Funding support for this project was provided by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Science and ICT (2016R1A2B2006354).

1. Preparation of Media
<ol>
	<li>Prepare Yeast Extract with supplements (YES), YES without adenine (YES Low Ade), Pombe Glutamate medium (PMG12), and PMG without adenine (PMG-Ade) by mixing the components as described in Table 1. YES-Ade (Low Ade) and PMG-Ade plates have all of the same components, but the adenine is omitted from the latter.
	<ol>
		<li>Use the following salt (50x) stock: 52.5 g/L MgCl2&#183;6H2O, 2 g/L CaCl2&#183;2H2O, 50 g/L KCl, 2 g/L Na2SO4 in distilled water. Filter sterilize using a 0.22-&#181;m pore-size filter and store at 4 &#176;C.</li>
		<li>Use the following vitamin (1,000x) stock: 1 g/L pantothenate, 10 g/L nicotinic acid, 10 g/L inositol, 10 mg/L biotin in distilled water. Filter sterilize using a 0.22-&#181;m pore-size filter and store at 4 &#176;C.</li>
		<li>Use the following mineral (10,000x) stock: 5 g/L boric acid, 4 g/L MnSO4, 4 g/L ZnSO4&#183;7H2O, 2 g/L FeCl2&#183;4H2O, 0.4 g/L MoO3, 1 g/L KI, 0.4 g/L CuSO4&#183;5H2O, 10 g/L citric acid in distilled water. Filter sterilize using a 0.22-&#181;m pore-size filter and store at 4 &#176;C. 
		NOTE: YES liquid medium can be made by omitting the agar.</li>
	</ol>
	</li>
	<li>Autoclave the medium and cool it to below 60 &#176;C while stirring with a stir bar, at the rate of 200 rpm.</li>
	<li>For YES+G418 (geneticin) plates, add 1 mL/L G418 stock solution to the YES medium.
	<ol>
		<li>Use the following G418 (1,000x) stock: 100 mg/mL G418 in distilled water. Filter sterilize using a 0.22-&#181;m pore-size filter, aliquot to 1.5 mL centrifuge tubes, and store at -20 &#176;C.</li>
	</ol>
	</li>
	<li>Stir for another 5 - 10 min and aliquot the media into 90-mm Petri dishes (1 L of medium aliquots to roughly 40 Petri dishes. Store the plates at 4 &#176;C.</li>
</ol>
2. Cloning of rpt4+ and its 5&#39;/3&#39; UTRs
<ol>
	<li>Perform PCR with primers p1 and p2 (Figure 1A) using fission yeast genomic DNA (gDNA) as the template in a total volume of 50 &#181;L (~1 &#181;g DNA, 20 U enzyme, 1x reaction buffer), and applying the reaction cycles described in Table 2 to amplify a 3,315-base pair (bp) fragment comprising rpt4+ and its 5&#39;/3&#39; UTRs. Purify the PCR product using a purification kit13 as directed by the manufacturer (Figure 1A).</li>
	<li>Digest the pBlueScript KS(-) vector14 and the amplified DNA fragment containing rpt4+ with its 5&#39;/3&#39; UTRs with BamH1 and Xho1 in a total volume of 20 &#181;L (~1 &#181;g DNA, 20 U enzyme, 1x digestion buffer) at 37 &#176;C in a water bath for 16 - 18 h (Figure 1B).</li>
	<li>Gel purify the digested vector (1.2% agarose gel) and DNA insert by performing TAE-based agarose gel electrophoresis (100 V, 1 h), excising the DNA bands of the desired sizes, and isolating the DNA with a gel extraction kit15.</li>
	<li>Ligate the vector and DNA insert using T4 DNA ligase by performing a 20-&#181;L ligation reaction containing 50 - 100 ng of the vector DNA, a ~3-fold molar excess of the insert DNA, 400 U T4 DNA ligase, and 1x ligation buffer. Incubate this mixture at 18 &#176;C for 16 - 18 h.</li>
	<li>Transform the ligated DNA into 100 &#181;L of E. coli DH5&#945; by applying heat shock for 70 s at 42 &#176;C. Add 1 mL of LB and incubate for 1 h at 37 &#176;C for recovery. Perform centrifugation (13,800 x&#160;g), discard the supernatant, plate all of the transformed E. coli cells on LB-Ampicillin (LA) plates, and incubate at 37 &#176;C for 16 h.</li>
	<li>Pick 4 - 8 colonies with toothpicks and grow overnight at 37 &#176;C in 3 mL LA medium.</li>
	<li>Isolate the plasmids with a plasmid purification kit16 used according to the manufacturer&#39;s protocol and perform analytical restriction enzyme digestions with 5 &#181;L of the isolated plasmid, 5 U of each restriction enzyme (BamH1 and Xho1) and 1x restriction buffer. Incubate the reaction mixture at 37 &#176;C in a water bath for 3 h. Confirm the cloning by sequencing candidate plasmids.</li>
</ol>
3. Introduction of the Silent Mutation (Xho1 Restriction Site)
<ol>
	<li>Design a pair of 33-bp primers (p3 and p4) that contain the desired mutation in the otherwise complementary sequence.</li>
	<li>Perform PCR with high-fidelity polymerase17 (Figure 1C) in a total volume of 25 &#181;L (10 ng of cloned plasmid, 2 &#181;L of 10 pmol primer mix, 2 U enzyme, 1x reaction buffer) using the cycling parameters listed in Table 3.</li>
