We thank Reine Protacio for helpful comments during the preparation of this manuscript. We express our gratitude to the National Science Foundation (grants nos. 1243680 and 1613754) and the Hendrix College Odyssey Program for funding support.

<ol>
	<li>Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., Richmond, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+nucleosome+core+particle+at+2.8+A+resolution.">Crystal structure of the nucleosome core particle at 2.8 A resolution.</a> Nature. 389 (6648), 251-260 (1997).</li><li>Campos, E. I., Reinberg, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histones:+annotating+chromatin.">Histones: annotating chromatin.</a> Annu Rev Genet. 43, 559-599 (2009).</li><li>Rando, O. J., Winston, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+and+transcription+in+yeast.">Chromatin and transcription in yeast.</a> Genetics. 190 (2), 351-387 (2012).</li><li>Duina, A. A., Miller, M. E., Keeney, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Budding+yeast+for+budding+geneticists:+a+primer+on+the+Saccharomyces+cerevisiae+model+system.">Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system.</a> Genetics. 197 (1), 33-48 (2014).</li><li>Storici, F., Resnick, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delitto+perfetto+targeted+mutagenesis+in+yeast+with+oligonucleotides.">Delitto perfetto targeted mutagenesis in yeast with oligonucleotides.</a> Genet Eng (N Y). 25, 189-207 (2003).</li><li>Gray, M., Kupiec, M., Honigberg, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Site-specific+genomic+(SSG)+and+random+domain-localized+(RDL)+mutagenesis+in+yeast.">Site-specific genomic (SSG) and random domain-localized (RDL) mutagenesis in yeast.</a> BMC Biotechnol. 4, 7 (2004).</li><li>Erdeniz, N., Mortensen, U. H., Rothstein, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning-free+PCR-based+allele+replacement+methods.">Cloning-free PCR-based allele replacement methods.</a> Genome Res. 7 (12), 1174-1183 (1997).</li><li>Brachmann, C. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Designer+deletion+strains+derived+from+Saccharomyces+cerevisiae+S288C:+a+useful+set+of+strains+and+plasmids+for+PCR-mediated+gene+disruption+and+other+applications.">Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications.</a> Yeast. 14 (2), 115-132 (1998).</li><li>Lundblad, V., Hartzog, G., Moqtaderi, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Manipulation+of+cloned+yeast+DNA.">Manipulation of cloned yeast DNA.</a> Curr Protoc Mol Biol. Chapter 13, (2001).</li><li>Hoffman, C. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+yeast+DNA.">Preparation of yeast DNA.</a> Curr Protoc Mol Biol. Chapter 13, (2001).</li><li>Treco, D. A., Lundblad, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+yeast+media.">Preparation of yeast media.</a> Curr Protoc Mol Biol. Chapter 13, (2001).</li><li>Lederberg, J., Lederberg, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replica+plating+and+indirect+selection+of+bacterial+mutants.">Replica plating and indirect selection of bacterial mutants.</a> J Bacteriol. 63 (3), 399-406 (1952).</li><li>Sikorski, R. S., Hieter, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+system+of+shuttle+vectors+and+yeast+host+strains+designed+for+efficient+manipulation+of+DNA+in+Saccharomyces+cerevisiae.">A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.</a> Genetics. 122 (1), 19-27 (1989).</li><li>Johnson, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+systematic+mutational+analysis+of+a+histone+H3+residue+in+budding+yeast+provides+insights+into+chromatin+dynamics.">A systematic mutational analysis of a histone H3 residue in budding yeast provides insights into chromatin dynamics.</a> G3 (Bethesda). 5 (5), 741-749 (2015).</li><li>DiCarlo, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+in+Saccharomyces+cerevisiae+using+CRISPR-Cas+systems.">Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems.</a> Nucleic Acids Res. 41 (7), 4336-4343 (2013).</li><li>Cross, S. L., Smith, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+the+structure+and+cell+cycle+expression+of+mRNAs+encoded+by+two+histone+H3-H4+loci+in+Saccharomyces+cerevisiae.">Comparison of the structure and cell cycle expression of mRNAs encoded by two histone H3-H4 loci in Saccharomyces cerevisiae.</a> Mol Cell Biol. 8 (2), 945-954 (1988).</li><li>Libuda, D. E., Winston, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amplification+of+histone+genes+by+circular+chromosome+formation+in+Saccharomyces+cerevisiae.">Amplification of histone genes by circular chromosome formation in Saccharomyces cerevisiae.</a> Nature. 443 (7114), 1003-1007 (2006).</li></ol>

The authors declare that they have no competing financial interests.

