The authors wish to thank Kami Harris for primer design, Ashley McKibbon and Jessica Thomas-Ebbett for filming, and John Blakely, Alexandra Foley-Eby, Chris Langley, Julie Lewis, Kelsey McIntyre, Ashley McKibbon, Chris Zinck, and Rosie the dog for appearing in the video. A. M. K. was supported by the Canadian Lyme Disease Research Foundation, and project funding was provided by the Natural Sciences and Engineering Research Council of Canada (NSERC). M. K. B. W. received salary funding from the New Brunswick Innovation Foundation (NBIF).

1. DNA Isolation from Ticks
<ol>
	<li>Acquire ticks via field collection, or passive surveillance from veterinarians and members of the public. Ticks should be killed by freezing, placed in a sealed bag, and mailed at room temperature.
	<ol>
		<li>Using a submission form, gather information on the date and geographic location of the encounter, tick attachment status, host species, and recent travel history of the host.</li>
		<li>Since nested PCR is inherently vulnerable to contamination, ensure that the laboratory workspace is set up to minimize cross-exposure of samples. This involves executing different elements of the protocol in separate, dedicated spaces well isolated from each other that are thoroughly cleaned and sterilized, and ensuring that all instruments are free of contaminants.</li>
		<li>Upon receiving the specimen, photograph the tick and determine species, developmental stage, sex, and engorgement status by comparison to an identification key32 .</li>
		<li>Under aseptic conditions, bisect the tick using a sterile razor blade or scalpel, and place the two tick fragments into separate microcentrifuge tubes.</li>
	</ol>
	</li>
	<li>To extract total DNA, use any isolation procedure that yields PCR-compatible template; this protocol demonstrates a simple chelation-based approach.
	<ol>
		<li>Begin by adding an appropriate volume (often between 50 - 200 &#181;L) of a lytic chelation reagent to the tick fragment. The specific amount will depend on the specimen size and engorgement status; guidelines should be provided by the manufacturer. Homogenize using a microtube pestle.</li>
		<li>Incubate samples in a water bath at 60 &#176;C for 45 min, and vortex briefly.</li>
		<li>Centrifuge samples for 4 min at 16,276 x g (13,300 rpm) in a desktop microcentrifuge.</li>
		<li>Transfer supernatant to a fresh, labeled microtube containing 50 &#181;L isopropanol, mix by inversion, and re-centrifuge as in (1.2.3).</li>
		<li>Decant the supernatant, and rinse the DNA pellet with 50 &#181;L of 70% ethanol.</li>
		<li>Remove excess ethanol with a pipette, and allow the pellet to air-dry for 15 min at room temperature.</li>
		<li>To resuspend DNA, add 50 &#181;L of 1 mM Tris pH 7.0, and incubate samples in a water bath for 1 h at 60 &#176;C. The DNA can now be stored at -20 &#176;C for future molecular analysis.</li>
	</ol>
	</li>
</ol>
2. Nested PCR Detection of Borrelia OspA and FlaB.
NOTE: An overview of general PCR principles and practices is provided by Lorenz, 201233.
<ol>
	<li>Synthesize or obtain Borrelia gene-specific outer and inner oligonucleotide primers. See Table 1 for primer sets, their respective amplicon sizes, and melting temperatures.</li>
</ol>
<table border="1">
	<tbody>
		<tr>
			<td>Primer Name</td>
			<td>Gene Target</td>
			<td colspan="2">Sequence (5&#8217;-3&#8217;)</td>
			<td>Amplicon Size</td>
			<td>Annealing Temperature</td>
		</tr>
		<tr>
			<td>FlaB Out Fw</td>
			<td>FlaB</td>
			<td colspan="2">gcatcactttcagggtctca</td>
			<td rowspan="2">503 bp</td>
			<td rowspan="2">55&#176;C</td>
		</tr>
		<tr>
			<td>FlaB Out Rv</td>
			<td>FlaB</td>
			<td colspan="2">tggggaacttgattagcctg</td>
		</tr>
		<tr>
			<td>FlaB In Fw</td>
			<td>FlaB</td>
			<td colspan="2">ctttaagagttcatgttggag</td>
			<td rowspan="2">447 bp</td>
			<td rowspan="2">58&#176;C</td>
		</tr>
		<tr>
			<td>FlaB In Rv</td>
			<td>FlaB</td>
			<td colspan="2">tcattgccattgcagattgt</td>
		</tr>
		<tr>
			<td>OspA Out Fw</td>
			<td>OspA</td>
			<td colspan="2">cttgaagttttcaaagaagat</td>
			<td rowspan="2">487 bp</td>
			<td rowspan="2">55&#176;C</td>
		</tr>
		<tr>
			<td>OspA Out Rv</td>
			<td>OspA</td>
			<td colspan="2">caactgctgacccctctaat</td>
		</tr>
		<tr>
			<td>OspA In Fw</td>
			<td>OspA</td>
			<td colspan="2">acaagagcagacggaaccag</td>
			<td rowspan="2">350 bp</td>
			<td rowspan="2">58&#176;C</td>
		</tr>
		<tr>
			<td>OspA In Rv</td>
			<td>OspA</td>
			<td colspan="2">ttggtgccatttgagtcgta</td>
		</tr>
	</tbody>
</table>
Table 1: Inner and outer primers for nPCR of Borrelia burgdorferiFlaB and OspA. 
In practice, the FlaB primers detect B. burgdorferi s.s. and other closely related Borrelia genospecies, while OspA primers capture only B. burgdorferi s.s. Amplification from both loci would indicate B. burgdorferi. s.s.
<ol start="2">
	<li>Pre-sterilize a PCR cabinet with UV light and 70% ethanol. 
	NOTE: To minimize potential sample contamination, this workspace should be distinct from the location of tick dissection, DNA extraction, and gel electrophoresis.
	<ol>
		<li>For the initial PCR run, use the outer primers in conjunction with the template DNA recovered in step 1.0 above, and set up the reaction mixture as described in Table 2. In parallel, perform positive control runs consisting of verified Borrelia DNA, and negative control runs including no-template reactions to detect reagent and aerosol contamination. Add DNA at the end to minimize potential contamination of reagents. Ensure each tube is closed at all times when reagents are not being added and close tubes immediately after DNA addition and before other tubes are&#160;opened.</li>
		<li>Program a thermal cycler as follows: 95 &#176;C for 5 min; 40 cycles of 95 &#176;C for 15 s, annealing temperature for 30 s, 72 &#176;C for 45 s; 72 &#176;C for 5 min; and hold at 4 &#176;C.</li>
	</ol>
	</li>
	<li>Perform the second round of PCR similar to the first reaction, except use inner primers with 2 &#181;L of the first PCR product (produced in 2.2.2). 
	NOTE: Reaction volumes are again provided in Table 2. Care must be taken to avoid cross-contamination of amplicons by ensuring that template DNA is added last and that only tubes corresponding to one sample are open at a time. 
	&#160;
	<table border="1">
		<tbody>
			<tr>
				<td>Component</td>
				<td>PCR # 1 Volumes</td>
				<td>PCR # 2 Volumes</td>
			</tr>
			<tr>
				<td>Taq Polymerase Master Mix 2X</td>
				<td>12.5 &#181;L</td>
				<td>12.5 &#181;L</td>
			</tr>
			<tr>
				<td>Nuclease-free Water</td>
				<td>8.5 &#181;L</td>
				<td>8.5 &#181;L</td>
			</tr>
			<tr>
				<td>10 &#181;M Forward and Reverse primers</td>
				<td>1.0 &#181;L Outer Primers</td>
				<td>1.0 &#181;L Inner Primers</td>
			</tr>
			<tr>
				<td>DNA Template</td>
				<td>2.0 &#181;L, from sample extraction (1.2.7)</td>
				<td>2.0 &#181;L, from round 1 of PCR (2.2.2)</td>
			</tr>
		</tbody>
	</table>
	Table 2: PCR reaction mixtures for first and second amplifications. 
	&#160;
	<ol>
		<li>Program the thermal cycler as before, but adjust the annealing temperature to accommodate the inner primers (refer to Table 1).</li>
	</ol>
	</li>
</ol>
3. Agarose Gel Electrophoresis and Imaging
NOTE: For basic instructions on separating DNA by electrophoresis, see Lee et al., 201234.
<ol>
	<li>Prepare a 1.2% agarose gel using 20X SB buffer (0.2 M NaOH, 0.8 M Boric Acid pH 8), diluted to 1X, and add approximately 5 &#181;L of a DNA stain, before pouring, if pre-staining of the gel is desired.</li>
	<li>Load 10 &#181;L of the product from the second (inner) PCR reaction from each experimental and control sample, alongside a 100 bp ladder (5 &#181;L).
	<ol>
		<li>Electrophorese for 1 h at 107 V (5V/cm).</li>
	</ol>
	</li>
	<li>View and document the gel using a transilluminator and associated camera and software.</li>
</ol>

