O apoio financeiro para este estudo foi fornecido pelo Programa Nacional de Pesquisa e Desenvolvimento Chave (2016YFC1200601) e a Fundação Nacional de Ciências Naturais da China (31390421).

1. Criação de mosca branca e identificação de espécies criptípicas <ol><li> Manter as espécies de moscas brancas em algodão Gossypium hirsutum (Malvaceae) (cv. Zhe-Mian 1973) em gaiolas sob condições padrão de 27 ± 1 ° C, 70 ± 10% de umidade e 14 h de luz: 10 h de regime escuro. </li><li> Recolher uma mosca branca branca individual e homogeneizar em 30 μL de tampão de lise (Tris 10 mM, pH 8,4, KCl 50 mM, 0,45% [wt / vol] Tween-20, 0,2% [wt / vol] de gelatina, 0,45% [vol / Vol] Nonidet P 40, 60 g / mL Proteinase K). </li><li> Incubar o homogeneizado a 65 ° C durante 1 h e depois 100 ° C durante 10 min. NOTA: O tempo de incubação a 65 ° C pode ser aumentado, se necessário. O tempo de incubação a 100 ° C deve ser controlado criticamente para inativar suficientemente a Proteinase K e evitar danos no DNA. </li><li> Realize a reação em cadeia da polimerase (PCR) usando DNA de mosca branca (adquirido na seção 1.3) com base nos iniciadores mitocondriais de citocromo oxidase I. COI-F: 5&#39;-TTGATTTTTTGGTCATCCAGAAGT-3 &#39; COI-R: 5&#39;-TAATATGGCAGATTAGTGCATTGGA-3 &#39; <ol><li> Realize as reações de PCR em um volume final de 25 μL contendo 1 U de polimerase de ADN Taq , 2,5 μL de tampão 10x, dNTP 0,2 mM, 0,2 mM de cada iniciador e 2 μL de DNA de mosca branca. </li><li> Utilize as seguintes condições de procedimento de PCR: desnaturação inicial 95 ° C durante 3 minutos seguido de 35 ciclos de 95 ° C durante 45 s (desnaturação), 50 ° C durante 45 s (recozimento) e 72 ° C durante 1 min (extensão) e Outros 10 min a 72 ° C para maior extensão. </li></ol></li><li> Limpe o produto amplificado por PCR usando um kit de extração de gel de DNA com o protocolo recomendado. </li><li> Seqüência de amostras de DNA purificado com um sistema de seqüenciamento de amostras de DNA seguindo as instruções do fabricante. </li><li> Analise as seqüências usando a Ferramenta de Pesquisa de Alinhamento Local Básico (BLAST) para identificar as espécies crípticas da mosca branca e evitar a contaminação de outras espéciesEs. </li></ol> 2. Endosymbiont Identificação e localização <ol><li> Execute PCR no DNA da mosca branca (adquirida no Passo 1.3) para amplificar os genes específicos de cada endosimbionto dentro da mosca branca (a receita de PCR é descrita na seção 1.4, e os procedimentos de PCR e primers estão listados na Tabela 1 ). </li><li> Sujeita a amostra amplificada em eletroforese em gel de agarose de acordo com o protocolo 20 previamente publicado (1% de gel de agarose, Tris-acetato-EDTA como tampão de corrida, tensão 5 V / cm) para identificar o gene específico de cada bactéria. </li><li> Recupere e sequencie cada banda para determinar as espécies bacterianas dentro da mosca branca (ver seções 1.5-1.7). </li><li> Execute hibridizações in situ de fluorescência (FISH) em moscas brancas para identificar a localização dos endossimbionetas de acordo com o protocolo 19 previamente publicado. NOTA: Aumente a concentração das sondas fluorescentes se necessário. </li></oL&gt; 3. Microscopia eletrônica de transmissão (TEM) <ol><li> Mergulhe e corrija as moscas brancas em tampão fosfato (0,1 M, pH 7,0) contendo 2,5% [vol / vol] glutaraldeído durante 4 h. </li><li> Lavar as amostras em tampão de fosfato (0,1 M, pH 7,0) três vezes, 15 min cada vez. </li><li> Mergulhe e repare novamente as amostras em tampão fosfato (0,1 M, pH 7,0) contendo 1% [wt / vol] OsO 4 durante 2 h. </li><li> Desidratar as amostras por uma série de etanol graduada (30%, 50%, 70%, 80%, 90%, 95% e 100%), 15 min a cada vez. </li><li> Transfira e mergulhe as amostras em 100% de acetona por 20 min. </li><li> Coloque as amostras em mistura de 100% de acetona e 100% de resina Spurr (1: 1) durante 1 h à temperatura ambiente. </li><li> Transfira as amostras para a mistura de 100% de acetona e 100% de resina Spurr (1: 3) durante 3 h à temperatura ambiente. </li><li> Transfira e mergulhe as amostras em 100% de resina Spurr (incubada a 70 ° C) por mais de 9 h. </li><li> Corte as amostras de moscas brancas usando um micropara mim. </li><li> Mancha os filmes ultra finos (adquiridos na seção 3.9) por imersão em acetato de uranilo absoluto durante 5-10 min, seguido de imersão em citrato de chumbo alcalino a 50% por mais 5-10 min. NOTA: Os volumes de reagentes utilizados na seção 3.1-3.10 dependem das amostras. Verifique se as amostras estão imersas nos reagentes. </li><li> Observe amostras sob microscopia eletrônica de transmissão (15,000 X) para determinar a localização, a forma e o tamanho das bactérias para uso posterior (ver seção 4.6). </li></ol> 4. Dissecção e Purificação de Bacterioma da Baleia Branca <ol><li> Adicione 100 μL de 1x solução de PBS em uma lâmina de microscópio. Escolha algumas ninfas do 3º ou 4º instar das folhas de algodão e mergulhe na solução de PBS. </li><li> Use agulhas entomológicas finas sob um estereomicroscópio e puxe as bacteriomas para fora do corpo da mosca branca. <ol><li> Corte suavemente um buraco de um lado da ninfa e pressione levemente o outroLado para deixar as bacteriomas sair. </li></ol></li><li> Monte um microcarregador de 20 μL (com o corte de extremidade dianteiro para atingir o tamanho da bactéria) em uma pipeta de 0,5-10 μL. Extraia o bacteriomo individual da solução PBS para o microcarregador. </li><li> Lave o bacteriomo para eliminar a contaminação de outros tecidos de mosca branca por pipetagem da bacterioma na solução de PBS e extração do bacteriomo. Repita três vezes. </li><li> Em seguida, pipetar a bacterioma lavada em um tubo de centrífuga contendo 60 μL de 1x solução de PBS. </li><li> Filtro de seringa da bacterioma montada através de uma membrana filtrante de 5 μm (determinada por tamanhos de bactérias e núcleo de bacteriócitos na mosca branca). Repita várias vezes para mover o líquido misto através da membrana do filtro completamente. NOTA: Para obter um melhor resultado de amplificação e seqüenciamento, montar mais de 100 bacteriomas. Molhe a membrana do filtro primeiro usando 1x solução de PBS para diminuir a perda de bactériasLigação à membrana. </li></ol> 5. Amplificação de Genomas de Endosimbionto <ol><li> Amplifique o filtrado (contendo principalmente endosimbiontes da mosca branca) usando um kit de amplificação de DNA pelo protocolo recomendado com alguma modificação. <ol><li> Escolha o protocolo recomendado de amplificação de DNA genômico de sangue ou células e prepare o tampão D2 para experiência subseqüente. </li><li> Adicione diretamente 1,5 μL de filtrado (ver seção 4.6) ao tubo de centrífuga, seguido de 1,5 μL do tampão D2 e ​​misture bem. </li><li> Incubar em gelo durante 10 min e adicionar 1,5 μL da solução de parada. </li><li> Adicione 15 μL do tampão de reação e 1 μL da DNA polimerase e misture suavemente. </li><li> Incubar a mistura a 30 ° C durante 16 h, seguido de 3 min a 65 ° C. </li></ol></li><li> Execute o PCR diretamente no filtrado amplificado (diluir as amostras amplificadas, se necessário) usando iniciadores específicos projetados para bacPara confirmar as espécies de bactérias (ver seção 2.1). </li><li> Conduza a PCR para confirmar se há contaminação do genoma do hospedeiro usando o beta-Actin e os primers EF1 do vírus da mosca branca de acordo com o método 21 previamente publicado (a receita de PCR é descrita na seção 1.4). </li></ol> 6. Seqüenciamento de Metagenome de Endosymbiont <ol><li> Sujeite o filtrado amplificado para um espectrofotômetro e um fluorômetro (de acordo com as instruções do fabricante) antes do seqüenciamento para testar a qualidade das amostras e se as amostras atendem aos critérios de seqüenciamento. </li><li> Assine o amplificador para um seqüenciador de genoma de acordo com as instruções do fabricante. </li></ol>

