yeast spindle pole body.</a> PeerJ Preprints. 5, e3377v3371 (2017).</li><li>Rasooly, A., Weisz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+antibacterial+activities+of+phloxine+B+and+other+halogenated+fluoresceins+against+methicillin-resistant+Staphylococcus+aureus.">In vitro antibacterial activities of phloxine B and other halogenated fluoresceins against methicillin-resistant Staphylococcus aureus.</a> Antimicrob Agents Chemother. 46 (11), 3650-3653 (2002).</li><li>Wilson, D. S., Keefe, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Random+mutagenesis+by+PCR.">Random mutagenesis by PCR.</a> Curr Protoc Mol Biol. , (2001).</li></ol>

Os autores não têm nada para divulgar.

Mutagénese aleatória através de PCR propensa é uma ferramenta poderosa para gerar um pool diversificado de mutantes em uma determinada região. Esta técnica é especialmente útil para estudos que visam avaliar a função de uma proteína em uma circunstância específica. Por exemplo, usamos aqui PCR propensa para avaliar a função da subunidade de proteossomo 19S, Rpt4, em manutenção de heterocromatina. Variando a região alvo de PCR propensa e ajustando as condições de triagem, fomos capazes de transformar células na região genômica de interesse e tela para o fenótipo desejado. Recentemente, um método semelhante foi usado para isolar as células de levedura de fissão abrigando mutações no eixo polo corpo componente25.
A principal vantagem de mutagênese aleatória é que pode ser aplicado aos genes não essenciais e essenciais. Mutagénese aleatória de genes essenciais pode produzir diversos mutantes, tais como aqueles com defeitos funcionais sutis e/ou parciais que permitem a viabilidade celular ser mantida, ou mutantes cujas funções são afetadas somente sob uma condição específica. Um exemplo deste último é um mutante sensíveis à temperatura. Tais mutantes podem ser isolados usando 5mg/L Floxina B, que manchas de células morrendo em vermelho e permite o crescimento lento de células a ser distinguida de células26a morrer.
A etapa crítica do presente protocolo é a etapa PCR propensa. Neste passo, é importante controlar a frequência de mutação, que pode variar amplamente, dependendo do número de ciclos PCR e a quantidade inicial de modelo. Recomendamos que o usuário fixar o número de ciclos PCR e variar a quantidade inicial de modelo, como achamos que isso seja uma estratégia mais conveniente para a otimização. Notamos que a técnica de PCR propensa tem sido amplamente disponível há décadas. Se o utilizador desejar, eles podem procurar um método para executar manualmente o propenso a PCR27 sem usar um kit mutagénese comercialmente disponível.
Como uma precaução, a taxa de falsos positivos do presente protocolo é bastante elevada. Assim, candidatos mutantes devem se submeter a uma série de sessões destinadas a eliminar os falsos positivos. Nós achamos que a incorporação silenciosa de um sítio de restrição no gene alvo pode ajudar a evitar a necessidade de falsos positivos de assunto à etapa relativamente trabalhoso de sequenciamento. Isto é cost-effective, como os candidatos mutantes podem número em centenas ou até mesmo além.

Genética para a frente é um método clássico em que pesquisadores buscam naturalmente mutantes que exibem um fenótipo específico e realizar análises genéticas. Em genética reversa, mutações são introduzidas em um gene de interesse e o fenótipo é examinado. Neste último caso, mutagênese aleatória de um gene alvo muitas vezes é usado para gerar um grupo de mutantes que posteriormente são selecionados para desejado fenótipos, tais como a sensibilidade à temperatura ou alterado a atividade enzimática. Podem ser utilizados vários métodos para alcançar o mutagenesis aleatório, incluindo propenso a PCR1; De irradiação UV2; mutagênicos químicos, tais como Metanossulfonato de etila (EMS) ou ácido nitroso3; o uso de cepas de modificador temporário, tais como aqueles excesso expressando mutD5 4; e DNA baralhar5.
Aqui, descrevemos uma estratégia reverso-genética em que utilizamos PCR propensa para gerar piscinas mutantes para um gene alvo no fermento a fissão. Como se pode adivinhar seu nome, este método gera mutações deliberadamente introduzindo erros durante a PCR. Ao contrário de outros métodos de mutagénese, propenso a PCR permite ao usuário definir a região a ser mutagenized. Isto o torna particularmente útil nos esforços para estudar a função de um domínio/proteína de interesse.
Para demonstrar este procedimento de mutagênese aleatória, aqui usamos o rpt4 +, que codifica a subunidade de proteossomo 19S, como exemplo. Rpt4 tem sido demonstrado que têm funções independente de proteólise em organismos que não sejam fissão fermento6,7,8,9, e um defeito na proteólise pode causar efeitos indiretos, alterando as proteínas níveis. Nós, portanto, selecionados para mutantes que desencadeou mudanças de proteólise-independente, com o objetivo de investigar a função da Proteassoma em heterocromatina.
Propenso a PCR pode ser aplicado a qualquer região do gene ajustando o local em que as primeiras demão vincular. Mutantes que apresentam a mudança fenotípica desejada podem ser identificados com repórteres apropriados. Aqui, utilizamos um repórter ade6 + inserido no Centrómero 1 exterior repetição (otr) região10. Heterocromatina constitutiva é formada nesta região11, então o repórter ade6 + é silenciado na condição de tipo selvagem; Isto é indicado por colônias vermelho10. Uma mutação que desestabiliza a heterocromatina constitutiva no Centrómero conduzirá à expressão do repórter ade6 + , que é visualizada como colônias brancas.