The authors have nothing to disclose.

Over decades of use, PCR-based techniques have consistently proven their value in the detection of Borrelia from arthropod and mammalian specimens, whether Borrelia come from environmental or clinical origins. PCR offers many improvements over pre-existing approaches to surveillance. Notably, it is not reliant on the development and performance of antibody reagents, and instead can be easily adapted to detect new targets of interest simply by modifying primer sequences. PCR also accommodates the evaluation of multiple loci in parallel, either independently or via a multiplex reaction. It can be applied to diverse specimen inputs, including fresh and archived ticks22, animal or human bodily fluids, and resected tissue25. PCR also yields amplicons that can be further processed, for example by restriction enzyme digestion, probe hybridization, or sequencing, to provide increased insight into microbial identity21.
As a clinical tool, PCR is conceptually preferable to the standard serological diagnostics, as it provides a direct indication of bacterial presence, rather than relying on host immune response as a secondary measure of infection. However, Lyme borreliosis is associated with a relatively modest microbial burden (&#60;50 organisms/mL of urine or plasma) and transient spirochetemia, which can give rise to false negative results25. The sensitivity of this technique in the clinic varies considerably depending on the tissue type, stage of infection, and sample condition, falling between 12.5% and 62% in existing studies of blood, cerebrospinal fluid, and biopsied tissue36. Molecular sensitivity limitations are not a concern if PCR is undertaken subsequent to bacterial culture, however recovery of viable spirochetes from clinical specimens has proven similarly challenging. Only recently have protocols been optimized for higher yield35. Meanwhile, the gut of an infected adult tick can harbor on average anywhere from 2,000 to over 50,000 Borrelia37,38,39, which is solidly within the detection range of nPCR. Thus, the protocol is well suited to tick surveillance efforts.
Despite its many advantages, nPCR does pose certain challenges, and the capacity of this technique to accurately report tick infection therefore depends on strategic selection of genes and amplicons, meticulous experimental workflows that recover quality DNA from specimens while minimizing cross-exposure of samples, and the use of appropriate controls that can report contaminants in the laboratory environment and reagents. Prior to any experimentation, the scope and intentions of the investigation should be clearly defined so that appropriate genetic loci, and regions therein, can be selected. If the objective is to provide an unbiased screen for the Lyme-causing Borrelia burgdorferi s.l. complex, primers should be created to detect all of the associated strains with similar affinity and amplification efficiency, without capturing unrelated organisms25. New primers can be designed and assessed in silico using software tools such as Primer-BLAST40, although they should also be validated experimentally against standard reference isolates before being applied to uncharacterized samples. The goal of the DNA extraction procedure is to recover intact microbial template from a mixed environmental sample (tick homogenate). An optional step before proceeding with PCR is to evaluate the integrity of the extracted DNA. Additionally, parallel reactions could be set up to target a housekeeping gene in the tick. The latter method can also indicate the presence of inhibitors in the reaction mixture, providing increased confidence that negative Borrelia reactions are due to the absence of the organism, and not to the presence of an inhibitory contaminant.
The increased sensitivity of the nested PCR approach comes at the expense of potential contamination that generates false-positive results. Exogenous template could be introduced to a sample during tick dissection and DNA recovery, or in the process of setting up the outer and inner amplification reactions. It is therefore especially important to follow best practice protocols for PCR to avoid template or amplicon cross-contamination. These include the use of separate work stations with independent airflows, containment in PCR and biological safety cabinets where appropriate, thorough chemical and physical cleaning and sterilization of surfaces and reagents, and cautious handling of DNA41. No-template controls are also vital in identifying contamination of stock reagents. A particular vulnerability of nPCR is the amplicon handling that occurs when transferring the products of the first reaction into the second PCR vessel. Since the target DNA has already undergone exponential enrichment in positive samples, this step is especially prone to cross-contamination, and a single-tube nPCR protocol has been developed to circumvent this limitation. In this approach, both sets of primers for a given gene are added together to a reaction tube that remains sealed for both rounds of PCR31. The outer and inner primer pairs must be thermodynamically distinct, such that the outer couple amplifies template at a high annealing temperature that is prohibitive for the inner primers. In the second round, the annealing temperature is lowered to accommodate the internal pair. Not only does this bypass a potentially confounding step, it also permits the use of additional anti-contamination measures31,42. However, this modification may sacrifice some assay sensitivity. Regardless of the approach, increasing the number of technical replicates performed independently on a sample will help to identify spurious contamination.
Molecular techniques have continued to evolve since the introduction of nPCR, and these newer approaches offer select advantages over the original designs, albeit at increased financial expense. As the name suggests, quantitative PCR (qPCR or real time (RT)-PCR) allows for the enumeration of pathogens in a sample, while conventional techniques are qualitative in nature43. The sensitivity of qPCR is reportedly similar to that of nPCR38, although it can fluctuate depending on primer characteristics28. A variation of qPCR that uses molecular beacons (MB) in place of conventional TaqMan probes has also shown promise in the detection of Borrelia in clinical specimens44,45,46. Due to their unique secondary structure, molecular beacons reportedly produce lower background fluorescence and higher legitimate signals, thereby providing superior sensitivity47. Pre-clinical evaluations suggest a potential detection threshold of between one and ten spirochetes44,45. Moreover, the technique has been successfully applied in multiplex reactions to simultaneously detect a mammalian host gene44 and other tick-borne pathogens45, which is not as readily achievable with nPCR. Other design modifications include droplet digital PCR (ddPCR) technology, which can quantify DNA without the use of a standard curve39,48. The lower detection limit of this technique for Borrelia is likewise around ten spirochetes/sample39. Compared to nPCR, these approaches also have the advantage of reduced potential for contamination, as they only require a single amplification protocol.
If the objective of surveillance is instead to profile the varied bacterial contents of a tick, 16S rRNA metagenomic screening is an attractive option49. Although this approach is costlier, requires specialized DNA sequencers not found in all molecular biology laboratories, and necessitates more sophisticated bioinformatics-based interpretation, it can capture a broad spectrum of microbes to more accurately represent the pathogen load of the vector.
While qPCR and its derivatives are methods of choice for quantitative applications, and metagenomics screens provide broad inventories of the tick microbiome, targeted surveillance efforts are often concerned with binary reporting of the presence or absence of one or a few pathogens in a vector. Under such circumstances, these newer, more elaborate approaches may introduce unnecessary complexity and financial burden into the process. For these reasons, nPCR has withstood the test of time as a pivotal technique in tick testing.

