Financial support for this study was provided by the National Key Research and Development Program (2016YFC1200601) and the National Natural Science Foundation of China (31390421).

1. Whitefly Rearing and Cryptic Species Identification
<ol>
	<li>Maintain the whitefly species on cotton Gossypium hirsutum (Malvaceae) (cv. Zhe-Mian 1973) in cages under standard conditions of 27 &#177; 1 &#176;C, 70 &#177; 10% humidity and 14 h light: 10 h dark regime.</li>
	<li>Collect an individual adult whitefly and homogenize in 30 &#181;L of lysis buffer (10 mM Tris, pH 8.4, 50 mM KCl, 0.45% [wt/vol] Tween-20, 0.2% [wt/vol] gelatin, 0.45% [vol/vol] Nonidet P 40, 60 g/mL Proteinase K).</li>
	<li>Incubate the homogenate at 65 &#176;C for 1 h and then 100 &#176;C for 10 min. 
	NOTE: The incubation time at 65 &#176;C can be increased if necessary. The incubation time at 100 &#176;C should be critically controlled to sufficiently inactivate Proteinase K and avoid DNA damage.</li>
	<li>Perform polymerase chain reaction (PCR) using whitefly DNA (acquired in section 1.3) based on mitochondrial cytochrome oxidase I primers. 
	COI-F: 5&#39;-TTGATTTTTTGGTCATCCAGAAGT-3&#39; 
	COI-R: 5&#39;-TAATATGGCAGATTAGTGCATTGGA-3&#39;
	<ol>
		<li>Perform the PCR reactions in a final volume of 25 &#181;L containing 1 U of Taq DNA polymerase, 2.5 &#181;L 10x Buffer, 0.2 mM dNTP, 0.2 mM of each primer and 2 &#181;L of whitefly DNA.</li>
		<li>Use the following PCR procedure conditions: initial denaturation 95 &#176;C for 3 min followed by 35 cycles of 95 &#176;C for 45 s (denaturation), 50 &#176;C for 45 s (annealing) and 72 &#176;C for 1 min (extension) and another 10 min at 72 &#176;C for further extension.</li>
	</ol>
	</li>
	<li>Clean the PCR amplified product using a DNA gel extraction kit with the recommended protocol.</li>
	<li>Sequence the purified DNA samples with a DNA sample sequencing system following the manufacturer&#39;s instruction.</li>
	<li>Analyze the sequences using the Basic Local Alignment Search Tool (BLAST) to identify the cryptic species of whitefly and avoid contamination of other species.</li>
</ol>
2. Endosymbiont Identification and Localization
<ol>
	<li>Perform PCR on the whitefly DNA (acquired in Step 1.3) to amplify the specific genes of each endosymbiont within the whitefly (the PCR recipe is described in section 1.4, and PCR procedures and primers are listed in Table 1).</li>
	<li>Subject the amplified sample to agarose gel electrophoresis according to previously published protocol20 (1% agarose gel, Tris-acetate-EDTA as running buffer, voltage 5 V/cm) to identify the specific gene of each bacterium.</li>
	<li>Recover and sequence each band to determine the bacterial species within whitefly (see sections 1.5-1.7).</li>
	<li>Perform fluorescence in situ hybridizations (FISH) on whiteflies to identify the location of endosymbionts according to previously published protocol19. 
	NOTE: Increase the concentration of the fluorescent probes if necessary.</li>
</ol>
3. Transmission Electron Microscopy (TEM)
<ol>
	<li>Immerse and fix whiteflies in phosphate buffer (0.1 M, pH 7.0) containing 2.5% [vol/vol] glutaraldehyde for 4 h.</li>
	<li>Wash the samples in phosphate buffer (0.1 M, pH 7.0) three times, 15 min each time.</li>
	<li>Immerse and fix the samples again in phosphate buffer (0.1 M, pH 7.0) containing 1% [wt/vol] OsO4 for 2 h.</li>
	<li>Dehydrate the samples by a graded series of ethanol (30%, 50%, 70%, 80%, 90%, 95% and 100%), 15 min each time.</li>
	<li>Transfer and immerse the samples into 100% acetone for 20 min.</li>
	<li>Place the samples in mixture of 100% acetone and 100% Spurr resin (1:1) for 1 h at room temperature.</li>
	<li>Transfer the samples to mixture of 100% acetone and 100% Spurr resin (1:3) for 3 h at room temperature.</li>
	<li>Transfer and immerse the samples into 100% Spurr resin (incubated at 70 &#176;C) for more than 9 h.</li>
	<li>Section the whitefly samples by using a microtome.</li>
	<li>Stain the ultra-thin films (acquired in section 3.9) by immersion in absolute uranyl acetate for 5-10 min, followed by immersion in 50% alkaline lead citrate for another 5-10 min. 
	NOTE: The volumes of reagents utilized in section 3.1-3.10 depend on the samples. Make sure the samples are immersed in the reagents.</li>
	<li>Observe samples under transmission electron microscopy (15,000X) to determine the localization, shape and size of bacteria for further use (see section 4.6).</li>
</ol>
4. Whitefly Bacteriome Dissection and Purification
<ol>
	<li>Add 100 &#181;L of 1x PBS solution onto a microscope slide. Pick some 3rd or 4th instar nymphs from cotton leaves and immerse them into the PBS solution.</li>
	<li>Use fine entomological needles under a stereomicroscope and pull the bacteriomes out from the whitefly body.
	<ol>
		<li>Gently cut a hole on one side of the nymph, and slightly press the other side to let the bacteriomes out.</li>
	</ol>
	</li>
	<li>Mount a 20 &#181;L microloader (with the leading end cut to meet the size of bacteriome) on a 0.5-10 &#181;L pipette. Extract the individual bacteriome out of the PBS solution into the microloader.</li>
	<li>Wash the bacteriome to eliminate the contamination of other whitefly tissues by pipetting the bacteriome into the PBS solution and extracting the bacteriome. Repeat three times.</li>
	<li>Immediately pipette the washed bacteriome into a centrifuge tube containing 60 &#181;L of 1x PBS solution.</li>
	<li>Syringe-filter the assembled bacteriome through a 5 &#181;m filter membrane (determined by sizes of bacteria and nucleus of bacteriocyte in whitefly). Repeat multiple times to move the mixed liquid through the filter membrane thoroughly. 
	NOTE: To achieve a better result of amplification and sequencing, assemble over 100 bacteriomes. Wet the filter membrane first by using 1x PBS solution to decrease the loss of bacteria binding to the membrane.</li>
</ol>
5. Amplification of Endosymbiont Genomes
<ol>
	<li>Amplify the filtrate (mainly containing endosymbionts of the whitefly) using a DNA amplification kit by the recommended protocol with some modification.
	<ol>
		<li>Choose the recommended protocol of amplification of genomic DNA from blood or cells and prepare buffer D2 for subsequent experiment.</li>
		<li>Directly add 1.5 &#181;L of filtrate (see section 4.6) to the centrifuge tube, followed by 1.5 &#181;L of the Buffer D2 and mix well.</li>
		<li>Incubate on ice for 10 min and add 1.5 &#181;L of the stop solution.</li>
		<li>Add 15 &#181;L of the reaction buffer and 1 &#181;L of the DNA polymerase and mix gently.</li>
		<li>Incubate the mixture at 30 &#176;C for 16 h, followed by 3 min at 65 &#176;C.</li>
	</ol>
	</li>
	<li>Perform PCR directly on the amplified filtrate (dilute the amplified samples if necessary) by using specific primers designed for bacteria to confirm the bacteria species (see section 2.1).</li>
	<li>Conduct PCR to confirm whether there is contamination of host genome by using whitefly gene beta-Actin and EF1 primers according to previously published method21 (the PCR recipe is described in section 1.4).</li>
</ol>
6. Endosymbiont Metagenome Sequencing
<ol>
	<li>Subject the amplified filtrate to a spectrophotometer and a fluorometer (according to the manufacturer&#39;s instructions) before sequencing to test the quality of samples and whether the samples meet the criteria for sequencing.</li>
	<li>Subject the amplified to a genome sequencer according to the manufacturer&#39;s instructions.</li>
</ol>