<table border="0" cellpadding="0" cellspacing="0" width="825">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:267px;">1. Media</td>
			<td style="width:155px;"></td>
			<td style="width:119px;"></td>
			<td style="width:285px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Glucose</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">G8270-10KG</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Yeast extract</td>
			<td style="width:155px;">BD Biosciences</td>
			<td style="width:119px;">212720</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">L-Leucine</td>
			<td style="width:155px;">JUNSEI</td>
			<td style="width:119px;">87070-0310</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Adenine sulfate</td>
			<td style="width:155px;">ACR</td>
			<td style="width:119px;">16363-0250</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Uracil&#160;</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">U0750</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">L-Histidine</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">H8125</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">KH2PO4</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">1.05108.0050</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">NaCl</td>
			<td style="width:155px;">JUNSEI</td>
			<td style="width:119px;">19015-0350</td>
			<td></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:267px;">MgSO4&#8226;7H2O</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">63140</td>
			<td></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:267px;">CaCl2</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">12095</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Potassium phthalate</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">P6758-500g</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Inositol</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">I7508-50G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Biotin</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">B4501-100MG</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Boric Acid</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">B6768-1KG</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">MnSO4</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">M7634-500G</td>
			<td></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:267px;">ZnSO4&#8226;7H2O&#160;</td>
			<td style="width:155px;">JUNSEI</td>
			<td style="width:119px;">83060-031</td>
			<td></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:267px;">FeCl2&#8226;4H2O</td>
			<td style="width:155px;">KANTO</td>
			<td style="width:119px;">CB8943686</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Sodium molybdate dihydrate</td>
			<td style="width:155px;">YAKURI</td>
			<td style="width:119px;">31621</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">KI</td>
			<td style="width:155px;">JUNSEI</td>
			<td style="width:119px;">80090-0301</td>
			<td></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:267px;">CuSO4&#8226;5H2O</td>
			<td style="width:155px;">YAKURI</td>
			<td style="width:119px;">09605</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">D-myo-inositol</td>
			<td style="width:155px;">MP biomedicals</td>
			<td style="width:119px;">102052</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Pantothenate</td>
			<td style="width:155px;">YAKURI</td>
			<td style="width:119px;">26003</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Nicotinic Acid</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">N4126-500G</td>
			<td></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:267px;">(NH4)2SO4&#160;</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">A4418-100G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Agarose</td>
			<td style="width:155px;">Biobasic</td>
			<td>D0012</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">G418, geneticin</td>
			<td style="width:155px;">LPS</td>
			<td style="width:119px;">G41805</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:267px;">2. Enzyme reactions</td>
			<td style="width:155px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">PfuUltra II Fusion HS DNA Polymerase</td>
			<td style="width:155px;">Aglient</td>
			<td style="width:119px;">600380</td>
			<td>For site-directed mutagenesis</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">GeneMorphII Random mutagenesis Kit</td>
			<td style="width:155px;">Aglient</td>
			<td style="width:119px;">200500</td>
			<td>For error-prone PCR</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">Phusion High-Fidelity DNA Polymerase</td>
			<td style="width:155px;">Thermo Fisher</td>
			<td>F-530L</td>
			<td>For fusion PCR</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Ex Taq&#160;DNA Polymerase</td>
			<td style="width:155px;">Takara</td>
			<td style="width:119px;">RR001b</td>
			<td>For general PCR</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">BamH1</td>
			<td style="width:155px;">New England BioLabs</td>
			<td style="width:119px;">R0136S</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">Xho1</td>
			<td style="width:155px;">New England BioLabs</td>
			<td>R0146S</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">Dpn1</td>
			<td style="width:155px;">New England BioLabs</td>
			<td style="width:119px;">R0176S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:267px;">3. Equipment</td>
			<td style="width:155px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Velveteen square, black</td>
			<td style="width:155px;">VWR</td>
			<td style="width:119px;">89033-116</td>
			<td>For replica</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Replica-plating tool</td>
			<td style="width:155px;">VWR</td>
			<td style="width:119px;">25395-380</td>
			<td>For replica</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">MicroPulser Electroporator</td>
			<td style="width:155px;">Biorad</td>
			<td style="width:119px;">1652100&#160;</td>
			<td>For fission yeast transformation</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">Electroporation Cuvettes, 0.2 cm gap</td>
			<td style="width:155px;">Biorad</td>
			<td style="width:119px;">1652086&#160;</td>
			<td>For fission yeast transformation</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Thermal Cycler</td>
			<td style="width:155px;">Bioer</td>
			<td style="width:119px;">BYQ6078</td>
			<td>For fusion PCR ramp reaction&#160;</td>
		</tr>
	</tbody>
</table>

gene-targeted random mutagenesis to select heterochromatin-destabilizing proteasome mutants in fission yeast