<ol><li>Buchner, P. <a target="_blank" href="http://onlinelibrary.wiley.com/doi/10.1002/jobm.19670070219/abstract">Endosymbiosis of animals with plant microorganisms.</a> J. Basic Microbiol. 7 (2), Interscience. New York. (1967).</li>
<li>Sloan, D. B., Moran, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Endosymbiotic+bacteria+as+a+source+of+carotenoids+in+whiteflies%5BTitle%5D)+AND+%22Biol.+Letters%22%5BJournal%5D)">Endosymbiotic bacteria as a source of carotenoids in whiteflies.</a> Biol. Letters. 8 (6), 986-989 (2012).</li>
<li>Stouthamer, R., Breeuwer, J. A., Hurst, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Wolbachia+pipientis%3A+microbial+manipulator+of+arthropod+reproduction%5BTitle%5D)+AND+%22Annu.+Rev.+Microbiol%22%5BJournal%5D)">Wolbachia pipientis: microbial manipulator of arthropod reproduction.</a> Annu. Rev. Microbiol. 53, 71-102 (1999).</li>
<li>Brumin, M., Kontsedalov, S., Ghanim, M. <a target="_blank" href="http://onlinelibrary.wiley.com/doi/10.1111/j.1744-7917.2010.01396.x/abstract">Rickettsia influences thermotolerance in the whitefly Bemisia tabaci B biotype.</a> Insect Sci. 18 (1), 57-66 (2011).</li>
<li>Hansen, A. K., Degnan, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Widespread+expression+of+conserved+small+RNAs+in+small+symbiont+genomes%5BTitle%5D)+AND+%22ISME+J%22%5BJournal%5D)">Widespread expression of conserved small RNAs in small symbiont genomes.</a> ISME J. 8, 2490-2502 (2014).</li>
<li>Moran, N. A., McCutcheon, J. P., Nakabachi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genomics+and+evolution+of+heritable+bacterial+symbionts%5BTitle%5D)+AND+%22Annu.+Rev.+Genet%22%5BJournal%5D)">Genomics and evolution of heritable bacterial symbionts.</a> Annu. Rev. Genet. 42, 165-190 (2008).</li>
<li>Shigenobu, S., Watanabe, H., Hattori, M., Sakaki, Y., Ishikawa, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome+sequence+of+the+endocellular+bacterial+symbiont+of+aphids+Buchnera+sp.+APS%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Genome sequence of the endocellular bacterial symbiont of aphids Buchnera sp. APS.</a> Nature. 407, 81-86 (2000).</li>
<li>Nikoh, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Evolutionary+origin+of+insect-Wolbachia+nutritional+mutualism%5BTitle%5D)+AND+%22Proc.+Natl.+Acad.+Sci.+U.+S.+A%22%5BJournal%5D)">Evolutionary origin of insect-Wolbachia nutritional mutualism.</a> Proc. Natl. Acad. Sci. U. S. A. 111 (28), 10257-10262 (2014).</li>
<li>Sloan, D. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Parallel+histories+of+horizontal+gene+transfer+facilitated+extreme+reduction+of+endosymbiont+genomes+in+sap-feeding+insects%5BTitle%5D)+AND+%22Mol.+Biol.+Evol%22%5BJournal%5D)">Parallel histories of horizontal gene transfer facilitated extreme reduction of endosymbiont genomes in sap-feeding insects.</a> Mol. Biol. Evol. 31 (4), 857-871 (2014).</li>
<li>Xue, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genomes+of+the+rice+pest+brown+planthopper+and+its+endosymbionts+reveal+complex+complementary+contributions+for+host+adaptation%5BTitle%5D)+AND+%22Genome+Biol%22%5BJournal%5D)">Genomes of the rice pest brown planthopper and its endosymbionts reveal complex complementary contributions for host adaptation.</a> Genome Biol. 15 (12), 521(2014).</li>
<li>Campbell, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome+expansion+via+lineage+splitting+and+genomereduction+in+the+cicada+endosymbiont+Hodgkinia%5BTitle%5D)+AND+%22Proc.+Natl.+Acad.+Sci.+U.+S.+A%22%5BJournal%5D)">Genome expansion via lineage splitting and genomereduction in the cicada endosymbiont Hodgkinia.</a> Proc. Natl. Acad. Sci. U. S. A. 112 (33), 10192-10199 (2015).</li>
<li>Wilson, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genomic+insight+into+the+amino+acid+relations+of+the+pea+aphid%2C+Acyrthosiphon+pisum%2C+with+its+symbiotic+bacterium+Buchnera+aphidicola%5BTitle%5D)+AND+%22Insect+Mol.+Biol%22%5BJournal%5D)">Genomic insight into the amino acid relations of the pea aphid, Acyrthosiphon pisum, with its symbiotic bacterium Buchnera aphidicola.</a> Insect Mol. Biol. 19, 249-258 (2010).</li>
<li>Degnan, P. H., Ochman, H., Moran, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sequence+conservation+and+functional+constraint+on+intergenic+spacers+in+reduced+genomes+of+the+obligate+symbiont+Buchnera%5BTitle%5D)+AND+%22PLoS+Genet%22%5BJournal%5D)">Sequence conservation and functional constraint on intergenic spacers in reduced genomes of the obligate symbiont Buchnera.</a> PLoS Genet. 7 (9), e1002252(2011).</li>
<li>Nakabachi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+160-kilobase+genome+of+the+bacterial+endosymbiont+Carsonella%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">The 160-kilobase genome of the bacterial endosymbiont Carsonella.</a> Science. 314 (5797), 267(2006).</li>
<li>De Barro, P. J., Liu, S. S., Boykin, L. M., Dinsdale, A. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Bemisia+tabaci%3A+a+statement+of+species+status%5BTitle%5D)+AND+%22Annu.+Rev.+Entomol%22%5BJournal%5D)">Bemisia tabaci: a statement of species status.</a> Annu. Rev. Entomol. 56, 1-19 (2011).</li>
<li>Himler, A. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Rapid+spread+of+a+bacterial+symbiont+in+an+invasive+whitefly+is+driven+by+fitness+benefits+and+female+bias%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Rapid spread of a bacterial symbiont in an invasive whitefly is driven by fitness benefits and female bias.</a> Science. 332 (6026), 254-256 (2011).</li>
<li>Bing, X. L., Ruan, Y. M., Rao, Q., Wang, X. W., Liu, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Diversity+of+secondary+endosymbionts+among+different+putative+species+of+the+whitefly+Bemisia+tabaci%5BTitle%5D)+AND+%22Insect+Sci%22%5BJournal%5D)">Diversity of secondary endosymbionts among different putative species of the whitefly Bemisia tabaci.</a> Insect Sci. 20 (2), 194-206 (2013).</li>
