Gostaríamos de agradecer a Michelle Moon (Vanderbilt University) para obter assistência com a fotografia. Universidade de Vanderbilt fornecido suporte para PA e SSLB é suportada pela DGE-1445197.

<ol>
	<li>Brisson, J. A., Stern, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+pea+aphid,+Acyrthosiphon+pisum.:+an+emerging+genomic+model+system+for+ecological,+developmental+and+evolutionary+studies.">The pea aphid, Acyrthosiphon pisum.: an emerging genomic model system for ecological, developmental and evolutionary studies.</a> BioEssays. 28, 747-755 (2006).</li><li>Dixon, A. F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Aphid Ecology: An Optimization Approach. , (1985).</li><li>Consortium, T. I. A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+Sequence+of+the+Pea+Aphid+Acyrthosiphon+pisum.">Genome Sequence of the Pea Aphid Acyrthosiphon pisum.</a> PLoS Biology. , 1000313 (2010).</li><li>Srinivasan, D. G., Brisson, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aphids:+A+Model+for+Polyphenism+and+Epigenetics.">Aphids: A Model for Polyphenism and Epigenetics.</a> Genetics Research International. 2012, 1-12 (2012).</li><li>Wenger, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole+genome+sequence+of+the+soybean+aphid,+Aphis+glycines.">Whole genome sequence of the soybean aphid, Aphis glycines.</a> Insect Biochememistry and Molecular Biology. , 1-10 (2017).</li><li>Li, Z. -. Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ecological+adaption+analysis+of+the+cotton+aphid+(Aphis+gossypii)+in+different+phenotypes+by+transcriptome+comparison.">Ecological adaption analysis of the cotton aphid (Aphis gossypii) in different phenotypes by transcriptome comparison.</a> PLoS ONE. 8, 83180 (2013).</li><li>Wang, D., Liu, Q., Jones, H. D., Bruce, T., Xia, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+transcriptomic+analyses+revealed+divergences+of+two+agriculturally+important+aphid+species.">Comparative transcriptomic analyses revealed divergences of two agriculturally important aphid species.</a> BMC Genomics. 15 (1), 1023-1024 (2014).</li><li>Wu, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=De+novo+characterization+of+the+pine+aphid+Cinara+pinitabulaeformis+Zhang+et+Zhang+transcriptome+and+analysis+of+genes+relevant+to+pesticides.">De novo characterization of the pine aphid Cinara pinitabulaeformis Zhang et Zhang transcriptome and analysis of genes relevant to pesticides.</a> PLoS ONE. 12, 0178496-0178517 (2017).</li><li>Birnbaum, S. S. L., Rinker, D. C., Gerardo, N. M., Abbot, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+profile+and+differential+fitness+in+a+specialist+milkweed+insect+across+host+plants+varying+in+toxicity.">Transcriptional profile and differential fitness in a specialist milkweed insect across host plants varying in toxicity.</a> Molecular Ecology. , (2017).</li><li>Dixon, A. F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Insect Herbivore-Host Dynamics. , (2005).</li><li>Goggin, F. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plant-aphid+interactions:+molecular+and+ecological+perspectives.">Plant-aphid interactions: molecular and ecological perspectives.</a> Current Opinion in Plant Biology. 10, 399-408 (2007).</li><li>Will, T., Furch, A., Zimmermann, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+phloem-feeding+insects+face+the+challenge+of+phloem-located+defenses.">How phloem-feeding insects face the challenge of phloem-located defenses.</a> Frontiers in Plant Science. 4, 1-12 (2013).</li><li>Webster, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+olfaction+in+aphid+host+location.">The role of olfaction in aphid host location.</a> Physiological Entomology. 37, 10-18 (2012).</li><li>Agrawal, A. A., Petschenka, G., Bingham, R. A., Weber, M. G., Rasmann, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toxic+cardenolides:+chemical+ecology+and+coevolution+of+specialized+plant-herbivore+interactions.">Toxic cardenolides: chemical ecology and coevolution of specialized plant-herbivore interactions.</a> New Phytologist. 194, 28-45 (2012).</li><li>Dobler, S., Petschenka, G., Pankoke, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coping+with+toxic+plant+compounds-+the+insect's+perspective+on+iridoid+glycosides+and+cardenolides.">Coping with toxic plant compounds- the insect's perspective on iridoid glycosides and cardenolides.</a> Phytochemistry. 72, 1593-1604 (2011).</li><li>Opitz, S. E. W., M&#252;ller, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plant+chemistry+and+insect+sequestration.">Plant chemistry and insect sequestration.</a> Chemoecology. 19, 117-154 (2009).</li><li>Birnbaum, S. S. L., Abbot, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insect+adaptations+toward+plant+toxins+in+milkweed-herbivores+systems+-+a+review.">Insect adaptations toward plant toxins in milkweed-herbivores systems - a review.</a> Entomologia Experimentalis et Applicata. 58, 579-610 (2018).</li><li>Rothschild, M., von Euw, J., Reichstein, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiac+glycosides+in+the+oleander+aphid,+Aphis+nerii.">Cardiac glycosides in the oleander aphid, Aphis nerii.</a> Journal of Insect Physiology. 16, 1141-1145 (1970).</li><li>Harrison, J. S., Mondor, E. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+an+invasive+aphid+'superclone':+extremely+low+genetic+diversity+in+oleander+aphid+(Aphis+nerii)+populations+in+the+southern+United+States.">Evidence for an invasive aphid 'superclone': extremely low genetic diversity in oleander aphid (Aphis nerii) populations in the southern United States.</a> PLoS ONE. 6, 17524 (2011).</li><li>Mooney, K. A., Halitschke, R., Kessler, A., Agrawal, A. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+trade-offs+in+plants+mediate+the+strength+of+trophic+cascades.">Evolutionary trade-offs in plants mediate the strength of trophic cascades.</a> Science. 327, 1642-1644 (2010).</li><li>Grabherr, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Full-length+transcriptome+assembly+from+RNA-Seq+data+without+a+reference+genome.">Full-length transcriptome assembly from RNA-Seq data without a reference genome.</a> Nature Biotechnology. 29, 644-652 (2011).</li><li>Haas, B. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=De+novo+transcript+sequence+reconstruction+from+RNA-seq+using+the+Trinity+platform+for+reference+generation+and+analysis.">De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis.</a> Nature Protocols. 8, 1494-1512 (2013).</li><li>Finn, R. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Pfam+protein+families+database:+towards+a+more+sustainable+future.">The Pfam protein families database: towards a more sustainable future.</a> Nucleic Acids Research. 44, 279-285 (2016).</li><li>The UniProt Consortium. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UniProt:+the+universal+protein+knowledgebase.">UniProt: the universal protein knowledgebase.</a> Nucleic Acids Research. 45, 158-169 (2017).</li><li>Johnson, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NCBI+BLAST:+a+better+web+interface.">NCBI BLAST: a better web interface.</a> Nucleic Acids Research. 1 (36), 5-9 (2008).</li><li>Fu, L., Niu, B., Zhu, Z., Wu, S., Li, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD-HIT:+accelerated+for+clustering+the+next+generation+sequencing+data.">CD-HIT: accelerated for clustering the next generation sequencing data.</a> Bioinformatics. 28 (23), 3150-3152 (2012).</li><li>Sim&#227;o, F. A., Waterhouse, R. M., Ioannidis, P., Kriventseva, E. V., Zdobnov, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BUSCO:+assessing+genome+assembly+and+annotation+completeness+with+single-copy+orthologs.">BUSCO: assessing genome assembly and annotation completeness with single-copy orthologs.</a> Bioinformatics. 31, 3210-3212 (2015).</li><li>Bolger, A. M., Lohse, M., Usadel, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trimmomatic:+a+flexible+trimmer+for+Illumina+sequence+data.">Trimmomatic: a flexible trimmer for Illumina sequence data.</a> Bioinformatics. 30, 2114-2120 (2014).</li><li>Langmead, B., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+gapped-read+alignment+with+Bowtie+2.">Fast gapped-read alignment with Bowtie 2.</a> Nature Methods. 9, 357-359 (2012).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25, 2078-2079 (2009).</li><li>Love, M. I., Huber, W., Anders, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Moderated+estimation+of+fold+change+and+dispersion+for+RNA-seq+data+with+DESeq2.">Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2.</a> Genome Biology. 15, 31 (2014).</li><li>Rieu, I., Powers, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+quantitative+RT-PCR:+design,+calculations,+and+statistics.">Real-time quantitative RT-PCR: design, calculations, and statistics.</a> Plant Cell. 21, 1031-1033 (2009).</li><li>Malcolm, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+defence+in+chewing+and+sucking+insect+herbivores:+plant-derived+cardenolides+in+the+monarch+butterfly+and+oleander+aphid.">Chemical defence in chewing and sucking insect herbivores: plant-derived cardenolides in the monarch butterfly and oleander aphid.</a> Chemoecology. 1, 12-21 (1990).</li><li>Agrawal, A. A., Underwood, N., Stinchcombe, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intraspecific+variation+in+the+strength+of+density+dependence+in+aphid+populations.">Intraspecific variation in the strength of density dependence in aphid populations.</a> Ecological Entomology. 29, 521-526 (2004).</li><li>Zehnder, C. B., Hunter, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comparison+of+maternal+effects+and+current+environment+on+vital+rates+of+Aphis+nerii,+the+milkweed-oleander+aphid.">A comparison of maternal effects and current environment on vital rates of Aphis nerii, the milkweed-oleander aphid.</a> Ecological Entomology. 32, 172-180 (2007).</li><li>Hartbauer, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Collective+defense+of+Aphis+nerii+and+Uroleucon+hypochoeridis+(Homoptera,+Aphididae)+against+natural+enemies.">Collective defense of Aphis nerii and Uroleucon hypochoeridis (Homoptera, Aphididae) against natural enemies.</a> PLoS ONE. 5, 10417 (2010).</li></ol>