Mutagénese aleatória de um gene alvo é comumente usado para identificar as mutações que produzem o fenótipo desejado. Dos métodos que podem ser usados para alcançar o mutagenesis aleatório, propenso a PCR é uma estratégia eficiente e conveniente para a geração de um pool diversificado de mutantes (i. e., uma biblioteca de mutante). Propenso a PCR é o método de escolha quando um pesquisador procura para transformar uma região pré-definidos, tais como a região da codificação de um gene, deixando outras regiões genômicas não afetado. Depois que a biblioteca mutante é amplificada por PCR propensa, isso deve ser clonado em um plasmídeo adequado. O tamanho da biblioteca gerada pelo PCR propensa é restringido pela eficiência da etapa de clonagem. No entanto, no fermento de fissão, Schizosaccharomyces pombe, passo a clonagem pode ser substituído pelo uso de uma fusão de uma etapa altamente eficiente do PCR para gerar construções para transformação. Mutantes de fenótipos desejados então podem ser selecionados usando repórteres apropriados. Aqui, descrevemos esta estratégia em detalhe, tomando como exemplo, um repórter inserido no heterocromatina centromérica.

Os mutantes Rpt4 adquiridos, seguindo os procedimentos descritos na Figura 1 podem ser analisados, avaliando as cores das colônias. As cores das colônias são vistas nas chapas de relevantes na diminuição do número de células na Figura 2. O repórter ade6 + inserido na região de heterocromatina é silenciado no selvagem-tipo e mostra vermelhas colônias em placa de Sim-Ade. Uma vez que a heterocromatina é desestabilizada e o repórter ade6 + é expresso, colônias brancas podem ser observadas na placa sim-Ade, como em clr4Δ mutante. Os mutantes Rpt4 selecionados são mostrados. mutante RPT4-1 mostra a desestabilização de heterocromatina mais grave.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57499/57499fig1.jpg"> Figura 1 : Representação esquemática do protocolo. (A) representação esquemática do produto do PCR obtidos pela primeira rodada do PCR, que é realizado com primers 1 e 2. (B) com base em restrição clonagem do fragmento rpt4 + . (C) o mutagenesis local-dirigido do vetor clonado é usado para introduzir uma mutação silenciosa que adiciona um sítio de restrição XhoI . (D) mutagênese aleatória do rpt4 + codificação região é executada usando PCR propensa. (E) o fragmento mutante rpt4 + , o fragmento de KAN e o fragmento de 3' UTR são unidas pela fusão do PCR para gerar uma fita pronta para transformação. (F) células de levedura de fissão são transformadas com a construção PCR, que substitui a sequência endógena rpt4 + por recombinação homóloga de fusão. (G) colônias KAN-selecionados são réplica chapeada Sim-Ade (Ade de baixo) e placas de PMG-Ade (n. Ade), e colônias positivas são selecionadas. (H) PCR e posterior XhoI restrição do produto do PCR são usados para evitar falsos positivos. (I) a mutação que faz com que o fenótipo é identificada pelo patch de colônias selecionadas, propagação de células, extração de DNA genômico (gDNA) e o sequenciamento da parte relevante do rpt4 +. (J) mutações causais são confirmadas (e falsos positivos são descartou) introduzindo directamente a mutação de células do tipo selvagem. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57499/57499fig1large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57499/57499fig2.jpg"> Figura 2 : Mutantes de repressão de heterocromatina de Rpt4. Diagrama esquemático do repórter otr1::ade6 + (superior). 5-fold diluições em série dos selecionados selecione Rpt4 mutantes foram vistas nas chapas de indicado em ordem crescente nível de desestabilização de heterocromatina (parte inferior). Esta figura foi modificada do artigo 'o proteossomo 19S está diretamente envolvido na regulação da heterocromatina espalhando no fermento de fissão' por Seo et al, 201724. A figura não-cortada pode ser encontrada no artigo original. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57499/57499fig2large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td rowspan="2">Componente de</td>
			<td colspan="2">Tipo de prato</td>
		</tr>
<tr>
<td>SIM</td>
			<td>PMG</td>
		</tr>
<tr>
<td>Extrato de levedura</td>
			<td>5 g/L</td>
			<td></td>
		</tr>
<tr>
<td>Glicose</td>
			<td>30 g/L</td>
			<td>20 g/L</td>
		</tr>
<tr>
<td>Adenina</td>
			<td>0,15 g/L</td>
			<td>0,1 g/L</td>
		</tr>
<tr>
<td>Histidina</td>
			<td>0,15 g/L</td>
			<td>0,1 g/L</td>
		</tr>
<tr>
<td>Leucina</td>
			<td>0,15 g/L</td>
			<td>0,1 g/L</td>
		</tr>
<tr>
<td>Uracilo</td>
			<td>0,15 g/L</td>
			<td>0,1 g/L</td>
		</tr>
<tr>
<td>Potássio pthalate de hidrogênio</td>
			<td></td>
			<td>3 g/L</td>
		</tr>
<tr>
<td>Na2HPO4
</td>
			<td></td>
			<td>2,2 g/L</td>
		</tr>
<tr>
<td>Ácido L-glutâmico</td>
			<td></td>
			<td>3,75 g/L</td>
		</tr>
<tr>
<td>Sais</td>
			<td></td>
			<td>20 ml/L</td>
		</tr>
<tr>
<td>Vitaminas</td>
			<td></td>
			<td>1 ml/L</td>
		</tr>
<tr>
<td>Minerais</td>
			<td></td>
			<td>0,1 ml/L</td>
		</tr>
<tr>
<td>Ágar-ágar</td>
			<td>16 g/L</td>
			<td>16 g/L</td>
		</tr>