<li>Bing, X. L., Yang, J., Zchori-Fein, E., Wang, X. W., Liu, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Characterization+of+a+newly+discovered+symbiont+of+the+whitefly+Bemisia+tabaci+%28Hemiptera%3A+Aleyrodidae%29%5BTitle%5D)+AND+%22Appl.+Environ.+Microbiol%22%5BJournal%5D)">Characterization of a newly discovered symbiont of the whitefly Bemisia tabaci (Hemiptera: Aleyrodidae).</a> Appl. Environ. Microbiol. 79 (2), 569-575 (2013).</li>
<li>Kliot, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Fluorescence+in+situ+hybridizations+%28FISH%29+for+the+localization+of+viruses+and+endosymbiotic+bacteria+in+plant+and+insect+tissues%5BTitle%5D)+AND+%22J.+Vis.+Exp%22%5BJournal%5D)">Fluorescence in situ hybridizations (FISH) for the localization of viruses and endosymbiotic bacteria in plant and insect tissues.</a> J. Vis. Exp. (84), e51030(2014).</li>
<li>Lee, P. Y., Costumbrado, J., Hsu, C., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments%5BTitle%5D)+AND+%22J.+Vis.+Exp%22%5BJournal%5D)">Agarose gel electrophoresis for the separation of DNA fragments.</a> J. Vis. Exp. (62), e3923(2012).</li>
<li>Rao, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome+reduction+and+potential+metabolic+complementation+of+the+dual+endosymbionts+in+the+whitefly+Bemisia+tabaci%5BTitle%5D)+AND+%22BMC+Genomics%22%5BJournal%5D)">Genome reduction and potential metabolic complementation of the dual endosymbionts in the whitefly Bemisia tabaci.</a> BMC Genomics. 16 (1), 226(2015).</li>
<li>Thao, L. L., Baumann, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Evolutionary+relationships+of+primary+prokaryotic+endosymbionts+of+whiteflies+and+their+hosts%5BTitle%5D)+AND+%22Appl.+Environ.+Microbiol%22%5BJournal%5D)">Evolutionary relationships of primary prokaryotic endosymbionts of whiteflies and their hosts.</a> Appl. Environ. Microbiol. 70 (6), 3401-3406 (2004).</li>
<li>Zhu, D. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sequencing+and+comparison+of+the+Rickettsia+genomes+from+the+whitefly+Bemisia+tabaci+Middle+East+Asia+Minor+I%5BTitle%5D)+AND+%22Insect+Sci%22%5BJournal%5D)">Sequencing and comparison of the Rickettsia genomes from the whitefly Bemisia tabaci Middle East Asia Minor I.</a> Insect Sci. 23 (4), 531-542 (2016).</li>
<li>Gottlieb, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Identification+and+localization+of+a+Rickettsia+sp.+in+Bemisia+tabaci+%28HomopteraAleyrodidae%29%5BTitle%5D)+AND+%22Appl.+Environ.+Microbiol%22%5BJournal%5D)">Identification and localization of a Rickettsia sp. in Bemisia tabaci (HomopteraAleyrodidae).</a> Appl. Environ. Microbiol. 72 (5), 3646-3652 (2006).</li>
<li>Zhang, C. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Differential+temporal+changes+of+primary+and+secondary+bacterial+symbionts+and+whitefly+host+fitness+following+antibiotic+treatments%5BTitle%5D)+AND+%22Sci.+Rep%22%5BJournal%5D)">Differential temporal changes of primary and secondary bacterial symbionts and whitefly host fitness following antibiotic treatments.</a> Sci. Rep. 5, 15898(2015).</li>
<li>Shan, H. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Temporal+changes+of+symbiont+density+and+host+fitness+after+rifampicin+treatment+in+a+whitefly+of+the+Bemisia+tabaci+species+complex%5BTitle%5D)+AND+%22Insect+Sci%22%5BJournal%5D)">Temporal changes of symbiont density and host fitness after rifampicin treatment in a whitefly of the Bemisia tabaci species complex.</a> Insect Sci. 23 (2), 200-214 (2016).</li>
<li>Zchori-Fein, E., Brown, J. K. <a target="_blank" href="http://www.bioone.org/doi/abs/10.1603/0013-8746(2002)095%5B0711:DOPAWB%5D2.0.CO%3B2">Diversity of prokaryotes asscociated with Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae).</a> Ann. Entomol. Soc. Am. 95 (6), 711-718 (2002).</li>
<li>Thao, M. L., Baumann, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Evolutionary+relationships+of+primary+prokaryotic+endosymbionts+of+whiteflies+and+their+hosts%5BTitle%5D)+AND+%22Appl.+Environ.+Microbiol%22%5BJournal%5D)">Evolutionary relationships of primary prokaryotic endosymbionts of whiteflies and their hosts.</a> Appl. Environ. Microbiol. 70 (6), 3401-3406 (2004).</li>
<li>Zchori-Fein, E., Perlman, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Distribution+of+the+bacterial+symbiont+Cardinium+in+arthropods%5BTitle%5D)+AND+%22Mol.+Ecol%22%5BJournal%5D)">Distribution of the bacterial symbiont Cardinium in arthropods.</a> Mol. Ecol. 13 (7), 2009-2016 (2004).</li>
<li>O'Neill, S. L., Giordano, R., Colbert, A. M., Karr, T. L., Robertson, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((116S+rRNA+phylogenetic+analysis+of+the+bacterial+endosymbionts+associated+with+cytoplasmic+incompatibility+in+insects%5BTitle%5D)+AND+%22Proc.+Natl.+Acad.+Sci.+U.+S.+A%22%5BJournal%5D)">116S rRNA phylogenetic analysis of the bacterial endosymbionts associated with cytoplasmic incompatibility in insects.</a> Proc. Natl. Acad. Sci. U. S. A. 89 (7), 2699-2702 (1992).</li>
<li>Nirgianaki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Wolbachia+infections+of+the+whitefly+Bemisia+tabaci%5BTitle%5D)+AND+%22Curr.+Microbiol%22%5BJournal%5D)">Wolbachia infections of the whitefly Bemisia tabaci.</a> Curr. Microbiol. 47 (2), 93-101 (2003).</li>
<li>Everett, K. D., Thao, M. L., Horn, M., Dyszynski, G. E., Baumann, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Novel+chlamydiae+in+whiteflies+and+scale+insects%3A+endosymbionts+%27Candidatus+Fritschea+bemisiae%27+strain+Falk+and+%27Candidatus+Fritschea+eriococci%27+strain+Elm%5BTitle%5D)+AND+%22Int.+J.+Syst.+Evol.+Micr%22%5BJournal%5D)">Novel chlamydiae in whiteflies and scale insects: endosymbionts 'Candidatus Fritschea bemisiae' strain Falk and 'Candidatus Fritschea eriococci' strain Elm.</a> Int. J. Syst. Evol. Micr. 55, 1581-1587 (2005).</li>
</ol>