Os autores não têm nada para divulgar.

Há muito tempo foi reconhecido que o aposemático a. nerii pode fornecer insights sobre os padrões e mecanismos de resistência às defesas vegetais e sequestro particularmente química18,37. Um número de recursos genômicos surgiram recentemente para a. nerii10, oferecendo novas oportunidades para estudos de genômicas funcionais e ecológicas que usam a. nerii como um modelo. Nós esboçamos protocolos básicos em cultura pulgão e planta e técnicas moleculares/genômica, com a suposição de que o trabalho futuro sobre esta espécie provavelmente envolverá estudos que utilizam abordagens ecológicas genômicas e funcionais. Muitas questões permanecem sobre os mecanismos e a importância da desintoxicação cardenolide e sequestro na . nerii. Técnicas como RNAi para derrubada de expressão ou gene edição abordagens provará valiosas a este respeito.
Um dos desafios no cultivo de pulgões é nas suas capacidades prodigiosas para a reprodução e dispersão. Estes traços, que diretamente se relacionar porque são pragas de cultura séria, significa que as culturas de afídio requerem atenção quase diária, como bem como extremo cuidado se linhas isogénicas são necessárias para as experiências. As técnicas descritas acima, incluindo aqueles para a geração de dados para a análise da expressão do gene, embora semelhante aos protocolos gerais para criação de pulgão e análise molecular, fornecer um guia passo a passo específico para gerar suficiente biológico material para a. nerii para um conjunto diversificado de aplicações moleculares e ecológicas.
Para este efeito, se estudos de genômicos funcionais ou ecológicos estão no horizonte para a. nerii, estas precisa ser acoplado com culturas vivas plenamente capitalizar as oportunidades experimentais que eles oferecem. Insetos herbívoros vivem em comunidades complexas em suas plantas hospedeiras, e interações intra-específica38,39 , bem como interações interespecíficas40 moldar a resposta final da . nerii para suas plantas hospedeiras . As plantas hospedeiras, a. nerii especializamo-na, representam um conjunto diversificado de plantas que expressam a história de vida divergentes estratégias15,21, ressaltando a importância de acoplamento abordagens puramente genômicas ou fisiológicas com manipulações experimentais que esclarecem a ocorrência natural de variação nas comunidades da . nerii . Os métodos descritos aqui são pontos de partida para uma perspectiva de genômica funcional e ecológica sobre a. nerii e suas interações com as plantas hospedeiras de tóxicos.

