We thank Reine Protacio for helpful comments during the preparation of this manuscript. We express our gratitude to the National Science Foundation (grants nos. 1243680 and 1613754) and the Hendrix College Odyssey Program for funding support.

<ol>
	<li>Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., Richmond, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+nucleosome+core+particle+at+2.8+A+resolution.">Crystal structure of the nucleosome core particle at 2.8 A resolution.</a> Nature. 389 (6648), 251-260 (1997).</li><li>Campos, E. I., Reinberg, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histones:+annotating+chromatin.">Histones: annotating chromatin.</a> Annu Rev Genet. 43, 559-599 (2009).</li><li>Rando, O. J., Winston, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+and+transcription+in+yeast.">Chromatin and transcription in yeast.</a> Genetics. 190 (2), 351-387 (2012).</li><li>Duina, A. A., Miller, M. E., Keeney, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Budding+yeast+for+budding+geneticists:+a+primer+on+the+Saccharomyces+cerevisiae+model+system.">Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system.</a> Genetics. 197 (1), 33-48 (2014).</li><li>Storici, F., Resnick, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delitto+perfetto+targeted+mutagenesis+in+yeast+with+oligonucleotides.">Delitto perfetto targeted mutagenesis in yeast with oligonucleotides.</a> Genet Eng (N Y). 25, 189-207 (2003).</li><li>Gray, M., Kupiec, M., Honigberg, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Site-specific+genomic+(SSG)+and+random+domain-localized+(RDL)+mutagenesis+in+yeast.">Site-specific genomic (SSG) and random domain-localized (RDL) mutagenesis in yeast.</a> BMC Biotechnol. 4, 7 (2004).</li><li>Erdeniz, N., Mortensen, U. H., Rothstein, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning-free+PCR-based+allele+replacement+methods.">Cloning-free PCR-based allele replacement methods.</a> Genome Res. 7 (12), 1174-1183 (1997).</li><li>Brachmann, C. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Designer+deletion+strains+derived+from+Saccharomyces+cerevisiae+S288C:+a+useful+set+of+strains+and+plasmids+for+PCR-mediated+gene+disruption+and+other+applications.">Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications.</a> Yeast. 14 (2), 115-132 (1998).</li><li>Lundblad, V., Hartzog, G., Moqtaderi, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Manipulation+of+cloned+yeast+DNA.">Manipulation of cloned yeast DNA.</a> Curr Protoc Mol Biol. Chapter 13, (2001).</li><li>Hoffman, C. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+yeast+DNA.">Preparation of yeast DNA.</a> Curr Protoc Mol Biol. Chapter 13, (2001).</li><li>Treco, D. A., Lundblad, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+yeast+media.">Preparation of yeast media.</a> Curr Protoc Mol Biol. Chapter 13, (2001).</li><li>Lederberg, J., Lederberg, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replica+plating+and+indirect+selection+of+bacterial+mutants.">Replica plating and indirect selection of bacterial mutants.</a> J Bacteriol. 63 (3), 399-406 (1952).</li><li>Sikorski, R. S., Hieter, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+system+of+shuttle+vectors+and+yeast+host+strains+designed+for+efficient+manipulation+of+DNA+in+Saccharomyces+cerevisiae.">A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.</a> Genetics. 122 (1), 19-27 (1989).</li><li>Johnson, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+systematic+mutational+analysis+of+a+histone+H3+residue+in+budding+yeast+provides+insights+into+chromatin+dynamics.">A systematic mutational analysis of a histone H3 residue in budding yeast provides insights into chromatin dynamics.</a> G3 (Bethesda). 5 (5), 741-749 (2015).</li><li>DiCarlo, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+in+Saccharomyces+cerevisiae+using+CRISPR-Cas+systems.">Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems.</a> Nucleic Acids Res. 41 (7), 4336-4343 (2013).</li><li>Cross, S. L., Smith, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+the+structure+and+cell+cycle+expression+of+mRNAs+encoded+by+two+histone+H3-H4+loci+in+Saccharomyces+cerevisiae.">Comparison of the structure and cell cycle expression of mRNAs encoded by two histone H3-H4 loci in Saccharomyces cerevisiae.</a> Mol Cell Biol. 8 (2), 945-954 (1988).</li><li>Libuda, D. E., Winston, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amplification+of+histone+genes+by+circular+chromosome+formation+in+Saccharomyces+cerevisiae.">Amplification of histone genes by circular chromosome formation in Saccharomyces cerevisiae.</a> Nature. 443 (7114), 1003-1007 (2006).</li></ol>

The authors declare that they have no competing financial interests.