<ol>
	<li>Buchner, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endosymbiosis+of+animals+with+plant+microorganisms.">Endosymbiosis of animals with plant microorganisms.</a> J. Basic Microbiol. 7 (2), (1967).</li><li>Sloan, D. B., Moran, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endosymbiotic+bacteria+as+a+source+of+carotenoids+in+whiteflies.">Endosymbiotic bacteria as a source of carotenoids in whiteflies.</a> Biol. Letters. 8 (6), 986-989 (2012).</li><li>Stouthamer, R., Breeuwer, J. A., Hurst, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+pipientis:+microbial+manipulator+of+arthropod+reproduction.">Wolbachia pipientis: microbial manipulator of arthropod reproduction.</a> Annu. Rev. Microbiol. 53, 71-102 (1999).</li><li>Brumin, M., Kontsedalov, S., Ghanim, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rickettsia+influences+thermotolerance+in+the+whitefly+Bemisia+tabaci+B+biotype.">Rickettsia influences thermotolerance in the whitefly Bemisia tabaci B biotype.</a> Insect Sci. 18 (1), 57-66 (2011).</li><li>Hansen, A. K., Degnan, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Widespread+expression+of+conserved+small+RNAs+in+small+symbiont+genomes.">Widespread expression of conserved small RNAs in small symbiont genomes.</a> ISME J. 8, 2490-2502 (2014).</li><li>Moran, N. A., McCutcheon, J. P., Nakabachi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomics+and+evolution+of+heritable+bacterial+symbionts.">Genomics and evolution of heritable bacterial symbionts.</a> Annu. Rev. Genet. 42, 165-190 (2008).</li><li>Shigenobu, S., Watanabe, H., Hattori, M., Sakaki, Y., Ishikawa, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+the+endocellular+bacterial+symbiont+of+aphids+Buchnera+sp.+APS.">Genome sequence of the endocellular bacterial symbiont of aphids Buchnera sp. APS.</a> Nature. 407, 81-86 (2000).</li><li>Nikoh, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+origin+of+insect-Wolbachia+nutritional+mutualism.">Evolutionary origin of insect-Wolbachia nutritional mutualism.</a> Proc. Natl. Acad. Sci. U. S. A. 111 (28), 10257-10262 (2014).</li><li>Sloan, D. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Parallel+histories+of+horizontal+gene+transfer+facilitated+extreme+reduction+of+endosymbiont+genomes+in+sap-feeding+insects.">Parallel histories of horizontal gene transfer facilitated extreme reduction of endosymbiont genomes in sap-feeding insects.</a> Mol. Biol. Evol. 31 (4), 857-871 (2014).</li><li>Xue, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomes+of+the+rice+pest+brown+planthopper+and+its+endosymbionts+reveal+complex+complementary+contributions+for+host+adaptation.">Genomes of the rice pest brown planthopper and its endosymbionts reveal complex complementary contributions for host adaptation.</a> Genome Biol. 15 (12), 521 (2014).</li><li>Campbell, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+expansion+via+lineage+splitting+and+genomereduction+in+the+cicada+endosymbiont+Hodgkinia.">Genome expansion via lineage splitting and genomereduction in the cicada endosymbiont Hodgkinia.</a> Proc. Natl. Acad. Sci. U. S. A. 112 (33), 10192-10199 (2015).</li><li>Wilson, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+insight+into+the+amino+acid+relations+of+the+pea+aphid,+Acyrthosiphon+pisum,+with+its+symbiotic+bacterium+Buchnera+aphidicola.">Genomic insight into the amino acid relations of the pea aphid, Acyrthosiphon pisum, with its symbiotic bacterium Buchnera aphidicola.</a> Insect Mol. Biol. 19, 249-258 (2010).</li><li>Degnan, P. H., Ochman, H., Moran, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequence+conservation+and+functional+constraint+on+intergenic+spacers+in+reduced+genomes+of+the+obligate+symbiont+Buchnera.">Sequence conservation and functional constraint on intergenic spacers in reduced genomes of the obligate symbiont Buchnera.</a> PLoS Genet. 7 (9), e1002252 (2011).</li><li>Nakabachi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+160-kilobase+genome+of+the+bacterial+endosymbiont+Carsonella.">The 160-kilobase genome of the bacterial endosymbiont Carsonella.</a> Science. 314 (5797), 267 (2006).</li><li>De Barro, P. J., Liu, S. S., Boykin, L. M., Dinsdale, A. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bemisia+tabaci:+a+statement+of+species+status.">Bemisia tabaci: a statement of species status.</a> Annu. Rev. Entomol. 56, 1-19 (2011).</li><li>Himler, A. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+spread+of+a+bacterial+symbiont+in+an+invasive+whitefly+is+driven+by+fitness+benefits+and+female+bias.">Rapid spread of a bacterial symbiont in an invasive whitefly is driven by fitness benefits and female bias.</a> Science. 332 (6026), 254-256 (2011).</li><li>Bing, X. L., Ruan, Y. M., Rao, Q., Wang, X. W., Liu, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diversity+of+secondary+endosymbionts+among+different+putative+species+of+the+whitefly+Bemisia+tabaci.">Diversity of secondary endosymbionts among different putative species of the whitefly Bemisia tabaci.