Pulgões são insetos pequenos, hemimetabólicos que colonizam em famílias de diversas plantas em todo o mundo. Eles são distintos para vários recursos, mais notavelmente seus ciclos de vida complexos envolvendo partenogênese cíclica e polyphenisms discreta e sua simbiose nutricional obrigatórios com endossimbiontes bacterianos ou levedura que fornecem nutrientes faltando sua dieta da seiva de planta1. Enquanto a maioria dos pulgões são especialistas em planta de acolhimento, algumas espécies generalistas são pragas de cultura importante, infligindo danos económicos consideráveis nas culturas ou diretamente ou por meio dos agentes patogénicos e vírus eles vetor2. A publicação do primeiro genoma de pulgão em 2010, o pulgão ervilha pisum piolho3, marcado um marco importante no estudo da biologia de afídio porque forneceu os recursos genômicos para abordar questões sobre do inseto adaptações para os herbívoros estilos de vida, incluindo aqueles que possam levar a um melhor controle de estratégias4. Desde aquela época, recursos adicionais de genômicos acumularam-se com a publicação de um genoma anotado para o pulgão de soja glycines Aphis5e recursos do genoma inteiro publicamente disponíveis para outro afídio-três espécies (Myzus Cerasi (cereja preta afídio), Myzus persicae (pulgão da batata-pêssego), Rhopalosiphum padi (pulgão Azereiro-aveia)6. Valioso de novo transcriptomic recursos estão disponíveis, bem como para um número de outras espécies de pulgão (e.g.,Aphis gossypii (pulgão do algodão)7, Sitobion avenae (afídio grão)8, Cinara pinitabulaeformis (afídio pinho)9, Aphis nerii (pulgão da serralha-oleandro)10).
Pulgões também fizeram contribuições duradouras para nossa compreensão de interações inseto-planta e a ecologia da vida em plantas11. Uma área onde os pulgões fizeram contribuições particularmente importantes é em nossa compreensão da ecologia química nas interações planta do anfitrião. Expressa diversas adaptações de insetos herbívoros para superar as defesas da planta e alguns até mesmo cooptam defesas vegetais para seu próprio beneficiam12,13,14. Por exemplo, o pulgão da serralha-Oleandro, Aphis nerii, é um brilhante amarelo, invasivo pulgão encontrado em regiões temperadas e tropicais do mundo que coloniza em plantas da família serralha (Apocynaceae). Plantas da família Apocynaceae evoluíram diversas defesas químicas, incluindo látex leitoso e glicosídeos cardíacos, conhecidos como cardenolides, que ligam o transportador de cátion Na, K-ATPase e eficaz dissuasiva para generalista herbívoros15, 16. especialistas milkweed expressam vários modos de resistência ao cardenolides, e alguns seletivamente ou passivamente se acumulam ou modificar cardenolides em seus tecidos, como um meio de impedir a predação ou para outros benefícios de17. A. nerii é pensado para sequestrar cardenolides desta forma, embora os mecanismos e benefícios funcionais permanecem pouco claras10,18.
Tendo em conta os recursos genômicos em mãos, a. nerii fornece um excelente modelo experimental para o estudo dos mecanismos moleculares e genéticos envolvidos nas interações quimio-ecológicas entre plantas hospedeiras tóxicos e seu especialista herbívoros. É interessante notar que, enquanto alguns dos primeiros estudos de a. nerii focada em sequestro de cardenolides19, desde aquela época, estudos da . nerii forneceram introspecções em um amplo conjunto de questões evolutivas e ecológicas, incluindo a estrutura genética de insetos invasiva20 e a interação entre ascendente e descendente de regulamento sobre o herbívoro densidade21. A. nerii , portanto, é um bom candidato como modelo experimental para um especialmente amplo conjunto de estudos das interações inseto-planta. Crítico para o sucesso de qualquer estudo com a. nerii é a cultura cuidadosa de afídio populações, que inclui a cultura de plantas de que dependem os pulgões, assim como uma geração eficiente de dados de alta qualidade - omic. Nosso objetivo é orientar o leitor através de ambos. Descritos abaixo são os métodos para a geração e a manutenção das culturas vegetais e pulgão na estufa e laboratório, DNA e RNA extrações, análise de microssatélites, de novo transcriptome montagem e anotação, transcriptoma análise da expressão diferencial e qPCR verificação de diferencialmente expressos genes. Enquanto esses métodos são escritos pela . nerii, os métodos de cultivo, extração e análise gerais podem estender a uma variedade de espécies de pulgão.

<table border="0" cellpadding="0" cellspacing="0" style="width:820px;" width="820">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="84">
			<td height="84" style="height:84px;width:64px;">Sun Gro Fafard Germination Mix</td>
			<td style="width:160px;">Hummert International</td>
			<td style="width:184px;">10-0952-2</td>
			<td style="width:412px;"></td>
		</tr>
		<tr height="105">
			<td height="105" style="height:105px;width:64px;">Sun Gro Fafard 3B/ Metro Mix</td>
			<td>Hummert International</td>
			<td style="width:184px;">10-0951-2</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:64px;">2x 4&#34; Round Standard Pot</td>
			<td>Anderson Pots</td>
			<td style="width:184px;">1503</td>
			<td></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:64px;">DreamTaq DNA Polymerase</td>
			<td>ThermoFisher Scientific</td>
			<td style="width:184px;">EP0701</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:64px;">Trizol</td>
			<td>ThermoFisher Scientific</td>
			<td style="width:184px;">15596026</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SuperScript&#174; III First-Strand Synthesis kit</td>
			<td>ThermoFisher Scientific</td>
			<td style="width:184px;">18080051</td>
			<td></td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;width:64px;">Power SYBR Green PCR Master Mix</td>
			<td>ThermoFisher Scientific</td>
			<td style="width:184px;">4367659</td>
			<td></td>
		</tr>
	</tbody>
</table>

maintaining biological cultures and measuring gene expression in aphis nerii: a non-model system for plant-insect interactions

Pulgões são excelentes modelos experimentais para uma variedade de questões biológicas, desde a evolução da simbiose e o desenvolvimento de polyphenisms a questões em torno as interações do inseto com suas plantas hospedeiras. Genômica recursos estão disponíveis para várias espécies de afídeos, e com os avanços no próxima geração de sequenciamento, transcriptomic estudos estão sendo estendidos para os organismos que não possuem genomas não-modelo. Além disso, culturas de pulgão podem ser coletadas do campo e criadas em laboratório para uso em experimentos de organismos e moleculares para colmatar o fosso entre os estudos ecológicos e genéticos. Por último, muitos pulgões podem ser mantidos no laboratório em suas plantas hospedeiras preferenciais perpétuos, parthenogenic ciclos de vida, permitindo comparações de genótipos assexuadamente. Aphis nerii, o pulgão da serralha-Oleandro, fornece um modelo deste tipo para estudar interações insetos com plantas tóxicas, usando as experiências dos e moleculares. Métodos para a geração e manutenção das culturas vegetais e pulgão na estufa e laboratório, extrações de DNA e RNA, análise de microssatélites, novo de transcriptoma montagem e anotação, transcriptoma expressão diferencial análise e verificação de qPCR de genes diferencialmente expressos são descritos e discutidos aqui.

