Yazarlar Kami Harris için astar tasarım, Ashley McKibbon ve Jessica Thomas-Ebbett filme ve John Blakely, Alexandra Foley-Münir, Chris Langley, Julie Lewis, Kelsey McIntyre, Ashley McKibbon, Chris Zinck ve Rosie köpek görünmesini için teşekkür etmek istiyorum video. A. M. K. Kanada Lyme hastalığı Araştırma Vakfı tarafından desteklenen ve proje finansman Doğa Bilimleri ve mühendislik Araştırma Konseyi, Kanada (NSERC) tarafından sağlandı. M. K. d. W. maaş New Brunswick yenilik Vakfı (NBIF) üzerinden fon aldı.

1. keneler DNA izolasyonu
<ol><li>Keneler alan koleksiyonu veya pasif güvenlik kayıtlarından veterinerler ve kamu üyeleri aracılığıyla elde etmek. Keneler dondurarak öldüren, mühürlü bir çantaya yerleştirilir ve oda sıcaklığında gönderilecek gerekir.<ol>
<li>Gönderme formu kullanarak, karşılaşma, kene eki durumu, ana türler ve son seyahat tarihi konağın coğrafi konumu ve tarihi hakkında bilgi toplayabilir.</li>
		<li>İç içe geçmiş PCR için kirlenme doğal olarak savunmasız olduğu için laboratuvar çalışma alanı çapraz-pozlama örneklerin en aza indirmek için ayarlandığından emin olun. Bu protokol farklı unsurları iyice temizlenmeli ve sterilize de birbirinden izole ayrı, özel alanlarda içinde yürütme içerir ve tüm aletleri sağlanması kirleticiler ücretsiz.</li>
		<li>Numune alınması, üzerine kene fotoğrafını çekip türler, gelişim aşamasını, seks ve şişkinliği durumunu bir kimlik anahtar32 ' ye kıyasla belirlemek.</li>
		<li>Aseptik şartlarda bir steril jilet veya skalpel kullanarak kene bisect ve iki kene parçaları ayrı microcentrifuge tüpler içine yerleştirin.</li>
	</ol>
</li>
	<li>Toplam DNA ayıklamak için PCR uyumlu şablon verir herhangi bir yalıtım yordamı kullanın; Bu iletişim kuralı basit bir şelasyon tabanlı yaklaşım gösteriyor.<ol>
<li>Kene parçası litik şelasyon reaktif (genellikle 50-200 µL arasında) uygun bir ses ekleyerek başlayın. Tutarı örnek boyutu ve şişkinliği durumuna bağlıdır; yönergeleri üretici tarafından sağlanmalıdır. Microtube havaneli kullanarak lunaparkçı.</li>
		<li>Bir su banyosunda 45 dk ve girdap için 60 ° C'de örnekleri kısaca kuluçkaya.</li>
		<li>Örnekleri için 16,276 x g (13,300 devir/dakika), 4 dk santrifüj kapasitesi bir masaüstü microcentrifuge.</li>
		<li>Süpernatant 50 µL isopropanol, mix inversiyon ve yeniden santrifüj kapasitesi olduğu gibi (1.2.3) içeren bir taze, etiketli microtube aktarın.</li>
		<li>Süpernatant dikkatle boşaltmak ve DNA Pelet 50 µL % 70 etanol ile durulayın.</li>
		<li>Bir pipet ile aşırı etanol kaldırmak ve Pelet oda sıcaklığında 15 dakika kurumasını bekleyin.</li>
		<li>DNA resuspend için 1 mM Tris pH 7,0 50 µL ekleyin ve bir su banyosu 60 ° C'de 1 h için örnekleri kuluçkaya DNA şimdi gelecekteki moleküler analiz için-20 ° C'de muhafaza edilebilir.</li>
	</ol>
</li>
</ol>2. iç içe PCR algılanması Borrelia OspA ve FlaB.
Not: Lorenz, 201233genel PCR ilkeleri ve uygulamaları genel bir bakış sağlanır.
<ol><li>Sentez veya Borrelia gene özgü dış ve iç Oligonükleotid astar alın. Astar setleri, onların anılan sıraya göre amplicon boyut ve erime sıcaklıkları için bkz: Tablo 1 .</li>
</ol><table border="1"><tbody>
<tr>
<td>Astar adı</td>
			<td>Gene hedef</td>
			<td colspan="2">Sıra (5' - 3')</td>
			<td>Amplicon boyutu</td>
			<td>Tavlama sıcaklığı</td>
		</tr>
<tr>
<td>FlaB Fw dışarı</td>
			<td>FlaB</td>
			<td colspan="2">gcatcactttcagggtctca</td>
			<td rowspan="2">503 bp</td>
			<td rowspan="2">55° C</td>
		</tr>
<tr>
<td>FlaB Rv dışarı</td>
			<td>FlaB</td>
			<td colspan="2">tggggaacttgattagcctg</td>
		</tr>
<tr>
<td>Fw flaB</td>
			<td>FlaB</td>
			<td colspan="2">ctttaagagttcatgttggag</td>
			<td rowspan="2">447 bp</td>
			<td rowspan="2">58° C</td>
		</tr>
<tr>
<td>FlaB Rv içinde</td>
			<td>FlaB</td>
			<td colspan="2">tcattgccattgcagattgt</td>
		</tr>
<tr>
<td>OspA Out Fw</td>
			<td>OspA</td>
			<td colspan="2">cttgaagttttcaaagaagat</td>
			<td rowspan="2">487 bp</td>
			<td rowspan="2">55° C</td>
		</tr>
<tr>
<td>OspA Out Rv</td>
			<td>OspA</td>
			<td colspan="2">caactgctgacccctctaat</td>
		</tr>
<tr>
<td>OspA Fw içinde</td>
			<td>OspA</td>
			<td colspan="2">acaagagcagacggaaccag</td>
			<td rowspan="2">350 bp</td>
			<td rowspan="2">58° C</td>
		</tr>
<tr>
<td>Rv içinde OspA</td>
			<td>OspA</td>
			<td colspan="2">ttggtgccatttgagtcgta</td>
		</tr>
</tbody></table>Tablo 1: Astar Borrelia burgdorferiFlaB ve OspA nPCR için iç ve dış. Uygulamada, B. burgdorferi s.s. ve diğer yakından ilgili Borrelia genospecies, sadece B. burgdorferi s.s. OspA astar yakalamak iken FlaB astar algılamak amplifikasyon her iki loci üzerinden B. göstermek burgdorferi. s.s.
<ol start="2"><li>UV ışık ve % 70 etanol PCR dolapla önceden sterilize. Not: potansiyel örnek kirlenme en aza indirmek için bu çalışma alanı kene diseksiyon, DNA ekstraksiyon, konumdan farklı olmalı ve Elektroforez jel.<ol>
<li>İlk PCR koşmak için dış astar DNA yukarıdaki 1,0 iyileşti ve Tablo 2' de açıklandığı gibi tepki karışımı ayarlayın şablonuyla birlikte kullanın. Buna paralel olarak, doğrulanmış Borrelia DNA oluşan denetim çalışır ve no-şablonu reaksiyonlar reaktif ve aerosol kirlenme tespit etmek de dahil olmak üzere negatif kontrol çalışan olumlu gerçekleştirin. DNA reaktifler olası bulaşma en aza indirmek için sona ekleyiniz. Her tüpün hiç otelde reaktifler değil eklenmektedir ve tüpler yakın hemen sonra DNA toplama ve diğer tüpler açılmadan önce kez kapalı olduğunu emin olun.</li>
		<li>Aşağıdaki gibi bir termal cycler programı: 95 ° C 5 dakika; 40 devredir 15 95 ° c sıcaklık 30 tavlama s, s, 45 72 ° C s; 72 ° C 5 min için; 4 ° C'de tutun</li>
	</ol>
</li>
	<li>PCR (2.2.2 içinde üretilen) ilk PCR ürününün 2 µL ile iç astar kullanmak dışında ilk tepki benzer ikinci tur gerçekleştirmek. Not: Tepki birimleri yeniden Tablo 2' de verilmektedir. Şablon DNA son eklenen ve tek tüpler bir örneğe karşılık gelen bir zaman açıktır sağlayarak amplicons Çapraz bulaşma kaçınmak için özen göstermelidir. 
	 