</a> Insect Sci. 20 (2), 194-206 (2013).</li><li>Bing, X. L., Yang, J., Zchori-Fein, E., Wang, X. W., Liu, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+newly+discovered+symbiont+of+the+whitefly+Bemisia+tabaci+(Hemiptera:+Aleyrodidae).">Characterization of a newly discovered symbiont of the whitefly Bemisia tabaci (Hemiptera: Aleyrodidae).</a> Appl. Environ. Microbiol. 79 (2), 569-575 (2013).</li><li>Kliot, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence+in+situ+hybridizations+(FISH)+for+the+localization+of+viruses+and+endosymbiotic+bacteria+in+plant+and+insect+tissues.">Fluorescence in situ hybridizations (FISH) for the localization of viruses and endosymbiotic bacteria in plant and insect tissues.</a> J. Vis. Exp. (84), e51030 (2014).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J. Vis. Exp. (62), e3923 (2012).</li><li>Rao, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+reduction+and+potential+metabolic+complementation+of+the+dual+endosymbionts+in+the+whitefly+Bemisia+tabaci.">Genome reduction and potential metabolic complementation of the dual endosymbionts in the whitefly Bemisia tabaci.</a> BMC Genomics. 16 (1), 226 (2015).</li><li>Thao, L. L., Baumann, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+relationships+of+primary+prokaryotic+endosymbionts+of+whiteflies+and+their+hosts.">Evolutionary relationships of primary prokaryotic endosymbionts of whiteflies and their hosts.</a> Appl. Environ. Microbiol. 70 (6), 3401-3406 (2004).</li><li>Zhu, D. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequencing+and+comparison+of+the+Rickettsia+genomes+from+the+whitefly+Bemisia+tabaci+Middle+East+Asia+Minor+I.">Sequencing and comparison of the Rickettsia genomes from the whitefly Bemisia tabaci Middle East Asia Minor I.</a> Insect Sci. 23 (4), 531-542 (2016).</li><li>Gottlieb, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+localization+of+a+Rickettsia+sp.+in+Bemisia+tabaci+(HomopteraAleyrodidae).">Identification and localization of a Rickettsia sp. in Bemisia tabaci (HomopteraAleyrodidae).</a> Appl. Environ. Microbiol. 72 (5), 3646-3652 (2006).</li><li>Zhang, C. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+temporal+changes+of+primary+and+secondary+bacterial+symbionts+and+whitefly+host+fitness+following+antibiotic+treatments.">Differential temporal changes of primary and secondary bacterial symbionts and whitefly host fitness following antibiotic treatments.</a> Sci. Rep. 5, 15898 (2015).</li><li>Shan, H. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temporal+changes+of+symbiont+density+and+host+fitness+after+rifampicin+treatment+in+a+whitefly+of+the+Bemisia+tabaci+species+complex.">Temporal changes of symbiont density and host fitness after rifampicin treatment in a whitefly of the Bemisia tabaci species complex.</a> Insect Sci. 23 (2), 200-214 (2016).</li><li>Zchori-Fein, E., Brown, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diversity+of+prokaryotes+asscociated+with+Bemisia+tabaci+(Gennadius)+(Hemiptera:+Aleyrodidae).">Diversity of prokaryotes asscociated with Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae).</a> Ann. Entomol. Soc. Am. 95 (6), 711-718 (2002).</li><li>Thao, M. L., Baumann, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+relationships+of+primary+prokaryotic+endosymbionts+of+whiteflies+and+their+hosts.">Evolutionary relationships of primary prokaryotic endosymbionts of whiteflies and their hosts.</a> Appl. Environ. Microbiol. 70 (6), 3401-3406 (2004).</li><li>Zchori-Fein, E., Perlman, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distribution+of+the+bacterial+symbiont+Cardinium+in+arthropods.">Distribution of the bacterial symbiont Cardinium in arthropods.</a> Mol. Ecol. 13 (7), 2009-2016 (2004).</li><li>O'Neill, S. L., Giordano, R., Colbert, A. M., Karr, T. L., Robertson, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=116S+rRNA+phylogenetic+analysis+of+the+bacterial+endosymbionts+associated+with+cytoplasmic+incompatibility+in+insects.">116S rRNA phylogenetic analysis of the bacterial endosymbionts associated with cytoplasmic incompatibility in insects.</a> Proc. Natl. Acad. Sci. U. S. A. 89 (7), 2699-2702 (1992).</li><li>Nirgianaki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+infections+of+the+whitefly+Bemisia+tabaci.">Wolbachia infections of the whitefly Bemisia tabaci.</a> Curr. Microbiol. 47 (2), 93-101 (2003).</li><li>Everett, K. D., Thao, M. L., Horn, M., Dyszynski, G. E., Baumann, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+chlamydiae+in+whiteflies+and+scale+insects:+endosymbionts+'Candidatus+Fritschea+bemisiae'+strain+Falk+and+'Candidatus+Fritschea+eriococci'+strain+Elm.">Novel chlamydiae in whiteflies and scale insects: endosymbionts 'Candidatus Fritschea bemisiae' strain Falk and 'Candidatus Fritschea eriococci' strain Elm.</a> Int. J. Syst. Evol. Micr. 55, 1581-1587 (2005).</li></ol>