	<li>Digest the template plasmid with DpnI in a total volume of 20 &#181;L (20 U enzyme, 1x digestion buffer) at 37 &#176;C in a water bath for 1 h.</li>
	<li>Transform, propagate, isolate, and sequence the plasmid containing the silent mutation, as described in steps 2.5 - 2.7. 
	Note: The silent mutation can also be introduced using a cloning method which allows for the joining of multiple DNA fragments in a single reaction18.</li>
</ol>
4. Random Mutagenesis of rpt4+ by Error-prone PCR
<ol>
	<li>Perform error-prone PCR, using the plasmid with the silent mutation (Xho1 site) as the template, primers p5 and p6, a total volume of 50 &#181;L (the amount of template defined in step 4.1.1, 2 &#181;L of 10 pmol primer mix, 2.5 U enzyme, 1x reaction buffer), and a special polymerase that is designed to generate a high error rate19 (Figure 1D). Perform PCR as described in Table 2.
	<ol>
		<li>Use 4 - 5 &#181;g of template plasmid to control the mutation frequency to 1 bp/kb (kilobase). 
		Note: A high-concentration (&#62;500 ng/&#181;L) of plasmid, which may be obtained using a Mini-prep kit20, is required.</li>
	</ol>
	</li>
	<li>Use gel electrophoresis to confirm a PCR product of 2670 bp (1.2% agarose gel). Gel purify this PCR product as described in step 2.5.</li>
</ol>
5. Preparation of Fusion PCR Fragments (KAN, 3&#39;UTR)
<ol>
	<li>Perform PCR using pFA6a-KANMX621 as the template, primers p7 and p8, and the conditions listed in Table 4 to obtain the marker (KAN) fragment. Gel purify the resulting 1,480-bp fragment as described in step 2.5 (Figure 1E).
	<ol>
		<li>Check if the stop codon of the gene targeted for mutation and the coding region of its adjacent gene are separated by more than 500 bp. The endogenous terminator may not be used when this region is less than 500 bp; rather, the ADH terminator should be used instead of the endogenous terminator. The protocol changes required to use the ADH terminator are presented in Table 5. 
		Note: These changes only apply when the ADH terminator, which is available in the pFA6a-3HA-KANMX6 plasmid, is used instead of the endogenous terminator.</li>
	</ol>
	</li>
	<li>Perform PCR with the cloned rpt4+-containing vector as the template and primers p9 and p10 in a total volume of 50 &#181;L (20 ng of the cloned plasmid, 2 &#181;L of 10 pmol primer mix, 2 U enzyme, 1x reaction buffer), using the conditions presented in Table 6. Gel purify the obtained 506-bp 3&#39;UTR fragment (Figure 1E).</li>
</ol>
6. Generation of the Transformation Construct by Fusion PCR (Figure 1E)
<ol>
	<li>Prepare the 3 fragments (mutagenized rpt4+, KAN, and the 3&#39;UTR) at 50 ng/&#181;L.</li>
	<li>Perform fusion PCR of the three fragments using primers p11 and p12, as described in Table 7. (The protocol for fusion PCR is a modification of the original protocol22.) Purify the major 4,398-bp PCR product.
	<ol>
		<li>Use rpt4+:KAN:3&#39;UTR fragments at a ratio of 1:3:1 for optimal results. 
		Note: The total amount of the insert DNA should not exceed 500 ng. The recommended amount of rpt4+:KAN:3&#39;UTR is 50 ng:150 ng:50 ng. The mutagenized region is approximately 1.6 kb, so the minimum number of yeast colonies that would account for all possible combinations of each base being mutated to the other three is 1,600 x 3 = 4,800 colonies. Because one transformation reaction typically yields 400 - 500 colonies, at least 10 reactions worth of fusion PCR construct is needed. This need can be met by simply increasing the reaction amount (i.e., the number of PCR tubes) by a factor of ten.</li>
	</ol>
	</li>
</ol>
7. Transformation of Fission Yeast by Electroporation (Figure 1F)
<ol>
	<li>Inoculate yeast to 10 mL of YES medium to saturation by incubating it for more than 16 h.</li>
	<li>Dilute the cells to an optical density at 600 nm (OD600) of 0.2 in 200 mL of YES medium and incubate at 30 &#176;C with shaking for 5 - 6 h, to OD600 = 0.6 - 0.8.</li>
	<li>Concentrate cells to OD600 = 30, dispense to four 50-mL conical tubes and chill on ice for 10 min.</li>
	<li>Harvest the cells by performing centrifugation at 1,050 x g for 3 min at 4 &#176;C. Place the tubes and 10 electro-cuvettes on ice. Perform the steps 7.3 - 7.8 on ice.</li>
	<li>Discard the supernatant and add 15 mL of 1.2 M sorbitol. Gently shake the tubes to resuspend the cells.</li>
	<li>Centrifuge the cells at 1050 x g for 3 min at 4 &#176;C.</li>
	<li>Repeat steps 7.4 and 7.5. Discard the supernatant. Add 500 &#181;L of 1.2 M sorbitol to each tube, resuspend the cells, and collect all of the cells in one 15-ml conical tube.</li>