	<table border="1"><tbody>
<tr>
<td>Bileşen</td>
				<td>PCR # 1 birimleri</td>
				<td>PCR # 2 birimleri</td>
			</tr>
<tr>
<td>Taq polimeraz Master Mix 2 X</td>
				<td>12.5 ΜL</td>
				<td>12.5 ΜL</td>
			</tr>
<tr>
<td>Nükleaz ücretsiz su</td>
				<td>8,5 ΜL</td>
				<td>8,5 ΜL</td>
			</tr>
<tr>
<td>10 µM ileri ve geri astar</td>
				<td>1.0 µL dış astar</td>
				<td>1.0 µL iç astar</td>
			</tr>
<tr>
<td>DNA şablonu</td>
				<td>Örnek çıkarma (1.2.7) üzerinden 2.0 µL</td>
				<td>2.0 µL PCR (2.2.2) yuvarlak 1</td>
			</tr>
</tbody></table>
Tablo 2: PCR reaksiyon karışımları için birinci ve ikinci Arttırımlar. 
	 
	<ol>
<li>Daha önce olduğu gibi termal cycler programı ama (tablo 1'e bakınız) iç astar karşılamak için tavlama sıcaklığı ayarlayın.</li>
	</ol>
</li>
</ol>3. özel Jel Elektroforez ve görüntüleme
Not: DNA tarafından Elektroforez ayıran temel yönergeleri için bkz: Lee ve ark., 201234.
<ol><li>1 X seyreltilmiş 20 X SB tampon (0.2 M NaOH, 0, 8 M Borik asit pH 8) kullanarak bir % 1.2 özel jel hazırlamak ve jöleyi ön boyama isteniyorsa dökülmeden önce yaklaşık 5 µL DNA leke ekleyin.</li>
	<li>10 µL ikinci (iç) PCR reaksiyon gelen her deneysel ürün ve yanı sıra 100 bp merdiven (5 µL) denetimi örneğini yükleyin.<ol>
<li>107, 1 h için electrophorese V (5V/cm).</li>
	</ol>
</li>
	<li>Görüntülemek ve bir transilluminator ve ilişkili kamera ve yazılım kullanarak jel belge.</li>
</ol>

Yazarlar ifşa gerek yok.