L&#39;elevata omologia di sequenza tra due geni non alleliche che codificano ciascuno dei quattro proteine essenziali istoniche delle cellule S. cerevisiae aploidi possa rappresentare sfida per investigatori vogliano indirizzare specificamente uno dei due geni per mutagenesi. In precedenza descritto lievito metodologie di mutagenesi, compreso il Delitto Perfetto, genomica mutagenesi sito-specifica (SSG), e PCR-based metodi pezzi allele-free clonazione 5, 6, 7, così come le tecniche CRISPR basata più recente di lievito 15, spesso si basano almeno in parte su sequenze all&#39;interno della ORF di un gene bersaglio di reclutare i macchinari ricombinazione o riparazione al sito genomico desiderato casualmente per generare l&#39;allele mutante finale. D&#39;altra parte, la strategia che abbiamo qui presentato fa uso di sequenze di DNA che fiancheggiano la ORF mirata a guidare il homologoci evento di ricombinazione necessaria per l&#39;integrazione della mutazione, e, di conseguenza, consente una più specifica destinazione di un gene rispetto ad un altro, nonostante i due geni aventi ORF altamente omologhi. Questa caratteristica rende la nostra strategia particolarmente adatto per istone mutagenesi. Tuttavia, questa strategia può anche essere adattato per mutagenesi di altri geni nel genoma del lievito. Altre caratteristiche della strategia comprendono i fatti che le lunghezze delle regioni che guidano ricombinazione omologa dei geni mutanti possono essere progettati per essere molto ampia, aumentando così l&#39;efficienza di integrazione nella posizione genomica di destinazione, e che oltre la mutazione desiderata (s ) nessuna sequenze di DNA aggiuntivi vengono introdotti nel genoma. Un ulteriore vantaggio di questo sistema è che una volta che un ceppo ospitare sostituzione di un gene specifico con istone URA3 è stato costruito, esso può essere utilizzato per la generazione di qualsiasi versione mutante desiderato di quel particolare histun gene. Così, ad esempio, ceppo yAAD156, che è disponibile per la comunità di ricerca, su richiesta, può essere usato per fare qualsiasi mutazione hht2 desiderato, senza la necessità di costruire una de novo hht2Δ :: URA3 allele. Infine, utilizzando primer PCR correttamente progettati, questa strategia può anche essere usato per generare alleli istoni con delezioni interne o con mutazioni a più codoni, purché sono relativamente vicine tra loro (per esempio, abbiamo generato un allele hht2 codifica di un H3-K56R, L61W doppio mutante proteina usando questa strategia). La capacità di indirizzare specificamente uno dei due geni istoni altamente omologhi per mutagenesi può essere utile in diverse impostazioni sperimentali. Ad esempio, dal momento che i geni HHT1-HHF1 sono espressi a livelli diversi rispetto ai geni HHT2-HHF2 16, che potrebbe essere di interesse per determinare se un particolare H3 o H4 mutazione conferisce difenotipi fferent a seconda di quale gene si esprime da. Un altro esempio è uno scenario in cui un investigatore desidera generare cellule aploidi esprimenti un particolare mutante istone da entrambi i corrispondenti geni istoni - ciò potrebbe essere ottenuto prima mutagenizing ciascun gene indipendentemente in due ceppi diversi, e quindi ottenendo doppie cellule aploidi mutanti attraverso una croce e successivo isolamento dei prodotti meiotici desiderati. Ancora un altro esempio si riferisce alla mutagenesi degli istoni H2A e H2B: in considerazione del fatto che due leggermente diverse isoforme di ogni proteina sono codificati dal set gene non-allelica corrispondente, un investigatore può essere utile per valutare gli effetti di un H2A specifico o H2B mutazione in contesto di una isoforma. Durante la progettazione di esperimenti per la mutagenize HTA1 e HTB1 loci (codifica rispettivamente H2A e H2B,), gli investigatori devono essere consapevoli delle recenti scoperte mostrano che i ceppi che trasporta un (hta1-HTB1) Δ sono vitali solo iof hanno amplificato il locus HTA2-HTB2 (e vicinanze locus HHT1-HHF1 pure) attraverso la generazione di un piccolo cromosoma circolare 17, in quanto questo potrebbe complicare l&#39;interpretazione dei risultati. Abbiamo recentemente utilizzato una versione di questa strategia mutagenesi per generare istone H3 proteine istoni esprimono tutte le possibili sostituzioni ammino acido in posizione 61, che è normalmente occupato dal leucina 14. Per questi esperimenti, invece di usare yAAD156 come il ceppo di inizio del mutagenesi, abbiamo usato ceppo yADP106, che ospita una sostituzione del HHT2 ORF sia con la URA3 e TRP1 marcatori nutrizionali (invece di URA3). La presenza di entrambi i geni marcatori facilitato l&#39;identificazione dei candidati per l&#39;integrazione dei prodotti di PCR mutante seguenti lo schermo e la purificazione fase 5-FOA (punti 5 e 6 del protocollo), in quanto tale candidates divennero fenotipicamente Ura - e Trp -, mentre spontanea URA3 mutazione producevano in cellule con un Ura - fenotipo Trp +. yADP106 è disponibile anche su richiesta, come è la sequenza della cassetta URA3-TRP1, che potrebbe essere amplificato come unità e usato per la mutagenesi di altri geni istone usando la strategia descritta. Incapacità di ottenere mutanti istone desiderati utilizzando questa strategia potrebbe essere attribuibile ad una serie di possibili motivi, tra cui quantità insufficiente di full-size prodotti di PCR utilizzati per la fase di integrazione o un insufficiente numero di trasformanti dopo la fase di co-trasformazione. Il primo problema potrebbe essere affrontato mettendo in comune insieme grandi gruppi di reazioni di PCR o progettando diversi set di primer che producono una maggiore resa di prodotto, mentre il secondo problema potrebbe essere risolto utilizzando una maggiore quantità di spina dorsale plasmide nell&#39;esperimento co-trasformazione. although, come indicato in precedenza, si può utilizzare questa procedura per generare mutanti istoni ospitano due o più sostituzioni di amminoacidi, gli amminoacidi mirati devono essere relativamente vicini l&#39;uno all&#39;altro in quanto i rispettivi codoni devono essere collocati all&#39;interno della stessa molecola primer. Così, questa strategia non può essere facilmente adattato per la generazione di istoni con mutazioni multiple situate lontano tra loro per tutta la lunghezza delle proteine.