The authors have nothing to disclose.

Since the endosymbionts within whiteflies cannot be cultured in vitro, dissection and assembling bacteriocytes is an effective way to obtain enough genetic material of endosymbionts. Before dissection, the species of whitefly and endosymbionts involved should be explicitly confirmed. The whitefly B. tabaci is a species complex with more than 35 morphologically indistinguishable species and different cryptic species may contain different endosymbionts. Portiera is uniformly harbored as an obligate symbiont22, and secondary symbionts vary among species, even the individual whitefly17,21,23. Moreover, although many endosymbionts have been proven to be restrained within bacteriocytes, some may be distributed in the entire body of the whitefly24. Thus, analyzing the localization of different endosymbionts by FISH and TEM is necessary before bacteriome dissection. 
For bacteriome dissection and any subsequent operations, the utilized materials must be strictly sterile to eliminate possible contamination of other bacteria, particularly the PBS solution, the filtration equipment, and the centrifuge tubes. Special care should be taken when filtering the PBS solution containing the bacteriomes to avoid environmental contamination. It is best to use a relatively aseptic environment. In addition, whitefly nymphs can be stored in absolute ethanol at room temperature before dissection, which may be useful to send samples to other places. Nevertheless, dead or environmental stress treated insects should not be used because there would be declination of bacteria25,26. 
In this protocol, the 3rd or 4th instar nymphs were utilized to isolate bacteriome. Compared to other stages of the whitefly, there are several advantages of using the 3rd or 4th instar nymphs for dissection. Firstly, compared to the 1st and 2nd instar nymphs, whiteflies in this stage are obviously larger and not so fragile. Secondly, in the 3rd or 4th instar nymphs of whitefly, bacteriome can be easily distinguished from other tissues of the whitefly body with an obviously yellow color, and bacteriocytes always cluster firmly and can be conveniently separated from other tissues. For the bacteriome in adult whiteflies, once pulled out from the body, bacteriocytes would separate quite easily thus increasing the difficulty in assembly. Hence, the best choice for dissecting bacteriomes is the 3rd or 4th instar nymphs. Nevertheless, this protocol can be used with adult whiteflies for certain experiment needs, with more practice. 
Compared to a previously published method using a single bacteriocyte21, this protocol assembled more bacteriocytes used in the amplification, which contributed to the richness and diversity of bacteriocytes. Furthermore, we utilized filtration to separate symbiont cells from whitefly bacteriocytes, which is more convenient than another method using a micromanipulator and a microinjector. Nevertheless, there were some limitations of this protocol. Firstly, symbionts not confined to bacteriocytes cannot be separated by this method, since we only dissect the bacteriome of the whitefly. Secondly, this protocol cannot absolutely eliminate the contamination of the whitefly genome, since some fragments of whitefly tissues would pass through the filter membrane. Thirdly, clustered symbionts cannot be further separated into individual symbiont species. Hence, obtaining a single species of bacterium accurately and purely requires further study.
In summary, we reported a convenient method for the extraction and purification of endosymbionts from the whitefly B. tabaci that is suitable for subsequent sequencing and analysis. The protocol described here can be easily adapted for the isolation of endosymbionts from other insects for genome sequencing.

Bacteria forming an intimate symbiotic relationship with relative hosts are widespread in arthropods1. The endosymbionts have been demonstrated to affect aspects of hosts, such as nutrition metabolism, reproduction, responses to environmental stresses2,3,4 etc., in almost every developmental stage5. However, the mechanism underpinning the associations still remains largely unknown. Genomics is of priority and importance when studying the potential functions and roles of bacteria. Some fundamental information, i.e. the taxonomic status, functional genes, metabolism pathways, secretion systems, can be inferred from genome sequences, which sheds lights on the potential roles of symbionts in symbiosis. With the development of high-throughput sequencing, a vast number of bacterial genomes have been sequenced with diverse functions revealed6.
Endosymbionts are of vital importance in hemipterans, such as aphids7, bedbugs8, psyllids9, brown planthoppers10 and cicadas11. For instance, Buchnera in aphids, as the obligate symbiont, has been demonstrated to be involved in essential amino acids biosynthesis, along with the genes from aphid genome12. Furthermore, transcriptional regulation of Buchnera is also revealed13. In psyllids, Carsonella is sequenced and ranked the smallest bacterial genome ever found14. All these hallmarks of endosymbionts are based and inferred from the genome sequences. Because these endosymbionts cannot be cultured in vitro, several approaches have been applied to isolate adequate bacteria for sequencing. In aphids, endosymbionts are extracted through centrifugation and filtration, and subjected to further genomic and transcriptomic analysis5. In brown planthoppers, endosymbionts are sequenced along with the whole insect genome10.
Whitefly B. tabaci is a species complex containing more than 35 morphologically indistinguishable species (cryptic species), among which, two invasive species have invaded all over the world and caused tremendous harm to agricultural production15. Of note, endosymbionts within the B. tabaci species have shown importance in the development of the pests16. To date, eight endosymbionts have been identified in the whitefly, including the obligate symbiont, Candidatus Portiera aleyrodidarum, and seven secondary symbionts Hamiltonella, Rickettsia, Arsenophonus, Cardinium, Wolbachia, Fritschea and Hemipteriphilus defined17,18.
Unlike the hemipterans described previously, the whitefly B. tabaci is an extremely tiny insect only 1 mm in length. Most endosymbionts are confined to bacteriocytes19 (specialized cells containing symbionts, which further form bacteriome in B. tabaci). In addition, these endosymbionts cannot be cultured in vitro. The only way to obtain endosymbionts from B. tabaci is to dissect the bacteriome out. However, there is difficulty in the dissection. First, the fragile bacteriome always links with other tissues of the whitefly, which is hard to separate. Secondly, the tiny size of the whitefly limits the isolation of enough bacteriome. Thirdly, endosymbionts cluster in the bacteriome, making it extremely complicated to acquire a single species of bacterium.
Here, we report a simple and inexpensive protocol to isolate whitefly endosymbionts for subsequent metagenome sequencing. Through dissection, purification and amplification, adequate endosymbiont DNA could be obtained and the species of bacteria could be confirmed. The described protocol can be used similarly in other arthropods.

<table border="0" cellpadding="0" cellspacing="0" width="775">
	<tbody>
		<tr height="53">
			<td height="53" style="height:53px;width:243px;">Taq DNA polymerase</td>
			<td style="width:107px;">Takara</td>
			<td style="width:129px;">R001A</td>
			<td style="width:296px;">including rTaq, 10&#215;Buffer and dNTP</td>
		</tr>
		<tr height="53">
			<td height="53" style="height:53px;width:243px;">Gel DNA extraction kit</td>
			<td style="width:107px;">Qiagen</td>
			<td style="width:129px;">28704</td>
			<td></td>
		</tr>
		<tr height="53">
			<td height="53" style="height:53px;width:243px;">DNA sample sequencing system</td>
			<td style="width:107px;">ABI</td>
			<td style="width:129px;">ABI-3730XL</td>
			<td></td>
		</tr>
		<tr height="53">
			<td height="53" style="height:53px;width:243px;">Microtome</td>
			<td style="width:107px;">Leica</td>
			<td style="width:129px;">EM UC7</td>
			<td></td>
		</tr>
		<tr height="53">
			<td height="53" style="height:53px;width:243px;">Transmission electron microscopy</td>
			<td style="width:107px;">Hitachi</td>
			<td style="width:129px;">H-7650 TEM</td>
			<td></td>
		</tr>
		<tr height="53">
			<td height="53" style="height:53px;width:243px;">Stereo microscope</td>
			<td style="width:107px;">Zeiss</td>
			<td style="width:129px;">Stemi 2000-C</td>
			<td></td>
		</tr>
		<tr height="53">
			<td height="53" style="height:53px;width:243px;">20 &#956;L microloader</td>
			<td style="width:107px;">Eppendorf</td>
			<td style="width:129px;">F2771951</td>
			<td></td>
		</tr>
		<tr height="53">
			<td height="53" style="height:53px;width:243px;">Filter holder</td>
			<td style="width:107px;">Millipore</td>
			<td style="width:129px;">SX0001300</td>
			<td></td>
		</tr>
		<tr height="53">
			<td height="53" style="height:53px;width:243px;">Filter membrane filter</td>
			<td style="width:107px;">Millipore</td>
			<td style="width:129px;">SMWP001300</td>
			<td>5.0 &#956;m SMWP</td>
		</tr>
		<tr height="53">
			<td height="53" style="height:53px;width:243px;">REPLI-g UltraFast Mini Kit</td>
			<td style="width:107px;">Qiagen</td>
			<td style="width:129px;">150033</td>
			<td>DNA amlification kit</td>
		</tr>
		<tr height="53">
			<td height="53" style="height:53px;width:243px;">NanoDrop</td>
			<td style="width:107px;">Thermo Scientific</td>
			<td style="width:129px;">NanoDrop 2000</td>
			<td></td>
		</tr>
		<tr height="53">
			<td height="53" style="height:53px;">Qubit Fluorometer</td>
			<td style="width:107px;">Thermo Fisher Scientific</td>
			<td style="width:129px;">Q33216</td>
			<td></td>
		</tr>
		<tr height="53">
			<td height="53" style="height:53px;width:243px;">Genome Sequencer</td>
			<td style="width:107px;">Illumina</td>
			<td style="width:129px;">Hiseq 2000</td>
			<td></td>
		</tr>
	</tbody>
</table>