Lyme disease (LD) is the most prevalent vector-borne infection in the northern hemisphere, and its incidence continues to increase1. This debilitating illness is caused by spirocheteal pathogens of the Lyme borreliosis (LB) complex (commonly referred to as Borrelia burgdorferi sensu lato, or s.l.), which historically&#160;comprises the predominant North American pathogen, B. burgdorferi sensu stricto (s.s), in addition to B. afzelii and B. garinii, which are widespread throughout Europe and Asia, and are species of emerging clinical relevance2,3. These bacteria are transmitted to humans through the bite of infected Ixodes ticks2. Although the main North American vectors are I. scapularis and I. pacificus, multiple species within this genus have been found to harbor and transmit the bacterium4. In humans, B. burgdorferi can cause multisystem symptoms affecting the skin, joints, heart, nervous system, endocrine glands, gastrointestinal tract, and internal organs5,6,7,8,9,10. The Center for Disease Control and Prevention currently estimates over 300,000 new human cases annually in the United States11,12. While prognosis is often favorable when the illness is diagnosed and treated in the early stages, studies have suggested that anywhere between 10% and 60% of patients who received the recommended antibiotic regimen continued to experience symptoms after therapy cessation, in a phenomenon termed Post Treatment Lyme Disease Syndrome (PTLDS)13,14,15. Moreover, delays in clinical intervention can arise as a result of lack of awareness of a tick bite, non-specific presentation of the initial illness, and the low sensitivity of traditional serology-based diagnostics when used at the onset of infection. Failure to treat swiftly and appropriately enables symptom progression that can manifest in increasingly debilitating complications16,17. Lyme disease prevention is therefore a cornerstone of risk management. Strategies to combat this growing threat include robust surveillance measures to indicate the pathogen prevalence in ticks, and identify geographic regions of concern.
This article demonstrates the utility of nested polymerase chain reaction (nPCR) as a molecular screening tool by which to identify infected ticks. To increase specificity, two Borrelia genes are used for parallel amplification. Flagellin B (FlaB) encodes a major filament protein of the flagellum18, and the gene is located on the single linear chromosome, while the lipoprotein product of Outer surface protein A (OspA) mediates tick midgut colonization, and is plasmid-encoded19,20. The workflow consists of tick collection, DNA extraction, and then an initial round of PCR to detect Borrelia-specific loci. Subsequent PCR uses the product of the first reaction as a new template to generate smaller, internal amplification fragments. A tick is considered positive for Borrelia burgdorferi when inner amplicons from both Borrelia genes can be detected by agarose gel electrophoresis.
Both the nPCR technique, and the FlaB and OspA gene targets, have been widely used for ecological surveillance and clinical detection of the Lyme spirochete since the early 1990s21,22,23,24,25. Prior to the development of molecular protocols, ticks were assessed by subjecting gut contents to anti-Borrelia immunofluorescence (IF) staining, microbial culture, or a combination thereof26. These approaches suffer from inherent limitations, including the slow growth and fastidious nature of Borrelia27, antibody performance issues, and the requirement of live ticks for IF processing21. PCR was subsequently adopted to provide fast, sensitive, and specific identification of infected vectors. It offered marked improvements over the traditional methodology, including culture-independent direct application to diverse specimen types, such as dead and archived ticks that would otherwise be unsuitable for testing21,22. Nested experimental designs further improve upon the specificity and sensitivity of classical PCR by employing two distinct sets of gene-specific primers in two consecutive rounds of amplification25,28.
Experimental success is critically dependent on strategic gene selection and amplicon design. To accurately estimate the presence of Borrelia burgdorferi, primers should detect the relevant pathogens without cross-reacting with relapsing fever spirochetes also in the Borrelia genus. In the case of FlaB, this specificity is achieved by targeting a variable internal region of the gene, rather than the relatively conserved flanking sequences that are shared by diverse bacteria (Figure 1)24,29,30.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56471/56471fig1.jpg" /> 
Figure 1: The concept of nPCR, as illustrated using Borrelia&#160;FlaB gene as a target. The 5&#39; and 3&#39; termini of the gene are common to organisms beyond Borrelia burgdorferi s.l., rendering these regions unsuitable for the specific assessment of Lyme-causing pathogens. Using the less-conserved interior sequences as primer targets, two rounds of PCR are executed to detect a final, internal amplicon. <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56471/56471fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