Os autores não têm nada a revelar.

Since the endosymbionts within whiteflies cannot be cultured in vitro, dissection and assembling bacteriocytes is an effective way to obtain enough genetic material of endosymbionts. Before dissection, the species of whitefly and endosymbionts involved should be explicitly confirmed. The whitefly B. tabaci is a species complex with more than 35 morphologically indistinguishable species and different cryptic species may contain different endosymbionts. Portiera is uniformly harbored as an obligate symbiont22, and secondary symbionts vary among species, even the individual whitefly17,21,23. Moreover, although many endosymbionts have been proven to be restrained within bacteriocytes, some may be distributed in the entire body of the whitefly24. Thus, analyzing the localization of different endosymbionts by FISH and TEM is necessary before bacteriome dissection. 
For bacteriome dissection and any subsequent operations, the utilized materials must be strictly sterile to eliminate possible contamination of other bacteria, particularly the PBS solution, the filtration equipment, and the centrifuge tubes. Special care should be taken when filtering the PBS solution containing the bacteriomes to avoid environmental contamination. It is best to use a relatively aseptic environment. In addition, whitefly nymphs can be stored in absolute ethanol at room temperature before dissection, which may be useful to send samples to other places. Nevertheless, dead or environmental stress treated insects should not be used because there would be declination of bacteria25,26. 
In this protocol, the 3rd or 4th instar nymphs were utilized to isolate bacteriome. Compared to other stages of the whitefly, there are several advantages of using the 3rd or 4th instar nymphs for dissection. Firstly, compared to the 1st and 2nd instar nymphs, whiteflies in this stage are obviously larger and not so fragile. Secondly, in the 3rd or 4th instar nymphs of whitefly, bacteriome can be easily distinguished from other tissues of the whitefly body with an obviously yellow color, and bacteriocytes always cluster firmly and can be conveniently separated from other tissues. For the bacteriome in adult whiteflies, once pulled out from the body, bacteriocytes would separate quite easily thus increasing the difficulty in assembly. Hence, the best choice for dissecting bacteriomes is the 3rd or 4th instar nymphs. Nevertheless, this protocol can be used with adult whiteflies for certain experiment needs, with more practice. 
Compared to a previously published method using a single bacteriocyte21, this protocol assembled more bacteriocytes used in the amplification, which contributed to the richness and diversity of bacteriocytes. Furthermore, we utilized filtration to separate symbiont cells from whitefly bacteriocytes, which is more convenient than another method using a micromanipulator and a microinjector. Nevertheless, there were some limitations of this protocol. Firstly, symbionts not confined to bacteriocytes cannot be separated by this method, since we only dissect the bacteriome of the whitefly. Secondly, this protocol cannot absolutely eliminate the contamination of the whitefly genome, since some fragments of whitefly tissues would pass through the filter membrane. Thirdly, clustered symbionts cannot be further separated into individual symbiont species. Hence, obtaining a single species of bacterium accurately and purely requires further study.
In summary, we reported a convenient method for the extraction and purification of endosymbionts from the whitefly B. tabaci that is suitable for subsequent sequencing and analysis. The protocol described here can be easily adapted for the isolation of endosymbionts from other insects for genome sequencing.

As bactérias que formam uma relação simbiótica íntima com hospedeiros relativos são generalizadas nos artrópodes 1 . Os endossimbiontes demonstraram afetar aspectos de hospedeiros, como o metabolismo nutricional, a reprodução, as respostas aos estresses ambientais 2 , 3 , 4 , etc. , em quase todos os estádios de desenvolvimento 5 . No entanto, o mecanismo subjacente às associações ainda é bastante desconhecido. A genômica é de prioridade e importância ao estudar as potenciais funções e papéis das bactérias. Algumas informações fundamentais, ou seja , o status taxonômico, genes funcionais, caminhos do metabolismo, sistemas de secreção, podem ser inferidos a partir de seqüências do genoma, que lança luzes sobre os potenciais papéis dos simbiontes em simbiose. Com o desenvolvimento de seqüenciamento de alto rendimento, um grande número de genomas bacterianos foram sequenciados wCom diversas funções reveladas 6 . Endosymbionts são de importância vital em hemipterans, como pulgões 7 , percevejos 8 , psyllids 9 , brownhoas 10 e cigarras 11 . Por exemplo, Buchnera nos pulgões, como o simbionte obrigatório, demonstrou estar envolvido na biossíntese de aminoácidos essenciais, juntamente com os genes do genoma do pulgão 12 . Além disso, a regulação transcricional da Buchnera também é revelada 13 . Em psílidos , Carsonella é sequenciada e classificada como o menor genoma bacteriano já encontrado 14 . Todas essas características dos endossimbiontes são baseadas e inferidas a partir das sequências do genoma. Como esses endosimbiontes não podem ser cultivados in vitro , várias abordagens foram aplicadas para isolar bactérias adequadas para seqUencing. Nos pulmões, os endossimbiontes são extraídos através de centrifugação e filtração e submetidos a análises genômicas e transcriptômicas adicionais 5 . Em planthoppers marrons, os endossimbionetas são sequenciados juntamente com todo o genoma do inseto 10 . Whitefly B. tabaci é um complexo de espécies contendo mais de 35 espécies morfologicamente indistinguíveis (espécies crípticas), entre as quais duas espécies invasivas invadiram todo o mundo e causaram enormes danos à produção agrícola 15 . De notar, os endossimbictos dentro das espécies de B. tabaci mostraram importância no desenvolvimento das pragas 16 . Até à data, oito endossimbiontes foram identificados na mosca branca, incluindo o simbionte obrigatório, Candidatus Portiera aleyrodidarum e sete simbiontes secundários Hamiltonella , Rickettsia , Arsenophonus , Cardinium , &lt;Em&gt; Wolbachia, Fritschea e Hemipteriphilus definiram 17 , 18 . Ao contrário dos hemipteranos descritos anteriormente, a mosca branca B. tabaci é um inseto extremamente pequeno com apenas 1 mm de comprimento. A maioria dos endossimbiontes é confinada aos bacteriócitos 19 (células especializadas que contêm simbiontes, que ainda formam bacteriomo em B. tabaci ). Além disso, estes endosimbiontes não podem ser cultivados in vitro . A única maneira de obter endosimbiontes de B. tabaci é dissecar a bactéria. No entanto, há dificuldade na dissecação. Primeiro, a bactéria frágil sempre se liga a outros tecidos da mosca branca, o que é difícil de separar. Em segundo lugar, o pequeno tamanho da mosca branca limita o isolamento de bacteriomo suficiente. Em terceiro lugar, os endossimbiontes se agrupam na bactéria, tornando extremamente complicado adquirir uma única espécie de bactéria. <p clAss = &quot;jove_content&quot;&gt; Aqui, relatamos um protocolo simples e barato para isolar endosimbilotes de mosca branca para sequenciação subseqüente de metagenome. Através da dissecção, purificação e amplificação, pode ser obtido ADN endosimbionado adequado e as espécies de bactérias podem ser confirmadas. O protocolo descrito pode ser usado de forma semelhante em outros artrópodes.