Plantar culturas: Sementes levará cerca de duas a quatro semanas, dependendo da época, para que cresça o suficiente para ser re-envasadas (Figura 1A). Re-potted mudas levará outro duas a quatro semanas para crescer a um tamanho ideal para culturas de pulgão (Figura 1B).
Culturas de afídio: Adultos a. nerii distinguem-se por uma cauda escura e pode ser unwinged (ápteras, Figura 3A, B) ou alado (alate, Figura 3C, D). Almofadas de asa em desenvolvimento tornam-se visíveis quando ninfas alcançam o terceiro ínstar (Figura 3,E, F). Culturas-mãe melhor são mantidas pela transferência ínstar média de um a três e um adulto-idoso pulgões unwinged; Isso garante uma saudável, misturado a população de idade. Populações a ser usado para experimentos devem ser cultivadas usando unwinged de pulgões, como descrito acima (2.4). Um adulto da . nerii pode produzir filhotes de 3 a 10 por dia, depende da planta hospedeira e o pulgão,10anos de idade.
Extração de DNA e RNA: Solteiro, adulto a. nerii renderá aproximadamente 100-200 ng / µ l DNA (eluição de 80 µ l; Figura 4 A) e 150-300 ng / µ l RNA (eluição de 30 µ l; Figura 4 B). representante microsatellite picos são mostrados na Figura 5. Representativa expressão relativa de um gene candidato sob três condições (controle, 1 tratamento, tratamento 2) são calculados na tabela 2 e mostrado na Figura 6.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/58044/58044fig1.jpg"> Figura 1 : Plantas representativas para culturas de afídio. Mudas de (A) podem ser re-potted depois que eles desenvolveram seu primeiro conjunto de folhas verdadeiras. (B) plantas podem ser usadas para culturas de pulgão quando desenvolvem 3-4 conjuntos de folhas verdadeiras. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58044/58044fig1large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/58044/58044fig2.jpg"> Figura 2 : Exemplos de ferramentas utilizadas para o cultivo de afídios. (A) boca pipetas podem ser criadas usando o ID 3/16" x 1/4" OD tubo plástico, uma ponta de pipeta de 1.000 µ l e uma ponta de pipeta de 200 µ l. (B, C) Use gaiolas de Copa (copos de plástico transparente com a parte superior cortada e fixada com malha fina) para caber firmemente sobre a parte superior dos potes de 4 pol. utilizados para culturas de pulgão. Isto permite ampla luz e ventilação para criar um ambiente adequado para os pulgões e a planta e mantém os pulgões contidos. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58044/58044fig2large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/58044/58044fig3.jpg"> Figura 3 : Representante adulto e ninfa Aphis nerii. (A, B) Áptera de adultos (unwinged) a. nerii são identificados pela cauda escura na sua extremidade posterior. (C, D) Alate adultos (alados) são identificados por asas totalmente desenvolvidas e escureceu cauda na sua parte posterior. (E, F) Ninfas da . nerii em desenvolvimento passam por quatro estágios de instar e almofadas de asa em desenvolvimento tornam-se aparentes durante a terceira fase de ínstar. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58044/58044fig3large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/58044/58044fig4.jpg"> Figura 4 : Representante géis. (A) DNA extrações (escada de 1 kb). Extrações de DNA a. nerii sete são visualizadas nas faixas 3-9. Controlo negativo é na pista 10. (B) RNA extrações. Extração de RNA a. nerii onze é visualizadas nas pistas 3-13. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58044/58044fig4large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/58044/58044fig5.jpg"> Figura 5 : Representante microsatellite picos. 6-FAM-tag picos são visualizados em azul. Escada de LIZ-500 é mostrada em laranja. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58044/58044fig5large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/58044/58044fig6.jpg"> Figura 6 : verificação de qPCR de um genes diferencialmente expressos. Expressão de quantidade relativa (RQ) representativo do mRNA (calculado usando o método ΔΔCt, tabela 2) mostrado para um gene candidato de interesse sob três condições: controle, tratamento 1, tratamento 2. O gráfico mostra diminuição da expressão do gene candidato sob tratamentos 1 e 2, em comparação ao controle (tabela 2). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58044/58044fig6large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a>
<table fo:keep-together.within-page="1"><tbody>
<tr>
<td>Nome da primeira demão</td>
			<td>Direção</td>
			<td>Sequência (5' - 3')</td>
		</tr>
<tr>
<td>Ago24_F</td>
			<td>para a frente</td>
			<td>TTTTCCCGGCACACCGAGT</td>
		</tr>
<tr>
<td>Ago24_R</td>
			<td>reversa</td>
			<td>GCCAAACTTTACACCCCGC</td>
		</tr>
<tr>
<td>Há 53_F</td>
			<td>para a frente</td>
			<td>TGACGAACGTGGTTAGTCGT</td>
		</tr>
<tr>
<td>Há 53_R</td>
			<td>reversa</td>
			<td>GGCATAACGTCCTAGTCACA</td>
		</tr>
<tr>
<td>Há 59_F</td>
			<td>para a frente</td>
			<td>GCGAGTGGTATTCGCTTAGT</td>
		</tr>
<tr>
<td>Há 59_R</td>
			<td>reversa</td>
			<td>GTTACCCTCGACGATTGCGT</td>
		</tr>
<tr>
<td>Há 66_F</td>
			<td>para a frente</td>
			<td>TCGGTTTGGCAACGTCGGGC</td>
		</tr>
<tr>
<td>Há 66_R</td>
			<td>reversa</td>
			<td>GACTAGGGAGATGCCGGCGA</td>
		</tr>
<tr>
<td>Há 69_F</td>
			<td>para a frente</td>
			<td>CGACTCAGCCCCGAGATTT</td>
		</tr>
<tr>
<td>Há 69_R</td>
			<td>reversa</td>
			<td>ATACAAGCAAACATAGACGGAA</td>
		</tr>
<tr>
<td>Há 84_F</td>
			<td>para a frente</td>
			<td>GACAGTGGTGAGGTTTCAA</td>
		</tr>
<tr>
<td>Há 84_R</td>
			<td>reversa</td>
			<td>ACTGGCGTTACCTTGTCTA</td>
		</tr>
<tr>
<td>Há 89_F</td>
			<td>para a frente</td>
			<td>GAACAGTGCTCGCAGTCTAT</td>
		</tr>
<tr>
<td>Há 89_R</td>
			<td>reversa</td>
			<td>GACAGCGTAAACATCGCGGT</td>
		</tr>
<tr>
<td>Há 126_F</td>
			<td>para a frente</td>
			<td>GGTACATTCGTGTCGATTT</td>
		</tr>
<tr>
<td>Há 126_R</td>
			<td>reversa</td>
			<td>TAAACGAAAAAACCACGTAC</td>
		</tr>
</tbody></table>Tabela 1: sequências de cartilha de microssatélite costumávamos genótipo APHIS nerii 20 .