	<li>Add 1.2 M sorbitol up to 2.4 mL (OD600 = 10 per 0.2 mL). Keep the tube on ice.</li>
	<li>Add 200 &#181;L of sorbitol-suspended cells (make sure they are fully suspended) to an EP tube containing the fusion PCR construct, mix well, and transfer the sample to an electro-cuvette.</li>
	<li>Electroporate the cells with the following options: Fungi, ShS (2.00kV, 1 pulse).</li>
	<li>Add 600 &#181;L of 1.2 M sorbitol to each electro-cuvette for a total volume of 800 &#181;L, and then spread the cells on four YES plates (200 &#181;L/plate). Ten electro-cuvettes will dispense to 40 YES plates.</li>
	<li>Incubate the plates at 30 &#176;C for 24 h.</li>
	<li>Perform replica plating to YES+G418 and incubate the plates at 30 &#176;C for 3 days.</li>
</ol>
8. Selection of Heterochromatin-destabilizing Mutants and Checking for False Positives
<ol>
	<li>For each YES+G418 plate, perform replica plating to YES-Ade (Low Ade) and PMG-Ade (No Ade) plates. Incubate the replica plates for 1 - 2 days at 30 &#176;C, until some of the colonies on the YES-Ade plates show a red coloration (Figure 1G).</li>
	<li>Compare YES-Ade and PMG-Ade plates and select cells that show pink or white on the YES-Ade plate and also grow on the PMG-Ade plate. Do not select colonies without growth on PMG-Ade, as they are false positives (e.g., reflecting that the KAN cassette has been integrated at a non-target site elsewhere in the genome).</li>
	<li>Pick approximately 1 x 105 cells from each colony and incubate in 10 &#181;L of SPZ solution containing 2.5 mg/mL zymolyase 100 T at 37 &#176;C for at least 30 min. Use 1 &#181;L of this solution to perform as the starting template for colony PCR (Figure 1H).
	<ol>
		<li>Make SPZ (50 mL) by mixing 30 mL of 2 M sorbitol, 4.05 mL of 1 M Na2HPO4, 0.95 mL NaH2PO4 and 15 mL of distilled water (final pH, 7.5). Samples (5 mL) can be supplemented with zymolyase and stored in 500-&#181;L aliquots at -20 &#176;C until use.</li>
	</ol>
	</li>
	<li>Perform gel electrophoresis (1.2% agarose gel, 180V, 20 min) to visualize the results of +the colony PCR. Select reactions that exhibit PCR bands of the proper size and digest 5 &#181;L of each reaction product with XhoI (4 U enzyme, 1x digestion buffer, 37 &#176;C water bath, 1 h) to screen out false positives (Figure 1H).</li>
	<li>Perform gel electrophoresis to visualize the XhoI digests (1.2% Agarose gel, 180 V, 20 min). Mark the colonies whose PCR products are cut by XhoI, and patch them to YES+G418 plates (Figure 1I).</li>
	<li>Isolate gDNA from the fission yeast cells and perform sequencing of the PCR products23. Compare the obtained sequence with the wild-type sequence to identify mutations (Figure 1I).</li>
	<li>Directly re-introduce the mutation(s) to wild-type cells by transforming them with fusion constructs amplified by PCR from mutant cells23. Use spotting to confirm the phenotype in the newly made mutant cells (Figure 1J).
	<ol>
		<li>Fusion transformation construct can be easily amplified by PCR with primers p1 and p10 using the genomic DNA of mutants as the template in a total volume of 50 &#181;L (~1 &#181;g DNA, 20 U enzyme, 1x reaction buffer), and applying the reaction cycles described in Table 2. Transformation of the construct can be done by following the steps 7.1 - 7.13.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Pritchard, L., Corne, D., Kell, D., Rowland, J., Winson, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+general+model+of+error-prone+PCR.">A general model of error-prone PCR.</a> J Theor Biol. 234 (4), 497-509 (2005).</li><li>Pfeifer, G. P., You, Y. H., Besaratinia, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+induced+by+ultraviolet+light.">Mutations induced by ultraviolet light.</a> Mutat Res. 571 (1-2), 19-31 (2005).</li><li>Moreno, S., Klar, A., Nurse, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+genetic+analysis+of+fission+yeast+Schizosaccharomyces+pombe.">Molecular genetic analysis of fission yeast Schizosaccharomyces pombe.</a> Methods Enzymol. 194, 795-823 (1991).</li><li>Selifonova, O., Valle, F., Schellenberger, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+evolution+of+novel+traits+in+microorganisms.">Rapid evolution of novel traits in microorganisms.</a> Appl Environ Microbiol. 67 (8), 3645-3649 (2001).</li><li>Cohen, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+DNA+shuffling+works.">How DNA shuffling works.</a> Science. 293 (5528), 237 (2001).