I quattro proteine ​​di base dell&#39;istone H2A, H2B, H3, H4 e giocano un ruolo centrale nella compattazione, l&#39;organizzazione e la funzione dei cromosomi eucariotiche. Due insiemi di ciascuna di tali istoni formano la ottamero istoni, un rocchetto molecolare che dirige l&#39;avvolgimento ~ 147 paia di basi del DNA su se stessa, che si traduce nella formazione di un nucleosoma 1. I nucleosomi sono partecipanti attivi in ​​una varietà di processi cromosomiche-based, come ad esempio la regolazione della trascrizione genica e la formazione di eucromatina e heterochromatin tra cromosomi, e come tali sono stati al centro di un&#39;intensa ricerca nel corso degli ultimi decenni. Un certo numero di meccanismi sono stati descritti da cui nucleosomi può essere manipolato in modi che possono facilitare l&#39;esecuzione di processi specifici - Questi meccanismi comprendono modificazione post-traslazionale di residui degli istoni, rimodellamento nucleosomi ATP-dipendente, e la riorganizzazione nucleosomi ATP-indipendentee montaggio / smontaggio 2, 3. Il lievito Saccharomyces cerevisiae erba è particolarmente potente organismo modello per la comprensione della funzione istone negli eucarioti. Questo può essere in gran parte attribuito all&#39;elevato grado di conservazione evolutiva delle proteine istone tutto il eucarioti dominio e la riconducibilità di lievito ad una varietà di sperimentale genetico e biochimico approcci 4. approcci Reverse-genetici nel lievito sono stati ampiamente utilizzati per studiare gli effetti di specifiche mutazioni istoni su vari aspetti della biologia della cromatina. Per questi tipi di esperimenti è spesso preferibile utilizzare cellule in cui gli istoni mutanti sono espressi dal loro loci genomici nativa, come espressione da plasmidi autonome può portare a anormali livelli intracellulari di proteine ​​istoni (a causa di un numero variabile di plasmidi in cellule) e alterazione concomitante di cromatina environments, che alla fine possono confondere l&#39;interpretazione dei risultati. Qui, si descrive una tecnica PCR-based che consente di mutagenesi mirata di geni istone alle loro posizioni nativi genomiche che non richiede una fase di clonazione e risultati nella generazione della mutazione desiderata (s) senza rimanenti sequenze di DNA esogene nel genoma. Questa tecnica sfrutta l&#39;efficiente sistema di ricombinazione omologa nel lievito e ha diverse caratteristiche in comune con altre tecniche simili sviluppati da altri gruppi - in particolare il Delitto Perfetto, genomica mutagenesi sito-specifica (SSG), e la clonazione senza PCR allele-based metodi sostitutivi 5, 6, 7. Tuttavia, la tecnica descriviamo ha un aspetto che lo rende particolarmente adatto per la mutagenesi dei geni istoni. In cellule di lievito aploidi, ciascuno dei quattro istoni nucleo è codificata da due non-ageni llelic e altamente omologhi: per esempio, l&#39;istone H3 vengono codificati dai geni HHT1 e HHT2, e le fasi di lettura aperte (ORF) dei due geni sono oltre il 90% identica in sequenza. Questo elevato grado di omologia può complicare esperimenti progettati per indirizzare specificamente uno dei due geni istone-codifica per la mutagenesi. Considerando che i suddetti metodi richiedono spesso l&#39;uso di almeno alcune sequenze all&#39;interno della ORF del gene bersaglio di guidare ricombinazione omologa, la tecnica descriviamo qui fa uso di sequenze fiancheggianti le ORF dei geni istoni (che condividono molto meno omologia di sequenza) per la fase di ricombinazione, aumentando così la probabilità di successo di targeting mutagenesi al locus desiderata. Inoltre, le regioni omologhe che guidano la ricombinazione possono essere molto ampia, contribuendo ulteriormente alla efficiente ricombinazione omologa mirato.

<table border="0" cellpadding="0" cellspacing="0" width="1091">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:517px;">1 kb DNA Ladder (DNA standards)</td>
			<td style="width:177px;">New England BioLabs</td>
			<td style="width:128px;">N3232L</td>
			<td style="width:269px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Agarose&#160;</td>
			<td>Sigma</td>
			<td>A5093-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Boric Acid</td>
			<td>Sigma</td>
			<td>B0394-500G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">dNTP mix (10 mM each)</td>
			<td>ThermoFisher Scientific</td>
			<td>R0192</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EDTA solution (0.5M, pH 8.0)</td>
			<td>AmericanBio</td>
			<td>AB00502-01000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ethanol (200 Proof)</td>
			<td>Fisher Scientific</td>
			<td>16-100-824</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:517px;">Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA)</td>
			<td>Sigma</td>
			<td>E4884-500G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Lithium acetate dihydrate</td>
			<td>Sigma</td>
			<td>L6883-250G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MyCycler Thermal Cycler</td>
			<td>BioRad</td>
			<td>170-9703</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Poly(ethylene glycol) (PEG)</td>
			<td>Sigma</td>
			<td>P3640-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PrimeSTAR HS DNA Polymerase (high fidelity DNA polymerase)&#160; and 5X buffer</td>
			<td>Fisher Scientific</td>
			<td>50-443-960</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Salmon sperm DNA solution</td>
			<td>ThermoFisher Scientific</td>
			<td>15632-011</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sigma 7-9 (Tris base, powder form)</td>
			<td>Sigma</td>
			<td>T1378-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sodium acetate trihydrate</td>
			<td>Sigma</td>
			<td>236500-500G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Supra Sieve GPG Agarose (low metling temperature agarose)</td>
			<td>AmericanBio</td>
			<td>AB00985-00100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Taq Polymerase and 10X Buffer</td>
			<td>New England BioLabs</td>
			<td>M0273X</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Toothpicks</td>
			<td>Fisher Scientific</td>
			<td>S67859</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tris-HCl (1M, pH 8.0)</td>
			<td>AmericanBio</td>
			<td>AB14043-01000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">a-D(+)-Glucose</td>
			<td>Fisher Scientific</td>
			<td>AC170080025</td>
			<td>for yeast media</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Agar</td>
			<td>Fisher Scientific</td>
			<td>DF0140-01-0</td>
			<td>for yeast media</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Peptone</td>
			<td>Fisher Scientific</td>
			<td>DF0118-07-2</td>
			<td>for YPD medium</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Yeast Extract</td>
			<td>Fisher Scientific</td>
			<td>DF0127-17-9</td>
			<td>for YPD medium</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">4-aminobenzoic acid</td>
			<td>Sigma</td>
			<td>A9878-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Adenine</td>
			<td>Sigma</td>
			<td>A8626-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glycine hydrochloride</td>
			<td>Sigma</td>
			<td>G2879-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Alanine</td>
			<td>Sigma</td>
			<td>A7627-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Arginine monohydrochloride</td>
			<td>Sigma</td>
			<td>A5131-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Asparagine monohydrate</td>
			<td>Sigma</td>
			<td>A8381-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Aspartic acid sodium salt monohydrate</td>
			<td>Sigma</td>
			<td>A6683-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Cysteine hydrochloride monohydrate</td>
			<td>Sigma</td>
			<td>C7880-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Glutamic acid hydrochloride</td>
			<td>Sigma</td>
			<td>G2128-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Glutamine</td>
			<td>Sigma</td>
			<td>G3126-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Histidine monohydrochloride monohydrate</td>
			<td>Sigma</td>
			<td>H8125-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:517px;">L-Isoleucine</td>
			<td>Sigma</td>
			<td>I2752-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Leucine</td>
			<td>Sigma</td>
			<td>L8000-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Lysine monohydrochloride</td>
			<td>Sigma</td>
			<td>L5626-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Methionine</td>
			<td>Sigma</td>
			<td>M9625-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Phenylalanine</td>
			<td>Sigma</td>
			<td>P2126-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Proline</td>
			<td>Sigma</td>
			<td>P0380-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Serine</td>
			<td>Sigma</td>
			<td>S4500-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:517px;">L-Threonine</td>
			<td>Sigma</td>
			<td>T8625-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Tryptophan</td>
			<td>Sigma</td>
			<td>T0254-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Tyrosine</td>
			<td>Sigma</td>
			<td>T3754-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Valine</td>
			<td>Sigma</td>
			<td>V0500-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">myo-Inositol</td>
			<td>Sigma</td>
			<td>I5125-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Uracil</td>
			<td>Sigma</td>
			<td>U0750-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ammonium Sulfate</td>
			<td>Fisher Scientific</td>
			<td>A702-500</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="18">
			<td height="18" style="height:19px;">Yeast Nitrogen Base</td>
			<td>Fisher Scientific</td>
			<td>DF0919-07-3</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">5-Fluoroorotic acid (5-FOA)</td>
			<td>AmericanBio</td>
			<td>AB04067-00005</td>
			<td>for&#160; 5-FOA medium</td>
		</tr>
	</tbody>
</table>