methods for the extraction of endosymbionts from the whitefly bemisia tabaci

Bacterial symbionts form an intimate relationship with their hosts and confer advantages to the hosts in most cases. Genomic information is critical to study the functions and evolution of bacterial symbionts in their host. As most symbionts cannot be cultured in vitro, methods to isolate an adequate quantity of bacteria for genome sequencing are very important. In the whitefly Bemisia tabaci, a number of endosymbionts have been identified and are predicted to be of importance in the development and reproduction of the pests through multiple approaches. However, the mechanism underpinning the associations remains largely unknown. The obstacle partially comes from the fact that the endosymbionts in whitefly, mostly restrained in bacteriocytes, are hard to separate from the host cells. Here we report a step-by-step protocol for the identification, extraction and purification of endosymbionts from the whitefly B. tabaci mainly by dissection and filtration. Endosymbiont samples prepared by this method, although still a mixture of different endosymbiont species, are suitable for subsequent genome sequencing and analysis of the possible roles of endosymbionts in B. tabaci. This method may also be used to isolate endosymbionts from other insects.

The Middle East Asia Minor 1 (MEAM1) species of the B. tabaci complex was taken as an example here for description. Cotton for rearing whiteflies and several developmental stages of whiteflies are shown in Figure 1 including a cotton plant, adult whitefly and the 1st, 2nd and 4th instar nymphs of whitefly (the 3rd instar nymph looks similarly as the 4th instar nymph). It was obvious that the 4th instar nymph is larger than the 1st and 2nd instar nymphs (Figure 1). FISH analysis of Portiera and Hamiltonella within MEAM1 is shown in Figure 2. These two endosymbionts are confined to the bacteriocytes of the whitefly, and overlapping of the two bacteria is also observed. Figure 3 shows transmission electron microscopy images of the Portiera endosymbiont of the whitefly, which indicates that Portiera may lose the its cell wall.
For sequencing, two libraries were built, with insert sizes of 200 bp and 2,000 bp, respectively. After sequencing, the two libraries generated 1,626 Mb and 1,302 Mb of raw data, respectively. After cleaning up the contamination data for adaptors and duplications, 1,484 Mb and 1,219 Mb of clean data were acquired. The assembly successfully resulted in a complete genome sequence for the obligate symbiont, Portiera. In addition, a draft genome of Hamiltonella was also obtained. The assembly based on both 200 bp and 2,000 bp libraries resulted in 138 contigs. According to paired-end relationships, the 138 contigs were further assembled into 89 scaffolds (Table 2).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/55809/55809fig1.jpg" /> 
Figure 1: Overview of the Plant-insect System Utilized in this Paper. (A) Whiteflies are reared on cotton plants (Gossypium hirsutum cv. Zhe-Mian 1793). (B) View of an adult whitefly. (C) Several developmental stages of instar nymph in the whitefly life cycle. Red arrow refers to the egg of whitefly; Black arrow refers to the 1st instar nymph of whitefly; White arrow refers to the 2nd nymph of whitefly; Blue arrow refers to the 4th instar nymph of whitefly. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55809/55809fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/55809/55809fig2.jpg" /> 
Figure 2: FISH Analysis of Portiera, Hamiltonella in the 4th Instar Nymph of MEAM1. Portiera-specific probe (red) conjugated to Cy3, Hamiltonella-specific probe (green) marked with Cy5 were used. Scale bars = 100 &#181;m. (A) The red hybridization signals represent the Portiera under dark field. (B) The green hybridization signals represent the Hamiltonella under dark field. (C) Portiera and Hamiltonella merged signals under dark field. (D) Portiera and Hamiltonella merged signals under bright field. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55809/55809fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/55809/55809fig3.jpg" /> 
Figure 3: Transmission Electron Microscopy Image of Portiera in Whitefly. Arrow indicates the location of Portiera. Scale bar = 1 &#181;m. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55809/55809fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Target symbiont</td>
			<td>Target gene</td>
			<td colspan="3">Primer sequences (5&#39;-3&#39;)</td>
			<td>PCR procedures</td>
			<td>References</td>
		</tr>
		<tr>
			<td>Portiera</td>
			<td>16S rRNA</td>
			<td colspan="3">Por-F: TGCAAGTCGAGCGGCATCAT</td>
			<td>95 &#176;C 1 min, 60 &#176;C 1 min, 72 &#176;C 1 min, 5 cycles;&#160;</td>
			<td>27</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3">Por-R: AAAGTTCCCGCCTTATGCGT</td>
			<td colspan="2">95 &#176;C 1 min, 58 &#176;C 1 min, 72 &#176;C 1 min, 30 cycles;</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3"></td>
			<td>72 &#176;C 20 min</td>
			<td></td>
		</tr>
		<tr>
			<td>Hamiltonella</td>
			<td>16S rRNA</td>
			<td colspan="3">Ham-F: TGAGTAAAGTCTGGGAATCTGG</td>
			<td>95 &#176;C 1 min, 60 &#176;C 1 min, 72 &#176;C 1 min, 5 cycles;&#160;</td>
			<td>27</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3">Ham-R: CCCGGGAACGTATTCACCGTAG</td>
			<td colspan="2">95 &#176;C 1 min, 58 &#176;C 1 min, 72 &#176;C 1 min, 30 cycles;</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3"></td>
			<td>72 &#176;C 20 min</td>
			<td></td>
		</tr>
		<tr>
			<td>Rickettsia</td>
			<td>16S rRNA</td>
			<td colspan="3">Ric-F: GCTCAGAACGAACGCTATC</td>
			<td>95 &#176;C 2 min;&#160;</td>
			<td>24</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3">Ric-R: GAAGGAAAGCATCTCTGC</td>
			<td>92 &#176;C 1 min, 58 &#176;C 1 min, 72 &#176;C 90 s, 30 cycles;</td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3"></td>