</li><li>Sahu, P. P., Sharma, N., Puranik, S., Chakraborty, S., Prasad, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tomato+26S+Proteasome+subunit+RPT4a+regulates+ToLCNDV+transcription+and+activates+hypersensitive+response+in+tomato.">Tomato 26S Proteasome subunit RPT4a regulates ToLCNDV transcription and activates hypersensitive response in tomato.</a> Sci Rep. 6, 27078 (2016).</li><li>Xu, Q., Singer, R. A., Johnston, G. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sug1+modulates+yeast+transcription+activation+by+Cdc68.">Sug1 modulates yeast transcription activation by Cdc68.</a> Mol Cell Biol. 15 (11), 6025-6035 (1995).</li><li>Bhat, K. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+19S+proteasome+ATPase+Sug1+plays+a+critical+role+in+regulating+MHC+class+II+transcription.">The 19S proteasome ATPase Sug1 plays a critical role in regulating MHC class II transcription.</a> Mol Immunol. 45 (8), 2214-2224 (2008).</li><li>Chang, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Gal4+activation+domain+binds+Sug2+protein,+a+proteasome+component,+in+vivo+and+in+vitro.">The Gal4 activation domain binds Sug2 protein, a proteasome component, in vivo and in vitro.</a> J Biol Chem. 276 (33), 30956-30963 (2001).</li><li>Ekwall, K., Cranston, G., Allshire, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fission+yeast+mutants+that+alleviate+transcriptional+silencing+in+centromeric+flanking+repeats+and+disrupt+chromosome+segregation.">Fission yeast mutants that alleviate transcriptional silencing in centromeric flanking repeats and disrupt chromosome segregation.</a> Genetics. 153 (3), 1153-1169 (1999).</li><li>Grewal, S. I., Jia, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterochromatin+revisited.">Heterochromatin revisited.</a> Nat Rev Genet. 8 (1), 35-46 (2007).</li><li>Forsburg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Forsburg Lab Recipes: Fission Yeast Media. , (2011).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> QIAquick PCR Purification Kit. , (2013).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> pBlueScript II Vector. , (2005).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> QIAquick Gel Extraction Kit. , (2013).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> QuickGene SP Kit Plasmid Kit II (SP-PL2). , (2016).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> PfuUltra High-fidelity DNA Polymerase. , (2004).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Gibson Assembly Master Mix. , (2017).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> GeneMorph II Random Mutagenesis Kits. , (2012).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Plasmid Plus Midi Kit. , (1999).</li><li>Bahler, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterologous+modules+for+efficient+and+versatile+PCR-based+gene+targeting+in+Schizosaccharomyces+pombe.">Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe.</a> Yeast. 14 (10), 943-951 (1998).</li><li>Szewczyk, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fusion+PCR+and+gene+targeting+in+Aspergillus+nidulans.">Fusion PCR and gene targeting in Aspergillus nidulans.</a> Nat Protoc. 1 (6), 3111-3120 (2006).</li><li>Nurse, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Fission Yeast Handbook. , (2000).</li><li>Seo, H. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+19S+proteasome+is+directly+involved+in+the+regulation+of+heterochromatin+spreading+in+fission+yeast.">The 19S proteasome is directly involved in the regulation of heterochromatin spreading in fission yeast.</a> J Biol Chem. , (2017).</li><li>Tang, N. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+and+characterisation+of+temperature+sensitive+mutants+of+genes+encoding+the+fission+yeast+spindle+pole+body.">Generation and characterisation of temperature sensitive mutants of genes encoding the fission yeast spindle pole body.</a> PeerJ Preprints. 5, e3377v3371 (2017).</li><li>Rasooly, A., Weisz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+antibacterial+activities+of+phloxine+B+and+other+halogenated+fluoresceins+against+methicillin-resistant+Staphylococcus+aureus.">In vitro antibacterial activities of phloxine B and other halogenated fluoresceins against methicillin-resistant Staphylococcus aureus.</a> Antimicrob Agents Chemother. 46 (11), 3650-3653 (2002).</li><li>Wilson, D. S., Keefe, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Random+mutagenesis+by+PCR.">Random mutagenesis by PCR.</a> Curr Protoc Mol Biol. , (2001).</li></ol>