targeted in situ mutagenesis of histone genes in budding yeast

We describe a PCR- and homologous recombination-based system for generating targeted mutations in histone genes in budding yeast cells. The resulting mutant alleles reside at their endogenous genomic sites and no exogenous DNA sequences are left in the genome following the procedure. Since in haploid yeast cells each of the four core histone proteins is encoded by two non-allelic genes with highly homologous open reading frames (ORFs), targeting mutagenesis specifically to one of two genes encoding a particular histone protein can be problematic. The strategy we describe here bypasses this problem by utilizing sequences outside, rather than within, the ORF of the target genes for the homologous recombination step. Another feature of this system is that the regions of DNA driving the homologous recombination steps can be made to be very extensive, thus increasing the likelihood of successful integration events. These features make this strategy particularly well-suited for histone gene mutagenesis, but can also be adapted for mutagenesis of other genes in the yeast genome.

Descriviamo la generazione di un allele hht2 esprimere un istone H3 mutante proteina ospitare una sostituzione nella posizione 53 da un arginina ad acido glutammico (H3-R53E mutante) come un esempio rappresentativo della mirata strategia situ mutagenesi. Abbiamo generato un ceppo in cui l&#39;intera ORF di HHT2 è sostituito dal gene URA3 (vedi punto 1 del protocollo). Questo ceppo, yAAD156, ospita anche un allele his3Δ200, che fa sì che le cellule da auxotrophic per istidina. Seguendo la procedura indicata al punto 2 del protocollo, abbiamo poi generato i due frammenti parzialmente sovrapposti di HHT2. I seguenti primer sono stati utilizzati per il primo frammento: Forward Primer (OAD20): 5 &#39;GCGTTCATTATCGCCCAATGTG 3&#39; e il Reverse Primer (R53Erev): 5 &#39;GTTCAGTAGATTTTTGGAATtcTCTAATTTCTCTCAAG 3&#39;. Il seguente prIMers sono stati utilizzati per il secondo frammento: Forward Primer (R53Efor): 5 &#39;CTTGAGAGAAATTAGAgaATTCCAAAAATCTACTGAAC 3&#39; e il Reverse Primer (OAD21): 5 &#39;GCGCTTGATCAGCAGTTCATCG 3&#39;. Si noti che il Reverse Primer nella prima reazione e la Forward Primer nella seconda reazione contengono i nucleotidi desiderati mutato (in minuscolo) - questi nucleotidi mutati sono immerso tra due lunghi tratti di sequenze wild-type, in quanto ciò permette di ricottura efficiente del primer al DNA stampo nonostante la mancata corrispondenza nelle posizioni mutati. Si noti inoltre che i nucleotidi mutati in queste due primer sono complementari inverso tra loro e causano un AG GA mutazione nel filamento senso, che si traduce in un AGA per GAA cambiamento codone, che alla fine produce la mutazione R53E nella proteina codificata. I risultati di queste reazioni PCR sono mostrati nella Figura 2A. Utilizzando la procedura al punto 3, abbiamo poi Gener<html> ated i prodotti di PCR full-size. I primer utilizzati sono stati Forward Primer (OAD479): 5&#39;TATGGCTCGGTGTCAAAACA 3 &#39;e Reverse Primer (OAD480): 5&#39; CATGGTTTCTTGCCGGTTAT 3 &#39;. Nel progettare questi primer, è importante accertarsi che la fusione PCR prodotti risultanti comprendono almeno 40 coppie di base su entrambi i lati per guidare la reazione di ricombinazione omologa (il più le regioni di omologia, più efficienti e specifici eventi di ricombinazione omologa sarà essere). Nel nostro esperimento, i prodotti di PCR in grandezza contenevano una regione di 195 paia di basi e 220 paia di basi regione omologa alle regioni a monte ea valle del HHT2 ORF rispettivamente. Un campione di questi prodotti di PCR è stato analizzato mediante elettroforesi su gel di agarosio (Figura 2B). I prodotti di PCR full-size sono stati poi co-trasformato con il plasmide pRS413 (un centromerico, HIS3- segnato plasmidef &quot;&gt; 13) e trasformanti sono stati selezionati su piastre prive di istidina (SC-le sue piastre), come descritto al punto 4 del protocollo. Le sue colonie + sono stati poi sottoposti a screening per la resistenza 5-FOA seguendo le procedure descritte al punto 5 del protocollo. la Figura 3 mostra un esempio di una piastra di trasformazione (SC-his) e 5-FOA piastre seguenti replica-plating da SC-suoi piatti. Esempi di campioni candidati e campioni improbabili per rappresentare gli eventi di integrazione desiderati vengono anche presentati nella figura 3 . nel nostro esperimento, abbiamo identificato dodici campioni candidati di ~ 90.000 trasformanti schermati. Questi candidati sono stati quindi purificati come descritto al punto 6 del protocollo. I dodici candidati sono stati poi sottoposti ad analisi PCR descritto al punto 7 del protocollo per valutare se riflettono le sostituzioni autentici del gene URA3 con prodotti di PCR mutanti. Per i nostri experiment, abbiamo utilizzato un primer forward che annealing 89 coppie di basi a monte del sito di integrazione del prodotto PCR e un Reverse Primer che annealing 302 coppie di basi a valle del sito di integrazione del prodotto PCR. Questi primer generano prodotti di PCR di 1217 coppie di basi di dimensione se il locus HHT2 è occupato da HHT2 (o versioni mutate di HHT2 ospitano coppie di basi sostituzioni), o prodotti di PCR di 2188 coppie di basi di dimensione se il locus è occupata dal gene marcatore URA3 . La sequenza del Forward Primer utilizzato (OAD476) è: 5 &#39;GAAACTATTGGCACGCCCTA e quella del Reverse Primer utilizzato (OAD477) è: 5&#39; CCTGCGAATCAACCGATACT 3 &#39;. Dei dodici candidati che avevamo individuate, quattro hanno dimostrato l&#39;integrazione di un prodotto di PCR nella posizione corretta (si veda la Figura 4A per un esempio). Infine, poiché l&#39;AG GA mutazione genera un nuovo sito di restrizione Eco RI, abbiamo sottoposto prodotti di PCR di uno dei campioni di integrazione di successo a un <em&gt; Eco RI digestione e sono stati in grado di dimostrare