<table fo:keep-together.within-page="1"><tbody>
<tr>
<td>Alvo</td>
			<td>Amostra</td>
			<td>Média de CT</td>
			<td>CT STD Dev</td>
			<td>ΔCt</td>
			<td>AVG. ΔCt</td>
			<td>ΔΔCt</td>
			<td>RQ=2^(-ΔΔCt)</td>
			<td>RQ SEM</td>
		</tr>
<tr>
<td>ef1a</td>
			<td>1.1</td>
			<td>22.59</td>
			<td>0</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td>ef1a</td>
			<td>1.2</td>
			<td>20.31</td>
			<td>0</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td>ef1a</td>
			<td>1.3</td>
			<td>20.36</td>
			<td>0,226</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td>ef1a</td>
			<td>1.4</td>
			<td>20.27</td>
			<td>0.036</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td>ef1a</td>
			<td>1.5</td>
			<td>20.55</td>
			<td>0,003</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td>ef1a</td>
			<td>1.6</td>
			<td>20.52</td>
			<td>0.245</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td>ef1a</td>
			<td>2.1</td>
			<td>20.49</td>
			<td>0.082</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td>ef1a</td>
			<td>2.2</td>
			<td>19,86</td>
			<td>0.033</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td>ef1a</td>
			<td>2.3</td>
			<td>20.19</td>
			<td>0.037</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td>ef1a</td>
			<td>2.4</td>
			<td>19.67</td>
			<td>0.058</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td>ef1a</td>
			<td>2.5</td>
			<td>20,25</td>
			<td>0.188</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td>ef1a</td>
			<td>2.6</td>
			<td>18.16</td>
			<td>0.089</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td>ef1a</td>
			<td>3.1</td>
			<td>20,93</td>
			<td>0.157</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td>ef1a</td>
			<td>3.2</td>
			<td>20,22</td>
			<td>0,003</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td>ef1a</td>
			<td>3.3</td>
			<td>20.44</td>
			<td>0.039</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td>ef1a</td>
			<td>3.4</td>
			<td>20.91</td>
			<td>0.559</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td>ef1a</td>
			<td>3.5</td>
			<td>20.63</td>
			<td>0,017</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td>ef1a</td>
			<td>3.6</td>
			<td>20.3</td>
			<td>0,135</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
<tr>
<td>Gene de interesse</td>
			<td>1.1</td>
			<td>24,6</td>
			<td>0.173</td>
			<td>2.01</td>
			<td></td>
			<td>0</td>
			<td>1</td>
			<td></td>
		</tr>
<tr>
<td>Gene de interesse</td>
			<td>1.2</td>
			<td>24.25</td>
			<td>0,019</td>
			<td>3.94</td>
			<td>2.975</td>
			<td>0</td>
			<td>1</td>
			<td>0</td>
		</tr>
<tr>
<td>Gene de interesse</td>
			<td>1.3</td>
			<td>24.79</td>
			<td>0,04</td>
			<td>4.43</td>
			<td></td>
			<td>0</td>
			<td>1</td>
			<td></td>
		</tr>
<tr>
<td>Gene de interesse</td>
			<td>1.4</td>
			<td>25.23</td>
			<td>0,285</td>
			<td>4.96</td>
			<td>4.695</td>
			<td>0</td>
			<td>1</td>
			<td>0</td>
		</tr>
<tr>
<td>Gene de interesse</td>
			<td>1.5</td>
			<td>24,6</td>
			<td>0,103</td>
			<td>4.05</td>
			<td></td>
			<td>0</td>
			<td>1</td>
			<td></td>
		</tr>
<tr>
<td>Gene de interesse</td>
			<td>1.6</td>
			<td>25.08</td>
			<td>0.033</td>
			<td>4.56</td>
			<td>4,305</td>
			<td>0</td>
			<td>1</td>
			<td>0</td>
		</tr>
<tr>
<td>Gene de interesse</td>
			<td>2.1</td>
			<td>27.52</td>
			<td>0.155</td>
			<td>7,03</td>
			<td></td>
			<td>5.019033762</td>
			<td>0.03084042</td>
			<td></td>
		</tr>
<tr>
<td>Gene de interesse</td>
			<td>2.2</td>
			<td>27.23</td>
			<td>0.061</td>
			<td>7,37</td>
			<td>7.2</td>
			<td>3.428355679</td>
			<td>0.092888533</td>
			<td>0.031024057</td>
		</tr>
<tr>
<td>Gene de interesse</td>
			<td>2.3</td>
			<td>27.18</td>
			<td>0.058</td>
			<td>6.99</td>
			<td></td>
			<td>2.56158174</td>
			<td>0.169389724</td>
			<td></td>
		</tr>
<tr>
<td>Gene de interesse</td>
			<td>2.4</td>
			<td>27.45</td>
			<td>0</td>
			<td>7,78</td>
			<td>7,385</td>
			<td>2.820764967</td>
			<td>0.141535419</td>
			<td>0.013927153</td>
		</tr>
<tr>
<td>Gene de interesse</td>
			<td>2.5</td>
			<td>27.44</td>
			<td>0.032</td>
			<td>7.19</td>
			<td></td>
			<td>3.138956897</td>
			<td>0.113521944</td>
			<td></td>
		</tr>
<tr>
<td>Gene de interesse</td>
			<td>2.6</td>
			<td>28</td>
			<td>0</td>
			<td>9.84</td>
			<td>8.515</td>
			<td>5.284272079</td>
			<td>0.025661119</td>
			<td>0.043930413</td>
		</tr>
<tr>
<td>Gene de interesse</td>
			<td>3.1</td>
			<td>27.23</td>
			<td>0.143</td>
			<td>6.3</td>
			<td></td>
			<td>4.292437371</td>
			<td>0.051032588</td>
			<td></td>
		</tr>
<tr>
<td>Gene de interesse</td>
			<td>3.2</td>
			<td>27.05</td>
			<td>0.088</td>
			<td>6.83</td>
			<td>6.565</td>
			<td>2.891234282</td>
			<td>0.134788164</td>
			<td>0.041877788</td>
		</tr>
<tr>
<td>Gene de interesse</td>
			<td>3.3</td>
			<td>27.45</td>
			<td>0.109</td>
			<td>7.01</td>
			<td></td>
			<td>2.578145722</td>
			<td>0.167456035</td>
			<td></td>
		</tr>
<tr>
<td>Gene de interesse</td>
			<td>3.4</td>
			<td>27.58</td>
			<td>0,019</td>
			<td>6,67</td>
			<td>6.84</td>
			<td>1.709038085</td>
			<td>0.305863936</td>
			<td>0.069203951</td>
		</tr>
<tr>
<td>Gene de interesse</td>
			<td>3.5</td>
			<td>27.06</td>
			<td>0.067</td>
			<td>6,43</td>
			<td></td>
			<td>2.384498984</td>
			<td>0.191511246</td>
			<td></td>
		</tr>
<tr>
<td>Gene de interesse</td>
			<td>3.6</td>
			<td>27.36</td>
			<td>0</td>
			<td>7.06</td>
			<td>6.745</td>
			<td>2.513723938</td>
			<td>0.175103043</td>
			<td>0.008204101</td>
		</tr>
</tbody></table>Tabela 2: cálculos para qPCR ΔΔC t verificação de gene candidato. Expressão do gene candidato é calculado em relação ao ef1a (Figura 6). Amostras de 1.1-1.6 representam seis biológico Replica sob o tratamento de controle; amostras 2.1-2.6 representam seis biológico Replica sob tratamento 1; amostras de 3.1-3.6 representam seis biológico Replica sob tratamento 2. Ct Std. Dev. é calculado a partir de três repetições de técnicas.