<table><tbody><tr><td>&lt;em&gt;Taq&lt;/em&gt; DNA polymerase</td><td>Takara</td><td>R001A</td><td>including rTaq, 10&amp;times;Buffer and dNTP</td></tr><tr><td>Gel DNA extraction kit</td><td>Qiagen</td><td>28704</td><td></td></tr><tr><td>DNA sample sequencing system</td><td>ABI</td><td>ABI-3730XL</td><td></td></tr><tr><td>Microtome</td><td>Leica</td><td>EM UC7</td><td></td></tr><tr><td>Transmission electron microscopy</td><td>Hitachi</td><td>H-7650 TEM</td><td></td></tr><tr><td>Stereo microscope</td><td>Zeiss</td><td>Stemi 2000-C</td><td></td></tr><tr><td>20 &amp;mu;L microloader</td><td>Eppendorf</td><td>F2771951</td><td></td></tr><tr><td>Filter holder</td><td>Millipore</td><td>SX0001300</td><td></td></tr><tr><td>Filter membrane filter</td><td>Millipore</td><td>SMWP001300</td><td>5.0 &amp;mu;m SMWP</td></tr><tr><td>REPLI-g UltraFast Mini Kit</td><td>Qiagen</td><td>150033</td><td>DNA amlification kit</td></tr><tr><td>NanoDrop</td><td>Thermo Scientific</td><td>NanoDrop 2000</td><td></td></tr><tr><td>Qubit Fluorometer</td><td>Thermo Fisher Scientific</td><td>Q33216</td><td></td></tr><tr><td>Genome Sequencer</td><td>Illumina</td><td>Hiseq 2000</td><td></td></tr></tbody></table>

methods for the extraction of endosymbionts from the whitefly bemisia tabaci

Os simbiontes bacterianos formam um relacionamento íntimo com seus hospedeiros e conferem vantagens aos hospedeiros na maioria dos casos. A informação genômica é fundamental para estudar as funções e a evolução dos simbiontes bacterianos em seu hospedeiro. Como a maioria dos simbiontes não pode ser cultivada in vitro , os métodos para isolar uma quantidade adequada de bactérias para o sequenciamento do genoma são muito importantes. Na mosca branca Bemisia tabaci , vários endossimbionos foram identificados e se prevê que sejam importantes no desenvolvimento e reprodução das pragas através de abordagens múltiplas. No entanto, o mecanismo subjacente às associações permanece em grande parte desconhecido. O obstáculo vem parcialmente do fato de que os endossimbicetos na mosca branca, principalmente retidos em bacteriócitos, são difíceis de separar das células hospedeiras. Aqui relatamos um protocolo passo-a-passo para a identificação, extração e purificação de endosimbiontes da mosca branca B. tabaci principalmente por dissectiSobre e filtração. As amostras de endossimbiontes preparadas por este método, apesar de ainda ser uma mistura de diferentes espécies de endosimbiontes, são adequadas para sequenciação subseqüente do genoma e análise das possíveis funções dos endossimbiontes em B. tabaci . Este método também pode ser usado para isolar endosimbionetas de outros insetos.

As espécies do Médio Oriente Ásia Menor 1 (MEAM1) do complexo B. tabaci foram tomadas como exemplo aqui para descrição. O algodão para a criação de moscas brancas e vários estádios de desenvolvimento de moscas brancas são mostrados na Figura 1, incluindo uma planta de algodão, mosca branca adulta e as ninfas 1ª, 2ª e 4ª instar da mosca branca (a ninfa do 3º instar parece similar à ninfa do 4º instar ). Era óbvio que a ninfa do 4º instar é maior que as ninfas do 1º e 2º instar ( Figura 1 ). A análise FISH de Portiera e Hamiltonella dentro do MEAM1 é mostrada na Figura 2 . Esses dois endossimbiontes são confinados aos bacteriócitos da mosca branca, e a sobreposição das duas bactérias também é observada. A Figura 3 mostra o eletro de transmissão<html> Imagens de tron ​​microscopia do endosimbio de Portiera da mosca branca, o que indica que a Portiera pode perder a parede celular. Para o seqüenciamento, foram construídas duas bibliotecas, com tamanhos de inserção de 200 pb e 2.000 pb, respectivamente. Após a seqüenciamento, as duas bibliotecas geraram 1.626 Mb e 1.302 Mb de dados brutos, respectivamente. Após a limpeza dos dados de contaminação para adaptadores e duplicações, foram adquiridos 1.484 Mb e 1.219 Mb de dados limpos. A montagem resultou em uma sequência de genoma completa para o simbionte obrigatório, Portiera . Além disso, um genoma de rascunho de Hamiltonella também foi obtido. A montagem baseada em bibliotecas de 200 pb e 2.000 pb resultou em 138 contigs. De acordo com os relacionamentos emparelhados, os 138 contigs foram novamente montados em 89 andaimes ( Tabela 2 ). Figimg &quot;src =&quot; / files / ftp_upload / 55809 / 55809fig1.jpg &quot;/&gt; Figura 1: Visão geral do sistema de insetos vegetais utilizado neste documento. ( A ) As moscas brancas são criadas em plantas de algodão ( Gossypium hirsutum cv. Zhe-Mian 1793). ( B ) Vista de uma mosca branca adulta. ( C ) Vários estádios de desenvolvimento da ninfa do instar no ciclo de vida da mosca branca. A seta vermelha refere-se ao ovo da mosca branca; A flecha preta refere-se à ninfa da mosca branca do 1º estádio; A flecha branca se refere à 2 ª ninfa da mosca branca; A seta azul refere-se à ninfa da mosca branca do 4º instar. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55809/55809fig1large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 2" class="xfigimg" src="/files/ftp_upload/55809/55809fig2.jpg" /> Figura 2: Análise FISH de Portiera , PresuntoIltonella na 4ª Instinca da Ninfa de MEAM1. Foi utilizada uma sonda especifica de Portiera (vermelha) conjugada com Cy3, uma sonda específica de Hamiltonella (verde) marcada com Cy5. Barras de escala = 100 μm. ( A ) Os sinais de hibridação vermelha representam a Portiera em campo escuro. ( B ) Os sinais de hibridação verde representam o Hamiltonella em um campo escuro. ( C ) Portiera e Hamiltonella fundiram sinais em campo escuro. ( D ) Portiera e Hamiltonella fundiram sinais sob campo brilhante . <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55809/55809fig2large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 3" class="xfigimg" src="/files/ftp_upload/55809/55809fig3.jpg" /> Figura 3: Transmissão Electron MicroScopy Imagem de Portiera em Whitefly. A seta indica a localização da Portiera. Barra de escala = 1 μm. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55809/55809fig3large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Símbolo alvo </td><td> Gene alvo </td><td colspan="3"> Primeiras sequências (5&#39;-3 &#39;) </td><td> Procedimentos de PCR </td><td> Referências </td></tr><tr><td> Portiera </td><td> ARNr 16S </td><td colspan="3"> Por-F: TGCAAGTCGAGCGGCATCAT </td><td> 95 ° C 1 min, 60 ° C 1 min, 72 ° C 1 min, 5 ciclos; </td><td> 27 </td></tr><tr><td></td><td></td><td colspan="3"> Por R: AAAGTTCCCGCCTTATGCGT </td><td colspan="2"> 9576; C 1 min, 58 ° C 1 min, 72 ° C 1 min, 30 ciclos; </td></tr><tr><td></td><td></td><td colspan="3"></td><td> 72 ° C 20 min </td><td></td></tr><tr><td> Hamiltonella </td><td> ARNr 16S </td><td colspan="3"> Ham-F: TGAGTAAAGTCTGGGAATCTGG </td><td> 95 ° C 1 min, 60 ° C 1 min, 72 ° C 1 min, 5 ciclos; </td><td> 27 </td></tr><tr><td></td><td></td><td colspan="3"> Ham-R: CCCGGGAACGTATTCACCGTAG </td><td colspan="2"> 95 ° C 1 min, 58 ° C 1 min, 72 ° C 1 min, 30 ciclos; </td></tr><tr><td></td><td></td><td colspan="3"></td><td> 72 ° C 20 min </td><td></td></tr><tr><td> Rickettsia </td><td> ARNr 16S </td><td colspan="3"> Ric-F: GCTCAGAACGAACGCTATC </td><td> 95 ° C 2 min; </td><td> 24 </td></tr><tr><td></td><td></td><td colspan="3"> Ric-R: GAAGGAAAGCATCTCTGC </td><td> 92 ° C 1 min, 58 °C 1 min, 72 ° C 90 s, 30 ciclos; </td><td></td></tr><tr><td></td><td></td><td colspan="3"></td><td> 72 ° C 5 min </td><td></td></tr><tr><td> Arsenofono </td><td> ARNr 23S </td><td colspan="3"> Ars-F: CGTTTGATGAATTCATAGTCAAA </td><td> 95 ° C 5 min; </td><td> 28 </td></tr><tr><td></td><td></td><td colspan="3"> Ars-R: GGTCCTCCAGTTAGTGTTACCCAAC </td><td> 95 ° C 30 s, 60,5 ° C 30 s, 72 ° C 45 s, 30 ciclos; </td><td></td></tr><tr><td></td><td></td><td colspan="3"></td><td> 72 ° C 10 min </td><td></td></tr><tr><td> Cardinium </td><td> ARNr 16S </td><td colspan="3"> Car-F: TACTGTAAGAATAAGCACCGGC </td><td> 95 ° C 2 min </td><td> 29 </td></tr><tr><td></td><td></td><td colspan="3"> Car-R: GTGGATCACTTAACGCTTTCG </td><td> 92 ° C 1 min, 57 ° C 1 min, 72 ° C 90 s, 30 ciclos; </td><td></td></tr><tr><td></td><td></td><td colspan="3"></td><td> 72 ° C 5 min </td><td></td></tr><tr><td> Wolbachia </td><td> ARNr 16S </td><td colspan="3"> Wol-F: TTGTAGCCTGCTATGGTATAACT </td><td> 94 ° C 5 min; </td><td> 30, 31 </td></tr><tr><td></td><td></td><td colspan="3"> Wol-R: GAATAGGTATGATTTTCATGT </td><td colspan="2"> 94 ° C 1 min, 55 ° C 1 min, 72 ° C 1 min, 35 ciclos </td></tr><tr><td> Fritschea </td><td> ARNr 23S </td><td colspan="3"> Fri-F: GATGCCTTGGCATTGATAGGCGATGAAGGA </td><td> 95 ° C 5 min; </td><td> 32 </td></tr><tr><td></td><td></td><td colspan="3"> Fri-R: TGGCTCATCATGCAAAAGGCA </td><td> 94 ° C 1 min, 64 ° C 1 min, 72 ° C 90 s, 35 ciclos; </td><td></td></tr><tr><td></td><td></td><td colspan="3"></td><td> 72 ° C 5 min </td><td></td></tr><tr><td> Hemipteriphilus </Em&gt; </td><td> GroEL </td><td colspan="3"> OR- groEL -F: CACCWAAAATTACTAAAGATGG </td><td> 94 ° C 3 min; </td><td> 18 </td></tr><tr><td></td><td></td><td colspan="3"> OR- groEL -R: TAGAARTCCATWCCKCCCATWC </td><td> 94 ° C 30 s, 52 ° C 30 s, 72 ° C 2 min, 34 ciclos; </td><td></td></tr><tr><td></td><td></td><td colspan="3"></td><td> 72 ° C 10 min </td><td></td></tr></tbody></table> Tabela 1: Imprimações e Procedimentos de PCR de endosimbiltes em Whitefly. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td></td><td> Portiera </td><td> Hamiltonella </td></tr><tr><td> Número Contig </td><td> 1 </td><td> 138 </td></tr><tr><td> Número do andaime a </strOng&gt; </td><td> 1 </td><td> 89 </td></tr><tr><td> Comprimento total, pb </td><td> 358.232 </td><td> 1.711.449 </td></tr><tr><td> N50, pb </td><td> / </td><td> 118.802 </td></tr><tr><td> N90, pb </td><td> / </td><td> 16.753 </td></tr><tr><td> Comprimento máximo, bp </td><td> / </td><td> 390,511 </td></tr><tr><td> Comprimento mínimo, bp </td><td> / </td><td> 503 </td></tr><tr><td> Conteúdo GC,% </td><td> 26.18 </td><td> 39,89 </td></tr><tr><td colspan="3"> A Informação apresentada abaixo é baseada em andaimes. </td></tr></tbody></table> Tabela 2: Características gerais de Portiera e Hamiltonella Draft Genome.