Die hohe Sequenzhomologie zwischen den zwei nicht allele Gene , die für jeden der vier Kern Histon - Proteine in haploiden S. cerevisiae - Zellen eine Herausforderung für die Forscher darstellen können , die wünschen speziell für die Mutagenese eines der beiden Gene abzuzielen. Zuvor Hefe Mutagenese Methodologien beschrieben, einschließlich der Delitto Perfetto, ortsspezifischen genomischen (SSG) Mutagenese und Klonierung freien PCR-basierten Allelaustausch Methoden 5, 6, 7, sowie neuere Hefe CRISPR-basierte Techniken 15, häufig angewiesen zumindest teilweise auf Sequenzen innerhalb des ORF eines Zielgens die Rekombination oder Reparatur Maschinen zur gewünschten genomischen Ort schließlich erzeugen das endgültige mutiertes Allel zu rekrutieren. Auf der anderen Seite ist die Strategie, die wir hier vorgestellt haben macht von DNA Sequenzen, die die gezielte ORF flankieren die homologo fahrenus Rekombinationsereignis für die Integration der Mutation erforderlich, und als Ergebnis ermöglicht eine spezifische Targeting eines Gens gegenüber einer anderen, trotz der beiden Gene in hohem Maße homolog ORFs aufweist. Diese Eigenschaft macht unsere Strategie besonders gut geeignet für Histon-Mutagenese. Jedoch kann diese Strategie auch für die Mutagenese anderer Gene in das Hefegenom angepasst werden. Zusätzliche Merkmale unserer Strategie umfassen die Tatsachen, daß die Längen der Bereiche, die homologe Rekombination der mutierten Gene Antrieb kann so gestaltet werden sehr umfangreich zu sein, wodurch die Effizienz der Integration an der Ziel genomischen Ort erhöht und dass neben der gewünschten Mutation (en ) keine zusätzlichen DNA-Sequenzen in das Genom eingebracht. Ein weiterer Vorteil dieses Systems ist , dass , sobald eine Belastung eines spezifischen Histon - Gen URA3 mit beherberge Ersatz konstruiert worden ist , kann es für die Erzeugung jeder gewünschten mutanten Version dieser bestimmten hist verwendet werdenein Gen. So kann zum Beispiel der Stamm yAAD156, die der Forschungsgemeinschaft auf Anfrage erhältlich ist , kann verwendet werden , um jede gewünschte hht2 Mutation zu machen , ohne die Notwendigkeit des Aufbaus einer De - novo - hht2Δ :: URA3 Allel. Schließlich wird durch richtig entworfen PCR unter Verwendung von Primern, kann diese Strategie auch verwendet werden , Histon - Allele mit internen Deletionen zu erzeugen , oder mit Mutationen an mehreren Codons, solange sie relativ nahe zueinander sind (beispielsweise haben wir ein hht2 Allel codierend eine generierte H3-K56R, L61W doppelt mutierte Protein mit dieser Strategie). Die Fähigkeit, spezifisch eine von zwei hoch homolog Histon-Gene für die Mutagenese gezielt konnte in einer Reihe von verschiedenen experimentellen Bedingungen nützlich sein. Da beispielsweise die HHT1-HHF1 Gene auf verschiedenen Ebenen im Vergleich zu den HHT2-HHF2 Gene 16 ausgedrückt werden, könnte es von Interesse sein , zu bestimmen , ob eine bestimmte H3 oder H4 Mutation di verleihtfferent Phänotypen in Abhängigkeit von dem Gen aus exprimiert wird. Ein weiteres Beispiel ist ein Szenario, in dem ein Ermittler haploiden Zellen zu erzeugen wünscht eine bestimmte Histon-Mutante von beiden entsprechenden Histon-Genen, die - dies zuerst erreicht werden konnte jedes Gen unabhängig voneinander in zwei verschiedenen Stämmen Mutagenisierung, und dann Doppelmutante haploiden Zellen durch ein Kreuz zu erhalten und anschließender Isolierung der gewünschten meiotic Produkte. Noch ein weiteres Beispiel einer Mutagenese von Histonen H2A und H2B bezieht: Angesichts der Tatsache, daß zwei geringfügig unterschiedliche Isoformen von jedem Protein, das von dem entsprechenden nicht-allelischen Gen Satz codiert werden, kann ein Forscher möchte die Auswirkungen einer bestimmten H2A oder H2B Mutation zu beurteilen, der Kontext jeder Isoform. Bei Experimenten Gestaltung der HTA1 und HTB1 Loci zu mutieren (kodieren H2A und H2B, beziehungsweise), sollten die Ermittler der jüngsten Erkenntnisse bewusst sein , die zeigen , dass Stämme ein (hta1-htb1) trägt Δ rentabel sind nur if sie amplifiziert 17 den HTA2-HTB2 locus (und in der Nähe HHT1-HHF1 Locus als auch) durch die Erzeugung einer kleinen kreisförmigen Chromosom, da dies die Interpretation der Ergebnisse erschweren könnte. Wir haben kürzlich eine Version dieser Histon - Mutagenese - Strategie zu erzeugen Histon H3 Proteine exprimieren alle möglichen Aminosäuresubstitutionen in Position 61, die in der Regel besetzt durch die Aminosäure Leucin 14 verwendet. Für jene Versuche, statt yAAD156 als Ausgangsstamm für die Mutagenese verwendet, verwendeten wir Stamm yADP106, die einen Austausch des HHT2 ORF birgt sowohl mit dem URA3 und TRP1 Ernährungsmarker (statt nur URA3). Die Anwesenheit der beiden Markergenen erleichtert die Identifizierung von Kandidaten für die Integration der mutanten PCR-Produkte nach der 5-FOA-Bildschirm und Reinigungsschritt (Schritte 5 und 6 des Protokolls), die als solche candidates wurde phänotypisch Ura - und Trp -, während spontane URA3 - Mutation in Zellen mit einem Ura resultierte - Trp + -Phänotyp. yADP106 ist auch auf Anfrage, wie die Sequenz des URA3-TRP1 - Kassette, die als eine Einheit amplifiziert werden konnten und für die Mutagenese anderer Histon - Gene verwendet , um die Strategie , die hier beschrieben ist . Unfähigkeit, die gewünschten Mutanten Histon diese Strategie zu erhalten unter Verwendung einer Reihe möglicher Gründe zurückzuführen sein könnten, einschließlich der nicht ausreichenden Menge von in voller Größe PCR-Produkte für die Integrationsstufe oder einer unzureichenden Anzahl von Transformanten nach der Co-Transformationsschritt verwendet. Das erstere Problem könnte durch Bündelung größere Sätze von PCR-Reaktionen oder durch die Entwicklung unterschiedlicher Primersätze adressiert werden, die eine höhere Ausbeute an Produkt zu produzieren, während das letztgenannte Problem durch Verwendung von höheren Mengen an Plasmid-Rückgrat in der Co-Transformationsexperiment gelöst werden könnte. Although, wie bereits angedeutet, kann man dieses Verfahren verwenden, um Histon-Mutanten beherbergen zwei oder mehr Aminosäuresubstitutionen, die gezielte Aminosäuren erzeugen relativ nahe, da die jeweiligen Codons zueinander sein müssen, innerhalb des gleichen Primermoleküls befinden. Somit kann diese Strategie nicht ohne weiteres für die Erzeugung von Histonen mit mehreren Mutationen weitläufig über die Länge der Proteine ​​voneinander angeordnet angepasst werden.