In a test of their discriminatory capacity, interior FlaB primers were evaluated with over 80 different Borrelia isolates, and found to identify only those associated with Lyme disease24. The lower detection limit of nPCR has been documented at between six24 and ten31 bacteria from pure culture, although the sensitivity can be further improved by Southern blotting the amplicon, and hybridizing a radiolabelled or chemiluminescent probe. Coupling the techniques reduces the detection threshold to a single spirochete31. By direct comparison, conventional, unprobed single-round PCR was found to report the presence of a minimum of 104 spirochetes31. It should be noted, however, that assay sensitivity will be lower when working with complex environmental and clinical samples, due to the overwhelming presence of unrelated DNA and potential inhibitory substances. These challenges can be largely circumvented by the use of nPCR.
Despite advances in molecular technologies in the past decades, nPCR remains a staple technique in modern surveillance efforts. If care is taken in the design and execution of this protocol, it is a powerful, adaptable, and relatively straightforward approach to capture the presence of pathogens in tick vectors.

<table border="0" cellpadding="0" cellspacing="0" width="830">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:299px;">LabGard Class II, Type A2 biological safety cabinet</td>
			<td style="width:192px;">Nuaire</td>
			<td style="width:140px;">ES AIR NU-543&#160;</td>
			<td style="width:199px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Razor blades</td>
			<td style="width:192px;">VWR</td>
			<td style="width:140px;">55411-050</td>
			<td>0.22 mm thickness</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Microfuge Tubes (Microtubes 1.5 mL)</td>
			<td style="width:192px;">Axygen</td>
			<td style="width:140px;">311-08-051</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:299px;">AquaGenomic&#160;</td>
			<td style="width:192px;">MultiTarget Pharmaceuticals</td>
			<td style="width:140px;">2030</td>
			<td>DNA extraction reagent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Microtube Pestle</td>
			<td style="width:192px;">Diamed</td>
			<td style="width:140px;">DIATEC610-1551</td>
			<td>Designed for 1.5 ml tubes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Water bath - Isotemp 202</td>
			<td style="width:192px;">Fishse Scientific</td>
			<td style="width:140px;">15-462-2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Vortex</td>
			<td style="width:192px;">Labnet</td>
			<td style="width:140px;">S0100 CAN</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Spectrafuge 24D Digital Microcentrifuge</td>
			<td style="width:192px;">Labnet</td>
			<td style="width:140px;">C2400</td>
			<td style="width:199px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Isopropanol</td>
			<td style="width:192px;">Sigma-Aldrich</td>
			<td style="width:140px;">190764</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">BIS-TRIS</td>
			<td style="width:192px;">Sigma-Aldrich</td>
			<td style="width:140px;">B9754</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Primer Synthesis</td>
			<td style="width:192px;">Sigma-Aldrich</td>
			<td style="width:140px;">OLIGO</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">PCR Cabinet</td>
			<td style="width:192px;">Misonix</td>
			<td style="width:140px;">PCR6-482</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">PCR tube with attached flat caps 0.2mL</td>
			<td style="width:192px;">VWR</td>
			<td style="width:140px;">20170-012</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">GoTaq Green Master Mix 2x</td>
			<td style="width:192px;">Promega</td>
			<td style="width:140px;">M7123</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Nuclease-free water</td>
			<td style="width:192px;">Promega</td>
			<td style="width:140px;">M7123</td>
			<td>The water comes with the GTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Spectrafuge Mini</td>
			<td style="width:192px;">Labnet</td>
			<td style="width:140px;">C1301</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:299px;">SYBR Safe DNA Stain 10,000X Concentration</td>
			<td style="width:192px;">EDVOTEK</td>
			<td style="width:140px;">608</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:299px;">Froggarose LE (Molecular Biology Grade Agarose)</td>
			<td style="width:192px;">FroggaBio</td>
			<td style="width:140px;">A87-500G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">GD 100 bp DNA Ladder</td>
			<td style="width:192px;">FroggaBio</td>
			<td style="width:140px;">DM001-R500&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Electrophoresis power pack&#160;</td>
			<td style="width:192px;">VWR</td>
			<td style="width:140px;">VWR 105</td>
			<td>EC Apparatus Corporation</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:299px;">Fluor-S MultiImager&#160;</td>
			<td style="width:192px;">BioRad</td>
			<td style="width:140px;">170-7700 (Serial number 433B0154)</td>
			<td></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:299px;">Quantity One 1-D Analysis Software (V. 4.5.2)</td>
			<td style="width:192px;">BioRad</td>
			<td style="width:140px;">1709600</td>
			<td></td>
		</tr>
	</tbody>
</table>

detecting the lyme disease spirochete, borrelia burgdorferi, in ticks using nested pcr