The authors have nothing to disclose.

Random mutagenesis via error-prone PCR is a powerful tool for generating a diverse pool of mutants in a given region. This technique is especially useful for studies that seek to assess the function of a protein under a specific circumstance. For example, we herein used error-prone PCR to assess the function of the 19S proteasome subunit, Rpt4, in heterochromatin maintenance. By varying the region targeted by the error-prone PCR and adjusting the screening conditions, we were able to mutate cells at the genomic region of interest and screen for the desired phenotype. Recently, a similar method was used to isolate fission yeast cells harboring mutations in the spindle pole body component25.
The key advantage of random mutagenesis is that it may be applied to both non-essential and essential genes. Random mutagenesis of essential genes may yield diverse mutants, such as those with subtle and/or partial functional defects that allow cell viability to be sustained, or mutants whose functions are affected only under a specific condition. An example of the latter is a temperature-sensitive mutant. Such mutants may be isolated using 5 mg/L phloxine B, which stains dying cells in red and enables slow-growing cells to be distinguished from dying cells26.
The critical step of this protocol is the error-prone PCR step. At this step, it is important to control the mutation frequency, which can vary widely depending on the number of PCR cycles and the initial amount of template. We recommend that the user fix the number of PCR cycles and vary the initial amount of template, as we found this to be a more convenient strategy for optimization. We note that the technique of error-prone PCR has been widely available for decades. If the user chooses, they may seek a method for manually performing error-prone PCR27 without using a commercially available mutagenesis kit.
As a caution, the false positive rate of this protocol is rather high. Thus, mutant candidates should undergo a series of screenings intended to weed out the false positives. We found that the silent incorporation of a restriction site in the target gene can help avoid the need to subject false positives to the relatively laborious step of sequencing. This is cost-effective, as the mutant candidates may number in the hundreds or even beyond.