Kullanım on yıl içinde PCR tabanlı teknikleri sürekli Eklem bacaklılar ve memeli örnekleri Borrelia tespiti onların değeri kanıtlamıştır Borrelia çevresel veya klinik kökenli gelir. PCR gözetim önceden varolan yaklaşımlar üzerinde birçok yenilik sunuyor. Özellikle, geliştirme ve Antikor Reaktif performansını üzerinde bağımlı değildir ve bunun yerine kolayca sadece astar sıralarını değiştirerek ilgi yeni hedefler tespit etmek için uyarlanabilir. PCR da tek başına veya bir multiplex tepki ile paralel, birden çok loci değerlendirilmesi barındırır. Taze ve arşivlenmiş keneler22, hayvan veya insan vücut sıvıları ve rezeke doku25de dahil olmak üzere çeşitli numune girişleri için uygulanabilir. PCR da daha fazla, restriksiyon enzimi sindirim, sonda hibridizasyon veya sıralama artan mikrobiyal kimlik21içgörü sağlamak için örneğin işlenebilir amplicons verir.
Konak immün yanıt üzerinde enfeksiyon ikincil bir ölçüsü olarak güvenmek yerine, bakteriyel varlığı hakkında doğrudan bir bilgi vermez gibi klinik bir araç olarak PCR standart serolojik teşhis için kavramsal olarak tercih edilir. Ancak, Lyme borreliosis nispeten mütevazı bir mikrobiyal yükü ile ilişkilidir (< idrar veya plazma 50 organizmalar/mL) ve25için yanlış negatif çıkmasına neden olabilir geçici spirochetemia neden olur. Bu teknik klinikte duyarlılığını önemli ölçüde doku türü, enfeksiyon ve örnek durum, aşamada % 12,5 ve kan, beyin omurilik sıvısı ve biyopsi doku36varolan çalışmalarda % 62 arasında düşülüyor bağlı olarak değişir. PCR bakteri kültürü ardından üstlenilen uygun spirochetes kurtarma klinik örneklerin en benzer şekilde zor kanıtlamıştır ancak moleküler duyarlılık sınırlamalar bir endişe değildir. Ancak son zamanlarda iletişim kuralları daha yüksek verim35için optimize edilmiştir. Bu arada, virüslü yetişkin kene gut ortalama olarak her yerde 2.000 nPCR algılama aralığı içinde sağlam olan 50.000'i aşkın Borrelia37,38,39, liman. Böylece, protokol kene gözetim çabalar için uygundur.
Birçok avantajları rağmen nPCR belli sorunlarla ve doğru bir şekilde kene enfeksiyon bu nedenle genler ve amplicons, kalite DNA kurtarmak titiz deneysel iş akışları stratejik seçime bağlıdır bildirmek için bu teknik kapasitesini teşkil etmez çapraz-pozlama örnekleri ve laboratuar ortamında ve reaktifler kirletici bildirmek uygun kontrollerin kullanımı en aza indirirken örnekler. Böylece uygun genetik loci ve bölgeler, seçilebilir herhangi bir deneme önce kapsam ve soruşturma niyetlerini açıkça tanımlanmalıdır. Amaç karmaşık Lyme neden Borrelia burgdorferi s.l. için tarafsız bir ekran sağlamak için ise, astar tüm benzer ilgi ile ilişkili suşlar algılamak için oluşturulacak ve yakalama olmadan amplifikasyon verimlilik, ilgisiz organizmalar25. Yeni astar tasarlanabilir ve uncharacterized örnekler için uygulanan önce biçilen silico her ne kadar onlar da deneysel olarak karşı standart referans doğrulanması gerektiğini astar-BLAST40gibi yazılım araçları kullanılarak izole ediyor. Sağlam mikrobiyal şablon bir karışık çevresel örnek (kene homogenate) kurtarmak için DNA ekstraksiyon yordamı hedefidir. İsteğe bağlı PCR ile devam etmeden önce ayıklanan DNA bütünlüğünü değerlendirmek için bir adımdır. Ayrıca, paralel reaksiyonlar kene bir temizlik gen hedeflemek için kurmak olabilir. İkinci yöntem da olumsuz Borrelia tepkiler organizmanın ve değil bir inhibitör kirletici varlığı nedeniyle olduğunu artan güven sağlayan tepki karışımı inhibitörleri varlığını gösterebilir.
İç içe geçmiş PCR yaklaşım duyarlılık arttı yanlış pozitif sonuçlar üretir potansiyel kirlilik pahasına geliyor. Eksojen şablonu bir örnek için kene diseksiyon ve DNA kurtarma sırasında veya kadar dış ve iç amplifikasyon tepkiler kurma sürecinde tanıttı. Bu nedenle özellikle PCR şablonu veya amplicon önlemek için en iyi uygulama protokolleri takip etmek önemlidir Çapraz bulaşma. Bunlar ayrı iş istasyonları ile bağımsız airflows, kapsama kullanımı PCR ve biyolojik Emanet dolapları uygun olan durumlarda, dahil kapsamlı kimyasal ve fiziksel temizlik ve sterilizasyon yüzeyler ve reaktifler ve DNA dikkatli işleme 41. No-şablonu denetimler de hisse senedi reaktifler kirlenme belirlenmesinde hayati vardır. NPCR belirli bir açığı bu işleme amplicon ilk tepki ürünleri ikinci PCR damar aktarma oluşur olduğunu. Hedef DNA zaten olumlu örnekler üstel zenginleştirme uğramıştır beri bu adımı Çapraz bulaşma özellikle eğilimli ve bir tek tüp nPCR protokol bu sınırlamayı aşmak için geliştirilmiştir. Bu yaklaşım, her iki kümesini astar için belirli bir gen de birlikte PCR31her iki tur için mühürlü kalacak bir tepki tüp eklenir. Öyle ki dış çift şablonu için iç astar yasak olduğunu yüksek tavlama sıcaklıkta yükselterek dış ve iç astar çiftleri thermodynamically farklı olması gerekir. İkinci turda, tavlama sıcaklığı iç çift karşılamak için indirilir. Sadece bu potansiyel karıştırıcı bir adım atlamak yok, Ayrıca ek kullanımına izin verir Anti-kirlenme ölçer31,42. Ancak, bu değişiklik bazı tahlil duyarlılık kurban. Yaklaşım ne olursa olsun, teknik çoğaltır bağımsız olarak bir örnek üzerinde gerçekleştirilen artırıldığında sahte kirlenme tanımlamak için yardımcı olacaktır.
Moleküler teknikleri nPCR giriş beri gelişmeye devam etmiştir ve bu yeni yaklaşımlar, mali gider artmış da olsa özgün tasarımlar, select avantajlar sunuyor. Adından da anlaşılacağı gibi kantitatif PCR (qPCR veya gerçek zaman (RT)-PCR) geleneksel teknikleri doğa43nitel olmakla birlikte bir örnek patojenler numaralandırılmasına olanak sağlar. QPCR duyarlılığını bildirildi nPCR38, benzer olsa da astar özellikleri28bağlı olarak değişebilir. Moleküler işaretleri (MB) geleneksel TaqMan sondalar yerine kullanır qPCR bir varyasyonu da Borrelia algılama içinde klinik örneklerin44,45,46söz göstermiştir. Kendi benzersiz ikincil yapı nedeniyle moleküler işaretleri bildirildi alt arka plan Floresans ve böylece üstün hassasiyet47sağlayarak daha yüksek meşru sinyalleri üretmek. Önceden klinik değerlendirme bir ve on spirochetes44,45arasında bir potansiyel algılama eşiği öneririz. Ayrıca, aynı anda bir memeli ev sahibi gen44 ve diğer kene patojenler45, hangi ile nPCR olarak kolayca ulaşılabilir değil algılamak için çok katmanlı reaksiyonlarda tekniği başarıyla uygulandı. Diğer tasarım değişiklikleri DNA bir standart eğri39,48kullanmadan ölçmek damlacık dijital PCR (ddPCR) teknolojisini içerir. Daha düşük algılama bu tekniğin için Borrelia aynı şekilde yaklaşık on spirochetes/örnek39sınırıdır. Onlar sadece bir tek amplifikasyon protokol gerektirir gibi nPCR için karşılaştırıldığında, bu yaklaşımlar da kontaminasyon için azaltılmış potansiyel avantajı var.
Gözetim amacı yerine bir kene çeşitli bakteri içeriğini profil ise, 16S rRNA metagenomic tarama bir çekici bir seçenek49olur. Bu yaklaşım costlier, tüm moleküler biyoloji laboratuvarlarında bulunamadı özel DNA sıralayıcılar için ve daha sofistike yorumu Biyoinformatik tabanlı gerektirir rağmen bu mikroplar daha geniş bir yelpazede doğru bir şekilde yakalayabilirsiniz vektör patojen yük temsil eder.
QPCR ve türevleri kantitatif uygulamaları için seçim yöntemlerini, metagenomics ekranlar kene microbiome geniş stoklar sunar iken ve hedeflenen gözetim çabalar kez varlığı ya da yokluğu ikili raporlama ile ilgili bir vektör bir veya bir kaç patojenler. Bu durumda, bu daha yeni, daha ayrıntılı yaklaşımların gereksiz karmaşıklık ve mali yük sürecine neden olabilir. Bu nedenlerden dolayı nPCR test kene önemli bir teknik olarak zaman test dayanmış.