Lyme disease is a serious vector-borne infection that is caused by the Borrelia burgdorferi sensu lato family of spirochetes, which are transmitted to humans through the bite of infected Ixodes ticks. The primary etiological agent in North America is Borrelia burgdorferi sensu stricto. As geographic risk regions expand, it is prudent to support robust surveillance programs that can measure tick infection rates, and communicate findings to clinicians, veterinarians, and the general public. The molecular technique of nested polymerase chain reaction (nPCR) has long been used for this purpose, and it remains a central, inexpensive, and robust approach in the detection of Borrelia in both ticks and wildlife. 
This article demonstrates the application of nPCR to tick DNA extracts to identify infected specimens. Two independent B. burgdorferi targets, genes encoding Flagellin B (FlaB) and Outer surface protein A (OspA), have been used extensively with this technique. The protocol involves tick collection, DNA extraction, and then an initial round of PCR to detect each of the two Borrelia-specific loci. Subsequent polymerase chain reaction (PCR) uses the product of the first reaction as a new template to generate smaller, internal amplification fragments. The nested approach improves upon both the specificity and sensitivity of conventional PCR. A tick is considered positive for the pathogen when inner amplicons from both Borrelia genes can be detected by agarose gel electrophoresis.

nPCR is an elegant approach to increase the specificity and sensitivity of pathogen detection, particularly when complex environmental samples are under investigation. As depicted in Figure 1, two rounds of PCR targeting a strategic region of the Borrelia FlaB locus (and OspA, not pictured) can report the presence of the Borrelia burgdorferi bacteria through the generation of short inner amplicons. When resolved by gel electrophoresis, the FlaB and OspA reaction products from each tick can be visually scored and compared against controls. In Figure 2, unique specimen identifiers are provided along the top of each gel, and no-template and aerosol controls are represented at the far left and right, respectively, adjacent to the ladders.
Robust amplicon bands are clearly visible in select experimental samples, and they are easily distinguished from surplus primers and residual DNA (Figure 2). Based on the experimental design principles set forth, a tick is considered positive for Borrelia when parallel negative controls demonstrate no amplification, and inner amplicons are produced from both FlaB and OspA primers. In this case, specimens T907, T604, and T606 met surveillance criteria for the Lyme pathogen (Figure 2). By contrast, T923 was only positive for OspA, an outcome for which there are multiple possible explanations: A) The tick of origin was negative for Borrelia, but the outer or inner OspA PCR preparation was spuriously contaminated with template DNA (note that systemic contamination of reagents was ruled out via negative controls), B) the tick carried Lyme Borrelia, but low template amounts or experimental error prevented amplification of FlaB, or C) an organism was present that contained the conserved OspA sequence, but lacked Flagellin or had insufficient identity in the targeted region of FlaB to anneal to the primers. Indeed,&#160;OspA&#160;sequence similarities have been noted in a variety of organisms, including plants and animals28. The converse situation, amplification of the more conserved Flagellin&#160;gene, but not the OspA&#160;gene, could indicate a related Borrelia&#160;species. In practice, this protocol yields more&#160;OspA&#160;single-positive results than do the&#160;FlaB&#160;primers, suggesting that scenario &#39;A&#39; is the least likely explanation.&#160;Without further experimental analysis of the contentious specimen, however, it is not possible to determine the source of the single-positive result. Increasing the number of technical replicates performed on equivocal samples may help to reconcile their true status, since any contaminants that were spuriously introduced to previous reactions would not be present in the archived DNA. However, if subsequent reactions with these primers fail to provide conclusive results, other Borrelia loci could be investigated by PCR. Amplicons generated from these reactions could also be sequenced and compared among isolates to help assign identity, and estimate the degree of strain divergence. Sapi and colleagues provide an example of this workflow using human clinical samples35.
All factors considered, the outlined protocol and interpretation criteria have been estimated to yield false positive and false negative rates of 0.17% and 0.0063%, respectively.
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56471/56471fig2.jpg" /> 
Figure 2: Detection of Borrelia burgdorferi in individual ticks by nPCR of FlaB and OspA. Codes assigned to each tick are represented across the top of the gels, and identities align vertically to report the detection of OspA and FlaB in each specimen. Lanes entitled B at the left of the image represent no-template controls, while A (right hand lanes) are aerosol controls to capture contamination of the laboratory environment. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56471/56471fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR at JoVE.com

Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR

Nested PCR is a sensitive, specific, and straightforward technique that can be applied to tick DNA extracts to probe for Borrelia burgdorferi, the causative agent of Lyme disease. The initial PCR experiment uses gene-specific primers to generate long amplicons, which then become templates for a subsequent reaction using internal primers.

Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR

Lyme disease is a serious vector-borne infection that is caused by the Borrelia burgdorferi sensu lato family of spirochetes, which are transmitted to ...

detecting-lyme-disease-spirochete-borrelia-burgdorferi-ticks-using

Nanyang Technological University

Research

JoVE Journal

Biology

17.8K Views.  Mount Allison University. Nested PCR is a sensitive, specific, and straightforward technique that can be applied to tick DNA extracts to probe for Borrelia burgdorferi, the causative agent of Lyme disease. The initial PCR experiment uses gene-specific primers to generate long amplicons, which then become templates for a subsequent reaction using internal primers. 