Forward genetics is a classical method in which researchers seek naturally occurring mutants that display a particular phenotype, and perform genetic analyses. In reverse genetics, mutations are introduced into a gene of interest and the phenotype is examined. In the latter case, random mutagenesis of a target gene is often used to generate a pool of mutants that are subsequently selected for desired phenotypes, such as temperature sensitivity or altered enzymatic activity. Various methods may be used to achieve random mutagenesis, including error-prone PCR1; UV irradiation2; chemical mutagens, such as ethyl methanesulfonate (EMS) or nitrous acid3; the use of temporary mutator strains, such as those over-expressing mutD5 4; and DNA shuffling5.
Here, we describe a reverse-genetics strategy in which we utilize error-prone PCR to generate mutant pools for a target gene in the fission yeast. As one might guess from its name, this method generates mutations by deliberately introducing errors during PCR. Unlike other mutagenesis methods, error-prone PCR allows the user to define the region to be mutagenized. This makes it particularly useful in efforts to study the function of a protein/domain of interest.
To demonstrate this random mutagenesis procedure, we herein use rpt4+, which encodes the 19S proteasome subunit, as an example. Rpt4 has been shown to have proteolysis-independent functions in organisms other than fission yeast6,7,8,9, and a defect in proteolysis could cause indirect effects by altering proteins levels. We, therefore, screened for mutants that triggered proteolysis-independent changes, with the goal of investigating the function of the proteasome on heterochromatin.
Error-prone PCR can be applied to any gene region by tuning the location at which the primers bind. Mutants that exhibit the desired phenotypic change can be identified with appropriate reporters. Here, we utilized an ade6+ reporter inserted at the centromere 1 outer repeat (otr) region10. Constitutive heterochromatin is formed at this region11, so the ade6+ reporter is silenced in the wild-type condition; this is indicated by red colonies10. A mutation that destabilizes the constitutive heterochromatin at the centromere will lead to the expression of the ade6+ reporter, which is visualized as white colonies.

<table border="0" cellpadding="0" cellspacing="0" width="825">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:267px;">1. Media</td>
			<td style="width:155px;"></td>
			<td style="width:119px;"></td>
			<td style="width:285px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Glucose</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">G8270-10KG</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Yeast extract</td>
			<td style="width:155px;">BD Biosciences</td>
			<td style="width:119px;">212720</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">L-Leucine</td>
			<td style="width:155px;">JUNSEI</td>
			<td style="width:119px;">87070-0310</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Adenine sulfate</td>
			<td style="width:155px;">ACR</td>
			<td style="width:119px;">16363-0250</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Uracil&#160;</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">U0750</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">L-Histidine</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">H8125</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">KH2PO4</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">1.05108.0050</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">NaCl</td>
			<td style="width:155px;">JUNSEI</td>
			<td style="width:119px;">19015-0350</td>
			<td></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:267px;">MgSO4&#8226;7H2O</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">63140</td>
			<td></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:267px;">CaCl2</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">12095</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Potassium phthalate</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">P6758-500g</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Inositol</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">I7508-50G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Biotin</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">B4501-100MG</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Boric Acid</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">B6768-1KG</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">MnSO4</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">M7634-500G</td>
			<td></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:267px;">ZnSO4&#8226;7H2O&#160;</td>
			<td style="width:155px;">JUNSEI</td>
			<td style="width:119px;">83060-031</td>
			<td></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:267px;">FeCl2&#8226;4H2O</td>
			<td style="width:155px;">KANTO</td>
			<td style="width:119px;">CB8943686</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Sodium molybdate dihydrate</td>
			<td style="width:155px;">YAKURI</td>
			<td style="width:119px;">31621</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">KI</td>
			<td style="width:155px;">JUNSEI</td>
			<td style="width:119px;">80090-0301</td>
			<td></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:267px;">CuSO4&#8226;5H2O</td>
			<td style="width:155px;">YAKURI</td>
			<td style="width:119px;">09605</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">D-myo-inositol</td>
			<td style="width:155px;">MP biomedicals</td>
			<td style="width:119px;">102052</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Pantothenate</td>
			<td style="width:155px;">YAKURI</td>
			<td style="width:119px;">26003</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Nicotinic Acid</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">N4126-500G</td>
			<td></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:267px;">(NH4)2SO4&#160;</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">A4418-100G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Agarose</td>
			<td style="width:155px;">Biobasic</td>
			<td>D0012</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">G418, geneticin</td>
			<td style="width:155px;">LPS</td>
			<td style="width:119px;">G41805</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:267px;">2. Enzyme reactions</td>
			<td style="width:155px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">PfuUltra II Fusion HS DNA Polymerase</td>
			<td style="width:155px;">Aglient</td>
			<td style="width:119px;">600380</td>
			<td>For site-directed mutagenesis</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">GeneMorphII Random mutagenesis Kit</td>
			<td style="width:155px;">Aglient</td>
			<td style="width:119px;">200500</td>
			<td>For error-prone PCR</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">Phusion High-Fidelity DNA Polymerase</td>
			<td style="width:155px;">Thermo Fisher</td>
			<td>F-530L</td>
			<td>For fusion PCR</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Ex Taq&#160;DNA Polymerase</td>
			<td style="width:155px;">Takara</td>
			<td style="width:119px;">RR001b</td>
			<td>For general PCR</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">BamH1</td>
			<td style="width:155px;">New England BioLabs</td>
			<td style="width:119px;">R0136S</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">Xho1</td>
			<td style="width:155px;">New England BioLabs</td>
			<td>R0146S</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">Dpn1</td>
			<td style="width:155px;">New England BioLabs</td>
			<td style="width:119px;">R0176S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:267px;">3. Equipment</td>
			<td style="width:155px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Velveteen square, black</td>
			<td style="width:155px;">VWR</td>
			<td style="width:119px;">89033-116</td>
			<td>For replica</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Replica-plating tool</td>
			<td style="width:155px;">VWR</td>
			<td style="width:119px;">25395-380</td>
			<td>For replica</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">MicroPulser Electroporator</td>
			<td style="width:155px;">Biorad</td>
			<td style="width:119px;">1652100&#160;</td>
			<td>For fission yeast transformation</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">Electroporation Cuvettes, 0.2 cm gap</td>
			<td style="width:155px;">Biorad</td>
			<td style="width:119px;">1652086&#160;</td>
			<td>For fission yeast transformation</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Thermal Cycler</td>
			<td style="width:155px;">Bioer</td>
			<td style="width:119px;">BYQ6078</td>
			<td>For fusion PCR ramp reaction&#160;</td>
		</tr>
	</tbody>
</table>