Die vier Kern Histonproteine ​​H2A, H2B, H3 und H4 spielen eine zentrale Rolle in der Verdichtung, die Organisation und Funktion von eukaryotischen Chromosomen. Zwei Sätze von jeder dieser Histone bilden die Histonoktamer, ein Molekular Spule, die die Verpackung von ~ 147 Basenpaaren der DNA um sich ergeb leitet schließlich in der Bildung einer Nukleosomen 1. Nukleosomen sind aktive Teilnehmer in einer Vielzahl von Chromosom-basierte Prozesse, wie zum Beispiel die Regulation der Gen-Transkription und die Bildung von Euchromatin und Heterochromatin über Chromosomen, und als solche im Mittelpunkt intensiver Forschung im Laufe der vergangenen Jahrzehnte. Eine Anzahl von Mechanismen wurden durch die Nukleosomen beschrieben kann in einer Weise manipuliert werden, die Ausführung bestimmter Prozesse erleichtern können - diese Mechanismen posttranslationaler Modifikation von Histon-Reste, ATP-abhängige Nukleosom-Remodeling und ATP-unabhängige Nukleosom Reorganisation umfassenund Montage / Demontage 2, 3. Die Bäckerhefe Saccharomyces cerevisiae ist ein besonders leistungsfähiges Modellorganismus für das Verständnis der Histon - Funktion in Eukaryoten. Dies kann weitgehend auf dem hohen Grad der evolutionären Konservierung der Histon - Proteine in der gesamten Domäne Eukarya und amenability von Hefe von genetischen und biochemischen experimentelle Ansätze 4 auf eine Vielzahl zurückzuführen. Reverse genetische Ansätze in Hefe wurden weitgehend verwendet, um die Auswirkungen der spezifischen Histon-Mutationen zu verschiedenen Aspekten der Chromatin Biologie zu studieren. Für diese Arten von Experimenten ist es oft bevorzugt, Zellen zu verwenden, bei dem die mutanten Histone aus ihren nativen genomischen Loci exprimiert werden, als Ausdruck von autonomen Plasmide zu abnormal intrazellulären Spiegel von Histon-Proteinen (durch eine unterschiedliche Anzahl von Plasmiden in Zellen) führen kann, und gleichzeitige Veränderung der Chromatinstruktur engebungen, die letztlich die Interpretation der Ergebnisse durcheinander bringen kann. Hier beschreiben wir eine PCR-basierte Technik, die zur gezielten Mutagenese von Histon-Gene in ihrer nativen genomischen Stellen ermöglicht, die keine Klonierungsschritt und führt zur Erzeugung der gewünschten Mutation (en) ohne Überbleibsel exogenen DNA-Sequenzen in das Genom erfordert. Diese Technik nutzt die effiziente homologe Rekombinationssystem in Hefe und gemeinsam hat mehrere Funktionen mit anderen ähnlichen Techniken , die von anderen Gruppen entwickelt - insbesondere der Delitto Perfetto, ortsspezifischen genomischen (SSG) Mutagenese und Klonierung freien PCR-basierte Allel Ersatzmethoden 5, 6, 7. Jedoch hat die Technik, die wir beschreiben, einen Aspekt, dass es besonders gut geeignet für die Mutagenese von Histon-Gene macht. In haploiden Hefezellen, ist jeder der vier Core-Histone durch zwei nicht-a codiertllelic und hoch homologe Gene: zum Beispiel wird Histon H3 durch die HHT1 und HHT2 Gene kodiert, und die offenen Leserahmen (ORFs) der beiden Gene sind mehr als 90% in - Sequenz identisch. Dieser hohe Grad an Homologie kann Experimente komplizieren spezifisch eine der beiden für die Mutagenese Histon-kodierenden Gene entworfen abzuzielen. Während oft die oben genannten Verfahren die Verwendung von mindestens einigen Sequenzen innerhalb des ORF des Zielgens erfordern homologe Rekombination zu treiben, beschreiben die Technik, die wir hier macht die Verwendung von Sequenzen, die die ORFs der Histon-Gene flankieren (die viel weniger Sequenzhomologie teilen) für die Rekombinationsschritt, Steigerung somit die Wahrscheinlichkeit einer erfolgreichen Ausrichtung der Mutagenese an den gewünschten Ort. Darüber hinaus sind die homologen Regionen, die Rekombination fahren kann sehr umfangreich sein, weiter zu einer effizienten gezielte homologe Rekombination beiträgt.

<table border="0" cellpadding="0" cellspacing="0" width="1091">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:517px;">1 kb DNA Ladder (DNA standards)</td>
			<td style="width:177px;">New England BioLabs</td>
			<td style="width:128px;">N3232L</td>
			<td style="width:269px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Agarose&#160;</td>
			<td>Sigma</td>
			<td>A5093-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Boric Acid</td>
			<td>Sigma</td>
			<td>B0394-500G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">dNTP mix (10 mM each)</td>
			<td>ThermoFisher Scientific</td>
			<td>R0192</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EDTA solution (0.5M, pH 8.0)</td>
			<td>AmericanBio</td>
			<td>AB00502-01000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ethanol (200 Proof)</td>
			<td>Fisher Scientific</td>
			<td>16-100-824</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:517px;">Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA)</td>
			<td>Sigma</td>
			<td>E4884-500G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Lithium acetate dihydrate</td>
			<td>Sigma</td>
			<td>L6883-250G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MyCycler Thermal Cycler</td>
			<td>BioRad</td>
			<td>170-9703</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Poly(ethylene glycol) (PEG)</td>
			<td>Sigma</td>
			<td>P3640-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PrimeSTAR HS DNA Polymerase (high fidelity DNA polymerase)&#160; and 5X buffer</td>
			<td>Fisher Scientific</td>
			<td>50-443-960</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Salmon sperm DNA solution</td>
			<td>ThermoFisher Scientific</td>
			<td>15632-011</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sigma 7-9 (Tris base, powder form)</td>
			<td>Sigma</td>
			<td>T1378-1KG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sodium acetate trihydrate</td>
			<td>Sigma</td>
			<td>236500-500G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Supra Sieve GPG Agarose (low metling temperature agarose)</td>
			<td>AmericanBio</td>
			<td>AB00985-00100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Taq Polymerase and 10X Buffer</td>
			<td>New England BioLabs</td>
			<td>M0273X</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Toothpicks</td>
			<td>Fisher Scientific</td>
			<td>S67859</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tris-HCl (1M, pH 8.0)</td>
			<td>AmericanBio</td>
			<td>AB14043-01000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">a-D(+)-Glucose</td>
			<td>Fisher Scientific</td>
			<td>AC170080025</td>
			<td>for yeast media</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Agar</td>
			<td>Fisher Scientific</td>
			<td>DF0140-01-0</td>
			<td>for yeast media</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Peptone</td>
			<td>Fisher Scientific</td>
			<td>DF0118-07-2</td>
			<td>for YPD medium</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Yeast Extract</td>
			<td>Fisher Scientific</td>
			<td>DF0127-17-9</td>
			<td>for YPD medium</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">4-aminobenzoic acid</td>
			<td>Sigma</td>
			<td>A9878-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Adenine</td>
			<td>Sigma</td>
			<td>A8626-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glycine hydrochloride</td>
			<td>Sigma</td>
			<td>G2879-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Alanine</td>
			<td>Sigma</td>
			<td>A7627-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Arginine monohydrochloride</td>
			<td>Sigma</td>
			<td>A5131-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Asparagine monohydrate</td>
			<td>Sigma</td>
			<td>A8381-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Aspartic acid sodium salt monohydrate</td>
			<td>Sigma</td>
			<td>A6683-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Cysteine hydrochloride monohydrate</td>
			<td>Sigma</td>
			<td>C7880-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Glutamic acid hydrochloride</td>
			<td>Sigma</td>
			<td>G2128-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Glutamine</td>
			<td>Sigma</td>
			<td>G3126-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Histidine monohydrochloride monohydrate</td>
			<td>Sigma</td>
			<td>H8125-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:517px;">L-Isoleucine</td>
			<td>Sigma</td>
			<td>I2752-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Leucine</td>
			<td>Sigma</td>
			<td>L8000-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Lysine monohydrochloride</td>
			<td>Sigma</td>
			<td>L5626-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Methionine</td>
			<td>Sigma</td>
			<td>M9625-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Phenylalanine</td>
			<td>Sigma</td>
			<td>P2126-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Proline</td>
			<td>Sigma</td>
			<td>P0380-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Serine</td>
			<td>Sigma</td>
			<td>S4500-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:517px;">L-Threonine</td>
			<td>Sigma</td>
			<td>T8625-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Tryptophan</td>
			<td>Sigma</td>
			<td>T0254-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Tyrosine</td>
			<td>Sigma</td>
			<td>T3754-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">L-Valine</td>
			<td>Sigma</td>
			<td>V0500-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">myo-Inositol</td>
			<td>Sigma</td>
			<td>I5125-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Uracil</td>
			<td>Sigma</td>
			<td>U0750-100G</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ammonium Sulfate</td>
			<td>Fisher Scientific</td>
			<td>A702-500</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="18">
			<td height="18" style="height:19px;">Yeast Nitrogen Base</td>
			<td>Fisher Scientific</td>
			<td>DF0919-07-3</td>
			<td>for complete minimal dropout medium&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">5-Fluoroorotic acid (5-FOA)</td>
			<td>AmericanBio</td>
			<td>AB04067-00005</td>
			<td>for&#160; 5-FOA medium</td>
		</tr>
	</tbody>
</table>