Video: Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR

Quantitative Real-Time PCR using the Thermo Scientific Solaris qPCR Assay

The Solaris qPCR Gene Expression Assay is a novel type of primer/probe set, designed to simplify the qPCR process while maintaining the sensitivity and accuracy of the assay. These primer/probe sets are pre-designed to &gt;98% of the human and mouse genomes and feature significant improvements from previously available technologies. These improvements were made possible by virtue of a novel design algorithm, developed by Thermo Scientific bioinformatics experts.
Several convenient features have been incorporated into the Solaris qPCR Assay to streamline the process of performing quantitative real-time PCR. First, the protocol is similar to commonly employed alternatives, so the methods used during qPCR are likely to be familiar. Second, the master mix is blue, which makes setting the qPCR reactions easier to track. Third, the thermal cycling conditions are the same for all assays (genes), making it possible to run many samples at a time and reducing the potential for error. Finally, the probe and primer sequence information are provided, simplifying the publication process.
Here, we demonstrate how to obtain the appropriate Solaris reagents using the GENEius product search feature found on the ordering web site (www.thermo.com/solaris) and how to use the Solaris reagents for performing qPCR using the standard curve method.

The Solaris qPCR Gene Expression Assays are novel pre-designed qPCR primer/probe combinations designed to simplify the qPCR process without sacrificing the specificity and robustness of the assay.

The Solaris qPCR Gene Expression Assay is a novel type of primer/probe set, designed to simplify the qPCR process while maintaining the sensitivity and ...

Quantification of &gamma;H2AX Foci in Response to Ionising Radiation

DNA double-strand breaks (DSBs), which are induced by either endogenous metabolic processes or by exogenous sources, are one of the most critical DNA lesions with respect to survival and preservation of genomic integrity. An early response to the induction of DSBs is phosphorylation of the H2A histone variant, H2AX, at the serine-139 residue, in the highly conserved C-terminal SQEY motif, forming &gamma;H2AX1. Following induction of DSBs, H2AX is rapidly phosphorylated by the phosphatidyl-inosito 3-kinase (PIKK) family of proteins, ataxia telangiectasia mutated (ATM), DNA-protein kinase catalytic subunit and ATM and RAD3-related (ATR)2. Typically, only a few base-pairs (bp) are implicated in a DSB, however, there is significant signal amplification, given the importance of chromatin modifications in DNA damage signalling and repair. Phosphorylation of H2AX mediated predominantly by ATM spreads to adjacent areas of chromatin, affecting approximately 0.03% of total cellular H2AX per DSB2,3. This corresponds to phosphorylation of approximately 2000 H2AX molecules spanning ~2 Mbp regions of chromatin surrounding the site of the DSB and results in the formation of discrete &gamma;H2AX foci which can be easily visualized and quantitated by immunofluorescence microscopy2. The loss of &gamma;H2AX at DSB reflects repair, however, there is some controversy as to what defines complete repair of DSBs; it has been proposed that rejoining of both strands of DNA is adequate however, it has also been suggested that re-instatement of the original chromatin state of compaction is necessary4-8. The disappearence of &gamma;H2AX involves at least in part, dephosphorylation by phosphatases, phosphatase 2A and phosphatase 4C5,6. Further, removal of &gamma;H2AX by redistribution involving histone exchange with H2A.Z has been implicated7,8. Importantly, the quantitative analysis of &gamma;H2AX foci has led to a wide range of applications in medical and nuclear research. Here, we demonstrate the most commonly used immunofluorescence method for evaluation of initial DNA damage by detection and quantitation of &gamma;H2AX foci in &gamma;-irradiated adherent human keratinocytes9.

Quantification of &#947;H2AX Foci in Response to Ionising Radiation

Quantification of DNA double-strand streaks using &gamma;H2AX formation as a molecular marker has become an invaluable tool in radiation biology. Here we demonstrate the use of an immunofluorescence assay for quantification of &gamma;H2AX foci after exposure of cells to radiation.

DNA double-strand breaks (DSBs), which are induced by either endogenous metabolic processes or by exogenous sources, are one of the most critical DNA ...

Analysis of Gene Expression in Emerald Ash Borer (Agrilus planipennis) Using Quantitative Real Time-PCR

Emerald ash borer (EAB, Agrilus planipennis) is an exotic invasive pest, which has killed millions of ash trees (Fraxinus spp) in North America. EAB continues to spread rapidly and attacks ash trees of different ages, from saplings to mature trees. However, to date very little or no molecular knowledge exists for EAB. We are interested in deciphering the molecular-based physiological processes at the tissue level that aid EAB in successful colonization of ash trees. In this report we show the effective use of quantitative real-time PCR (qRT-PCR) to ascertain mRNA levels in different larval tissues (including midgut, fat bodies and cuticle) and different developmental stages (including 1st-, 2nd-, 3rd-, 4th-instars, prepupae and adults) of EAB. As an example, a peritrophin gene (herein named, AP-PERI1) is exemplified as the gene of interest and a ribosomal protein (AP-RP1) as the internal control. Peritrophins are important components of the peritrophic membrane/matrix (PM), which is the lining of the insect gut. The PM has diverse functions including digestion and mechanical protection to the midgut epithelium.

Analysis of Gene Expression in Emerald Ash Borer Agrilus planipennis Using Quantitative Real Time-PCR

Quantitative real-time PCR (qRT-PCR) is an effective tool to diagnose mRNA levels in different insect tissues and developmental stages. In this report we show the use of qRT-PCR to ascertain mRNA levels in different larval tissues and developmental stages of the invasive insect species, emerald ash borer.

Emerald ash borer (EAB, Agrilus planipennis) is an exotic invasive pest, which has killed millions of ash trees (Fraxinus spp) in North America. EAB ...