Watch this Scientific Journal Video about Methods for the Extraction of Endosymbionts from the Whitefly Bemisia tabaci at JoVE.com

Methods for the Extraction of Endosymbionts from the Whitefly Bemisia tabaci

Aqui, apresentamos um protocolo para isolar os endossimbionetas da mosca branca Bemisia tabaci através da dissecção e filtração. Após a amplificação, as amostras de DNA são adequadas para posterior seqüenciamento e estudo do mutualismo entre endosimbiontes e mosca branca.

Métodos para a extração de endossimbiontes da mosca branca<em&gt; Bemisia tabaci</em

Bacterial symbionts form an intimate relationship with their hosts and confer advantages to the hosts in most cases. Genomic information is critical to ...

methods-for-extraction-endosymbionts-from-whitefly-bemisia

Nanyang Technological University

Research

JoVE Journal

Biology

Methods for the Extraction of Endosymbionts from the Whitefly Bemisia tabaci

9.8K visualizações.  Zhejiang University.  Aqui, apresentamos um protocolo para isolar os endossimbionetas da mosca branca Bemisia tabaci através da dissecção e filtração. Após a amplificação, as amostras de DNA são adequadas para posterior seqüenciamento e estudo do mutualismo entre endosimbiontes e mosca branca. 

Vídeo: Methods for the Extraction of Endosymbionts from the Whitefly Bemisia tabaci

Methodology for Developing Life Tables for Sessile Insects in the Field Using the Whitefly, Bemisia tabaci, in Cotton As a Model System

Life tables provide a means of measuring the schedules of birth and death from populations over time. They also can be used to quantify the sources and rates of mortality in populations, which has a variety of applications in ecology, including agricultural ecosystems. Horizontal, or cohort-based, life tables provide for the most direct and accurate method of quantifying vital population rates because they follow a group of individuals in a population from birth to death. Here, protocols are presented for conducting and analyzing cohort-based life tables in the field that takes advantage of the sessile nature of the immature life stages of a global insect pest, Bemisia tabaci. Individual insects are located on the underside of cotton leaves and are marked by drawing a small circle around the insect with a non-toxic pen. This insect can then be observed repeatedly over time with the aid of hand lenses to measure development from one stage to the next and to identify stage-specific causes of death associated with natural and introduced mortality forces. Analyses explain how to correctly measure multiple mortality forces that act contemporaneously within each stage and how to use such data to provide meaningful population dynamic metrics. The method does not directly account for adult survival and reproduction, which limits inference to dynamics of immature stages. An example is presented that focused on measuring the impact of bottom-up (plant quality) and top-down (natural enemies) effects on the mortality dynamics of B. tabaci in the cotton system.

Methodology for Developing Life Tables for Sessile Insects in the Field Using the Whitefly, Bemisia tabaci, in Cotton As a Model System

Life tables allow quantification of the sources and rates of mortality in insect populations and contribute to understanding, predicting and manipulating population dynamics in agroecosystems. Methods for conducting and analyzing cohort-based life tables in the field for an insect with sessile immature life stages are presented.

Metodologia para desenvolvimento de tabelas de vida para insetos sésseis no campo utilizando a mosca branca, Bemisia tabaci, em algodão como um modelo de sistema

Life tables provide a means of measuring the schedules of birth and death from populations over time. They also can be used to quantify the sources and ...