</tbody></table>Tabela 1. Componentes de Sim e placas PMG
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Temperatura</td>
			<td>Tempo</td>
			<td>Ensaio</td>
		</tr>
<tr>
<td>95óC</td>
			<td>2 min</td>
			<td>1 ciclo</td>
		</tr>
<tr>
<td>95óC</td>
			<td>20 s</td>
			<td rowspan="3">30 ciclos</td>
		</tr>
<tr>
<td>55oC</td>
			<td>30 s</td>
		</tr>
<tr>
<td>72oC</td>
			<td>2 min</td>
		</tr>
<tr>
<td>72oC</td>
			<td>8 min</td>
			<td>1 ciclo</td>
		</tr>
<tr>
<td>8oC</td>
			<td>Segure</td>
			<td></td>
		</tr>
</tbody></table>Tabela 2. Programa recomendado de PCR para o mutagenesis local-dirigido
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Temperatura</td>
			<td>Tempo</td>
			<td>Ensaio</td>
		</tr>
<tr>
<td>95óC</td>
			<td>2 min</td>
			<td>1 ciclo</td>
		</tr>
<tr>
<td>95óC</td>
			<td>30 s</td>
			<td rowspan="3">19 ciclos</td>
		</tr>
<tr>
<td>55oC</td>
			<td>1 min</td>
		</tr>
<tr>
<td>72oC</td>
			<td>7 min</td>
		</tr>
<tr>
<td>72oC</td>
			<td>10 min</td>
			<td>1 ciclo</td>
		</tr>
<tr>
<td>8oC</td>
			<td>Segure</td>
			<td></td>
		</tr>
</tbody></table>Tabela 3. Programa recomendado de PCR para PCR propensa
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Temperatura</td>
			<td>Tempo</td>
			<td>Ensaio</td>
		</tr>
<tr>
<td>95óC</td>
			<td>2 min</td>
			<td>1 ciclo</td>
		</tr>
<tr>
<td>95óC</td>
			<td>20 s</td>
			<td rowspan="3">30 ciclos</td>
		</tr>
<tr>
<td>55oC</td>
			<td>30 s</td>
		</tr>
<tr>
<td>72oC</td>
			<td>2 min</td>
		</tr>
<tr>
<td>72oC</td>
			<td>8 min</td>
			<td>1 ciclo</td>
		</tr>
<tr>
<td>8oC</td>
			<td>Segure</td>
			<td></td>
		</tr>
</tbody></table>Tabela 4. Recomendado programa PCR para a obtenção do fragmento de KAN
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Mudança</td>
			<td>Para</td>
			<td colspan="2">Exemplo de caso de rpt4 +</td>
		</tr>
<tr>
<td>Vetor de modelo</td>
			<td>pFA6a-3HA-KANMX6</td>
			<td colspan="2"></td>
		</tr>
<tr>
<td>Sequência de ligação de vetor de p7</td>
			<td>ATTACGCTGCTCAGTGCTGA</td>
			<td colspan="2" rowspan="2">ttgctgacctgaagaaacttgaaggtacaattgattaccaaaagctttag ATTACGCTGCTCAGTGCTGA</td>
		</tr>
<tr>
<td>Sequência de enforcamento de p7</td>
			<td>A última sequência de 50bp incluindo o códon de parada</td>
		</tr>
<tr>
<td>Sequência de enforcamento de p8</td>
			<td>A primeira sequência de 50bp logo após o stop códon (sequência complementar)</td>
			<td colspan="2">AATCTTCATCGGTAAACTTATCATTTCATGGCTTTTTGGATATATGTGCA GAATTCGAGCTCGTTTAAAC</td>
		</tr>
<tr>
<td>Sequência de p9</td>
			<td>Começar certo após o códon de parada</td>
			<td colspan="2">tgcacatatatccaaaaagccatgaa</td>
		</tr>
<tr>
<td>Sequência de p10</td>
			<td>Produzir ~ 500bp fragmento com p9 (seqeucne complementar)</td>
			<td colspan="2">TAGACGTTTTTCCTCGTTTCTTTGTC</td>
		</tr>
</tbody></table>Tabela 5. Mudanças necessárias quando o exterminador de ADH é usado em vez do Exterminador do futuro endógena
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Temperatura</td>
			<td>Tempo</td>
			<td>Ensaio</td>
		</tr>
<tr>
<td>95óC</td>
			<td>2 min</td>
			<td>1 ciclo</td>
		</tr>
<tr>
<td>95óC</td>
			<td>20 s</td>
			<td rowspan="3">30 ciclos</td>
		</tr>
<tr>
<td>55oC</td>
			<td>30 s</td>
		</tr>
<tr>
<td>72oC</td>
			<td>1 min</td>
		</tr>
<tr>
<td>72oC</td>
			<td>8 min</td>
			<td>1 ciclo</td>
		</tr>
<tr>
<td>8oC</td>
			<td>Segure</td>
			<td></td>
		</tr>
</tbody></table>Tabela 6. Recomendado programa PCR para a obtenção do fragmento de 3' UTR
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Temperatura</td>
			<td>Tempo</td>
			<td>Rampa</td>
			<td>Ensaio</td>
		</tr>
<tr>
<td>94oC</td>
			<td>2 min</td>
			<td></td>
			<td>1 ciclo</td>
		</tr>
<tr>
<td>94oC</td>
			<td>20 s</td>
			<td></td>
			<td rowspan="4">10 ciclos</td>
		</tr>
<tr>
<td>70oC</td>
			<td>1 s</td>
			<td></td>
		</tr>
<tr>
<td>55oC</td>
			<td>30 s</td>
			<td>0.1 oC/s</td>
		</tr>
<tr>
<td>68oC</td>
			<td>02:30 min</td>
			<td>0.2 oC/s</td>
		</tr>
<tr>
<td>94oC</td>
			<td>20 s</td>
			<td></td>
			<td rowspan="4">5 ciclos</td>
		</tr>
<tr>
<td>70oC</td>
			<td>1 s</td>
			<td></td>
		</tr>
<tr>
<td>55oC</td>
			<td>30 s</td>
			<td>0.1 oC/s</td>
		</tr>
<tr>
<td>68oC</td>
			<td>02:30 min</td>
			<td>0.2 oC/s + 5 s/ciclo</td>
		</tr>
<tr>
<td>94oC</td>
			<td>20 s</td>
			<td></td>
			<td rowspan="4">10 ciclos</td>
		</tr>
<tr>
<td>70oC</td>
			<td>1 s</td>
			<td></td>
		</tr>
<tr>
<td>55oC</td>
			<td>30 s</td>
			<td>0.1 oC/s</td>
		</tr>
<tr>
<td>68oC</td>
			<td>02:30 min</td>
			<td>0.2 oC/s + s/ciclo 20</td>
		</tr>
<tr>
<td>72oC</td>
			<td>10 min</td>
			<td></td>
			<td>1 ciclo</td>
		</tr>
<tr>
<td>8oC</td>
			<td>Segure</td>
			<td></td>
			<td></td>
		</tr>
</tbody></table>Tabela 7. Programa recomendado de PCR para fusão do PCR
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr>
<td>CBL1877</td>
			<td>h +</td>
			<td>otr1R ADE6-210 leu1-32 ura4-D18 (dg-glu) Sph1:ade6</td>
		</tr></tbody></table>Tabela S1: Estirpes utilizadas neste estudo
<img src="/files/ftp_upload/57499/57499tbl2.jpg"> Tabela S2: Lista de primers utilizados neste estudo