Watch this Scientific Journal Video about Maintaining Biological Cultures and Measuring Gene Expression in Aphis nerii: A Non-model System for Plant-insect Interactions at JoVE.com

Maintaining Biological Cultures and Measuring Gene Expression in Aphis nerii: A Non-model System for Plant-insect Interactions

O pulgão Aphis nerii coloniza altamente defendido das plantas pertencente à família (Apocyanaceae) e oferece inúmeras oportunidades para estudar interações inseto-planta. Aqui, apresentamos uma série de protocolos para a manutenção da planta e pulgão, culturas e a geração e análise molecular e - omic dados pela . nerii.

Manutenção de culturas biológicas e medição de expressão gênica em Aphis nerii: um sistema Non-modelo de interações inseto-planta

Aphids are excellent experimental models for a variety of biological questions ranging from the evolution of symbioses and the development of polyphenisms ...

maintaining-biological-cultures-measuring-gene-expression-aphis-nerii

Nanyang Technological University

Research

JoVE Journal

Genetics

Maintaining Biological Cultures and Measuring Gene Expression in Aphis nerii: A Non-model System for Plant-insect Interactions

7.5K visualizações.  Vanderbilt University. O pulgão Aphis nerii coloniza altamente defendido das plantas pertencente à família (Apocyanaceae) e oferece inúmeras oportunidades para estudar interações inseto-planta. Aqui, apresentamos uma série de protocolos para a manutenção da planta e pulgão, culturas e a geração e análise molecular e - omic dados pela . nerii.

Vídeo: Maintaining Biological Cultures and Measuring Gene Expression in Aphis nerii: A Non-model System for Plant-insect Interactions

Parallel Measurement of Circadian Clock Gene Expression and Hormone Secretion in Human Primary Cell Cultures

Circadian clocks are functional in all light-sensitive organisms, allowing for an adaptation to the external world by anticipating daily environmental changes. Considerable progress in our understanding of the tight connection between the circadian clock and most aspects of physiology has been made in the field over the last decade. However, unraveling the molecular basis that underlies the function of the circadian oscillator in humans stays of highest technical challenge. Here, we provide a detailed description of an experimental approach for long-term (2-5 days) bioluminescence recording and outflow medium collection in cultured human primary cells. For this purpose, we have transduced primary cells with a lentiviral luciferase reporter that is under control of a core clock gene promoter, which allows for the parallel assessment of hormone secretion and circadian bioluminescence. Furthermore, we describe the conditions for disrupting the circadian clock in primary human cells by transfecting siRNA targeting CLOCK. Our results on the circadian regulation of insulin secretion by human pancreatic islets, and myokine secretion by human skeletal muscle cells, are presented here to illustrate the application of this methodology. These settings can be used to study the molecular makeup of human peripheral clocks and to analyze their functional impact on primary cells under physiological or pathophysiological conditions.

Here, we describe settings to monitor in parallel circadian bioluminescence and the secretory activity of human islet cells and primary myotubes. For this, we employed lentiviral gene delivery of a luciferase core clock reporter, followed by in vitro synchronization and collection of outflow medium by continuous cell perifusion.

Medição paralela da expressão do gene relógio circadiano e hormonal secreção em culturas de células primárias humanas

Circadian clocks are functional in all light-sensitive organisms, allowing for an adaptation to the external world by anticipating daily environmental ...

Genética

Perturbations of Circulating miRNAs in Irritable Bowel Syndrome Detected Using a Multiplexed High-throughput Gene Expression Platform

The gene expression platform assay allows for robust and highly reproducible quantification of the expression of up to 800 transcripts (mRNA or miRNAs) in a single reaction. The miRNA assay counts transcripts by directly imaging and digitally counting miRNA molecules that are labeled with color-coded fluorescent barcoded probe sets (a reporter probe and a capture probe). Barcodes are hybridized directly to mature miRNAs that have been elongated by ligating a unique oligonucleotide tag (miRtag) to the 3&#39; end. Reverse transcription and amplification of the transcripts are not required. Reporter probes contain a sequence of six color positions populated using a combination of four fluorescent colors. The four colors over six positions are used to construct a gene-specific color barcode sequence. Post-hybridization processing is automated on a robotic prep station. After hybridization, the excess probes are washed away, and the tripartite structures (capture probe-miRNA-reporter probe) are fixed to a streptavidin-coated slide via the biotin-labeled capture probe. Imaging and barcode counting is done using a digital analyzer. The immobilized barcoded miRNAs are visualized and imaged using a microscope and camera, and the unique barcodes are decoded and counted. Data quality control (QC), normalization, and analysis are facilitated by a custom-designed data processing and analysis software that accompanies the assay software. The assay demonstrates high linearity over a broad range of expression, as well as high sensitivity. Sample and assay preparation does not involve enzymatic reactions, reverse transcription, or amplification; has few steps; and is largely automated, reducing investigator effects and resulting in high consistency and technical reproducibility. Here, we describe the application of this technology to identifying circulating miRNA perturbations in irritable bowel syndrome.