Ambiente

Maintaining Biological Cultures and Measuring Gene Expression in Aphis nerii: A Non-model System for Plant-insect Interactions

Aphids are excellent experimental models for a variety of biological questions ranging from the evolution of symbioses and the development of polyphenisms to questions surrounding insect's interactions with their host plants. Genomic resources are available for several aphid species, and with advances in the next-generation sequencing, transcriptomic studies are being extended to non-model organisms that lack genomes. Furthermore, aphid cultures can be collected from the field and reared in the laboratory for the use in organismal and molecular experiments to bridge the gap between ecological and genetic studies. Last, many aphids can be maintained in the laboratory on their preferred host plants in perpetual, parthenogenic life cycles allowing for comparisons of asexually reproducing genotypes. Aphis nerii, the milkweed-oleander aphid, provides one such model to study insect interactions with toxic plants using both organismal and molecular experiments. Methods for the generation and maintenance of the plant and aphid cultures in the greenhouse and laboratory, DNA and RNA extractions, microsatellite analysis, de novo transcriptome assembly and annotation, transcriptome differential expression analysis, and qPCR verification of differentially expressed genes are outlined and discussed here.

Maintaining Biological Cultures and Measuring Gene Expression in Aphis nerii: A Non-model System for Plant-insect Interactions

The aphid Aphis nerii colonizes on highly-defended plants in the dogbane family (Apocyanaceae) and provides numerous opportunities to study plant-insect interactions. Here, we present a series of protocols for the maintenance of plant and aphid cultures, and the generation and analysis of molecular and -omic data for A. nerii.

Manutenção de culturas biológicas e medição de expressão gênica em Aphis nerii: um sistema Non-modelo de interações inseto-planta

Aphids are excellent experimental models for a variety of biological questions ranging from the evolution of symbioses and the development of polyphenisms ...

Genética

Determining the Egg Fertilization Rate of Bemisia tabaci Using a Cytogenetic Technique

A few species of sap-sucking whiteflies are some of the most damaging terrestrial pests worldwide because of the crop damage they inflict and plant viruses they vector. Despite numerous studies of the biology of these species in different environments, a key life history parameter, offspring sex ratios, has received little attention, yet is important for predicting population dynamics. The primary sex ratio (sex ratio at oviposition) of Bemisia tabaci has never been reported but can be found by determining the egg fertilization rate of this haplodiploid insect. The technique involves the dechorionation of eggs with bleach, a series of fixation steps, and the application of the general DNA fluorescent stain, DAPI (4&#8242;,6-diamidino-2-phenylindole, a DNA-binding fluorescent dye), to bind to female and male pronuclei. Here, we present the technique, and an example of its application, to test whether an endosymbiotic bacterium, Rickettsia sp. nr. bellii, influenced the primary sex ratio of B. tabaci. This method may assist in population studies of whiteflies, or in determining if sex allocation exists with certain environmental stimuli.

Determining the Egg Fertilization Rate of Bemisia tabaci Using a Cytogenetic Technique

We present a simple cytogenetic technique using 4&#8242;,6-diamidino-2-phenylindole (DAPI) to determine the fertilization rate and primary sex ratio of the haplodiploid invasive pest Bemisia tabaci.

Determinação da taxa de fertilização do ovo de Bemisia tabaci usando uma técnica citogenética

A few species of sap-sucking whiteflies are some of the most damaging terrestrial pests worldwide because of the crop damage they inflict and plant ...

A Loop-mediated Isothermal Amplification (LAMP) Assay for Rapid Identification of Bemisia tabaci

The whitefly Bemisia tabaci (Gennadius) is an invasive pest of considerable importance, affecting the production of vegetable and ornamental crops in many countries around the world. Severe yield losses are caused by direct feeding, and even more importantly, also by the transmission of more than 100 harmful plant pathogenic viruses. As for other invasive pests, increased international trade facilitates the dispersal of B. tabaci to areas beyond its native range. Inspections of plant import products at points of entry such as seaports and airports are, therefore, seen as an important prevention measure. However, this last line of defense against pest invasions is only effective if rapid identification methods for suspicious insect specimens are readily available. Because the morphological differentiation between the regulated B. tabaci and close relatives without quarantine status is difficult for non-taxonomists, a rapid molecular identification assay based on the loop-mediated isothermal amplification (LAMP) technology has been developed. This publication reports the detailed protocol of the novel assay describing rapid DNA extraction, set-up of the LAMP reaction, as well as interpretation of its read-out, which allows identifying B. tabaci specimens within one hour. Compared to existing protocols for the detection of specific B. tabaci biotypes, the developed method targets the whole B. tabaci species complex in one assay. Moreover the assay is designed to be applied on-site by plant health inspectors with minimal laboratory training directly at points of entry. Thorough validation performed under laboratory and on-site conditions demonstrates that the reported LAMP assay is a rapid and reliable identification tool, improving the management of B. tabaci.

A Loop-mediated Isothermal Amplification LAMP Assay for Rapid Identification of Bemisia tabaci

This paper reports the protocol for a rapid identification assay for Bemisia tabaci based on loop-mediated isothermal amplification (LAMP) technology. The protocol requires minimal laboratory training and can, therefore, be implemented on-site at points of entry for plant imports such as seaports and airports.

Um ensaio de amplificação isotérmica (lâmpada) mediada por Loop para identificação rápida de Bemisia tabaci

The whitefly Bemisia tabaci (Gennadius) is an invasive pest of considerable importance, affecting the production of vegetable and ornamental crops in many ...

Fluorescence in situ Hybridizations (FISH) for the Localization of Viruses and Endosymbiotic Bacteria in Plant and Insect Tissues

Fluorescence in situ hybridization (FISH) is a name given to a variety of techniques commonly used for visualizing gene transcripts in eukaryotic cells and can be further modified to visualize other components in the cell such as infection with viruses and bacteria. Spatial localization and visualization of viruses and bacteria during the infection process is an essential step that complements expression profiling experiments such as microarrays and RNAseq in response to different stimuli. Understanding the spatiotemporal infections with these agents complements biological experiments aimed at understanding their interaction with cellular components. Several techniques for visualizing viruses and bacteria such as reporter gene systems or immunohistochemical methods are time-consuming, and some are limited to work with model organisms&#160;and involve complex methodologies. FISH that targets RNA or DNA species in the cell is a relatively easy and fast method for studying spatiotemporal localization of genes and for diagnostic purposes. This method can be robust and relatively easy to implement when the protocols employ short hybridizing, commercially-purchased probes, which are not expensive. This is particularly robust when sample preparation, fixation, hybridization, and microscopic visualization do not involve complex steps. Here we describe a protocol for localization of bacteria and viruses in insect and plant tissues. The method is based on simple preparation, fixation, and hybridization of insect whole mounts and dissected organs or hand-made plant sections, with 20 base pairs short DNA probes conjugated to fluorescent dyes on their 5&#39; or 3&#39; ends. This protocol has been successfully applied to a number of insect and plant tissues, and can be used to analyze expression of mRNAs or other RNA or DNA species in the cell.

Fluorescence in situ Hybridizations FISH for the Localization of Viruses and Endosymbiotic Bacteria in Plant and Insect Tissues

We describe here a simple fluorescence in situ hybridization (FISH) method for the localization of viruses and bacteria in insect and plant tissues. This protocol can be extended for the visualization of mRNA in whole mount and microscopic sections.

Fluorescência<em&gt; In situ</em&gt; Hibridizações (FISH) para a localização de vírus e bactérias Endosymbiotic em Plant e Insect Tecidos

Fluorescence in situ hybridization (FISH) is a name given to a variety of techniques commonly used for visualizing gene transcripts in eukaryotic cells ...