che la sequenza mutante aveva effettivamente stato integrato nel genoma (vedi Figura 4B). In questo caso particolare, non abbiamo sequenziamento prodotti di PCR per garantire che ulteriori mutazioni indesiderate non erano stati incorporati nel genoma: tuttavia, abbiamo utilizzato una procedura molto simile a questo per generare un gran numero di mutazioni HHT2 in uno studio passati 14, e ha scoperto che la maggior parte degli alleli mutanti integrati portano mutazioni diverse da quelle desiderate. <img alt="figura 2" src="/files/ftp_upload/55263/55263fig2.jpg" /> Figura 2: Generazione di prodotti di PCR presentano mutazioni per l&#39;integrazione desiderato nel genoma del lievito. Reazione (A) PCR per generare i frammenti parzialmente sovrapposti di HHT2 harboring mutazioni desiderati. Rappresentazione cartone animato di t: Topha due reazioni PCR per ottenere i due HHT2 frammenti (Figura 1B-1). cerchi rossi rappresentano i nucleotidi corrispondenti sui primers utilizzati per introdurre l&#39;AG GA mutazione nel filamento senso del gene. In basso: gel elettroforesi analisi di PCR prodotti A e B (corsie rispettivamente 2 e 3,). Standard di DNA sono mostrati in corsia 1. (B) reazione Fusion PCR per generare formato del prodotto intero PCR per l&#39;integrazione nel genoma di lievito (fare riferimento alla Figura 1B-2 e 3). Top: Rappresentazione cartone animato della reazione PCR e atteso prodotto di PCR (prodotto C). cerchi rossi rappresentano desiderato mutazione come descritto in (A) di cui sopra. In basso: gel elettroforesi analisi dei prodotti della PCR c (corsia 2). Standard del DNA sono indicati nella corsia 1. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55263/55263fig2large.jpg" target="_blank">Clicca qui per vedere una versione più grande di questa figura.</a> Figura 3: Risultati Rappresentante dall&#39;esperimento Co-trasformazione e schermo da 5 FOA. A sinistra: rappresentante SC-suo piatto placcato con le cellule sottoposte alla procedura di co-trasformazione dopo una incubazione di 3 giorni a 30 ° C. Circa 5.000 le colonie sono state contate. Medio: rappresentante piatto 5-FOA seguente replica-placcatura da una piastra di SC-suo co-trasformazione dopo una incubazione di 2 giorni a 30 ° C. I campioni 1 e 2 sono stati considerati candidati per aver attraversato un evento di integrazione di successo a causa delle loro morfologie asimmetriche. Questo perché un vero sostituzione del gene URA3 con l&#39;allele hht2 è probabile che si verifichi prima (o subito dopo) una cellula trasformata è placcato sul SC-piatto e, di conseguenza, la colonia che sorgerà in quella posizione conterrà per lo più, se non esclusivamente, 5-FOA-resistancellule t - quando tale colonia è successivamente replica placcato ad una piastra 5-FOA sarà schiacciato, dando luogo ad una patch asimmetrica dall&#39;aspetto delle cellule sulla piastra. Al contrario, spontanea mutazioni nel gene URA3 che possono sorgere durante la formazione di colonie hanno maggiori probabilità di essere confinata in una piccola regione di una colonia, e quindi più probabilità di dare origine a papille quando replica placcato di una piastra 5-FOA. A destra: un rappresentante 5-FOA piastra diversa seguente replica-plating da una piastra SC-suo co-trasformazione dopo una incubazione di 3 giorni a 30 ° C. Un candidato supplementare (campione 3), così come due piccole papille sono visibili su questa piastra (campioni 4 e 5) - come papille, che sono più chiaramente visibili dopo 3 o più giorni di incubazione, sono suscettibili di rappresentare mutazioni URA3 spontanee e non l&#39;evento di integrazione desiderato. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55263/55263fig3large.jpg" target="_blank">Clicca qui per vedere</a>una versione più grande di questa figura. <img alt="Figura 4" src="/files/ftp_upload/55263/55263fig4.jpg" /> Figura 4: Analisi molecolari di campioni di integrazione Candidate. Saggio (A) PCR per identificare eventi di integrazione di successo. Rappresentazioni dei cartoni animati delle reazioni PCR utilizzati per valutare riuscita integrazione della allele mutante hht2 nel genoma: Top. In basso: gel elettroforesi analisi delle reazioni PCR utilizzando DNA genomico derivato da un ceppo selvatico HHT2 (utilizzato come controllo, corsia 2), ceppo yAAD156 ospitare la sostituzione hht2Δ :: URA3 (utilizzato come controllo, corsia 3), un candidato campione integrazione (corsia 4), ed un campione papille 5-FOA-resistenti (e quindi improbabile che rappresenti un evento di integrazione corretta, corsia 5). standard del DNA sono indicati nella corsia 1. Si noti che le dimensioni dei prodotti di PCR per il campione di integrazione candidato sono Consistent con un evento di integrazione riuscita, mentre la dimensione dei prodotti di PCR per il campione papille è coerente con una intatta locus hht2Δ :: URA3. (B) Eco RI digestione per confermare la presenza di allele mutante. Top: Rappresentazione dei cartoni animati dei frammenti di digestione attesi derivanti da una reazione di digestione Eco RI di prodotti di PCR che contengono sia la wild-type HHT2 gene o allele mutante hht2. In basso: gel di analisi elettroforesi delle reazioni digestione dei prodotti di PCR derivati da una wild-type HHT2 ceppo (corsia 2; i prodotti di PCR usati qui sono stati ricavati dallo stesso campione di quello usato in corsia 2 del pannello A) e un campione di integrazione candidato ( corsia 3, i prodotti PCR usati qui sono stati ottenuti dallo stesso campione come quello utilizzato in corsia 4 del pannello a). standard di DNA sono indicati nella corsia 1. Si noti che i modelli di digestione confermano che l&#39;AG GA mutazione è stata introdotta con successo nel genoma del candidatocampione di integrazione. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55263/55263fig4large.jpg" target="_blank">Clicca qui per vedere una versione più grande di questa figura.</a>