Watch this Scientific Journal Video about Gene-targeted Random Mutagenesis to Select Heterochromatin-destabilizing Proteasome Mutants in Fission Yeast at JoVE.com

Gene-targeted Random Mutagenesis to Select Heterochromatin-destabilizing Proteasome Mutants in Fission Yeast

Gene-alvo Mutagenesis aleatório para selecionar heterocromatina-desestabilizando Proteassoma mutantes no fermento de fissão

Este artigo descreve uma metodologia detalhada para o mutagenesis aleatório de um gene alvo no fermento de fissão. Como exemplo, temos como alvo rpt4 +, que codifica uma subunidade do proteossomo 19S e tela para as mutações que desestabilizam a heterocromatina.

Random mutagenesis of a target gene is commonly used to identify mutations that yield the desired phenotype. Of the methods that may be used to achieve ...

gene-targeted-random-mutagenesis-to-select-heterochromatin

Nanyang Technological University

Research

JoVE Journal

Genetics

10.6K visualizações.  Korea Advanced Institute of Science and Technology. Este artigo descreve uma metodologia detalhada para o mutagenesis aleatório de um gene alvo no fermento de fissão. Como exemplo, temos como alvo rpt4 +, que codifica uma subunidade do proteossomo 19S e tela para as mutações que desestabilizam a heterocromatina.

Vídeo: Gene-targeted Random Mutagenesis to Select Heterochromatin-destabilizing Proteasome Mutants in Fission Yeast

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most mutagenesis-based screens, researchers have relied on the use of toxic chemicals, carcinogens, or irradiation, which requires designated equipment, safety setup, and/or disposal of hazardous materials. We have developed a simple approach to induce heritable mutations in C. elegans using germline-expressed histone-miniSOG, a light-inducible potent generator of reactive oxygen species. This mutagenesis method is free of toxic chemicals and requires minimal laboratory safety and waste management. The induced DNA modifications include single-nucleotide changes and small deletions, and complement those caused by classical chemical mutagenesis. This methodology can also be used to induce integration of extrachromosomal transgenes. Here, we provide the details of the LED setup and protocols for standard mutagenesis and transgene integration.