Imunologia e Infecção

Parasitização artificial do hospedeiro por Trichogramma dendrolimi e extração de veneno

Extracting Venom from the Parasitoid Wasp Trichogramma dendrolimi Using an Artificial Host

Parasitoid wasps are a diverse group of hymenopteran insects that serve as invaluable resources for pest biocontrol. To ensure successful parasitism, parasitoid wasps inject venom into their hosts to suppress their hosts&#39; immunity, modulate hosts&#39; development, metabolism, and even behavior. With over 600,000 estimated species, the diversity of parasitoid wasps surpasses that of other venomous animals, such as snakes, cone snails, and spiders. Parasitoid wasp venom is an underexplored source of bioactive molecules with potential applications in pest control and medicine. However, collecting parasitoid venom is challenging due to the inability to use direct or electrical stimulation and the difficulty in dissection because of their small size. Trichogramma is a genus of tiny (~0.5 mm) egg parasitoid wasps that are widely used for the biological control of lepidopteran pests in both agriculture and forests. Here, we report a method for extracting venom from T. dendrolimi using artificial hosts. These artificial hosts are created with polyethylene film and amino acid solutions and then inoculated with Trichogramma wasps for parasitism. The venom was subsequently collected and concentrated. This method enables the extraction of large amounts of Trichogramma venom while avoiding contamination from other tissues caused by dissection, a common issue in venom reservoir dissection protocols. This innovative approach facilitates the study of Trichogramma venom, paving the way for new research and potential applications.

Autor em destaque: Método eficiente de extração de veneno de vespas parasitóides Trichogramma 

Here, we present a protocol for extracting venom from Trichogramma dendrolimi using an artificial host created with polyethylene film and amino acid solution.

Extração de veneno da vespa parasitoide Trichogramma dendrolimi usando um hospedeiro artificial

Parasitoid wasps are a diverse group of hymenopteran insects that serve as invaluable resources for pest biocontrol. To ensure successful parasitism, ...

Bioquímica

Transmitting Plant Viruses Using Whiteflies

Whiteflies, Hemiptera: Aleyrodidae, Bemisia tabaci, a complex of morphologically indistinquishable species5, are vectors of many plant viruses. Several genera of these whitefly-transmitted plant viruses (Begomovirus, Carlavirus, Crinivirus, Ipomovirus, Torradovirus) include several hundred species of emerging and economically significant pathogens of important food and fiber crops (reviewed by9,10,16). These viruses do not replicate in their vector but nevertheless are moved readily from plant to plant by the adult whitefly by various means (reviewed by2,6,7,9,10,11,17). For most of these viruses whitefly feeding is required for acquisition and inoculation, while for others only probing is required. Many of these viruses are unable or cannot be easily transmitted by other means. Therefore maintenance of virus cultures, biological and molecular characterization (identification of host range and symptoms)3,13, ecology2,12, require that the viruses be transmitted to experimental hosts using the whitefly vector. In addition the development of new approaches to management, such as evaluation of new chemicals14 or compounds15, new cultural approaches1,4,19, or the selection and development of resistant cultivars7,8,18, requires the use of whiteflies for virus transmission. The use of whitefly transmission of plant viruses for the selection and development of resistant cultivars in breeding programs is particularly challenging7. Effective selection and screening for resistance employs large numbers of plants and there is a need for 100% of the plants to be inoculated in order to find the few genotypes which possess resistance genes. These studies use very large numbers of viruliferous whiteflies, often several times per year.
Whitefly maintenance described here can generate hundreds or thousands of adult whiteflies on plants each week, year round, without the contamination of other plant viruses. Plants free of both whiteflies and virus must be produced to introduce into the whitefly colony each week. Whitefly cultures must be kept free of whitefly pathogens, parasites, and parasitoids that can reduce whitefly populations and/or reduce the transmission efficiency of the virus. Colonies produced in the manner described can be quickly scaled to increase or decrease population numbers as needed, and can be adjusted to accommodate the feeding preferences of the whitefly based on the plant host of the virus.
There are two basic types of whitefly colonies that can be maintained: a nonviruliferous and a viruliferous whitefly colony. The nonviruliferous colony is composed of whiteflies reared on virus-free plants and allows the weekly availability of whiteflies which can be used to transmit viruses from different cultures. The viruliferous whitefly colony, composed of whiteflies reared on virus-infected plants, allows weekly availability of whiteflies which have acquired the virus thus omitting one step in the virus transmission process.

Improving our understanding of and our ability to manage many of the insect-transmitted plant viruses requires the use of the vector. Insect transmission of plant viruses is a tritrophic interaction, and as such requires the manipulation of insects, virus, and plant. Vectors must be reared in large numbers and manipulated in such a way as to insure high rates of transmission to test plants. The basics of rearing and manipulating the whitefly, Bemisa tabaci (Hemiptera: Aleyrodidae), a vector of plant viruses belonging to several emerging plant virus genera, representing a large number of economically significant viruses is presented.

Transmissão de vírus de plantas Usando Whiteflies

Whiteflies, Hemiptera: Aleyrodidae, Bemisia tabaci, a complex of morphologically indistinquishable species5, are vectors of many plant viruses. Several ...

Biologia

Localization and Quantification of Begomoviruses in Whitefly Tissues by Immunofluorescence and Quantitative PCR

Begomoviruses (genus Begomovirus, family Geminiviridae) are transmitted by whiteflies of the Bemisia tabaci complex in a persistent, circulative manner. Considering the extensive damage caused by begomoviruses to crop production worldwide, it is imperative to understand the interaction between begomoviruses and their whitefly vector. To do so, localization and quantification of the virus in the vector tissues is crucial. Here, using tomato yellow leaf curl virus (TYLCV) as an example, we describe a detailed protocol to localize begomoviruses in whitefly midguts, primary salivary glands, and ovaries by immunofluorescence. The method is based on the use of specific antibodies against a virus coat protein, dye-labeled secondary antibodies, and a confocal microscope. The protocol can also be used to colocalize begomoviral and whitefly proteins. We further describe a protocol for the quantification of TYLCV in whitefly midguts, primary salivary glands, hemolymph, and ovaries by quantitative PCR (qPCR). Using primers specifically designed for TYLCV, the protocols for quantification allow the comparison of the amount of TYLCV in different tissues of the whitefly. The described protocol is potentially useful for the quantification of begomoviruses in the body of a whitefly and a virus-infected plant. These protocols can be used to analyze the circulation pathway of begomoviruses in the whitefly or as a complement to other methods to study whitefly-begomovirus interactions.

We describe an immunofluorescence and quantitative PCR method for the localization and quantification of begomoviruses in insect tissues. The immunofluorescence protocol can be used to colocalize viral and vector proteins. The quantitative PCR protocol can be extended to quantify viruses in whole whitefly bodies and virus-infected plants.

Localização e Quantificação de Begomovírus em Tecidos Whitefly por Imunofluorescência e PCR Quantitativo

Begomoviruses (genus Begomovirus, family Geminiviridae) are transmitted by whiteflies of the Bemisia tabaci complex in a persistent, circulative manner. ...

Métodos para a extração de endossimbiontes da mosca branca

Resumo

Explore mais vídeos

Metodologia para desenvolvimento de tabelas de vida para insetos sésseis no campo utilizando a mosca branca, Bemisia tabaci, em algodão como um modelo de sistema

Manutenção de culturas biológicas e medição de expressão gênica em Aphis nerii: um sistema Non-modelo de interações inseto-planta

Determinação da taxa de fertilização do ovo de Bemisia tabaci usando uma técnica citogenética

Um ensaio de amplificação isotérmica (lâmpada) mediada por Loop para identificação rápida de Bemisia tabaci

Fluorescência

Extração de veneno da vespa parasitoide Trichogramma dendrolimi usando um hospedeiro artificial

Extração de veneno da vespa parasitoide Trichogramma dendrolimi usando um hospedeiro artificial

Extração de veneno da vespa parasitoide Trichogramma dendrolimi usando um hospedeiro artificial

Transmissão de vírus de plantas Usando Whiteflies

Localização e Quantificação de Begomovírus em Tecidos Whitefly por Imunofluorescência e PCR Quantitativo