Watch this Scientific Journal Video about Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast at JoVE.com

Mirato alla mutagenesi in situ dei geni istonici nel lievito in erba | Genetica | Video

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

A strategy for generating mutations in histone genes at their endogenous location in Saccharomyces cerevisiae is presented.

Mirata<em&gt; In Situ</em&gt; mutagenesi dell&#39;istone geni in germogliamento lievito

We describe a PCR- and homologous recombination-based system for generating targeted mutations in histone genes in budding yeast cells. The resulting ...

targeted-in-situ-mutagenesis-of-histone-genes-in-budding-yeast

Nanyang Technological University

Research

Education

JoVE Journal

JoVE Core

Biology

Genetics

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

DNA Structure and Function

SCIENTISTS IN ACTION

15.2K Views.  Hendrix College. A strategy for generating mutations in histone genes at their endogenous location in Saccharomyces cerevisiae is presented. 

Video: Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most mutagenesis-based screens, researchers have relied on the use of toxic chemicals, carcinogens, or irradiation, which requires designated equipment, safety setup, and/or disposal of hazardous materials. We have developed a simple approach to induce heritable mutations in C. elegans using germline-expressed histone-miniSOG, a light-inducible potent generator of reactive oxygen species. This mutagenesis method is free of toxic chemicals and requires minimal laboratory safety and waste management. The induced DNA modifications include single-nucleotide changes and small deletions, and complement those caused by classical chemical mutagenesis. This methodology can also be used to induce integration of extrachromosomal transgenes. Here, we provide the details of the LED setup and protocols for standard mutagenesis and transgene integration.

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Genetically-encoded histone-miniSOG induces genome-wide heritable mutations in a blue&#160;light-dependent manner. This mutagenesis method is simple, fast, free of toxic chemicals, and well-suited for forward genetic screening and transgene integration.

Optogenetic caso Mutagenesi Utilizzando istone-miniSOG in<em&gt; C. elegans</em

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most ...

Ricerca

Genetica

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

As a promising genome editing platform, the CRISPR/Cas9 system has great potential for efficient genetic manipulation, especially for targeted integration of transgenes. However, due to the low efficiency of homologous recombination (HR) and various indel mutations of non-homologous end joining (NHEJ)-based strategies in non-dividing cells, in vivo genome editing remains a great challenge. Here, we describe a homology-mediated end joining (HMEJ)-based CRISPR/Cas9 system for efficient in vivo precise targeted integration. In this system, the targeted genome and the donor vector containing homology arms (~800 bp) flanked by single guide RNA (sgRNA) target sequences are cleaved by CRISPR/Cas9. This HMEJ-based strategy achieves efficient transgene integration in mouse zygotes, as well as in hepatocytes in vivo. Moreover, a HMEJ-based strategy offers an efficient approach for correction of fumarylacetoacetate hydrolase (Fah) mutation in the hepatocytes and rescues Fah-deficiency induced liver failure mice. Taken together, focusing on targeted integration, this HMEJ-based strategy provides a promising tool for a variety of applications, including generation of genetically modified animal models and targeted gene therapies.

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

The clustered regularly interspaced short palindromic repeats/CRISPR associated protein 9 (CRISPR/Cas9) system provides a promising tool for genetic engineering, and opens up the possibility of targeted integration of transgenes. We describe a homology-mediated end joining (HMEJ)-based strategy for efficient DNA targeted integration in vivo and targeted gene therapies using CRISPR/Cas9.

Integrazione mirata CRISPR/Cas9-mediata In Vivo usando una strategia basata su unendo fine omologia-mediata

As a promising genome editing platform, the CRISPR/Cas9 system has great potential for efficient genetic manipulation, especially for targeted integration ...

Gene-targeted Random Mutagenesis to Select Heterochromatin-destabilizing Proteasome Mutants in Fission Yeast

Random mutagenesis of a target gene is commonly used to identify mutations that yield the desired phenotype. Of the methods that may be used to achieve random mutagenesis, error-prone PCR is a convenient and efficient strategy for generating a diverse pool of mutants (i.e., a mutant library). Error-prone PCR is the method of choice when a researcher seeks to mutate a pre-defined region, such as the coding region of a gene while leaving other genomic regions unaffected. After the mutant library is amplified by error-prone PCR, it must be cloned into a suitable plasmid. The size of the library generated by error-prone PCR is constrained by the efficiency of the cloning step. However, in the fission yeast, Schizosaccharomyces pombe, the cloning step can be replaced by the use of a highly efficient one-step fusion PCR to generate constructs for transformation. Mutants of desired phenotypes may then be selected using appropriate reporters. Here, we describe this strategy in detail, taking as an example, a reporter inserted at centromeric heterochromatin.