			<td>72 &#176;C 5 min</td>
			<td></td>
		</tr>
		<tr>
			<td>Arsenophonus</td>
			<td>23S rRNA</td>
			<td colspan="3">Ars-F: CGTTTGATGAATTCATAGTCAAA</td>
			<td>95 &#176;C 5 min;&#160;</td>
			<td>28</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3">Ars-R: GGTCCTCCAGTTAGTGTTACCCAAC</td>
			<td>95 &#176;C 30 s, 60.5 &#176;C 30 s, 72 &#176;C 45 s, 30 cycles;</td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3"></td>
			<td>72 &#176;C 10 min</td>
			<td></td>
		</tr>
		<tr>
			<td>Cardinium</td>
			<td>16S rRNA</td>
			<td colspan="3">Car-F: TACTGTAAGAATAAGCACCGGC</td>
			<td>95 &#176;C 2 min</td>
			<td>29</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3">Car-R: GTGGATCACTTAACGCTTTCG</td>
			<td>92 &#176;C 1 min, 57 &#176;C 1 min, 72 &#176;C 90 s, 30 cycles;</td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3"></td>
			<td>72 &#176;C 5 min</td>
			<td></td>
		</tr>
		<tr>
			<td>Wolbachia</td>
			<td>16S rRNA</td>
			<td colspan="3">Wol-F: TTGTAGCCTGCTATGGTATAACT</td>
			<td>94 &#176;C 5 min;&#160;</td>
			<td>30, 31</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3">Wol-R: GAATAGGTATGATTTTCATGT</td>
			<td colspan="2">94 &#176;C 1 min, 55 &#176;C 1 min, 72 &#176;C 1 min, 35 cycles</td>
		</tr>
		<tr>
			<td>Fritschea</td>
			<td>23S rRNA</td>
			<td colspan="3">Fri-F: GATGCCTTGGCATTGATAGGCGATGAAGGA</td>
			<td>95 &#176;C 5 min;&#160;</td>
			<td>32</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3">Fri-R: TGGCTCATCATGCAAAAGGCA</td>
			<td>94 &#176;C 1 min, 64 &#176;C 1 min, 72 &#176;C 90 s, 35 cycles;</td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3"></td>
			<td>72 &#176;C 5 min</td>
			<td></td>
		</tr>
		<tr>
			<td>Hemipteriphilus</td>
			<td>groEL</td>
			<td colspan="3">OR-groEL-F: CACCWAAAATTACTAAAGATGG</td>
			<td>94 &#176;C 3 min;&#160;</td>
			<td>18</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3">OR-groEL-R: TAGAARTCCATWCCKCCCATWC</td>
			<td>94 &#176;C 30 s, 52 &#176;C 30 s, 72 &#176;C 2 min, 34 cycles;</td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3"></td>
			<td>72 &#176;C 10 min</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 1: PCR Primers and Procedures of Endosymbionts in Whitefly.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td>Portiera</td>
			<td>Hamiltonella</td>
		</tr>
		<tr>
			<td>Contig Number</td>
			<td>1</td>
			<td>138</td>
		</tr>
		<tr>
			<td>Scaffold numbera</td>
			<td>1</td>
			<td>89</td>
		</tr>
		<tr>
			<td>Total length, bp</td>
			<td>358,232</td>
			<td>1,711,449</td>
		</tr>
		<tr>
			<td>N50, bp</td>
			<td>/</td>
			<td>118,802</td>
		</tr>
		<tr>
			<td>N90, bp</td>
			<td>/</td>
			<td>16,753</td>
		</tr>
		<tr>
			<td>Max length, bp</td>
			<td>/</td>
			<td>390,511</td>
		</tr>
		<tr>
			<td>Min length, bp</td>
			<td>/</td>
			<td>503</td>
		</tr>
		<tr>
			<td>GC content, %</td>
			<td>26.18</td>
			<td>39.89</td>
		</tr>
		<tr>
			<td colspan="3">a Information presented below are all based on scaffolds.</td>
		</tr>
	</tbody>
</table>
Table 2: General Features of Portiera and Hamiltonella Draft Genome.

Watch this Scientific Journal Video about Methods for the Extraction of Endosymbionts from the Whitefly Bemisia tabaci at JoVE.com

Methods for the Extraction of Endosymbionts from the Whitefly Bemisia tabaci

Here, we present a protocol to isolate endosymbionts from the whitefly Bemisia tabaci through dissection and filtration. After amplification, the DNA samples are suitable for subsequent sequencing and study of the mutualism between endosymbionts and whitefly.

Methods for the Extraction of Endosymbionts from the Whitefly Bemisia tabaci

Bacterial symbionts form an intimate relationship with their hosts and confer advantages to the hosts in most cases. Genomic information is critical to ...

methods-for-extraction-endosymbionts-from-whitefly-bemisia

Nanyang Technological University

Research

JoVE Journal

Biology

9.8K Views.  Zhejiang University. Here, we present a protocol to isolate endosymbionts from the whitefly Bemisia tabaci through dissection and filtration. After amplification, the DNA samples are suitable for subsequent sequencing and study of the mutualism between endosymbionts and whitefly.

Video: Methods for the Extraction of Endosymbionts from the Whitefly Bemisia tabaci

Methods for Patch Clamp Capacitance Recordings from the Calyx

We demonstrate the basic techniques for presynaptic patch clamp recording at the calyx of Held, a mammalian central nervous system nerve terminal. Electrical recordings from the presynaptic terminal allow the measurement of action potentials, calcium channel currents, vesicle fusion (exocytosis) and subsequent membrane uptake (endocytosis). The fusion of vesicles containing neurotransmitter causes the vesicle membrane to be added to the cell membrane of the calyx. This increase in the amount of cell membrane is measured as an increase in capacitance. The subsequent reduction in capacitance indicates endocytosis, the process of membrane uptake or removal from the calyx membrane. Endocytosis, is necessary to maintain the structure of the calyx and it is also necessary to form vesicles that will be filled with neurotransmitter for future exocytosis events. Capacitance recordings at the calyx of Held have made it possible to directly and rapidly measure vesicular release and subsequent endocytosis in a mammalian CNS nerve terminal. In addition, the corresponding postsynaptic activity can be simultaneously measured by using paired recordings. Thus a complete picture of the presynaptic and postsynaptic electrical activity at a central nervous system synapse is achievable using this preparation. Here, the methods for slice preparation, morphological features for identification of calyces of Held, basic patch clamping techniques, and examples of capacitance recordings to measure exocytosis and endocytosis are presented.