Rapid PCR Thermocycling using Microscale Thermal Convection

Many molecular biology assays depend in some way on the polymerase chain reaction (PCR) to amplify an initially dilute target DNA sample to a detectable concentration level. But the design of conventional PCR thermocycling hardware, predominantly based on massive metal heating blocks whose temperature is regulated by thermoelectric heaters, severely limits the achievable reaction speed1. Considerable electrical power is also required to repeatedly heat and cool the reagent mixture, limiting the ability to deploy these instruments in a portable format.
Thermal convection has emerged as a promising alternative thermocycling approach that has the potential to overcome these limitations2-9. Convective flows are an everyday occurrence in a diverse array of settings ranging from the Earth's atmosphere, oceans, and interior, to decorative and colorful lava lamps. Fluid motion is initiated in the same way in each case: a buoyancy driven instability arises when a confined volume of fluid is subjected to a spatial temperature gradient. These same phenomena offer an attractive way to perform PCR thermocycling. By applying a static temperature gradient across an appropriately designed reactor geometry, a continuous circulatory flow can be established that will repeatedly transport PCR reagents through temperature zones associated with the denaturing, annealing, and extension stages of the reaction (Figure 1). Thermocycling can therefore be actuated in a pseudo-isothermal manner by simply holding two opposing surfaces at fixed temperatures, completely eliminating the need to repeatedly heat and cool the instrument.
One of the main challenges facing design of convective thermocyclers is the need to precisely control the spatial velocity and temperature distributions within the reactor to ensure that the reagents sequentially occupy the correct temperature zones for a sufficient period of time10,11. Here we describe results of our efforts to probe the full 3-D velocity and temperature distributions in microscale convective thermocyclers12. Unexpectedly, we have discovered a subset of complex flow trajectories that are highly favorable for PCR due to a synergistic combination of (1) continuous exchange among flow paths that provides an enhanced opportunity for reagents to sample the full range of optimal temperature profiles, and (2) increased time spent within the extension temperature zone the rate limiting step of PCR. Extremely rapid DNA amplification times (under 10 min) are achievable in reactors designed to generate these flows.

We describe a novel method to perform DNA replication via the polymerase chain reaction (PCR). Thermal convection is harnessed to continuously shuttle reagents between denaturing, annealing, and extension conditions by maintaining opposing surfaces of the reactor at constant temperature. This inherently simple design promises to make rapid PCR more accessible.

Many molecular biology assays depend in some way on the polymerase chain reaction (PCR) to amplify an initially dilute target DNA sample to a detectable ...

Using SecM Arrest Sequence as a Tool to Isolate Ribosome Bound Polypeptides

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway that polypeptide chain follows during co-translational folding to achieve its functional form is still an enigma. In order to understand this process and to determine the exact conformation of the co-translational folding intermediates, it is essential to develop techniques that allow the isolation of RNCs carrying nascent chains of predetermined sizes to allow their further structural analysis.
SecM (secretion monitor) is a 170 amino acid E. coli protein that regulates expression of the downstream SecA (secretion driving) ATPase in the secM-secA operon6. Nakatogawa and Ito originally found that a 17 amino acid long sequence (150-FSTPVWISQAQGIRAGP-166) in the C-terminal region of the SecM protein is sufficient and necessary to cause stalling of SecM elongation at Gly165, thereby producing peptidyl-glycyl-tRNA stably bound to the ribosomal P-site7-9. More importantly, it was found that this 17 amino acid long sequence can be fused to the C-terminus of virtually any full-length and/or truncated protein thus allowing the production of RNCs carrying nascent chains of predetermined sizes7. Thus, when fused or inserted into the target protein, SecM stalling sequence produces arrest of the polypeptide chain elongation and generates stable RNCs both in vivo in E. coli cells and in vitro in a cell-free system. Sucrose gradient centrifugation is further utilized to isolate RNCs.
The isolated RNCs can be used to analyze structural and functional features of the co-translational folding intermediates. Recently, this technique has been successfully used to gain insights into the structure of several ribosome bound nascent chains10,11. Here we describe the isolation of bovine Gamma-B Crystallin RNCs fused to SecM and generated in an in vitro translation system.

We describe here a technique that is now routinely used to isolate stably bound ribosome nascent chain complexes (RNCs). This technique takes advantage of the discovery that a 17 amino acid long SecM "arrest sequence" can halt translation elongation in a prokaryotic (E. coli) system, when inserted into (or fused to the C-terminus) of virtually any protein.

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway ...

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Transposon mutagenesis and single-gene deletion are two methods applied in genome-wide gene knockout in bacteria 1,2. Although transposon mutagenesis is less time consuming, less costly, and does not require completed genome information, there are two weaknesses in this method: (1) the possibility of a disparate mutants in the mixed mutant library that counter-selects mutants with decreased competition; and (2) the possibility of partial gene inactivation whereby genes do not entirely lose their function following the insertion of a transposon. Single-gene deletion analysis may compensate for the drawbacks associated with transposon mutagenesis. To improve the efficiency of genome-wide single gene deletion, we attempt to establish a high-throughput technique for genome-wide single gene deletion using Streptococcus sanguinis as a model organism. Each gene deletion construct in S. sanguinis genome is designed to comprise 1-kb upstream of the targeted gene, the aphA-3 gene, encoding kanamycin resistance protein, and 1-kb downstream of the targeted gene. Three sets of primers F1/R1, F2/R2, and F3/R3, respectively, are designed and synthesized in a 96-well plate format for PCR-amplifications of those three components of each deletion construct. Primers R1 and F3 contain 25-bp sequences that are complementary to regions of the aphA-3 gene at their 5' end. A large scale PCR amplification of the aphA-3 gene is performed once for creating all single-gene deletion constructs. The promoter of aphA-3 gene is initially excluded to minimize the potential polar effect of kanamycin cassette. To create the gene deletion constructs, high-throughput PCR amplification and purification are performed in a 96-well plate format. A linear recombinant PCR amplicon for each gene deletion will be made up through four PCR reactions using high-fidelity DNA polymerase. The initial exponential growth phase of S. sanguinis cultured in Todd Hewitt broth supplemented with 2.5% inactivated horse serum is used to increase competence for the transformation of PCR-recombinant constructs. Under this condition, up to 20% of S. sanguinis cells can be transformed using ~50 ng of DNA. Based on this approach, 2,048 mutants with single-gene deletion were ultimately obtained from the 2,270 genes in S. sanguinis excluding four gene ORFs contained entirely within other ORFs in S. sanguinis SK36 and 218 potential essential genes. The technique on creating gene deletion constructs is high throughput and could be easy to use in genome-wide single gene deletions for any transformable bacteria.