targeted in situ mutagenesis of histone genes in budding yeast

We describe a PCR- and homologous recombination-based system for generating targeted mutations in histone genes in budding yeast cells. The resulting mutant alleles reside at their endogenous genomic sites and no exogenous DNA sequences are left in the genome following the procedure. Since in haploid yeast cells each of the four core histone proteins is encoded by two non-allelic genes with highly homologous open reading frames (ORFs), targeting mutagenesis specifically to one of two genes encoding a particular histone protein can be problematic. The strategy we describe here bypasses this problem by utilizing sequences outside, rather than within, the ORF of the target genes for the homologous recombination step. Another feature of this system is that the regions of DNA driving the homologous recombination steps can be made to be very extensive, thus increasing the likelihood of successful integration events. These features make this strategy particularly well-suited for histone gene mutagenesis, but can also be adapted for mutagenesis of other genes in the yeast genome.

Wir beschreiben die Erzeugung eines hht2 Allel ein Histon H3 mutiertes Protein beherbergt eine Substitution an Position 53 von Arginin zu einem einer Glutaminsäure (H3-R53E - Mutante) als repräsentatives Beispiel für die gezielte in - situ - Mutagenese - Strategie exprimieren. Wir erzielten einen Stamm , in dem das gesamte ORF von HHT2 durch das URA3 - Gen ersetzt (Schritt 1 des Protokolls). Dieser Stamm, yAAD156 birgt auch ein his3Δ200 Allel, die die Zellen veranlaßt auxotroph für Histidin sein. Im Anschluss an die in Schritt angegebenen Verfahren 2 des Protokolls erzielten wir dann die beiden teilweise überlappende Fragmente von HHT2. Forward Primer (OAD20): 5 &#39;GCGTTCATTATCGCCCAATGTG 3&#39; und der Reverse Primer (R53Erev): 5 &#39;GTTCAGTAGATTTTTGGAATtcTCTAATTTCTCTCAAG 3&#39; Die folgenden Primer wurden für das erste Fragment verwendet. Die folgende prForward Primer (R53Efor): 5 &#39;CTTGAGAGAAATTAGAgaATTCCAAAAATCTACTGAAC 3&#39; und der Reverse-Primer (OAD21): 5 &#39;GCGCTTGATCAGCAGTTCATCG 3&#39; IMers wurden für das zweite Fragment verwendet. Beachten Sie, dass der Reverse-Primer in der ersten Reaktion und der Forward-Primer in der zweiten Reaktion enthalten die Nukleotide gewünschte mutierte (in Kleinbuchstaben) - diese mutierten Nukleotide zwischen zwei langen Strecken von Wildtyp-Sequenzen eingebettet sind, wie dies für eine effiziente Glühen erlaubt des Primers an die Template-DNA trotz der Fehlanpassung an den mutierten Positionen. Beachten Sie auch, dass die mutierten Nukleotide in diesen beiden Primer sind revers komplementär zueinander und eine AG zu GA Mutation im Sense-Strang verursachen, was in einem AGA Codon resultiert Änderung GAA, die letztlich die R53E Mutation in dem codierten Protein produziert. Ergebnisse aus diesen PCR - Reaktionen sind in 2A gezeigt. Unter Verwendung des Verfahrens in Schritt 3, wir dann gener<html> die Full-Size-PCR-Produkte ATED. Die verwendeten Primer waren Forward Primer (OAD479): 5&#39;TATGGCTCGGTGTCAAAACA 3 &#39;und Reverse Primer (OAD480): 5&#39; CATGGTTTCTTGCCGGTTAT 3 &#39;. Wenn dieser Primer entwerfen, ist es wichtig, sicherzustellen, dass die resultierenden Fusions-PCR-Produkte mindestens 40 Basenpaare umfassen entweder endet Reaktion die homologe Rekombination zu fahren (die die Regionen der Homologie länger, desto effizienter und spezifischer die homologe Rekombination wird Sein). In unserem Experiment die Full-Size - PCR - Produkte enthielten ein 195 Basenpaar - Region und 220 Basenpaar - Region homolog zu den Regionen vor und hinter dem HHT2 ORF sind. Eine Probe dieser PCR - Produkte wurden durch Agarose - Gelelektrophorese (2B) analysiert. Die Full-Size - PCR - Produkte wurden dann zusammen mit Plasmid pRS413 co-transformiert (ein zentromerischen, markiert HIS3- Plasmidf &quot;&gt; 13) und Transformanten wurden auf Platten ohne Histidin (SC-his - Platten) ausgewählt , wie in Schritt 4 des Protokolls beschrieben. His + Kolonien wurden dann auf Widerstand 5-FOA gescreent nach den in Schritt 5 beschriebenen Verfahren des Protokolls. Abbildung 3 zeigt ein Beispiel einer Transformationsplatte (SC-sein) und 5-FOA - Platten folgende Replik-Plattierung von SC-seine Platten. Beispiele für Kandidatenproben sowie Proben unwahrscheinlich , dass die gewünschte Integrationsveranstaltungen zu repräsentieren , werden auch in Abbildung 3 in unserem Experiment., wir zwölf Kandidatenproben von ~ 90.000 Transformanten gescreent identifiziert. wurden gereinigt Diese Kandidaten dann wie in Schritt 6 des Protokolls beschrieben. Die zwölf Kandidaten wurden dann 7 des Protokolls in Schritt beschrieben zur PCR - Analyse unterzogen , um zu bewerten , ob sie authentisch Ersatz des URA3 - Gens mit mutierten PCR - Produkte wider. Für unsere experiment, verwendeten wir einen Forward Primer, die 89 Basenpaare stromaufwärts von der Integrationsstelle des PCR-Produkts und eines Reverse Primer annealt, die 302 Basenpaare stromabwärts der Integrationsstelle des PCR-Produkts anlagert. Diese Primer erzeugen PCR - Produkte von 1217 Basenpaaren in der Größe , wenn die HHT2 Locus durch HHT2 belegt ist (oder mutierte Versionen von HHT2 beherbergen Substitutionen Basenpaar) oder PCR - Produkte von 2188 Basenpaaren in Größe , wenn der Ort durch den URA3 - Marker - Gen besetzt ist . Die Sequenz des Forward Primer verwendet (OAD476) ist: 5 &#39;GAAACTATTGGCACGCCCTA und der der Reverse Primer verwendet (OAD477) ist: 5&#39; CCTGCGAATCAACCGATACT 3 &#39;. Von den zwölf Kandidaten , die wir identifiziert hatten, zeigten vier Integration eines PCR - Produkts an der richtigen Stelle (4A für ein Beispiel siehe). Schließlich, da die AG GA Mutation eine neue Eco RI - Restriktionsstelle erzeugt, wir PCR - Produkte von einem der erfolgreichen Integration Proben eine unterworfen <em&gt; Eco RI - Verdau und konnten zeigen , dass die mutierte Sequenz in der