gene-targeted random mutagenesis to select heterochromatin-destabilizing proteasome mutants in fission yeast

Random mutagenesis of a target gene is commonly used to identify mutations that yield the desired phenotype. Of the methods that may be used to achieve random mutagenesis, error-prone PCR is a convenient and efficient strategy for generating a diverse pool of mutants (i.e., a mutant library). Error-prone PCR is the method of choice when a researcher seeks to mutate a pre-defined region, such as the coding region of a gene while leaving other genomic regions unaffected. After the mutant library is amplified by error-prone PCR, it must be cloned into a suitable plasmid. The size of the library generated by error-prone PCR is constrained by the efficiency of the cloning step. However, in the fission yeast, Schizosaccharomyces pombe, the cloning step can be replaced by the use of a highly efficient one-step fusion PCR to generate constructs for transformation. Mutants of desired phenotypes may then be selected using appropriate reporters. Here, we describe this strategy in detail, taking as an example, a reporter inserted at centromeric heterochromatin.

The acquired Rpt4 mutants by following the procedures described in Figure 1 can be analyzed by assessing the colors of the colonies. The colors of the colonies are spotted onto the relevant plates in decreasing cell number in Figure 2. The ade6+ reporter inserted at the heterochromatin region is silenced in wild-type and shows red colonies in YES-Ade plate. Once the heterochromatin is destabilized and the ade6+ reporter is expressed, white colonies can be observed in YES-Ade plate as in clr4&#916; mutant. The screened Rpt4 mutants are as shown. rpt4-1 mutant shows the most severe heterochromatin destabilization.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57499/57499fig1.jpg" /> 
Figure 1: Schematic representation of the protocol. (A) Schematic representation of the PCR product obtained by the first round of PCR, which is performed with primers 1 and 2. (B) Restriction-based cloning of the rpt4+ fragment. (C) Site-directed mutagenesis of the cloned vector is used to introduce a silent mutation that adds an XhoI restriction site. (D) Random mutagenesis of the rpt4+ coding region is performed using error-prone PCR. (E) The mutated rpt4+ fragment, the KAN fragment, and the 3&#39;UTR fragment are joined by fusion PCR to generate a transformation-ready cassette. (F) Fission yeast cells are transformed with the fusion PCR construct, which replaces the endogenous rpt4+ sequence by homologous recombination. (G) KAN-selected colonies are replica plated to YES-Ade (Low Ade) and PMG-Ade (No Ade) plates, and positive colonies are selected. (H) PCR and subsequent XhoI restriction of the PCR product are used to avoid false positives. (I) The mutation that causes the phenotype is identified by patching of the selected colonies, propagation of cells, extraction of genomic DNA (gDNA), and sequencing of the relevant portion of rpt4+. (J) Causative mutations are confirmed (and false positives are ruled out) by directly introducing the mutation to wild-type cells. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57499/57499fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57499/57499fig2.jpg" /> 
Figure 2: Heterochromatin de-repression mutants of Rpt4. Schematic diagram of the otr1::ade6+ reporter (top). 5-fold serial dilutions of select screened Rpt4 mutants were spotted onto the indicated plates in order of increasing level of heterochromatin destabilization (bottom). This figure was modified from the article &#39;The 19S proteasome is directly involved in the regulation of heterochromatin spreading in fission yeast&#39; by Seo et al., 201724. The non-cropped figure can be found in the original article. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57499/57499fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td rowspan="2">Component</td>
			<td colspan="2">Type of plate</td>
		</tr>
		<tr>
			<td>YES</td>
			<td>PMG</td>
		</tr>
		<tr>
			<td>Yeast extract</td>
			<td>5 g/L</td>
			<td></td>
		</tr>
		<tr>
			<td>Glucose</td>
			<td>30 g/L</td>
			<td>20 g/L</td>
		</tr>
		<tr>
			<td>Adenine</td>
			<td>0.15 g/L</td>
			<td>0.1g/L</td>
		</tr>
		<tr>
			<td>Histidine</td>
			<td>0.15 g/L</td>
			<td>0.1g/L</td>
		</tr>
		<tr>
			<td>Leucine</td>
			<td>0.15 g/L</td>
			<td>0.1g/L</td>
		</tr>
		<tr>
			<td>Uracil</td>
			<td>0.15 g/L</td>
			<td>0.1g/L</td>
		</tr>
		<tr>
			<td>Potassium hydrogen pthalate</td>
			<td></td>
			<td>3 g/L</td>
		</tr>
		<tr>
			<td>Na2HPO4</td>
			<td></td>
			<td>2.2 g/L</td>
		</tr>
		<tr>
			<td>L-glutamic acid</td>
			<td></td>
			<td>3.75 g/L</td>
		</tr>
		<tr>
			<td>Salts</td>
			<td></td>
			<td>20 ml/L</td>
		</tr>
		<tr>
			<td>Vitamins</td>
			<td></td>
			<td>1 ml/L</td>
		</tr>
		<tr>
			<td>Minerals</td>
			<td></td>
			<td>0.1 ml/L</td>
		</tr>
		<tr>
			<td>Agar</td>
			<td>16 g/L</td>
			<td>16 g/L</td>
		</tr>
	</tbody>
</table>
Table 1. Components of YES and PMG plates
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Temperature</td>
			<td>Time</td>
			<td>Cycle(s)</td>
		</tr>
		<tr>
			<td>95oC</td>
			<td>2 min</td>
			<td>&#160; 1 cycle</td>
		</tr>
		<tr>
			<td>95oC</td>
			<td>20 s</td>
			<td rowspan="3">&#160;30 cycles</td>
		</tr>
		<tr>
			<td>55oC</td>
			<td>30 s</td>
		</tr>
		<tr>
			<td>72oC</td>
			<td>2 min</td>
		</tr>
		<tr>
			<td>72oC</td>
			<td>8 min</td>
			<td>1 cycle</td>
		</tr>
		<tr>
			<td>8oC</td>
			<td>Hold</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 2. Recommended PCR program for site-directed mutagenesis