This article describes a detailed methodology for random mutagenesis of a target gene in fission yeast. As an example, we target rpt4+, which encodes a subunit of the 19S proteasome, and screen for mutations that destabilize heterochromatin.

Gene targeting mutagenesi casuale per selezionare eterocromatina-destabilizzare Proteasome mutanti in lievito di fissione

Random mutagenesis of a target gene is commonly used to identify mutations that yield the desired phenotype. Of the methods that may be used to achieve ...

Visualization of Microbiota in Tick Guts by Whole-mount In Situ Hybridization

Infectious diseases transmitted by arthropod vectors continue to pose a significant threat to human health worldwide. The pathogens causing these diseases, do not exist in isolation when they colonize the vector; rather, they likely engage in interactions with resident microorganisms in the gut lumen. The vector microbiota has been demonstrated to play an important role in pathogen transmission for several vector-borne diseases. Whether resident bacteria in the gut of the Ixodes scapularis tick, the vector of several human pathogens including Borrelia burgdorferi, influence tick transmission of pathogens is not determined. We require methods for characterizing the composition of the bacteria associated with the tick gut to facilitate a better understanding of potential interspecies interactions in the tick gut. Using whole-mount in situ hybridization to visualize RNA transcripts associated with particular bacterial species allows for the collection of qualitative data regarding the abundance and distribution of the microbiota in intact tissue. This technique can be used to examine changes in the gut microbiota milieu over the course of tick feeding and can also be applied to analyze expression of tick genes. Staining of whole tick guts yield information about the gross spatial distribution of target RNA in the tissue without the need for three-dimensional reconstruction and is less affected by environmental contamination, which often confounds the sequencing-based methods frequently used to study complex microbial communities. Overall, this technique is a valuable tool that can be used to better understand vector-pathogen-microbiota interactions and their role in disease transmission.

Visualization of Microbiota in Tick Guts by Whole-mount In Situ Hybridization

Here, we present a protocol to spatially and temporally assess the presence of viable microbiota in tick guts using a modified whole-mount in situ hybridization approach.

Visualizzazione del Microbiota in Tick budella di intero-monta In Situ di ibridazione

Infectious diseases transmitted by arthropod vectors continue to pose a significant threat to human health worldwide. The pathogens causing these ...

Single Molecule Fluorescence In Situ Hybridization (smFISH) Analysis in Budding Yeast Vegetative Growth and Meiosis

Single molecule fluorescence in situ hybridization (smFISH) is a powerful technique to study gene expression in single cells due to its ability to detect and count individual RNA molecules. Complementary to deep sequencing-based methods, smFISH provides information about the cell-to-cell variation in transcript abundance and the subcellular localization of a given RNA. Recently, we have used smFISH to study the expression of the gene&#160;NDC80&#160;during meiosis in budding yeast, in which two transcript isoforms exist and the short transcript isoform has its entire sequence shared with the long isoform. To confidently identify each transcript isoform, we optimized known smFISH protocols and obtained high consistency and quality of smFISH data for the samples acquired during budding yeast meiosis. Here, we describe this optimized protocol, the criteria that we use to determine whether high quality of smFISH data is obtained, and some tips for implementing this protocol in&#160;other yeast strains and growth conditions.

Single Molecule Fluorescence In Situ Hybridization smFISH Analysis in Budding Yeast Vegetative Growth and Meiosis

This single molecule fluorescence in situ hybridization protocol is optimized to quantify the number of RNA molecules in budding yeast during vegetative growth and meiosis.

Singola molecola l'ibridazione In Situ (smFISH) analisi in crescita vegetativa lievito germogliante e meiosi

Single molecule fluorescence in situ hybridization (smFISH) is a powerful technique to study gene expression in single cells due to its ability to detect ...

Mating-based Overexpression Library Screening in Yeast

Budding yeast has been widely used as a model in studying proteins associated with human diseases. Genome-wide genetic screening is a powerful tool commonly used in yeast studies. The expression of a number of neurodegenerative disease-associated proteins in yeast causes cytotoxicity and aggregate formation, recapitulating findings seen in patients with these disorders. Here, we describe a method for screening a yeast model of the Amyotrophic Lateral Sclerosis-associated protein FUS for modifiers of its toxicity. Instead of using transformation, this new screening platform relies on the mating of yeast to introduce an arrayed library of plasmids into the yeast model. The mating method has two clear advantages: first, it is highly efficient; second, the pre-transformed arrayed library of plasmids can be stored for long-term as a glycerol stock, and quickly applied to other screens without the labor-intensive step of transformation into the yeast model each time. We demonstrate how this method can successfully be used to screen for genes that modify the toxicity of FUS.

This article presents a mating-based method to facilitate overexpression screening in budding yeast using an arrayed plasmid library.

Sovraespressione di accoppiamento-based Library Screening in lievito

Budding yeast has been widely used as a model in studying proteins associated with human diseases. Genome-wide genetic screening is a powerful tool ...

Characterizing Histone Post-translational Modification Alterations in Yeast Neurodegenerative Proteinopathy Models

Neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and Parkinson&#39;s disease (PD), cause the loss of hundreds of thousands of lives each year. Effective treatment options able to halt disease progression are lacking. Despite the extensive sequencing efforts in large patient populations, the majority of ALS and PD cases remain unexplained by genetic mutations alone. Epigenetics mechanisms, such as the post-translational modification of histone proteins, may be involved in neurodegenerative disease etiology and progression and lead to new targets for pharmaceutical intervention. Mammalian in vivo and in vitro models of ALS and PD are costly and often require prolonged and laborious experimental protocols. Here, we outline a practical, fast, and cost-effective approach to determining genome-wide alterations in histone modification levels using Saccharomyces cerevisiae as a model system. This protocol allows for comprehensive investigations into epigenetic changes connected to neurodegenerative proteinopathies that corroborate previous findings in different model systems while significantly expanding our knowledge of the neurodegenerative disease epigenome.