Tat in das Genom integriert worden war (siehe 4B). In diesem Fall wir die PCR - Produkte nicht - Sequenz , die zusätzliche unerwünschte Mutationen worden war , um sicherzustellen , nicht in das Genom eingebaut: Jedoch haben wir ein Verfahren sehr ähnlich wie diese verwendet , um eine große Anzahl von HHT2 Mutationen in einer letzten Studie zu erzeugen 14, und festgestellt, dass die Mehrheit der integrierten mutierten Allele keine Mutationen andere als die gewünschten Einsen tragen. <img alt="Figur 2" src="/files/ftp_upload/55263/55263fig2.jpg" /> Abbildung 2: Generierung von PCR - Produkten Beherbergung gewünschten Mutationen für die Integration in das Genom der Hefe. (A) PCR - Reaktion , die teilweise überlappenden Fragmente HHT2 beherbergen die gewünschten Mutationen zu erzeugen. Top: Cartoon Darstellung von ter zwei PCR - Reaktionen , die beiden HHT2 Fragmente zu erhalten (siehe Abbildung 1B-1). Rote Kreise stellen die mismatched Nukleotide an den Primer verwendet, um die AG zu GA-Mutation im Sense-Strang des Gens einzuführen. Unten: Gelelektrophorese Analyse der PCR - Produkte a und b (Bahnen 2 bzw. 3). DNA - Standards sind in Spur 1 (B) Fusion PCR - Reaktion gezeigt , für die Integration in Hefegenom voller Größe PCR - Produkt zu erzeugen (siehe 1B-2 gezeigt und 3). Top: Cartoon Darstellung der PCR - Reaktion und erwartete PCR - Produkt (Produkt c). Rote Kreise stellen gewünschte Mutation wie in (A) oben beschrieben. Unten: Gel - Elektrophorese - Analyse von PCR - Produkten c (Bahn 2). DNA - Standards sind in Spur 1 gezeigt <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55263/55263fig2large.jpg" target="_blank">Bitte klicken Sie hier</a> um <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55263/55263fig2large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> Abbildung 3: Repräsentative Ergebnisse aus der Co-Transformation Experiment und 5-FOA - Bildschirm. Links: Vertreter SC-seine Platte plattiert mit zur Co-Transformation unterzogen Zellen nach einem 3-tägigen Inkubation bei 30 ° C. Rund 5.000 Kolonien wurden gezählt. Mitte: Vertreter 5-FOA Platte folgende Replik-Überzug aus einem SC-sein Co-Transformationsplatte nach einer 2-tägigen Inkubation bei 30 ° C. Die Proben 1 und 2 wurden durch eine erfolgreiche Integration Veranstaltung gegangen Kandidaten betrachtet aufgrund ihrer asymmetrischen Morphologien haben. Dies ist , weil eine wahr Ersatz des URA3 - Gens mit dem hht2 Allel ist wahrscheinlich , bevor das Auftreten (oder kurz danach) eine transformierte Zelle auf der SC-his Platte und als Folge beschichtet ist, die Kolonie , die an dieser Stelle entstehen enthalten zumeist, wenn nicht ausschließlich, 5-FOA-resistanT-Zellen - wenn eine solche Kolonie ist dann anschließend replica-plattiert auf eine 5-FOA Platte wird es zerquetscht werden, Aufstieg zu geben zu einem asymmetrischen aussehenden Flecken der Zellen auf der Platte. Im Gegensatz dazu, spontan Mutationen im URA3 - Gen , das während der Koloniebildung sind eher zu beschränken innerhalb einer kleinen Region einer Kolonie und damit eher zu verursachen Papillen wenn replica-plattiert auf eine 5-FOA Platte entstehen können. Rechts: ein anderer Vertreter 5-FOA Platte folgende Replik-Überzug aus einem SC-sein Co-Transformationsplatte nach einem 3-tägigen Inkubation bei 30 ° C. Eine zusätzliche Kandidaten (Probe 3) sowie zwei kleine Papillen sind auf dieser Platte (Proben 4 und 5) - solche Papillen, die am deutlichsten sichtbar sind , nach 3 oder mehr Tagen Inkubation wahrscheinlich spontane URA3 Mutationen darstellen und nicht die gewünschte Integrationsereignis. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55263/55263fig3large.jpg" target="_blank">Bitte klicken Sie hier</a> , <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55263/55263fig3large.jpg" target="_blank">um</a>eine größere Version dieser Figur. <img alt="Abbildung 4" src="/files/ftp_upload/55263/55263fig4.jpg" /> Abbildung 4: Molekulare Analysen der Kandidaten Integration Proben. (A) PCR - Test erfolgreiche Integration Ereignisse zu identifizieren. Top: Cartoon - Darstellungen der PCR - Reaktionen verwendet , um eine erfolgreiche Integration des hht2 Allelmutante in das Genom zu bewerten. Unten: Gelelektrophorese Analyse von PCR - Reaktionen unter Verwendung von genomischer DNA aus einem HHT2 abgeleiteten Wildtyp-Stamm (als Kontrolle verwendet, Spur 2), Stamm yAAD156 beherbergt das hht2Δ :: URA3 Ersatz (als Kontrolle verwendet, Spur 3), ein Kandidat Integration Probe (Bahn 4) und eine 5-FOA-resistente Papillen Probe (und somit unwahrscheinlich, dass eine korrekte Integration Ereignis darzustellen, Spur 5). DNA-Standards sind in Spur 1. Hinweis gezeigt, dass die Größen der PCR-Produkte für den Kandidaten Integration Probe consiste sindnt mit einer erfolgreichen Integrationsereignis, während die Größe der PCR - Produkte für die Papillen Probe ist in Übereinstimmung mit einem intakten hht2Δ :: URA3 - Locus. (B) EcoRI Verdauung Vorhandensein von mutierten Allels zu bestätigen. Top: Cartoon Darstellung der erwarteten Verdauung Fragmente , abgeleitet von einem EcoRI - Verdauungsreaktion von PCR - Produkten entweder die Wildtyp - HHT2 Gen oder das mutierte hht2 Allel enthält. Unten: Gelelektrophorese Analyse der Verdauung Reaktionen von PCR - Produkten , die von einem Wildtyp HHT2 Stamm (Spur 2, die PCR - Produkte , die hier verwendet wurden aus der gleichen Probe wie in Spur 2 von Feld A verwendet abgeleitet) und ein Kandidat Integration Probe ( Spur 3, die PCR Produkte, die hier verwendet wurden aus derselben Probe abgeleitet wie die in Spur 4 von Panel A) verwendet. DNA-Standards sind in Spur 1. Hinweis gezeigt, dass die Verdauung Muster bestätigen, dass die AG GA Mutation in das Genom des Kandidaten erfolgreich eingeführt wurde,Integration Probe. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55263/55263fig4large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55263/55263fig4large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a>