Lyme hastalığı (LD) kuzey yarımkürede en yaygın vektör kaynaklı enfeksiyon, ve onun insidansı1artmaya devam ediyor. Bu zayıflatıcı hastalığı tarihsel baskın Kuzey Amerika patojen, B. kapsamaktadır (genellikle Borrelia burgdorferi sensu lato veya s.l. olarak adlandırılır), Lyme borreliosis (LB) karmaşık spirocheteal patojenlerin neden olduğu burgdorferi sensu stricto (s.s), B. afzelii ve B. garinii, Avrupa ve Asya yaygın ve klinik önemi2,3gelişen türlerin vardır ek olarak. Bu bakterilerin insanlara virüslü Ixodes keneler2. ısırık aracılığıyla aktarılır Ana Kuzey Amerika vektörel çizimler ı. scapularis ve ı. pacificusolmakla birlikte, bu cins içinde birden çok tür liman ve bakteri4iletmek için bulundu. İnsanlarda, B. burgdorferi cilt, eklemler, kalp, sinir sistemi, endokrin bezleri, gastrointestinal sistem ve iç organlar5,6,7etkileyen çoklu sistem semptomlara yol açabilir, 8,9,10. Hastalık kontrol ve Önleme Merkezi şu anda 300.000'den fazla yeni insan durumlarda her yıl Amerika Birleşik Devletleri11,12tahmin ediyor. Hastalık tanısı ve erken aşamalarında tedavi prognoz genellikle olumlu olsa da, çalışmalar bu yerde arasında % 10 ve tedavi sonrası farklı belirtilerle devam önerilen antibiyotik rejimi alınan hastaların % 60'ı tavsiye ettiler bırakma, bir fenomen olarak sonrası tedavi Lyme hastalığı Sendromu (PTLDS)13,14,15olarak adlandırdığı. Ayrıca, klinik müdahale gecikmeler kene ısırması bilincini, non-spesifik sunuyu ilk hastalık ve enfeksiyon başlangıcında kullanılan geleneksel seroloji tabanlı tanılama düşük duyarlılık eksikliği sonucu olarak ortaya çıkabilir. Hızlı ve uygun bir şekilde tedavi etmek için başarısızlık giderek komplikasyonlar16,17zayıflatıcı, meydana gelen belirti ilerleme sağlar. Lyme hastalığı önleme bu nedenle risk yönetimi taşıdır. Büyüyen bu tehdidi ile savaşmak için stratejiler patojen yaygınlık dilimleri belirtmek için sağlam gözetim önlemler ve endişe coğrafi bölgeleri tanımlar.
Bu makalede iç içe Polimeraz zincir reaksiyonu (nPCR) yardımcı programı enfekte keneler tanımlamak kullanılacak bir moleküler tarama aracı olarak gösterilmektedir. Özgüllüğü artırmak için iki Borrelia gen paralel amplifikasyon için kullanılır. Flagellin B (FlaB) kamçı18büyük filaman protein kodlar ve lipoprotein ürün dış yüzey protein A (OspA) kene midgut aracılık eder iken gen tek doğrusal kromozom üzerinde bulunan kolonizasyon, ve plazmid kodlanmış19,20' dir. İş akışı kene koleksiyonu, DNA ekstraksiyon ve o zaman PCR Borreliaalgılamak için ilk turunda oluşur-belirli loci. Sonraki PCR ürünü ilk tepki olan daha küçük, iç amplifikasyon parçaları oluşturmak için yeni bir şablon olarak kullanır. Her iki Borrelia genler üzerinden iç amplicons özel Jel Elektroforez tarafından tespit edilebilir bir kene Borrelia burgdorferi için pozitif kabul edilir.
Hem nPCR tekniği ve FlaB ve OspA gen hedefleri, yaygın olarak ekolojik gözetim ve Lyme Sfilis klinik algılama erken 1990'larda21,22,23 beri için kullanılmıştır ,24,25. Moleküler protokoller geliştirme önce keneler bağırsak içeriği boyama anti -Borrelia ayirt (Eğer), mikrobiyal kültür veya bunların bir kombinasyonu26subjecting tarafından değerlendirildi. Bu yaklaşımlar yavaş büyüme ve titiz doğa Borrelia27, antikor performans sorunları ve eğer işleme21canlı keneler şartı da dahil olmak üzere içerdiği sınırlamaları muzdarip. PCR daha sonra virüslü vektörler hızlı, hassas ve belirli kimlik sağlamak için kabul edilmiştir. Kültür bağımsız direkt uygulama için başka21,22 test etmek için uygun olacağını ölü ve arşivlenmiş kene gibi çeşitli örnek türleri de dahil olmak üzere geleneksel yöntemler üzerinde işaretli gelişmeler teklif . İç içe geçmiş deneysel tasarımlar daha fazla özgüllük ve klasik PCR hassasiyeti gene özgü astar amplifikasyon25,28iki ardışık tur iki ayrı takım istihdam ederek geliştirmek.
Deneysel başarısı stratejik gen seçimi ve amplicon tasarım üzerinde eleştirel bağlıdır. Borrelia burgdorferivarlığı doğru bir şekilde tahmin etmek için astar ilgili patojenler depreşen spirochetes da Borrelia Sylviidae ile cross-reacting olmadan algılaması gerekir. FlaBsöz konusu olduğunda, bir değişken iç bölge çeşitli bakteri (şekil 1)24,29 tarafından paylaşılır nispeten korunmuş kanat dizileri yerine gen hedefleyerek bu özgüllüğü elde edilir , 30.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56471/56471fig1.jpg"> Şekil 1: kullanma gösterildiği gibi nPCR, kavramı Borrelia FlaB bir hedef olarak gen. Gen 5' ve 3' termini organizmalar bu bölgelerini Lyme neden olan patojen belirli değerlendirilmesi için uygun olmayan işleme Borrelia burgdorferi s.l. ötesinde yaygındır. Daha az korunmuş iç dizileri astar hedef olarak kullanılarak, PCR iki tur final, iç amplicon algılamak için yürütülür. <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56471/56471fig1large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
Ayrımcı kapasitelerini test, iç FlaB astar 80'den fazla farklı Borrelia yalıtır ile değerlendirildi ve sadece o Lyme hastalığı24ile ilişkili tanımlamak için bulundu. Duyarlılığı daha da Güney amplicon kurutma ve radiolabelled bir hybridizing tarafından geliştirilmiş rağmen nPCR alt algılama sınırı, altı24 ve saf kültür, on31 bakterilerden arasında belgelenmiş oldu veya chemiluminescent sonda. Teknikleri kaplin algılama eşiği tek Sfilis31azaltır. Doğrudan karşılaştırma tarafından geleneksel, unprobed tek yönlü PCR en az 104 spirochetes31varlığı rapor bulundu. Bu, ancak, tahlil duyarlılık ilgisiz DNA ve potansiyel inhibitör maddeler ezici varlığı nedeniyle karmaşık çevre ve klinik örnekleri ile çalışırken düşük olacağı unutulmamalıdır. Bu sorunlar büyük ölçüde nPCR kullanımı ile atlatılabilir.
Son on yıl içinde moleküler teknoloji gelişmeler rağmen nPCR modern gözetim çabalarında bir zımba teknik kalır. Tasarım ve yürütme bu protokol özen, kene vektörel çizimler patojenler varlığı yakalamak için güçlü, uyarlanabilir ve nispeten basit bir yaklaşım tek.