This protocol outlines experimental procedures to characterize genome-wide changes in the levels of histone post-translational modifications (PTM) occurring in connection with the overexpression of proteins associated with ALS and Parkinson&#39;s disease in Saccharomyces cerevisiae models. After SDS-PAGE separation, individual histone PTM levels are detected with modification-specific antibodies via Western blotting.

Alterazioni di modificazione post-traduzionale istone caratterizzante nel lievito Neurodegenerative Proteinopathy modelli

Neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and Parkinson&#39;s disease (PD), cause the loss of hundreds of thousands of lives ...

In Vivo Forward Genetic Screen to Identify Novel Neuroprotective Genes in Drosophila melanogaster

There is much to understand about the onset and progression of neurodegenerative diseases, including the underlying genes responsible. Forward genetic screening using chemical mutagens is a useful strategy for mapping mutant phenotypes to genes among Drosophila and other model organisms that share conserved cellular pathways with humans. If the mutated gene of interest is not lethal in early developmental stages of flies, a climbing assay can be conducted to screen for phenotypic indicators of decreased brain functioning, such as low climbing rates. Subsequently, secondary histological analysis of brain tissue can be performed in order to verify the neuroprotective function of the gene by scoring neurodegeneration phenotypes. Gene mapping strategies include meiotic and deficiency mapping that rely on these same assays can be followed by DNA sequencing to identify possible nucleotide changes in the gene of interest.

In Vivo Forward Genetic Screen to Identify Novel Neuroprotective Genes in Drosophila melanogaster

We present a protocol using a forward genetic approach to screen for mutants exhibiting neurodegeneration in Drosophila melanogaster. It incorporates a climbing assay, histology analysis, gene mapping and DNA sequencing to ultimately identify novel genes related to the process of neuroprotection.

In Vivo Avanti Schermo Genetico per Identificare Nuovi Geni Neuroprotettivi in Drosophila melanogaster

There is much to understand about the onset and progression of neurodegenerative diseases, including the underlying genes responsible. Forward genetic ...

Expression, Purification, and Liposome Binding of Budding Yeast SNX-BAR Heterodimers

SNX-BAR proteins are an evolutionarily conserved class of membrane remodeling proteins that play key roles in sorting and trafficking of protein and lipids during endocytosis, sorting within the endosomal system, and autophagy. Central to SNX-BAR protein function is the ability to form homodimers or heterodimers that bind membranes using highly conserved phox-homology (PX) and BAR (Bin/Amphiphysin/Rvs) domains. In addition, oligomerization of SNX-BAR dimers on membranes can elicit the formation of membrane tubules and vesicles and this activity is thought to reflect their functions as coat proteins for endosome-derived transport carriers. Researchers have long utilized in vitro binding studies using recombinant SNX-BAR proteins on synthetic liposomes or giant unilamellar vesicles (GUVs) to reveal the precise makeup of lipids needed to drive membrane remodeling, thus revealing their mechanism of action. However, due to technical challenges with dual expression systems, toxicity of SNX-BAR protein expression in bacteria, and poor solubility of individual SNX-BAR proteins, most studies to date have examined SNX-BAR homodimers, including non-physiological dimers that form during expression in bacteria. Recently, we have optimized a protocol to overcome the major shortcomings of a typical bacterial expression system. Using this workflow, we demonstrate how to successfully express and purify large amounts of SNX-BAR heterodimers and how to reconstitute them on synthetic liposomes for binding and tubulation assays.

Here, we present a workflow for the expression, purification and liposome binding of SNX-BAR heterodimers in yeast.

Espressione, purificazione e rilegatura lipososo di eterodimeri SNX-BAR

SNX-BAR proteins are an evolutionarily conserved class of membrane remodeling proteins that play key roles in sorting and trafficking of protein and ...

Identification of Host Pathways Targeted by Bacterial Effector Proteins using Yeast Toxicity and Suppressor Screens

Intracellular bacteria secrete virulence factors called effector proteins into the host cytosol that act to subvert host proteins and/or their associated biological pathways to the benefit of the bacterium. Identification of putative bacterial effector proteins has become more manageable due to advances in bacterial genome sequencing and the advent of algorithms that allow in silico identification of genes encoding secretion candidates and/or eukaryotic-like domains. However, identification of these important virulence factors is only an initial step. Naturally, the goal is to determine the molecular function of effector proteins and elucidate how they interact with the host. In recent years, techniques like the yeast two-hybrid screen and large-scale immunoprecipitations coupled with mass spectrometry have aided in the identification of protein-protein interactions. Although identification of a host binding partner is the crucial first step toward elucidating the molecular function of a bacterial effector protein, sometimes the host protein is found to have multiple biological functions (e.g., actin, clathrin, tubulin), or the bacterial protein may not physically bind host proteins, depriving the researcher of crucial information about the precise host pathway being manipulated. A modified yeast toxicity screen coupled with a suppressor screen has been adapted to identify host pathways impacted by bacterial effector proteins. The toxicity screen relies on a toxic effect in yeast caused by the effector protein interfering with the host biological pathways, which often manifests as a growth defect. Expression of a yeast genomic library is used to identify host factors that suppress the toxicity of the bacterial effector protein and thus identify proteins in the pathway that the effector protein targets. This protocol contains detailed instructions for both the toxicity and suppressor screens. These techniques can be performed in any lab capable of molecular cloning and cultivation of yeast and Escherichia coli.

Bacterial pathogens secrete proteins into the host that target crucial biological processes. Identifying the host pathways targeted by bacterial effector proteins is key to addressing molecular pathogenesis. Here, a method using a modified yeast suppressor and toxicity screen to elucidate host pathways targeted by toxic bacterial effector proteins is described.

Identificazione dei percorsi host mirati dalle proteine degli effetti batterici utilizzando la tossicità del lievito e gli schermi soppressori

Intracellular bacteria secrete virulence factors called effector proteins into the host cytosol that act to subvert host proteins and/or their associated ...