Watch this Scientific Journal Video about Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast at JoVE.com

Gezielte In-situ-Mutagenese von Histon-Genen in Keimhefe | Genetik | Video

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

A strategy for generating mutations in histone genes at their endogenous location in Saccharomyces cerevisiae is presented.

Gezielt<em&gt; In Situ</em&gt; Mutagenese von Histon-Gene in Bäckerhefe

We describe a PCR- and homologous recombination-based system for generating targeted mutations in histone genes in budding yeast cells. The resulting ...

targeted-in-situ-mutagenesis-of-histone-genes-in-budding-yeast

Nanyang Technological University

Research

Education

JoVE Journal

JoVE Core

Biology

Genetics

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

DNA Structure and Function

SCIENTISTS IN ACTION

15.2K Aufrufe.  Hendrix College. A strategy for generating mutations in histone genes at their endogenous location in Saccharomyces cerevisiae is presented. 

Serie: Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most mutagenesis-based screens, researchers have relied on the use of toxic chemicals, carcinogens, or irradiation, which requires designated equipment, safety setup, and/or disposal of hazardous materials. We have developed a simple approach to induce heritable mutations in C. elegans using germline-expressed histone-miniSOG, a light-inducible potent generator of reactive oxygen species. This mutagenesis method is free of toxic chemicals and requires minimal laboratory safety and waste management. The induced DNA modifications include single-nucleotide changes and small deletions, and complement those caused by classical chemical mutagenesis. This methodology can also be used to induce integration of extrachromosomal transgenes. Here, we provide the details of the LED setup and protocols for standard mutagenesis and transgene integration.

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Genetically-encoded histone-miniSOG induces genome-wide heritable mutations in a blue&#160;light-dependent manner. This mutagenesis method is simple, fast, free of toxic chemicals, and well-suited for forward genetic screening and transgene integration.

Optogenetische Zufallsmutagenese Mit Histon-miniSOG in<em&gt; C. elegans</em

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most ...

Forschung

Genetik

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

As a promising genome editing platform, the CRISPR/Cas9 system has great potential for efficient genetic manipulation, especially for targeted integration of transgenes. However, due to the low efficiency of homologous recombination (HR) and various indel mutations of non-homologous end joining (NHEJ)-based strategies in non-dividing cells, in vivo genome editing remains a great challenge. Here, we describe a homology-mediated end joining (HMEJ)-based CRISPR/Cas9 system for efficient in vivo precise targeted integration. In this system, the targeted genome and the donor vector containing homology arms (~800 bp) flanked by single guide RNA (sgRNA) target sequences are cleaved by CRISPR/Cas9. This HMEJ-based strategy achieves efficient transgene integration in mouse zygotes, as well as in hepatocytes in vivo. Moreover, a HMEJ-based strategy offers an efficient approach for correction of fumarylacetoacetate hydrolase (Fah) mutation in the hepatocytes and rescues Fah-deficiency induced liver failure mice. Taken together, focusing on targeted integration, this HMEJ-based strategy provides a promising tool for a variety of applications, including generation of genetically modified animal models and targeted gene therapies.

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

The clustered regularly interspaced short palindromic repeats/CRISPR associated protein 9 (CRISPR/Cas9) system provides a promising tool for genetic engineering, and opens up the possibility of targeted integration of transgenes. We describe a homology-mediated end joining (HMEJ)-based strategy for efficient DNA targeted integration in vivo and targeted gene therapies using CRISPR/Cas9.

CRISPR/Cas9-vermittelten gezielte Integration In Vivo mit einer Homologie-vermittelte Ende verbinden-basierte Strategie

As a promising genome editing platform, the CRISPR/Cas9 system has great potential for efficient genetic manipulation, especially for targeted integration ...