<table border="0" cellpadding="0" cellspacing="0" width="830">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:299px;">LabGard Class II, Type A2 biological safety cabinet</td>
			<td style="width:192px;">Nuaire</td>
			<td style="width:140px;">ES AIR NU-543&#160;</td>
			<td style="width:199px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Razor blades</td>
			<td style="width:192px;">VWR</td>
			<td style="width:140px;">55411-050</td>
			<td>0.22 mm thickness</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Microfuge Tubes (Microtubes 1.5 mL)</td>
			<td style="width:192px;">Axygen</td>
			<td style="width:140px;">311-08-051</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:299px;">AquaGenomic&#160;</td>
			<td style="width:192px;">MultiTarget Pharmaceuticals</td>
			<td style="width:140px;">2030</td>
			<td>DNA extraction reagent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Microtube Pestle</td>
			<td style="width:192px;">Diamed</td>
			<td style="width:140px;">DIATEC610-1551</td>
			<td>Designed for 1.5 ml tubes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Water bath - Isotemp 202</td>
			<td style="width:192px;">Fishse Scientific</td>
			<td style="width:140px;">15-462-2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Vortex</td>
			<td style="width:192px;">Labnet</td>
			<td style="width:140px;">S0100 CAN</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Spectrafuge 24D Digital Microcentrifuge</td>
			<td style="width:192px;">Labnet</td>
			<td style="width:140px;">C2400</td>
			<td style="width:199px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Isopropanol</td>
			<td style="width:192px;">Sigma-Aldrich</td>
			<td style="width:140px;">190764</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">BIS-TRIS</td>
			<td style="width:192px;">Sigma-Aldrich</td>
			<td style="width:140px;">B9754</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Primer Synthesis</td>
			<td style="width:192px;">Sigma-Aldrich</td>
			<td style="width:140px;">OLIGO</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">PCR Cabinet</td>
			<td style="width:192px;">Misonix</td>
			<td style="width:140px;">PCR6-482</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">PCR tube with attached flat caps 0.2mL</td>
			<td style="width:192px;">VWR</td>
			<td style="width:140px;">20170-012</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">GoTaq Green Master Mix 2x</td>
			<td style="width:192px;">Promega</td>
			<td style="width:140px;">M7123</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Nuclease-free water</td>
			<td style="width:192px;">Promega</td>
			<td style="width:140px;">M7123</td>
			<td>The water comes with the GTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Spectrafuge Mini</td>
			<td style="width:192px;">Labnet</td>
			<td style="width:140px;">C1301</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:299px;">SYBR Safe DNA Stain 10,000X Concentration</td>
			<td style="width:192px;">EDVOTEK</td>
			<td style="width:140px;">608</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:299px;">Froggarose LE (Molecular Biology Grade Agarose)</td>
			<td style="width:192px;">FroggaBio</td>
			<td style="width:140px;">A87-500G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">GD 100 bp DNA Ladder</td>
			<td style="width:192px;">FroggaBio</td>
			<td style="width:140px;">DM001-R500&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:299px;">Electrophoresis power pack&#160;</td>
			<td style="width:192px;">VWR</td>
			<td style="width:140px;">VWR 105</td>
			<td>EC Apparatus Corporation</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:299px;">Fluor-S MultiImager&#160;</td>
			<td style="width:192px;">BioRad</td>
			<td style="width:140px;">170-7700 (Serial number 433B0154)</td>
			<td></td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:299px;">Quantity One 1-D Analysis Software (V. 4.5.2)</td>
			<td style="width:192px;">BioRad</td>
			<td style="width:140px;">1709600</td>
			<td></td>
		</tr>
	</tbody>
</table>

detecting the lyme disease spirochete, borrelia burgdorferi, in ticks using nested pcr

Lyme hastalığı Borrelia burgdorferi sensu lato ailesinin insana enfekte Ixodes kene ısırması ile bulaşan spirochetes neden olduğu ciddi bir vektör kaynaklı enfeksiyondur. Kuzey Amerika'da birincil etyolojik Ajan Borrelia burgdorferi sensu stricto değil. Gibi coğrafi risk bölgeleri genişler, kene enfeksiyon oranları ölçmek ve bulgular klinisyenler, veterinerler ve halkın geneli için iletişim sağlam gözetim programları desteklemek ihtiyatlı olduğunu. İç içe geçmiş Polimeraz zincir reaksiyonu (nPCR) moleküler tekniğin uzun bu amaç için kullanılan ve algılama Borrelia keneler ve yabani hayvanlar ve bitkiler Merkezi, ucuz ve sağlam bir yaklaşımda kalır.
Bu makalede virüslü numuneler tanımlamak için DNA özleri kene için nPCR uygulanması gösterilmektedir. İki bağımsız B. burgdorferi hedefler, genlerin kodlama Flagellin B (FlaB) ve dış yüzey protein A (OspA), kullanılan kapsamlı bu tekniği ile. Kene koleksiyonu, DNA ekstraksiyon ve sonra her iki Borreliaalgılamak için PCR ilk turunda protokol içerir-belirli loci. Sonraki Polimeraz zincir tepkimesi (PCR) ilk tepki ürün daha küçük, iç amplifikasyon parçaları oluşturmak için yeni bir şablon olarak kullanılır. İç içe geçmiş yaklaşım özgüllük ve geleneksel PCR hassasiyeti geliştirir. Her iki Borrelia genler üzerinden iç amplicons özel Jel Elektroforez tarafından tespit edilebilir bir kene için patojen pozitif kabul edilir.

nPCR özellikle karmaşık çevre örnekleri soruşturma altında olduğunda özgüllük ve patojen algılama, duyarlılığını artırmak için zarif bir yaklaşımdır. Şekil 1' de gösterildiği gibi iki tur Borrelia FlaB odağı (ve OspAresimde değil,) stratejik bir bölgede hedefleyen PCR kısa iç nesil aracılığıyla Borrelia burgdorferi bakteri varlığı bildirebilirsiniz amplicons. Jel Elektroforez tarafından çözüldü zaman her kene FlaB ve OspA reaksiyon Urun olabilir görsel olarak attı ve denetimleri karşı karşılaştırıldığında. Şekil 2, benzersiz numune tanımlayıcıları her jel üst kısmında sağlanır ve no-şablonu ve aerosol denetimleri, sol ve sağ, sırasıyla, merdivenler için bitişik temsil edilir.
Sağlam amplicon bantları select deneysel örnekleri açıkça görülebilir ve ihtiyaç fazlası astar ve kalan DNA (Şekil 2) kolayca ayırt edilirler. Belirtilen deneysel tasarım ilkelerine dayanan, bir kene için Borrelia paralel zaman negatif denetimler hiçbir amplifikasyon gösterir ve iç amplicons FlaB ve OspA astar üretilen pozitif olarak kabul edilir. Bu durumda, örnek T907, T604 ve T606 için Lyme patojen (Şekil 2) gözetim kriterlerini karşıladı. By Contrast, T923 sadece OspAiçin birden çok olası açıklaması vardır bir sonuç pozitif: A) kökenli kene Borreliaiçin negatif çıktı, ama dış veya iç OspA PCR hazırlık spuriously ile kontamine yapıldı. Şablon DNA (reaktifler sistemik bulaşma yolu ile negatif denetimleri ekarte Not), B) BorreliaLyme kene taşıdı, ancak düşük şablon tutarlar veya deneysel hata engelledi amplifikasyon FlaBveya C) bir organizma mevcuttu Bu korunmuş OspA sıra yer alan ama Flagellin yoksun veya astar için tavlamak için FlaB hedeflenen bölgede yetersiz kimlik vardı. Gerçekten de, OspA sıra benzerlikler bitki ve hayvan28da dahil çeşitli gözlemlemekteyiz. Converse durum, daha fazla amplifikasyon Flagellin gen, ama OspA gene korunmuş, ilişkili bir Borrelia tür olduğunu gösterebilir. Uygulamada, bu iletişim kuralını senaryo 'A' en muhtemel açıklama olduğunu düşündüren FlaB astar yapmak daha fazla OspA tek pozitif sonuç verir. Çekişmeli numune deneysel analizi daha fazla, ancak, bu tek pozitif sonuç kaynağını belirlemek mümkün değildir. Belirsiz örnekleri üzerinde gerçekleştirilen teknik çoğaltır sayısını artırarak spuriously önceki tepkiler sunulan herhangi bir kirletici arşivlenmiş DNA'mevcut olmaz bu yana doğru onların durumu, uzlaştırmak için yardımcı olabilir. Ancak, bu astar sonraki reaksiyon kesin sonuçlar sağlamak için başarısız olursa, diğer Borrelia loci PCR tarafından soruşturma. Bu tepkiler oluşturulan Amplicons Ayrıca sıralı ve yalıtır arasında kimlik atamak ve gerilme sapma derecesini tahmin etmek için karşılaştırıldığında. Sapı ve arkadaşları insan klinik örnekler35kullanarak bu iş akışı için bir örnek sağlar.
Tüm faktörler olarak kabul, anahatları belirlenmiş iletişim kuralı ve yorumu kriterleri %0.17, %0.0063, yanlış pozitif ve yanlış negatif oranları sırasıyla verim için tahmin edilmiştir.
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56471/56471fig2.jpg"> Resim 2 : Hafiye-in Borrelia burgdorferi nPCR tarafından tek tek dilimleri FlaB ve OspA. Her kene için atanan kodları jelleri üst kısmında gösterilir ve kimlik tespiti OspA ve FlaB her örnek içinde bildirmek için dikey olarak hizalama. Şerit B sol tarafındaki görüntü temsil no-şablonu denetimler biletlerinde (sağ şerit) laboratuar ortamında kirlenme yakalamak için aerosol denetimleridir. <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56471/56471fig2large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>