We describe the use of a multiplexed high-throughput gene expression platform that quantitates gene expression by barcoding and counting molecules in biological substrates without the need for amplification. We used the platform to quantitate microRNA (miRNA) expression in whole blood in subjects with and without irritable bowel syndrome.

Perturbações de circulação miRNAs na Síndrome do Cólon Irritável detectada usando um multiplexado de alta capacidade: Plataforma Gene Expression

The gene expression platform assay allows for robust and highly reproducible quantification of the expression of up to 800 transcripts (mRNA or miRNAs) in ...

Single-cell Gene Expression Profiling Using FACS and qPCR with Internal Standards

Gene expression measurements from bulk populations of cells can obscure the considerable transcriptomic variation of individual cells within those populations. Single-cell gene expression measurements can help assess the role of noise in gene expression, identify correlations in the expression of pairs of genes, and reveal subpopulations of cells that respond differently to a stimulus. Here, we describe a procedure to measure the expression of up to 96 genes in single mammalian cells isolated from a population growing in tissue culture. Cells are sorted into lysis buffer by fluorescence-activated cell sorting (FACS), and the mRNA species of interest are reverse-transcribed and amplified. Gene expression is then measured using a microfluidic real-time PCR machine, which performs up to 96 qPCR assays on up to 96 samples at a time. We also describe the generation and use of PCR amplicon standards to enable the estimation of the absolute number of each transcript. Compared with other methods of measuring gene expression in single cells, this approach allows for the quantification of more distinct transcripts than RNA FISH at a lower cost than RNA-Seq.

We describe a method to sort single mammalian cells and to quantify the expression of up to 96 target genes of interest in each cell. This method includes the use of internal qPCR standards to enable the estimation of absolute transcript counts.

Perfil de expressão gênica de célula única usando FACS e qPCR com controles internos

Gene expression measurements from bulk populations of cells can obscure the considerable transcriptomic variation of individual cells within those ...

Sample Preparation and Analysis of RNASeq-based Gene Expression Data from Zebrafish

The analysis of global gene expression changes is a valuable tool for identifying novel pathways underlying observed phenotypes. The zebrafish is an excellent model for rapid assessment of whole transcriptome from whole animal or individual cell populations due to the ease of isolation of RNA from large numbers of animals. Here a protocol for global gene expression analysis in zebrafish embryos using RNA sequencing (RNASeq) is presented. We describe preparation of RNA from whole embryos or from cell populations obtained using cell sorting in transgenic animals. We also describe an approach for analysis of RNASeq data to identify enriched pathways and Gene Ontology (GO) terms in global gene expression data sets. Finally, we provide a protocol for validation of gene expression changes using quantitative reverse transcriptase PCR (qRT-PCR). These protocols can be used for comparative analysis of control and experimental sets of zebrafish to identify novel gene expression changes, and provide molecular insight into phenotypes of interest.

This protocol presents an approach for whole transcriptome analysis from zebrafish embryos, larvae, or sorted cells. We include isolation of RNA, pathway analysis of RNASeq data, and qRT-PCR-based validation of gene expression changes.

Preparação da amostra e análise de dados da expressão do Gene RNASeq-baseado de Zebrafish

The analysis of global gene expression changes is a valuable tool for identifying novel pathways underlying observed phenotypes. The zebrafish is an ...

Measuring Gene Expression in Bombarded Barley Aleurone Layers with Increased Throughput

The aleurone layer of barley grains is an important model system for hormone-regulated gene expression in plants. In aleurone cells, genes required for germination or early seedling development are activated by gibberellin (GA), while genes associated with stress responses are activated by abscisic acid (ABA). The mechanisms of GA and ABA signaling can be interrogated by introducing reporter gene constructs into aleurone cells via particle bombardment, with the resulting transient expression measured using enzyme assays. An improved protocol is reported that partially automates and streamlines the grain homogenization step and the enzyme assays, allowing significantly more throughput than existing methods. Homogenization of the grain samples is carried out using an automated tissue homogenizer, and GUS (&#946;-glucuronidase) assays are carried out using a 96-well plate system. Representative results using the protocol suggest that phospholipase D activity may play an important role in the activation of HVA1 gene expression by ABA, through the transcription factor TaABF1.

An improved protocol is presented for the measurement of transient gene expression from reporter constructs in barley aleurone cells after particle bombardment. The combination of automated grain grinding with 96-well plate enzyme assays provides high throughput for the procedure.

Expressão gênica em camadas de aleurona cevada bombardeado com maior Throughput de medição

The aleurone layer of barley grains is an important model system for hormone-regulated gene expression in plants. In aleurone cells, genes required for ...

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development of a customizable platform to rapidly generate gene modifications in a wide variety of organisms, including zebrafish. CRISPR-based genome editing uses a single guide RNA (sgRNA) to target a CRISPR-associated (Cas) endonuclease to a genomic DNA (gDNA) target of interest, where the Cas endonuclease generates a double-strand break (DSB). Repair of DSBs by error-prone mechanisms lead to insertions and/or deletions (indels). This can cause frameshift mutations that often introduce a premature stop codon within the coding sequence, thus creating a protein-null allele. CRISPR-based genome engineering requires only a few molecular components and is easily introduced into zebrafish embryos by microinjection. This protocol describes the methods used to generate CRISPR reagents for zebrafish microinjection and to identify fish exhibiting germline transmission of CRISPR-modified genes. These methods include in vitro transcription of sgRNAs, microinjection of CRISPR reagents, identification of indels induced at the target site using a PCR-based method called a heteroduplex mobility assay (HMA), and characterization of the indels using both a low throughput and a powerful next-generation sequencing (NGS)-based approach that can analyze multiple PCR products collected from heterozygous fish. This protocol is streamlined to minimize both the number of fish required and the types of equipment needed to perform the analyses. Furthermore, this protocol is designed to be amenable for use by laboratory personal of all levels of experience including undergraduates, enabling this powerful tool to be economically employed by any research group interested in performing CRISPR-based genomic modification in zebrafish.