We demonstrate the basic techniques for presynaptic patch clamp recording at the calyx of Held, a mammalian central nervous system nerve terminal.

We demonstrate the basic techniques for presynaptic patch clamp recording at the calyx of Held, a mammalian central nervous system nerve terminal. ...

Micro-dissection of Rat Brain for RNA or Protein Extraction from Specific Brain Region

Micro-dissection of rat brain into various regions is extremely important for the study of different neurodegenerative diseases. This video demonstrates micro-dissection of four major brain regions include olfactory bulb, frontal cortex, striatum and hippocampus in fresh rat brain tissue. Useful tips for quick removal of respective regions to avoid RNA and protein degradation of the tissue are given.

Micro-dissection of rat brain into various regions is extremely important for the study of different neurodegenerative diseases. This video demonstrates micro-dissection of four major brain regions include olfactory bulb, frontal cortex, striatum and hippocampus in fresh rat brain tissue. Useful tips for quick removal of respective regions to avoid RNA and protein degradation of the tissue are given.

Micro-dissection of rat brain into various regions is extremely important for the study of different neurodegenerative diseases. This video demonstrates ...

RNA Extraction from Neuroprecursor Cells Using the Bio-Rad Total RNA Kit

Electrophysiological Methods for Recording Synaptic Potentials from the NMJ of Drosophila Larvae

In this video, we describe the electrophysiological methods for recording synaptic transmission at the neuromuscular junction (NMJ) of Drosophila larva. The larval neuromuscular system is a model synapse for the study of synaptic physiology and neurotransmission, and is a valuable research tool that has defined genetics and is accessible to experimental manipulation. Larvae can be dissected to expose the body wall musculature, central nervous system, and peripheral nerves. The muscles of Drosophila and their innervation pattern are well characterized and muscles are easy to access for intracellular recording. Individual muscles can be identified by their location and orientation within the 8 abdominal segments, each with 30 muscles arranged in a pattern that is repeated in segments A2 - A7. Dissected drosophila larvae are thin and individual muscles and bundles of motor neuron axons can be visualized by transillumination1. Transgenic constructs can be used to label target cells for visual identification or for manipulating gene products in specific tissues. In larvae, excitatory junction potentials (EJP&#8217;s) are generated in response to vesicular release of glutamate from the motoneurons at the synapse. In dissected larvae, the EJP can be recorded in the muscle with an intracellular electrode. Action potentials can be artificially evoked in motor neurons that have been cut posterior to the ventral ganglion, drawn into a glass pipette by gentle suction and stimulated with an electrode. These motor neurons have distinct firing thresholds when stimulated, and when they fire simultaneously, they generate a response in the muscle. Signals transmitted across the NMJ synapse can be recorded in the muscles that the motor neurons innervate. The EJP&#8217;s and minature excitatory junction potentials (mEJP&#8217;s) are seen as changes in membrane potential. Electrophysiological responses are recorded at room temperature in modified minimal hemolymph-like solution2 (HL3) that contains 5 mM Mg2+ and 1.5 mM Ca2+. Changes in the amplitude of evoked EJP&#8217;s can indicate differences in synaptic function and structure. Digitized recordings are analyzed for EJP amplitude, mEJP frequency and amplitude, and quantal content.

Here we describe electrophysiological methods for measuring synaptic transmission at the neuromuscular junction of Drosophila larva. Evoked release is initiated artificially by stimulating the motor neuron axons, and transmission through the NMJ can be measured by the postsynaptic response evoked in the muscle.

In this video, we describe the electrophysiological methods for recording synaptic transmission at the neuromuscular junction (NMJ) of Drosophila larva. ...

Methods for the Study of the Zebrafish Maxillary Barbel

Barbels are skin sensory appendages found in fishes, reptiles and amphibians. The zebrafish, Danio rerio, develops two pairs of barbels- a short nasal pair and a longer maxillary pair. Barbel tissue contains cells of ectodermal, mesodermal and neural crest origin, including skin cells, glands, taste buds, melanocytes, circulatory vessels and sensory nerves. Unlike most adult tissue, the maxillary barbel is optically clear, allowing us to visualize the development and maintenance of these tissue types throughout the life cycle. 
This video shows early development of the maxillary barbel (beginning approximately one month post-fertilization) and demonstrates a surgical protocol to induce regeneration in the adult appendage (&gt;3 months post-fertilization). Briefly, the left maxillary barbel of an anesthetized fish is elevated with sterile forceps just distal to the caudal edge of the maxilla. A fine, sterile spring scissors is positioned against the forceps to cut the barbel shaft at this level, establishing an anatomical landmark for the amputation plane. Regenerative growth can be measured with respect to this plane, and in comparison to the contralateral barbel. Barbel tissue regenerates rapidly, reaching maximal regrowth within 2 weeks of injury.
Techniques for analyzing the regenerated barbel include dissecting and embedding matched pairs of barbels (regenerate and control) in the wells of a standard DNA electrophoresis gel. Embedded specimens are conveniently photographed under a stereomicroscope for gross morphology and morphometry, and can be stored for weeks prior to downstream applications such as paraffin histology, cryosectioning, and/or whole mount immunohistochemistry. These methods establish the maxillary barbel as a novel in vivo tissue system for studying the regenerative capacity of multiple cell types within the genetic context of zebrafish.

The zebrafish maxillary barbel is an integumentary sense organ containing ectodermal, mesodermal and neural crest derivatives. Importantly, the adult barbel can regenerate after proximal amputation. This video introduces maxillary barbel development and demonstrates a surgical protocol to induce regeneration, followed by collection, embedding and downstream imaging of barbel specimens.

Barbels are skin sensory appendages found in fishes, reptiles and amphibians.  The zebrafish, Danio rerio, develops two pairs of barbels- a short nasal ...