Watch this Scientific Journal Video about Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR at JoVE.com

Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR

İç içe geçmiş PCR DNA Borrelia burgdorferiiçin hastalığının Lyme hastalığı araştırma ayıklar kene için uygulanan hassas, belirli ve basit bir tekniktir. İlk PCR deney gene özgü astar iç primerler kullanılarak bir sonraki tepki için şablonlar haline uzun amplicons oluşturmak için kullanılır.

İç içe geçmiş PCR kullanarak keneler Lyme hastalığı Sfilis, Borrelia Burgdorferi, algılama

Lyme disease is a serious vector-borne infection that is caused by the Borrelia burgdorferi sensu lato family of spirochetes, which are transmitted to ...

detecting-lyme-disease-spirochete-borrelia-burgdorferi-ticks-using

Nanyang Technological University

Research

JoVE Journal

Biology

Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR

17.8K Görüntüleme.  Mount Allison University. İç içe geçmiş PCR DNA Borrelia burgdorferiiçin hastalığının Lyme hastalığı araştırma ayıklar kene için uygulanan hassas, belirli ve basit bir tekniktir. İlk PCR deney gene özgü astar iç primerler kullanılarak bir sonraki tepki için şablonlar haline uzun amplicons oluşturmak için kullanılır.

Video: Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR

Quantitative Real-Time PCR using the Thermo Scientific Solaris qPCR Assay

The Solaris qPCR Gene Expression Assay is a novel type of primer/probe set, designed to simplify the qPCR process while maintaining the sensitivity and accuracy of the assay. These primer/probe sets are pre-designed to &gt;98% of the human and mouse genomes and feature significant improvements from previously available technologies. These improvements were made possible by virtue of a novel design algorithm, developed by Thermo Scientific bioinformatics experts.
Several convenient features have been incorporated into the Solaris qPCR Assay to streamline the process of performing quantitative real-time PCR. First, the protocol is similar to commonly employed alternatives, so the methods used during qPCR are likely to be familiar. Second, the master mix is blue, which makes setting the qPCR reactions easier to track. Third, the thermal cycling conditions are the same for all assays (genes), making it possible to run many samples at a time and reducing the potential for error. Finally, the probe and primer sequence information are provided, simplifying the publication process.
Here, we demonstrate how to obtain the appropriate Solaris reagents using the GENEius product search feature found on the ordering web site (www.thermo.com/solaris) and how to use the Solaris reagents for performing qPCR using the standard curve method.

The Solaris qPCR Gene Expression Assays are novel pre-designed qPCR primer/probe combinations designed to simplify the qPCR process without sacrificing the specificity and robustness of the assay.

Thermo Scientific Solaris qPCR Testi kullanarak Kantitatif Real-Time PCR

The Solaris qPCR Gene Expression Assay is a novel type of primer/probe set, designed to simplify the qPCR process while maintaining the sensitivity and ...

Biyoloji

Quantification of &gamma;H2AX Foci in Response to Ionising Radiation

DNA double-strand breaks (DSBs), which are induced by either endogenous metabolic processes or by exogenous sources, are one of the most critical DNA lesions with respect to survival and preservation of genomic integrity. An early response to the induction of DSBs is phosphorylation of the H2A histone variant, H2AX, at the serine-139 residue, in the highly conserved C-terminal SQEY motif, forming &gamma;H2AX1. Following induction of DSBs, H2AX is rapidly phosphorylated by the phosphatidyl-inosito 3-kinase (PIKK) family of proteins, ataxia telangiectasia mutated (ATM), DNA-protein kinase catalytic subunit and ATM and RAD3-related (ATR)2. Typically, only a few base-pairs (bp) are implicated in a DSB, however, there is significant signal amplification, given the importance of chromatin modifications in DNA damage signalling and repair. Phosphorylation of H2AX mediated predominantly by ATM spreads to adjacent areas of chromatin, affecting approximately 0.03% of total cellular H2AX per DSB2,3. This corresponds to phosphorylation of approximately 2000 H2AX molecules spanning ~2 Mbp regions of chromatin surrounding the site of the DSB and results in the formation of discrete &gamma;H2AX foci which can be easily visualized and quantitated by immunofluorescence microscopy2. The loss of &gamma;H2AX at DSB reflects repair, however, there is some controversy as to what defines complete repair of DSBs; it has been proposed that rejoining of both strands of DNA is adequate however, it has also been suggested that re-instatement of the original chromatin state of compaction is necessary4-8. The disappearence of &gamma;H2AX involves at least in part, dephosphorylation by phosphatases, phosphatase 2A and phosphatase 4C5,6. Further, removal of &gamma;H2AX by redistribution involving histone exchange with H2A.Z has been implicated7,8. Importantly, the quantitative analysis of &gamma;H2AX foci has led to a wide range of applications in medical and nuclear research. Here, we demonstrate the most commonly used immunofluorescence method for evaluation of initial DNA damage by detection and quantitation of &gamma;H2AX foci in &gamma;-irradiated adherent human keratinocytes9.

Quantification of &#947;H2AX Foci in Response to Ionising Radiation

Quantification of DNA double-strand streaks using &gamma;H2AX formation as a molecular marker has become an invaluable tool in radiation biology. Here we demonstrate the use of an immunofluorescence assay for quantification of &gamma;H2AX foci after exposure of cells to radiation.

İyonlaştırıcı Radyasyon Cevabı γH2AX Foci Kantitasyonu

DNA double-strand breaks (DSBs), which are induced by either endogenous metabolic processes or by exogenous sources, are one of the most critical DNA ...