Gene-targeted Random Mutagenesis to Select Heterochromatin-destabilizing Proteasome Mutants in Fission Yeast

Random mutagenesis of a target gene is commonly used to identify mutations that yield the desired phenotype. Of the methods that may be used to achieve random mutagenesis, error-prone PCR is a convenient and efficient strategy for generating a diverse pool of mutants (i.e., a mutant library). Error-prone PCR is the method of choice when a researcher seeks to mutate a pre-defined region, such as the coding region of a gene while leaving other genomic regions unaffected. After the mutant library is amplified by error-prone PCR, it must be cloned into a suitable plasmid. The size of the library generated by error-prone PCR is constrained by the efficiency of the cloning step. However, in the fission yeast, Schizosaccharomyces pombe, the cloning step can be replaced by the use of a highly efficient one-step fusion PCR to generate constructs for transformation. Mutants of desired phenotypes may then be selected using appropriate reporters. Here, we describe this strategy in detail, taking as an example, a reporter inserted at centromeric heterochromatin.

This article describes a detailed methodology for random mutagenesis of a target gene in fission yeast. As an example, we target rpt4+, which encodes a subunit of the 19S proteasome, and screen for mutations that destabilize heterochromatin.

Gen gezielt Random Mutagenesis Heterochromatin destabilisieren Proteasom Mutanten in Spalthefe auswählen

Random mutagenesis of a target gene is commonly used to identify mutations that yield the desired phenotype. Of the methods that may be used to achieve ...

Visualization of Microbiota in Tick Guts by Whole-mount In Situ Hybridization

Infectious diseases transmitted by arthropod vectors continue to pose a significant threat to human health worldwide. The pathogens causing these diseases, do not exist in isolation when they colonize the vector; rather, they likely engage in interactions with resident microorganisms in the gut lumen. The vector microbiota has been demonstrated to play an important role in pathogen transmission for several vector-borne diseases. Whether resident bacteria in the gut of the Ixodes scapularis tick, the vector of several human pathogens including Borrelia burgdorferi, influence tick transmission of pathogens is not determined. We require methods for characterizing the composition of the bacteria associated with the tick gut to facilitate a better understanding of potential interspecies interactions in the tick gut. Using whole-mount in situ hybridization to visualize RNA transcripts associated with particular bacterial species allows for the collection of qualitative data regarding the abundance and distribution of the microbiota in intact tissue. This technique can be used to examine changes in the gut microbiota milieu over the course of tick feeding and can also be applied to analyze expression of tick genes. Staining of whole tick guts yield information about the gross spatial distribution of target RNA in the tissue without the need for three-dimensional reconstruction and is less affected by environmental contamination, which often confounds the sequencing-based methods frequently used to study complex microbial communities. Overall, this technique is a valuable tool that can be used to better understand vector-pathogen-microbiota interactions and their role in disease transmission.

Visualization of Microbiota in Tick Guts by Whole-mount In Situ Hybridization

Here, we present a protocol to spatially and temporally assess the presence of viable microbiota in tick guts using a modified whole-mount in situ hybridization approach.

Visualisierung der Mikrobiota in Tick Mut durch ganze-Mount In Situ Hybridisierung

Infectious diseases transmitted by arthropod vectors continue to pose a significant threat to human health worldwide. The pathogens causing these ...

Single Molecule Fluorescence In Situ Hybridization (smFISH) Analysis in Budding Yeast Vegetative Growth and Meiosis

Single molecule fluorescence in situ hybridization (smFISH) is a powerful technique to study gene expression in single cells due to its ability to detect and count individual RNA molecules. Complementary to deep sequencing-based methods, smFISH provides information about the cell-to-cell variation in transcript abundance and the subcellular localization of a given RNA. Recently, we have used smFISH to study the expression of the gene&#160;NDC80&#160;during meiosis in budding yeast, in which two transcript isoforms exist and the short transcript isoform has its entire sequence shared with the long isoform. To confidently identify each transcript isoform, we optimized known smFISH protocols and obtained high consistency and quality of smFISH data for the samples acquired during budding yeast meiosis. Here, we describe this optimized protocol, the criteria that we use to determine whether high quality of smFISH data is obtained, and some tips for implementing this protocol in&#160;other yeast strains and growth conditions.

Single Molecule Fluorescence In Situ Hybridization smFISH Analysis in Budding Yeast Vegetative Growth and Meiosis

This single molecule fluorescence in situ hybridization protocol is optimized to quantify the number of RNA molecules in budding yeast during vegetative growth and meiosis.

Einzigen Molekül Fluoreszenz In Situ Hybridisierung (SmFISH) Analyse in Knospen Hefe vegetativen Wachstums und Meiose

Single molecule fluorescence in situ hybridization (smFISH) is a powerful technique to study gene expression in single cells due to its ability to detect ...

Mating-based Overexpression Library Screening in Yeast

Budding yeast has been widely used as a model in studying proteins associated with human diseases. Genome-wide genetic screening is a powerful tool commonly used in yeast studies. The expression of a number of neurodegenerative disease-associated proteins in yeast causes cytotoxicity and aggregate formation, recapitulating findings seen in patients with these disorders. Here, we describe a method for screening a yeast model of the Amyotrophic Lateral Sclerosis-associated protein FUS for modifiers of its toxicity. Instead of using transformation, this new screening platform relies on the mating of yeast to introduce an arrayed library of plasmids into the yeast model. The mating method has two clear advantages: first, it is highly efficient; second, the pre-transformed arrayed library of plasmids can be stored for long-term as a glycerol stock, and quickly applied to other screens without the labor-intensive step of transformation into the yeast model each time. We demonstrate how this method can successfully be used to screen for genes that modify the toxicity of FUS.

This article presents a mating-based method to facilitate overexpression screening in budding yeast using an arrayed plasmid library.

Paarung-basierte Überexpression Bibliothek Screening in der Hefe

Budding yeast has been widely used as a model in studying proteins associated with human diseases. Genome-wide genetic screening is a powerful tool ...