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Targeted genome editing in the model system Danio rerio (zebrafish) has been greatly facilitated by the emergence of CRISPR-based approaches. Herein, we describe a streamlined, robust protocol for generation and identification of CRISPR-derived nonsense alleles that incorporates the heteroduplex mobility assay and identification of mutations using next-generation sequencing.

Produção eficiente e identificação de CRISPR/Cas9 gerado pelo Gene nocautes no sistema modelo Danio rerio

Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development ...

An Optogenetic Method to Control and Analyze Gene Expression Patterns in Cell-to-cell Interactions

Cells should respond properly to temporally changing environments, which are influenced by various factors from surrounding cells. The Notch signaling pathway is one of such essential molecular machinery for cell-to-cell communications, which plays key roles in normal development of embryos. This pathway involves a cell-to-cell transfer of oscillatory information with ultradian rhythms, but despite the progress in molecular biology techniques, it has been challenging to elucidate the impact of multicellular interactions on oscillatory gene dynamics. Here, we present a protocol that permits optogenetic control and live monitoring of gene expression patterns in a precise temporal manner. This method successfully revealed that intracellular and intercellular periodic inputs of Notch signaling entrain intrinsic oscillations by frequency tuning and phase shifting at the single-cell resolution. This approach is applicable to the analysis of the dynamic features of various signaling pathways, providing a unique platform to test a functional significance of dynamic gene expression programs in multicellular systems.

Here, we present a protocol to analyze cell-to-cell transfer of oscillatory information by optogenetic control and live monitoring of gene expression. This approach provides a unique platform to test a functional significance of dynamic gene expression programs in multicellular systems.

Um método de Optogenetic para controlar e analisar os padrões de expressão de Gene em interações de célula para célula

Cells should respond properly to temporally changing environments, which are influenced by various factors from surrounding cells. The Notch signaling ...

An Ecdysone Receptor-based Singular Gene Switch for Deliberate Expression of Transgene with Robustness, Reversibility, and Negligible Leakiness

Precise control of transgene expression is desirable in biological and clinical studies. However, because the binary feature of currently employed gene switches requires the transfer of two therapeutic expression units concurrently into a single cell, the practical application of the system for gene therapy is limited. To simplify the transgene expression system, we generated a gene switch designated as pEUI(+) encompassing a complete set of transgene expression modules in a single vector. Comprising of the GAL4 DNA-binding domain and modified EcR (GvEcR), a minimal VP16 activation domain fused with a GAL4 DNA-binding domain, as well as a modified Drosophila ecdysone receptor (EcR), the newly developed singular gene switch is highly responsive to the administration of a chemical inducer in a time- and dosage-dependent manner. The pEUI(+) vector is a potentially powerful tool for improving the control of transgene expression in both biological research and pre-clinical studies. Here, we present a detailed protocol for modulation of a transient and stable transgene expression using pEUI(+) vector by the treatment of tebufenozide (Teb). Additionally, we share important guidelines for the use of Teb as a chemical inducer.

Here, we present a protocol for the modulation of transgene expression using pEUI(+) singular gene switch by tebufenozide treatment.

Um isoinokosterone baseado no Receptor Singular Gene interruptor para deliberada expressão do Transgene com robustez, reversibilidade e insignificante Leakiness

Precise control of transgene expression is desirable in biological and clinical studies. However, because the binary feature of currently employed gene ...

Exploring the Root Microbiome: Extracting Bacterial Community Data from the Soil, Rhizosphere, and Root Endosphere

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to abiotic stresses and diseases. As the plant microbiome can be highly complex, low-cost, high-throughput methods such as amplicon-based sequencing of the 16S rRNA gene are often preferred for characterizing its microbial composition and diversity. However, the selection of appropriate methodology when conducting such experiments is critical for reducing biases that can make analysis and comparisons between samples and studies difficult. This protocol describes in detail a standardized methodology for the collection and extraction of DNA from soil, rhizosphere, and root samples. Additionally, we highlight a well-established 16S rRNA amplicon sequencing pipeline that allows for the exploration of the composition of bacterial communities in these samples, and can easily be adapted for other marker genes. This pipeline has been validated for a variety of plant species, including sorghum, maize, wheat, strawberry, and agave, and can help overcome issues associated with the contamination from plant organelles.

Here, we describe a protocol to obtain amplicon sequence data of soil, rhizosphere, and root endosphere microbiomes. This information can be used to investigate the composition and diversity of plant-associated microbial communities, and is suitable for the use with a wide range of plant species.

Explorando o microbioma da raiz: extraindo dados da comunidade bacteriana do solo

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to ...

Candidate Gene Testing in Clinical Cohort Studies with Multiplexed Genotyping and Mass Spectrometry

Complex diseases are often underpinned by multiple common genetic variants that contribute to disease susceptibility. Here, we describe a cost-effective tag single nucleotide polymorphism (SNP) approach using a multiplexed genotyping assay with mass spectrometry, to investigate gene pathway associations in clinical cohorts. We investigate the food allergy candidate locus Interleukin13 (IL13) as an example. This method efficiently maximizes the coverage by taking advantage of shared linkage disequilibrium (LD) within a region. Selected LD SNPs are then designed into a multiplexed assay, enabling up to 40 different SNPs to be analyzed simultaneously, boosting cost-effectiveness. Polymerase chain reaction (PCR) is used to amplify the target loci, followed by single nucleotide extension, and the amplicons are then measured using matrix-assisted laser desorption/ionization-time of flight(MALDI-TOF) mass spectrometry. The raw output is analyzed with the genotype calling software, using stringent quality control definitions and cut-offs, and high probability genotypes are determined and output for data analysis.

Identification of genetic variants contributing to complex human disease allows us to identify novel mechanisms. Here, we demonstrate a multiplex genotyping approach to candidate genes or gene pathway analysis that maximizes the coverage at low cost and is amenable to cohort-based studies.

Gene candidato teste em estudos de coorte clínica com genotipagem multiplexada e espectrometria de massa

Complex diseases are often underpinned by multiple common genetic variants that contribute to disease susceptibility. Here, we describe a cost-effective ...