Analysis of Gene Expression in Emerald Ash Borer (Agrilus planipennis) Using Quantitative Real Time-PCR

Emerald ash borer (EAB, Agrilus planipennis) is an exotic invasive pest, which has killed millions of ash trees (Fraxinus spp) in North America. EAB continues to spread rapidly and attacks ash trees of different ages, from saplings to mature trees. However, to date very little or no molecular knowledge exists for EAB. We are interested in deciphering the molecular-based physiological processes at the tissue level that aid EAB in successful colonization of ash trees. In this report we show the effective use of quantitative real-time PCR (qRT-PCR) to ascertain mRNA levels in different larval tissues (including midgut, fat bodies and cuticle) and different developmental stages (including 1st-, 2nd-, 3rd-, 4th-instars, prepupae and adults) of EAB. As an example, a peritrophin gene (herein named, AP-PERI1) is exemplified as the gene of interest and a ribosomal protein (AP-RP1) as the internal control. Peritrophins are important components of the peritrophic membrane/matrix (PM), which is the lining of the insect gut. The PM has diverse functions including digestion and mechanical protection to the midgut epithelium.

Analysis of Gene Expression in Emerald Ash Borer Agrilus planipennis Using Quantitative Real Time-PCR

Quantitative real-time PCR (qRT-PCR) is an effective tool to diagnose mRNA levels in different insect tissues and developmental stages. In this report we show the use of qRT-PCR to ascertain mRNA levels in different larval tissues and developmental stages of the invasive insect species, emerald ash borer.

Emerald Kül Freze Gen İfade Analizi ( Agrilus planipennis) Kullanarak Kantitatif Real Time PCR

Emerald ash borer (EAB, Agrilus planipennis) is an exotic invasive pest, which has killed millions of ash trees (Fraxinus spp) in North America. EAB ...

Rapid PCR Thermocycling using Microscale Thermal Convection

Many molecular biology assays depend in some way on the polymerase chain reaction (PCR) to amplify an initially dilute target DNA sample to a detectable concentration level. But the design of conventional PCR thermocycling hardware, predominantly based on massive metal heating blocks whose temperature is regulated by thermoelectric heaters, severely limits the achievable reaction speed1. Considerable electrical power is also required to repeatedly heat and cool the reagent mixture, limiting the ability to deploy these instruments in a portable format.
Thermal convection has emerged as a promising alternative thermocycling approach that has the potential to overcome these limitations2-9. Convective flows are an everyday occurrence in a diverse array of settings ranging from the Earth's atmosphere, oceans, and interior, to decorative and colorful lava lamps. Fluid motion is initiated in the same way in each case: a buoyancy driven instability arises when a confined volume of fluid is subjected to a spatial temperature gradient. These same phenomena offer an attractive way to perform PCR thermocycling. By applying a static temperature gradient across an appropriately designed reactor geometry, a continuous circulatory flow can be established that will repeatedly transport PCR reagents through temperature zones associated with the denaturing, annealing, and extension stages of the reaction (Figure 1). Thermocycling can therefore be actuated in a pseudo-isothermal manner by simply holding two opposing surfaces at fixed temperatures, completely eliminating the need to repeatedly heat and cool the instrument.
One of the main challenges facing design of convective thermocyclers is the need to precisely control the spatial velocity and temperature distributions within the reactor to ensure that the reagents sequentially occupy the correct temperature zones for a sufficient period of time10,11. Here we describe results of our efforts to probe the full 3-D velocity and temperature distributions in microscale convective thermocyclers12. Unexpectedly, we have discovered a subset of complex flow trajectories that are highly favorable for PCR due to a synergistic combination of (1) continuous exchange among flow paths that provides an enhanced opportunity for reagents to sample the full range of optimal temperature profiles, and (2) increased time spent within the extension temperature zone the rate limiting step of PCR. Extremely rapid DNA amplification times (under 10 min) are achievable in reactors designed to generate these flows.

We describe a novel method to perform DNA replication via the polymerase chain reaction (PCR). Thermal convection is harnessed to continuously shuttle reagents between denaturing, annealing, and extension conditions by maintaining opposing surfaces of the reactor at constant temperature. This inherently simple design promises to make rapid PCR more accessible.

Mikro Termal Isı Yayımı kullanarak Rapid PCR Thermocycling

Many molecular biology assays depend in some way on the polymerase chain reaction (PCR) to amplify an initially dilute target DNA sample to a detectable ...

Using SecM Arrest Sequence as a Tool to Isolate Ribosome Bound Polypeptides

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway that polypeptide chain follows during co-translational folding to achieve its functional form is still an enigma. In order to understand this process and to determine the exact conformation of the co-translational folding intermediates, it is essential to develop techniques that allow the isolation of RNCs carrying nascent chains of predetermined sizes to allow their further structural analysis.
SecM (secretion monitor) is a 170 amino acid E. coli protein that regulates expression of the downstream SecA (secretion driving) ATPase in the secM-secA operon6. Nakatogawa and Ito originally found that a 17 amino acid long sequence (150-FSTPVWISQAQGIRAGP-166) in the C-terminal region of the SecM protein is sufficient and necessary to cause stalling of SecM elongation at Gly165, thereby producing peptidyl-glycyl-tRNA stably bound to the ribosomal P-site7-9. More importantly, it was found that this 17 amino acid long sequence can be fused to the C-terminus of virtually any full-length and/or truncated protein thus allowing the production of RNCs carrying nascent chains of predetermined sizes7. Thus, when fused or inserted into the target protein, SecM stalling sequence produces arrest of the polypeptide chain elongation and generates stable RNCs both in vivo in E. coli cells and in vitro in a cell-free system. Sucrose gradient centrifugation is further utilized to isolate RNCs.
The isolated RNCs can be used to analyze structural and functional features of the co-translational folding intermediates. Recently, this technique has been successfully used to gain insights into the structure of several ribosome bound nascent chains10,11. Here we describe the isolation of bovine Gamma-B Crystallin RNCs fused to SecM and generated in an in vitro translation system.

We describe here a technique that is now routinely used to isolate stably bound ribosome nascent chain complexes (RNCs). This technique takes advantage of the discovery that a 17 amino acid long SecM "arrest sequence" can halt translation elongation in a prokaryotic (E. coli) system, when inserted into (or fused to the C-terminus) of virtually any protein.

Ribozom Ciltli Polipeptitler izole bir aracı olarak SECM Tutuklanma sırası kullanılarak

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway ...

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Transposon mutagenesis and single-gene deletion are two methods applied in genome-wide gene knockout in bacteria 1,2. Although transposon mutagenesis is less time consuming, less costly, and does not require completed genome information, there are two weaknesses in this method: (1) the possibility of a disparate mutants in the mixed mutant library that counter-selects mutants with decreased competition; and (2) the possibility of partial gene inactivation whereby genes do not entirely lose their function following the insertion of a transposon. Single-gene deletion analysis may compensate for the drawbacks associated with transposon mutagenesis. To improve the efficiency of genome-wide single gene deletion, we attempt to establish a high-throughput technique for genome-wide single gene deletion using Streptococcus sanguinis as a model organism. Each gene deletion construct in S. sanguinis genome is designed to comprise 1-kb upstream of the targeted gene, the aphA-3 gene, encoding kanamycin resistance protein, and 1-kb downstream of the targeted gene. Three sets of primers F1/R1, F2/R2, and F3/R3, respectively, are designed and synthesized in a 96-well plate format for PCR-amplifications of those three components of each deletion construct. Primers R1 and F3 contain 25-bp sequences that are complementary to regions of the aphA-3 gene at their 5' end. A large scale PCR amplification of the aphA-3 gene is performed once for creating all single-gene deletion constructs. The promoter of aphA-3 gene is initially excluded to minimize the potential polar effect of kanamycin cassette. To create the gene deletion constructs, high-throughput PCR amplification and purification are performed in a 96-well plate format. A linear recombinant PCR amplicon for each gene deletion will be made up through four PCR reactions using high-fidelity DNA polymerase. The initial exponential growth phase of S. sanguinis cultured in Todd Hewitt broth supplemented with 2.5% inactivated horse serum is used to increase competence for the transformation of PCR-recombinant constructs. Under this condition, up to 20% of S. sanguinis cells can be transformed using ~50 ng of DNA. Based on this approach, 2,048 mutants with single-gene deletion were ultimately obtained from the 2,270 genes in S. sanguinis excluding four gene ORFs contained entirely within other ORFs in S. sanguinis SK36 and 218 potential essential genes. The technique on creating gene deletion constructs is high throughput and could be easy to use in genome-wide single gene deletions for any transformable bacteria.