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Genetically-encoded histone-miniSOG induces genome-wide heritable mutations in a blue&#160;light-dependent manner. This mutagenesis method is simple, fast, free of toxic chemicals, and well-suited for forward genetic screening and transgene integration.

A mutagénese aleatória optogenetic Usando Histona-miniSOG em<em&gt; C. elegans</em

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most ...

Genética

High-Throughput Robotically Assisted Isolation of Temperature-sensitive Lethal Mutants in Chlamydomonas reinhardtii

Systematic identification and characterization of genetic perturbations have proven useful to decipher gene function and cellular pathways. However, the conventional approaches of permanent gene deletion cannot be applied to essential genes. We have pioneered a unique collection of ~70 temperature-sensitive (ts) lethal mutants for studying cell cycle regulation in the unicellular green algae Chlamydomonas reinhardtii1. These mutations identify essential genes, and the ts alleles can be conditionally inactivated by temperature shift, providing valuable tools to identify and analyze essential functions. Mutant collections are much more valuable if they are close to comprehensive, since scattershot collections can miss important components. However, this requires the efficient collection of a large number of mutants, especially in a wide-target screen. Here, we describe a robotics-based pipeline for generating ts lethal mutants and analyzing their phenotype in Chlamydomonas. This technique can be applied to any microorganism that grows on agar. We have collected over 3000 ts mutants, probably including mutations in most or all cell-essential pathways, including about 200 new candidate cell cycle mutations. Subsequent molecular and cellular characterization of these mutants should provide new insights in plant cell biology; a comprehensive mutant collection is an essential prerequisite to ensure coverage of a broad range of biological pathways. These methods are integrated with downstream genetics and bioinformatics procedures for efficient mapping and identification of the causative mutations that are beyond the scope of this manuscript.

High-Throughput Robotically Assisted Isolation of Temperature-sensitive Lethal Mutants in Chlamydomonas reinhardtii

Temperature-sensitive (ts) lethal mutants are valuable tools to identify and analyze essential functions. Here we describe methods to generate and classify ts lethal mutants in high throughput.

Alto Throughput Robotically Isolamento Assistida da temperatura sensível Lethal Mutantes em<em&gt; Chlamydomonas reinhardtii</em

Systematic identification and characterization of genetic perturbations have proven useful to decipher gene function and cellular pathways. However, the ...

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

We describe a PCR- and homologous recombination-based system for generating targeted mutations in histone genes in budding yeast cells. The resulting mutant alleles reside at their endogenous genomic sites and no exogenous DNA sequences are left in the genome following the procedure. Since in haploid yeast cells each of the four core histone proteins is encoded by two non-allelic genes with highly homologous open reading frames (ORFs), targeting mutagenesis specifically to one of two genes encoding a particular histone protein can be problematic. The strategy we describe here bypasses this problem by utilizing sequences outside, rather than within, the ORF of the target genes for the homologous recombination step. Another feature of this system is that the regions of DNA driving the homologous recombination steps can be made to be very extensive, thus increasing the likelihood of successful integration events. These features make this strategy particularly well-suited for histone gene mutagenesis, but can also be adapted for mutagenesis of other genes in the yeast genome.

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

A strategy for generating mutations in histone genes at their endogenous location in Saccharomyces cerevisiae is presented.

Visadas<em&gt; In Situ</em&gt; mutagénese de histona Genes em brotamento Yeast

We describe a PCR- and homologous recombination-based system for generating targeted mutations in histone genes in budding yeast cells. The resulting ...

Using a Fluorescent PCR-capillary Gel Electrophoresis Technique to Genotype CRISPR/Cas9-mediated Knockout Mutants in a High-throughput Format

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play in the functioning of cells and whole organisms. This cause has been tremendously aided by the recent introduction of the CRISPR/Cas9 system-a versatile tool that allows researchers to manipulate the genome and transcriptome in order to, among other things, knock out, knock down, or knock in genes in a targeted manner. For the purpose of knocking out a gene, CRISPR/Cas9-mediated double-strand breaks recruit the non-homologous end-joining DNA repair pathway to introduce the frameshift-causing insertion or deletion of nucleotides at the break site. However, an individual guide RNA may cause undesirable off-target effects, and to rule these out, the use of multiple guide RNAs is necessary. This multiplicity of targets also means that a high-volume screening of clones is required, which in turn begs the use of an efficient high-throughput technique to genotype the knockout clones. Current genotyping techniques either suffer from inherent limitations or incur high cost, hence rendering them unsuitable for high-throughput purposes. Here, we detail the protocol for using fluorescent PCR, which uses genomic DNA from crude cell lysate as a template, and then resolving the PCR fragments via capillary gel electrophoresis. This technique is accurate enough to differentiate one base-pair difference between fragments and hence is adequate in indicating the presence or absence of a frameshift in the coding sequence of the targeted gene. This precise knowledge effectively precludes the need for a confirmatory sequencing step and allows users to save time and cost in the process. Moreover, this technique has proven to be versatile in genotyping various mammalian cells of various tissue origins targeted by guide RNAs against numerous genes, as shown here and elsewhere.