Extraction of the EPP Component from the Surface EMG

A surface electromyogram (EMG), especially when recorded near the neuromuscular junction, is expected to contain the endplate potential (EPP) component which can be extracted with an appropriate signal filter. Two factors are important: the EMG must be recorded in monopolar fashion, and the recording must be done so the low frequency signal corresponding the EPP is not eliminated. This report explains how to extract the EPP component from the EMG of the masseter muscle in a human subject. The surface EMG is recorded from eight sites using traditional disc electrodes aligned along over the muscle, with equal inter-electrode distance from the zygomatic arch to the angle of mandible in response to quick gum clenching. A reference electrode is placed on the tip of the nose. The EPP component is extracted from the raw EMGs by applying a high-cut digital filter (2nd dimension Butterworth filter) with a range of 10-35 Hz. When the filter is set to 10 Hz, the extracted EPP wave deflects either negative or positive depending on the recording site. The difference in the polarity reflects the sink-source relation of the end plate current, with the site showing the most negative deflection corresponding to the neuromuscular junction. In the case of the masseter muscle, the neuromuscular junction is estimated to be located in the inferior portion close to the angle of mandible. The EPP component exhibits an interesting oscillation when the cut-off frequency of the high-cut digital filter is set to 30 Hz. The EPP oscillation indicates that muscle contraction is adjusted in an intermittent manner. Abnormal tremors accompanying various sorts of diseases may be substantially due to this EPP oscillation, which becomes slower and is difficult to cease.

The endplate potential (EPP) component can be extracted from the surface EMG using a digital filter. The extracted EPP shows oscillation with a frequency of about 30 Hz.

A surface electromyogram (EMG), especially when recorded near the neuromuscular junction, is expected to contain the endplate potential (EPP) component ...

Budding Yeast Protein Extraction and Purification for the Study of Function, Interactions, and Post-translational Modifications

Homogenization by bead beating is a fast and efficient way to release DNA, RNA, proteins, and metabolites from budding yeast cells, which are notoriously hard to disrupt. Here we describe the use of a bead mill homogenizer for the extraction of proteins into buffers optimized to maintain the functions, interactions and post-translational modifications of proteins. Logarithmically growing cells expressing the protein of interest are grown in a liquid growth media of choice. The growth media may be supplemented with reagents to induce protein expression from inducible promoters (e.g. galactose), synchronize cell cycle stage (e.g. nocodazole), or inhibit proteasome function (e.g. MG132). Cells are then pelleted and resuspended in a suitable buffer containing protease and/or phosphatase inhibitors and are either processed immediately or frozen in liquid nitrogen for later use. Homogenization is accomplished by six cycles of 20 sec&#160;bead-beating (5.5 m/sec), each followed by one minute incubation on ice. The resulting homogenate is cleared by centrifugation and small particulates can be removed by filtration. The resulting cleared whole cell extract (WCE) is precipitated using 20% TCA for direct analysis of total proteins by SDS-PAGE followed by Western blotting. Extracts are also suitable for affinity purification of specific proteins, the detection of post-translational modifications, or the analysis of co-purifying proteins. As is the case for most protein purification protocols, some enzymes and proteins may require unique conditions or buffer compositions for their purification and others may be unstable or insoluble under the conditions stated. In the latter case, the protocol presented may provide a useful starting point to empirically determine the best bead-beating strategy for protein extraction and purification. We show the extraction and purification of an epitope-tagged SUMO E3 ligase, Siz1, a cell cycle regulated protein that becomes both sumoylated and phosphorylated, as well as a SUMO-targeted ubiquitin ligase subunit, Slx5.

The preparation of high quality yeast cell extracts is a necessary first step in the analysis of individual proteins or entire proteomes. Here we describe a fast, efficient, and reliable homogenization protocol for budding yeast cells that has been optimized to preserve protein functions, interactions, and post-translational modifications.

Homogenization by bead beating is a fast and efficient way to release DNA, RNA, proteins, and metabolites from budding yeast cells, which are notoriously ...

The Infiltration-centrifugation Technique for Extraction of Apoplastic Fluid from Plant Leaves Using Phaseolus vulgaris as an Example

The apoplast is a distinct extracellular compartment in plant tissues that lies outside the plasma membrane and includes the cell wall. The apoplastic compartment of plant leaves is the site of several important biological processes, including cell wall formation, cellular nutrient and water uptake and export, plant-endophyte interactions and defence responses to pathogens. The infiltration-centrifugation method is well established as a robust technique for the analysis of the soluble apoplast composition of various plant species. The fluid obtained by this method is commonly known as apoplast washing fluid (AWF). The following protocol describes an optimized vacuum infiltration and centrifugation method for AWF extraction from Phaseolus vulgaris (French bean) cv. Tendergreen leaves. The limitations of this method and the optimization of the protocol for other plant species are discussed. Recovered AWF can be used in a wide range of downstream experiments that seek to characterize the composition of the apoplast and how it varies in response to plant species and genotype, plant development and environmental conditions, or to determine how microorganisms grow in apoplast fluid and respond to changes in its composition.

The Infiltration-centrifugation Technique for Extraction of Apoplastic Fluid from Plant Leaves Using Phaseolus vulgaris as an Example

This protocol details the optimized extraction of apoplast washing fluid from plant leaves, using French bean plants (Phaseolus vulgaris) as a model example.

The apoplast is a distinct extracellular compartment in plant tissues that lies outside the plasma membrane and includes the cell wall. The apoplastic ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 &#181;l whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

We describe here a simple and rapid paper-based DNA extraction method of HIV proviral DNA from whole blood detected by quantitative PCR. This protocol can be extended for use in detecting other genetic markers or using alternative amplification methods.

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Methods for the Isolation, Culture, and Functional Characterization of Sinoatrial Node Myocytes from Adult Mice

Sinoatrial node myocytes (SAMs) act as the natural pacemakers of the heart, initiating each heart beat by generating spontaneous action potentials (APs). These pacemaker APs reflect the coordinated activity of numerous membrane currents and intracellular calcium cycling. However the precise mechanisms that drive spontaneous pacemaker activity in SAMs remain elusive. Acutely isolated SAMs are an essential preparation for experiments to dissect the molecular basis of cardiac pacemaking. However, the indistinct anatomy, complex microdissection, and finicky enzymatic digestion conditions have prevented widespread use of acutely isolated SAMs. In addition, methods were not available until recently to permit longer-term culture of SAMs for protein expression studies. Here we provide a step-by-step protocol and video demonstration for the isolation of SAMs from adult mice. A method is also demonstrated for maintaining adult mouse SAMs in vitro and for expression of exogenous proteins via adenoviral infection. Acutely isolated and cultured SAMs prepared via these methods are suitable for a variety of electrophysiological and imaging studies.

Methods are demonstrated for the isolation of sinoatrial node myocytes (SAMs) from adult mice for patch clamp electrophysiology or imaging studies. Isolated cells can be used directly or can be maintained in culture to permit expression of proteins of interest, such as genetically encoded reporters.

Sinoatrial node myocytes (SAMs) act as the natural pacemakers of the heart, initiating each heart beat by generating spontaneous action potentials (APs). ...