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

An efficient genome-wide single gene mutation method has been established using Streptococcus sanguinis as a model organism. This method has achieved via high throughput recombinant PCRs and transformations.

Genom çapında Gen Delesyonlar içinde<em&gt; Streptococcus sanguinis</em&gt; Yüksek Verimli PCR ile

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present methods for the development of assays to query potentially clinically significant nonsynonymous changes using in vivo complementation in zebrafish. Zebrafish (Danio rerio) are a useful animal system due to their experimental tractability; embryos are transparent to enable facile viewing, undergo rapid development ex vivo, and can be genetically manipulated.1 These aspects have allowed for significant advances in the analysis of embryogenesis, molecular processes, and morphogenetic signaling. Taken together, the advantages of this vertebrate model make zebrafish highly amenable to modeling the developmental defects in pediatric disease, and in some cases, adult-onset disorders. Because the zebrafish genome is highly conserved with that of humans (~70% orthologous), it is possible to recapitulate human disease states in zebrafish. This is accomplished either through the injection of mutant human mRNA to induce dominant negative or gain of function alleles, or utilization of morpholino (MO) antisense oligonucleotides to suppress genes to mimic loss of function variants. Through complementation of MO-induced phenotypes with capped human mRNA, our approach enables the interpretation of the deleterious effect of mutations on human protein sequence based on the ability of mutant mRNA to rescue a measurable, physiologically relevant phenotype. Modeling of the human disease alleles occurs through microinjection of zebrafish embryos with MO and/or human mRNA at the 1-4 cell stage, and phenotyping up to seven days post fertilization (dpf). This general strategy can be extended to a wide range of disease phenotypes, as demonstrated in the following protocol. We present our established models for morphogenetic signaling, craniofacial, cardiac, vascular integrity, renal function, and skeletal muscle disorder phenotypes, as well as others.

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present a systematic approach for developing physiologically relevant, sensitive and specific in vivo assays for interpreting variation in human pathology. Transient genetic manipulation via microinjection of WT and mutant human mRNA and morpholino (MO) antisense oligonucleotides harness the tractability of the developing zebrafish embryo to rapidly assay pathogenic mutations, especially, but not exclusively, in the context of human developmental disorders.

Br.rerio kullanarak Morbid İnsan Genomu İn Vivo Modelleme

Here,  we present methods for the development of assays to query potentially clinically  significant nonsynonymous changes using in  vivo complementation ...

Rapid and Efficient Zebrafish Genotyping Using PCR with High-resolution Melt Analysis

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic tools have been introduced, including multiple strategies for inducing mutations and generating transgenic lines. However, large-scale screening is limited by traditional genotyping methods, which are time-consuming and labor-intensive. Here we describe a technique to analyze zebrafish genotypes by PCR combined with high-resolution melting analysis (HRMA).&#160;This approach is rapid, sensitive, and inexpensive, with lower risk of contamination artifacts.&#160;Genotyping by PCR with HRMA can be used for embryos or adult fish, including in high-throughput screening protocols.

PCR combined with high-resolution melt analysis (HRMA) is demonstrated as a rapid and efficient method to genotype zebrafish.

Yüksek çözünürlüklü Melt Analizi ile PCR kullanarak hızlı ve verimli Zebra Genotiplemesi

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different lineages. A single cell transcriptome assay can be a new approach for dissecting individual variation. We have developed the single cell qRT-PCR method, and confirmed that this method works well in several gene expression profiles. In single cell level, each human embryonic stem cell, sorted by OCT4::EGFP positive cells, has high expression in OCT4, but a different level of NANOG expression. Our single cell gene expression assay should be useful to interrogate population heterogeneities.

Single cell gene expression assay is needed for understanding stem cell heterogeneities.

Kantitatif RT-PCR ile Bireysel İnsan Embriyonik Kök Hücreleri profilleme

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...

Detecting Estrogenic Ligands in Personal Care Products using a Yeast Estrogen Screen Optimized for the Undergraduate Teaching Laboratory

The Yeast Estrogen Screen (YES) is used to detect estrogenic ligands in environmental samples and has been broadly applied in studies of endocrine disruption. Estrogenic ligands include both natural and manmade &#34;Environmental Estrogens&#34; (EEs) found in many consumer goods including Personal Care Products (PCPs), plastics, pesticides, and foods. EEs disrupt hormone signaling in humans and other animals, potentially reducing fertility and increasing disease risk. Despite the importance of EEs and other Endocrine Disrupting Chemicals (EDCs) to public health, endocrine disruption is not typically included in undergraduate curricula. This shortcoming is partly due to a lack of relevant laboratory activities that illustrate the principles involved while also being accessible to undergraduate students. This article presents an optimized YES for quantifying ligands in personal care products that bind estrogen receptors alpha (ER&#945;) and/or beta (ER&#946;). The method incorporates one of the two colorimetric substrates (ortho-nitrophenyl-&#946;-D-galactopyranoside (ONPG) or chlorophenol red-&#946;-D-galactopyranoside (CPRG)) that are cleaved by &#946;-galactosidase, a 6-day refrigerated incubation step to facilitate use in undergraduate laboratory courses, an automated application for LacZ calculations, and R code for the associated 4-parameter logistic regression analysis. The protocol has been designed to allow undergraduate students to develop and conduct experiments in which they screen products of their choosing for estrogen mimics. In the process, they learn about endocrine disruption, cell culture, receptor binding, enzyme activity, genetic engineering, statistics, and experimental design. Simultaneously, they also practice fundamental and broadly applicable laboratory skills, such as: calculating concentrations; making solutions; demonstrating sterile technique; serially diluting standards; constructing and interpolating standard curves; identifying variables and controls; collecting, organizing, and analyzing data; constructing and interpreting graphs; and using common laboratory equipment such as micropipettors and spectrophotometers. Thus, implementing this assay encourages students to engage in inquiry-based learning while exploring emerging issues in environmental science and health.

This article presents an optimized yeast estrogen screen for quantifying ligands in Personal Care Products (PCPs) that bind estrogen receptors alpha (ER&#945;) and/or beta (ER&#946;). The method incorporates two colorimetric substrate options, a six-day refrigerated incubation for use in undergraduate courses, and statistical tools for data analysis.