The genotyping technique described here, which couples fluorescent polymerase chain reaction (PCR) to capillary gel electrophoresis, allows for high-throughput genotyping of nuclease-mediated knockout clones. It circumvents limitations faced by other genotyping techniques and is more cost effective than sequencing methods.

Usando uma técnica de PCR fluorescente-capilar Electroforese em Gel de genótipo CRISPR / cas9 mediada KO mutantes em um formato de elevado rendimento

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play ...

CRISPR/Cas9 Gene Editing to Make Conditional Mutants of Human Malaria Parasite P. falciparum

Malaria is a significant cause of morbidity and mortality worldwide. This disease, which primarily affects those living in tropical and subtropical regions, is caused by infection with Plasmodium parasites. The development of more effective drugs to combat malaria can be accelerated by improving our understanding of the biology of this complex parasite. Genetic manipulation of these parasites is key to understanding their biology; however, historically the genome of P. falciparum has been difficult to manipulate. Recently, CRISPR/Cas9 genome editing has been utilized in malaria parasites, allowing for easier protein tagging, generation of conditional protein knockdowns, and deletion of genes. CRISPR/Cas9 genome editing has proven to be a powerful tool for advancing the field of malaria research. Here, we describe a CRISPR/Cas9 method for generating glmS-based conditional knockdown mutants in P. falciparum. This method is highly adaptable to other types of genetic manipulations, including protein tagging and gene knockouts.

CRISPR/Cas9 Gene Editing to Make Conditional Mutants of Human Malaria Parasite P. falciparum

We describe a method for generating glmS-based conditional knockdown mutants in Plasmodium falciparum using CRISPR/Cas9 genome editing.

CRISPR/Cas9 Gene edição para fazer condicional mutantes de humano parasita da malária por p. falciparum

Malaria is a significant cause of morbidity and mortality worldwide. This disease, which primarily affects those living in tropical and subtropical ...

Mating-based Overexpression Library Screening in Yeast

Budding yeast has been widely used as a model in studying proteins associated with human diseases. Genome-wide genetic screening is a powerful tool commonly used in yeast studies. The expression of a number of neurodegenerative disease-associated proteins in yeast causes cytotoxicity and aggregate formation, recapitulating findings seen in patients with these disorders. Here, we describe a method for screening a yeast model of the Amyotrophic Lateral Sclerosis-associated protein FUS for modifiers of its toxicity. Instead of using transformation, this new screening platform relies on the mating of yeast to introduce an arrayed library of plasmids into the yeast model. The mating method has two clear advantages: first, it is highly efficient; second, the pre-transformed arrayed library of plasmids can be stored for long-term as a glycerol stock, and quickly applied to other screens without the labor-intensive step of transformation into the yeast model each time. We demonstrate how this method can successfully be used to screen for genes that modify the toxicity of FUS.

This article presents a mating-based method to facilitate overexpression screening in budding yeast using an arrayed plasmid library.

Rastreio de biblioteca superexpressão de acasalamento-baseado no fermento

Budding yeast has been widely used as a model in studying proteins associated with human diseases. Genome-wide genetic screening is a powerful tool ...

Characterizing Histone Post-translational Modification Alterations in Yeast Neurodegenerative Proteinopathy Models

Neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and Parkinson&#39;s disease (PD), cause the loss of hundreds of thousands of lives each year. Effective treatment options able to halt disease progression are lacking. Despite the extensive sequencing efforts in large patient populations, the majority of ALS and PD cases remain unexplained by genetic mutations alone. Epigenetics mechanisms, such as the post-translational modification of histone proteins, may be involved in neurodegenerative disease etiology and progression and lead to new targets for pharmaceutical intervention. Mammalian in vivo and in vitro models of ALS and PD are costly and often require prolonged and laborious experimental protocols. Here, we outline a practical, fast, and cost-effective approach to determining genome-wide alterations in histone modification levels using Saccharomyces cerevisiae as a model system. This protocol allows for comprehensive investigations into epigenetic changes connected to neurodegenerative proteinopathies that corroborate previous findings in different model systems while significantly expanding our knowledge of the neurodegenerative disease epigenome.

This protocol outlines experimental procedures to characterize genome-wide changes in the levels of histone post-translational modifications (PTM) occurring in connection with the overexpression of proteins associated with ALS and Parkinson&#39;s disease in Saccharomyces cerevisiae models. After SDS-PAGE separation, individual histone PTM levels are detected with modification-specific antibodies via Western blotting.

Caracterizando a histona modificação pós-traducional alterações nos modelos de Neurodegenerative Proteinopathy de levedura

Neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and Parkinson&#39;s disease (PD), cause the loss of hundreds of thousands of lives ...