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

An efficient genome-wide single gene mutation method has been established using Streptococcus sanguinis as a model organism. This method has achieved via high throughput recombinant PCRs and transformations.

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present methods for the development of assays to query potentially clinically significant nonsynonymous changes using in vivo complementation in zebrafish. Zebrafish (Danio rerio) are a useful animal system due to their experimental tractability; embryos are transparent to enable facile viewing, undergo rapid development ex vivo, and can be genetically manipulated.1 These aspects have allowed for significant advances in the analysis of embryogenesis, molecular processes, and morphogenetic signaling. Taken together, the advantages of this vertebrate model make zebrafish highly amenable to modeling the developmental defects in pediatric disease, and in some cases, adult-onset disorders. Because the zebrafish genome is highly conserved with that of humans (~70% orthologous), it is possible to recapitulate human disease states in zebrafish. This is accomplished either through the injection of mutant human mRNA to induce dominant negative or gain of function alleles, or utilization of morpholino (MO) antisense oligonucleotides to suppress genes to mimic loss of function variants. Through complementation of MO-induced phenotypes with capped human mRNA, our approach enables the interpretation of the deleterious effect of mutations on human protein sequence based on the ability of mutant mRNA to rescue a measurable, physiologically relevant phenotype. Modeling of the human disease alleles occurs through microinjection of zebrafish embryos with MO and/or human mRNA at the 1-4 cell stage, and phenotyping up to seven days post fertilization (dpf). This general strategy can be extended to a wide range of disease phenotypes, as demonstrated in the following protocol. We present our established models for morphogenetic signaling, craniofacial, cardiac, vascular integrity, renal function, and skeletal muscle disorder phenotypes, as well as others.

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present a systematic approach for developing physiologically relevant, sensitive and specific in vivo assays for interpreting variation in human pathology. Transient genetic manipulation via microinjection of WT and mutant human mRNA and morpholino (MO) antisense oligonucleotides harness the tractability of the developing zebrafish embryo to rapidly assay pathogenic mutations, especially, but not exclusively, in the context of human developmental disorders.

Here,  we present methods for the development of assays to query potentially clinically  significant nonsynonymous changes using in  vivo complementation ...

Rapid and Efficient Zebrafish Genotyping Using PCR with High-resolution Melt Analysis

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic tools have been introduced, including multiple strategies for inducing mutations and generating transgenic lines. However, large-scale screening is limited by traditional genotyping methods, which are time-consuming and labor-intensive. Here we describe a technique to analyze zebrafish genotypes by PCR combined with high-resolution melting analysis (HRMA).&#160;This approach is rapid, sensitive, and inexpensive, with lower risk of contamination artifacts.&#160;Genotyping by PCR with HRMA can be used for embryos or adult fish, including in high-throughput screening protocols.

PCR combined with high-resolution melt analysis (HRMA) is demonstrated as a rapid and efficient method to genotype zebrafish.

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different lineages. A single cell transcriptome assay can be a new approach for dissecting individual variation. We have developed the single cell qRT-PCR method, and confirmed that this method works well in several gene expression profiles. In single cell level, each human embryonic stem cell, sorted by OCT4::EGFP positive cells, has high expression in OCT4, but a different level of NANOG expression. Our single cell gene expression assay should be useful to interrogate population heterogeneities.

Single cell gene expression assay is needed for understanding stem cell heterogeneities.

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...

Detecting Estrogenic Ligands in Personal Care Products using a Yeast Estrogen Screen Optimized for the Undergraduate Teaching Laboratory

The Yeast Estrogen Screen (YES) is used to detect estrogenic ligands in environmental samples and has been broadly applied in studies of endocrine disruption. Estrogenic ligands include both natural and manmade &#34;Environmental Estrogens&#34; (EEs) found in many consumer goods including Personal Care Products (PCPs), plastics, pesticides, and foods. EEs disrupt hormone signaling in humans and other animals, potentially reducing fertility and increasing disease risk. Despite the importance of EEs and other Endocrine Disrupting Chemicals (EDCs) to public health, endocrine disruption is not typically included in undergraduate curricula. This shortcoming is partly due to a lack of relevant laboratory activities that illustrate the principles involved while also being accessible to undergraduate students. This article presents an optimized YES for quantifying ligands in personal care products that bind estrogen receptors alpha (ER&#945;) and/or beta (ER&#946;). The method incorporates one of the two colorimetric substrates (ortho-nitrophenyl-&#946;-D-galactopyranoside (ONPG) or chlorophenol red-&#946;-D-galactopyranoside (CPRG)) that are cleaved by &#946;-galactosidase, a 6-day refrigerated incubation step to facilitate use in undergraduate laboratory courses, an automated application for LacZ calculations, and R code for the associated 4-parameter logistic regression analysis. The protocol has been designed to allow undergraduate students to develop and conduct experiments in which they screen products of their choosing for estrogen mimics. In the process, they learn about endocrine disruption, cell culture, receptor binding, enzyme activity, genetic engineering, statistics, and experimental design. Simultaneously, they also practice fundamental and broadly applicable laboratory skills, such as: calculating concentrations; making solutions; demonstrating sterile technique; serially diluting standards; constructing and interpolating standard curves; identifying variables and controls; collecting, organizing, and analyzing data; constructing and interpreting graphs; and using common laboratory equipment such as micropipettors and spectrophotometers. Thus, implementing this assay encourages students to engage in inquiry-based learning while exploring emerging issues in environmental science and health.

This article presents an optimized yeast estrogen screen for quantifying ligands in Personal Care Products (PCPs) that bind estrogen receptors alpha (ER&#945;) and/or beta (ER&#946;). The method incorporates two colorimetric substrate options, a six-day refrigerated incubation for use in undergraduate courses, and statistical tools for data analysis.