Characterizing Histone Post-translational Modification Alterations in Yeast Neurodegenerative Proteinopathy Models

Neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and Parkinson&#39;s disease (PD), cause the loss of hundreds of thousands of lives each year. Effective treatment options able to halt disease progression are lacking. Despite the extensive sequencing efforts in large patient populations, the majority of ALS and PD cases remain unexplained by genetic mutations alone. Epigenetics mechanisms, such as the post-translational modification of histone proteins, may be involved in neurodegenerative disease etiology and progression and lead to new targets for pharmaceutical intervention. Mammalian in vivo and in vitro models of ALS and PD are costly and often require prolonged and laborious experimental protocols. Here, we outline a practical, fast, and cost-effective approach to determining genome-wide alterations in histone modification levels using Saccharomyces cerevisiae as a model system. This protocol allows for comprehensive investigations into epigenetic changes connected to neurodegenerative proteinopathies that corroborate previous findings in different model systems while significantly expanding our knowledge of the neurodegenerative disease epigenome.

This protocol outlines experimental procedures to characterize genome-wide changes in the levels of histone post-translational modifications (PTM) occurring in connection with the overexpression of proteins associated with ALS and Parkinson&#39;s disease in Saccharomyces cerevisiae models. After SDS-PAGE separation, individual histone PTM levels are detected with modification-specific antibodies via Western blotting.

Charakterisierung von Histon Post-translationale Modifikation Veränderungen in Hefe Neurodegenerative Proteinopathy Modelle

Neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and Parkinson&#39;s disease (PD), cause the loss of hundreds of thousands of lives ...

In Vivo Forward Genetic Screen to Identify Novel Neuroprotective Genes in Drosophila melanogaster

There is much to understand about the onset and progression of neurodegenerative diseases, including the underlying genes responsible. Forward genetic screening using chemical mutagens is a useful strategy for mapping mutant phenotypes to genes among Drosophila and other model organisms that share conserved cellular pathways with humans. If the mutated gene of interest is not lethal in early developmental stages of flies, a climbing assay can be conducted to screen for phenotypic indicators of decreased brain functioning, such as low climbing rates. Subsequently, secondary histological analysis of brain tissue can be performed in order to verify the neuroprotective function of the gene by scoring neurodegeneration phenotypes. Gene mapping strategies include meiotic and deficiency mapping that rely on these same assays can be followed by DNA sequencing to identify possible nucleotide changes in the gene of interest.

In Vivo Forward Genetic Screen to Identify Novel Neuroprotective Genes in Drosophila melanogaster

We present a protocol using a forward genetic approach to screen for mutants exhibiting neurodegeneration in Drosophila melanogaster. It incorporates a climbing assay, histology analysis, gene mapping and DNA sequencing to ultimately identify novel genes related to the process of neuroprotection.

In Vivo Forward Genetic Screen zur Identifizierung neuartiger neuroprotektive gene in Drosophila melanogaster

There is much to understand about the onset and progression of neurodegenerative diseases, including the underlying genes responsible. Forward genetic ...

Expression, Purification, and Liposome Binding of Budding Yeast SNX-BAR Heterodimers

SNX-BAR proteins are an evolutionarily conserved class of membrane remodeling proteins that play key roles in sorting and trafficking of protein and lipids during endocytosis, sorting within the endosomal system, and autophagy. Central to SNX-BAR protein function is the ability to form homodimers or heterodimers that bind membranes using highly conserved phox-homology (PX) and BAR (Bin/Amphiphysin/Rvs) domains. In addition, oligomerization of SNX-BAR dimers on membranes can elicit the formation of membrane tubules and vesicles and this activity is thought to reflect their functions as coat proteins for endosome-derived transport carriers. Researchers have long utilized in vitro binding studies using recombinant SNX-BAR proteins on synthetic liposomes or giant unilamellar vesicles (GUVs) to reveal the precise makeup of lipids needed to drive membrane remodeling, thus revealing their mechanism of action. However, due to technical challenges with dual expression systems, toxicity of SNX-BAR protein expression in bacteria, and poor solubility of individual SNX-BAR proteins, most studies to date have examined SNX-BAR homodimers, including non-physiological dimers that form during expression in bacteria. Recently, we have optimized a protocol to overcome the major shortcomings of a typical bacterial expression system. Using this workflow, we demonstrate how to successfully express and purify large amounts of SNX-BAR heterodimers and how to reconstitute them on synthetic liposomes for binding and tubulation assays.

Here, we present a workflow for the expression, purification and liposome binding of SNX-BAR heterodimers in yeast.

Expression, Reinigung und Liposomenbindung von angehenden Hefe-SNX-BAR-Heterodimeren

SNX-BAR proteins are an evolutionarily conserved class of membrane remodeling proteins that play key roles in sorting and trafficking of protein and ...

Identification of Host Pathways Targeted by Bacterial Effector Proteins using Yeast Toxicity and Suppressor Screens

Intracellular bacteria secrete virulence factors called effector proteins into the host cytosol that act to subvert host proteins and/or their associated biological pathways to the benefit of the bacterium. Identification of putative bacterial effector proteins has become more manageable due to advances in bacterial genome sequencing and the advent of algorithms that allow in silico identification of genes encoding secretion candidates and/or eukaryotic-like domains. However, identification of these important virulence factors is only an initial step. Naturally, the goal is to determine the molecular function of effector proteins and elucidate how they interact with the host. In recent years, techniques like the yeast two-hybrid screen and large-scale immunoprecipitations coupled with mass spectrometry have aided in the identification of protein-protein interactions. Although identification of a host binding partner is the crucial first step toward elucidating the molecular function of a bacterial effector protein, sometimes the host protein is found to have multiple biological functions (e.g., actin, clathrin, tubulin), or the bacterial protein may not physically bind host proteins, depriving the researcher of crucial information about the precise host pathway being manipulated. A modified yeast toxicity screen coupled with a suppressor screen has been adapted to identify host pathways impacted by bacterial effector proteins. The toxicity screen relies on a toxic effect in yeast caused by the effector protein interfering with the host biological pathways, which often manifests as a growth defect. Expression of a yeast genomic library is used to identify host factors that suppress the toxicity of the bacterial effector protein and thus identify proteins in the pathway that the effector protein targets. This protocol contains detailed instructions for both the toxicity and suppressor screens. These techniques can be performed in any lab capable of molecular cloning and cultivation of yeast and Escherichia coli.

Bacterial pathogens secrete proteins into the host that target crucial biological processes. Identifying the host pathways targeted by bacterial effector proteins is key to addressing molecular pathogenesis. Here, a method using a modified yeast suppressor and toxicity screen to elucidate host pathways targeted by toxic bacterial effector proteins is described.

Identifizierung von Wirtspfaden, die von bakteriellen Effektorproteinen mit Hefetoxizität und Suppressor-Screens gezielt werden

Intracellular bacteria secrete virulence factors called effector proteins into the host cytosol that act to subvert host proteins and/or their associated ...