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

A genetic screen for mutant alleles that suppress phenotypic defects caused by a mutation is a powerful approach to identify genes that belong to closely related biochemical pathways. Previous methods such as the Synthetic Genetic Array (SGA) analysis, and random mutagenesis techniques using ultraviolet (UV) or chemicals like ethyl methanesulfonate (EMS) or N-ethyl-N- nitrosourea (ENU), have been widely used but are often costly and laborious. Also, these mutagen-based screening methods are frequently associated with severe side effects on the organism, inducing multiple mutations that add to the complexity of isolating the suppressors. Here, we present a simple and effective protocol to identify suppressor mutations in mutants which confer a growth defect in Schizosaccharomyces pombe. The fitness of cells with a growth deficiency in standard rich liquid media or synthetic liquid media can be monitored for recovery using an automated 96-well plate reader over an extended period. Once a cell acquires a suppressor mutation in the culture, its descendants outcompete those of the parental cells. The recovered cells that have a competitive growth advantage over the parental cells can then be isolated and backcrossed with the parental cells. The suppressor mutations are then identified using whole-genome sequencing. Using this approach, we have successfully isolated multiple suppressors that alleviate the severe growth defects caused by loss of Elf1, an AAA+ family ATPase that is important in nuclear mRNA transport and maintenance of genomic stability. There are currently over 400 genes in S. pombe with mutants conferring a growth defect. As many of these genes are uncharacterized, we propose that our method will hasten the identification of novel functional interactions with this user-friendly, high-throughput approach.

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

We present a simple suppressor screen protocol in fission yeast. This method is efficient, mutagen-free, and&#160; selective&#160; for&#160; mutations that&#160; often&#160; occur at&#160; &#160;a&#160; single&#160; genomic&#160; locus.&#160; The protocol is suitable for isolating suppressors that alleviate growth defects in liquid culture that are caused by a mutation or a drug.

Uma tela de supressor de Deep-sequenciamento-assistida, espontânea na fissão levedura Schizosaccharomyces pombe

A genetic screen for mutant alleles that suppress phenotypic defects caused by a mutation is a powerful approach to identify genes that belong to closely ...

Enhanced Yeast One-hybrid Screens To Identify Transcription Factor Binding To Human DNA Sequences

Identifying the sets of transcription factors (TFs) that regulate each human gene is a daunting task that requires integrating numerous experimental and computational approaches. One such method is the yeast one-hybrid (Y1H) assay, in which interactions between TFs and DNA regions are tested in the milieu of the yeast nucleus using reporter genes. Y1H assays involve two components: a &#8216;DNA-bait&#8217; (e.g., promoters, enhancers, silencers, etc.) and a &#8216;TF-prey,&#8217; which can be screened for reporter gene activation. Most published protocols for performing Y1H screens are based on transforming TF-prey libraries or arrays into DNA-bait yeast strains. Here, we describe a pipeline, called enhanced Y1H (eY1H) assays, where TF-DNA interactions are interrogated by mating DNA-bait strains with an arrayed collection of TF-prey strains using a high density array (HDA) robotic platform that allows screening in a 1,536 colony format. This allows for a dramatic increase in throughput (60 DNA-bait sequences against &#62;1,000 TFs takes two weeks per researcher) and reproducibility. We illustrate the different types of expected results by testing human promoter sequences against an array of 1,086 human TFs, as well as examples of issues that can arise during screens and how to troubleshoot them.

Here, we present an enhanced yeast one-hybrid screening protocol to identify the transcription factors (TFs) that can bind to a human DNA region of interest. This method uses a high-throughput screening pipeline that can interrogate the binding of &#62;1,000 TFs in a single experiment.

Telas de um híbrido levedura melhorada para identificar o fator de transcrição, vinculando a sequências de DNA humano

Identifying the sets of transcription factors (TFs) that regulate each human gene is a daunting task that requires integrating numerous experimental and ...

Embryo Microinjection Techniques for Efficient Site-Specific Mutagenesis in Culex quinquefasciatus

Culex quinquefasciatus is a vector of a diverse range of vector-borne diseases such as avian malaria, West Nile virus (WNV), Japanese encephalitis, Eastern equine encephalitis, lymphatic filariasis, and Saint Louis encephalitis. Notably, avian malaria has played a major role in the extinction of numerous endemic island bird species, while WNV has become an important vector-borne disease in the United States. To gain further insight into C. quinquefasciatus biology and expand their genetic control toolbox, we need to develop more efficient and affordable methods for genome engineering in this species. However, some biological traits unique to Culex mosquitoes, particularly their egg rafts, have made it difficult to perform microinjection procedures required for genome engineering. To address these challenges, we have developed an optimized embryo microinjection protocol that focuses on mitigating the technical obstacles associated with the unique characteristics of Culex mosquitoes. These procedures demonstrate optimized methods for egg collection, egg raft separation and other handling procedures essential for successful microinjection in C. quinquefasciatus. When coupled with the CRISPR/Cas9 genome editing technology, these procedures allow us to achieve site-specific, efficient and heritable germline mutations, which are required to perform advanced genome engineering and develop genetic control technologies in this important, but currently understudied, disease vector.

Embryo Microinjection Techniques for Efficient Site-Specific Mutagenesis in Culex quinquefasciatus

This protocol describes microinjection procedures for Culex quinquefasciatus embryos that are optimized to work with CRISPR/Cas9 gene editing tools. This technique can efficiently generate site-specific, heritable, germline mutations that can be used for building genetic technologies in this understudied disease vector.

Técnicas de microinjeção de embriões para mutagênese específica do local eficiente em Culex quinquefasciatus

Culex quinquefasciatus is a vector of a diverse range of vector-borne diseases such as avian malaria, West Nile virus (WNV), Japanese encephalitis, ...