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Temperature</td>
			<td>Time</td>
			<td>Cycle(s)</td>
		</tr>
		<tr>
			<td>95oC</td>
			<td>2 min</td>
			<td>&#160; 1 cycle</td>
		</tr>
		<tr>
			<td>95oC</td>
			<td>30 s</td>
			<td rowspan="3">&#160;19 cycles</td>
		</tr>
		<tr>
			<td>55oC</td>
			<td>1 min</td>
		</tr>
		<tr>
			<td>72oC</td>
			<td>7 min</td>
		</tr>
		<tr>
			<td>72oC</td>
			<td>10 min</td>
			<td>1 cycle</td>
		</tr>
		<tr>
			<td>8oC</td>
			<td>Hold</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 3. Recommended PCR program for error-prone PCR
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Temperature</td>
			<td>Time</td>
			<td>Cycle(s)</td>
		</tr>
		<tr>
			<td>95oC</td>
			<td>2 min</td>
			<td>&#160; 1 cycle</td>
		</tr>
		<tr>
			<td>95oC</td>
			<td>20 s</td>
			<td rowspan="3">&#160;30 cycles</td>
		</tr>
		<tr>
			<td>55oC</td>
			<td>30 s</td>
		</tr>
		<tr>
			<td>72oC</td>
			<td>2 min</td>
		</tr>
		<tr>
			<td>72oC</td>
			<td>8 min</td>
			<td>1 cycle</td>
		</tr>
		<tr>
			<td>8oC</td>
			<td>Hold</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 4. Recommended PCR program for obtaining the KAN fragment
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Change</td>
			<td>To</td>
			<td colspan="2">Example case of rpt4+</td>
		</tr>
		<tr>
			<td>Template vector</td>
			<td>pFA6a-3HA-KANMX6</td>
			<td colspan="2"></td>
		</tr>
		<tr>
			<td>Vector-binding sequence of p7</td>
			<td>ATTACGCTGCTCAGTGCTGA</td>
			<td colspan="2" rowspan="2">ttgctgacctgaagaaacttgaaggtacaattgattaccaaaagctttag ATTACGCTGCTCAGTGCTGA</td>
		</tr>
		<tr>
			<td>Hanging sequence of p7</td>
			<td>The last 50bp sequence including the stop codon</td>
		</tr>
		<tr>
			<td>Hanging sequence of p8</td>
			<td>The first 50bp sequence right after the stop codon (complementary sequence)</td>
			<td colspan="2">AATCTTCATCGGTAAACTTATCATTTCATGGCTTTTTGGATATATGTGCA GAATTCGAGCTCGTTTAAAC</td>
		</tr>
		<tr>
			<td>Sequence of p9</td>
			<td>Start right after the stop codon</td>
			<td colspan="2">tgcacatatatccaaaaagccatgaa</td>
		</tr>
		<tr>
			<td>Sequence of p10</td>
			<td>Produce ~500bp fragment with p9 (complementary seqeucne)</td>
			<td colspan="2">TAGACGTTTTTCCTCGTTTCTTTGTC</td>
		</tr>
	</tbody>
</table>
Table 5. Changes needed when the ADH terminator is used instead of the endogenous terminator
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Temperature</td>
			<td>Time</td>
			<td>Cycle(s)</td>
		</tr>
		<tr>
			<td>95oC</td>
			<td>2 min</td>
			<td>&#160; 1 cycle</td>
		</tr>
		<tr>
			<td>95oC</td>
			<td>20 s</td>
			<td rowspan="3">&#160;30 cycles</td>
		</tr>
		<tr>
			<td>55oC</td>
			<td>30 s</td>
		</tr>
		<tr>
			<td>72oC</td>
			<td>1 min</td>
		</tr>
		<tr>
			<td>72oC</td>
			<td>8 min</td>
			<td>1 cycle</td>
		</tr>
		<tr>
			<td>8oC</td>
			<td>Hold</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 6. Recommended PCR program for obtaining the 3&#39;UTR fragment
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Temperature</td>
			<td>Time</td>
			<td>Ramp</td>
			<td>Cycle(s)</td>
		</tr>
		<tr>
			<td>94oC</td>
			<td>2 min</td>
			<td></td>
			<td>&#160; 1 cycle</td>
		</tr>
		<tr>
			<td>94oC</td>
			<td>20 s</td>
			<td></td>
			<td rowspan="4">&#160;10 cycles</td>
		</tr>
		<tr>
			<td>70oC</td>
			<td>1 s</td>
			<td></td>
		</tr>
		<tr>
			<td>55oC</td>
			<td>30 s</td>
			<td>0.1&#160;oC/s</td>
		</tr>
		<tr>
			<td>68oC</td>
			<td>2:30 min</td>
			<td>0.2&#160;oC/s</td>
		</tr>
		<tr>
			<td>94oC</td>
			<td>20 s</td>
			<td></td>
			<td rowspan="4">&#160;5 cycles</td>
		</tr>
		<tr>
			<td>70oC</td>
			<td>1 s</td>
			<td></td>
		</tr>
		<tr>
			<td>55oC</td>
			<td>30 s</td>
			<td>0.1&#160;oC/s</td>
		</tr>
		<tr>
			<td>68oC</td>
			<td>2:30 min</td>
			<td>0.2&#160;oC/s + 5 s/cycle</td>
		</tr>
		<tr>
			<td>94oC</td>
			<td>20 s</td>
			<td></td>
			<td rowspan="4">&#160;10 cycles</td>
		</tr>
		<tr>
			<td>70oC</td>
			<td>1 s</td>
			<td></td>
		</tr>
		<tr>
			<td>55oC</td>
			<td>30 s</td>
			<td>0.1&#160;oC/s</td>
		</tr>
		<tr>
			<td>68oC</td>
			<td>2:30 min</td>
			<td>0.2&#160;oC/s + 20 s/cycle</td>
		</tr>
		<tr>
			<td>72oC</td>
			<td>10 min</td>
			<td></td>
			<td>1 cycle</td>
		</tr>
		<tr>
			<td>8oC</td>
			<td>Hold</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 7. Recommended PCR program for fusion PCR
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>CBL1877</td>
			<td>h+</td>
			<td>ade6-210 leu1-32 ura4-D18 otr1R (dg-glu) Sph1:ade6</td>
		</tr>
	</tbody>
</table>
Table S1: Strain used in this study
<img src="/files/ftp_upload/57499/57499tbl2.jpg" /> 
Table S2: List of primers used in this study

Watch this Scientific Journal Video about Gene-targeted Random Mutagenesis to Select Heterochromatin-destabilizing Proteasome Mutants in Fission Yeast at JoVE.com

Gene-targeted Random Mutagenesis to Select Heterochromatin-destabilizing Proteasome Mutants in Fission Yeast

This article describes a detailed methodology for random mutagenesis of a target gene in fission yeast. As an example, we target rpt4+, which encodes a subunit of the 19S proteasome, and screen for mutations that destabilize heterochromatin.

Random mutagenesis of a target gene is commonly used to identify mutations that yield the desired phenotype. Of the methods that may be used to achieve ...

gene-targeted-random-mutagenesis-to-select-heterochromatin

Nanyang Technological University

Research

JoVE Journal

Genetics

10.6K Views.  Korea Advanced Institute of Science and Technology. This article describes a detailed methodology for random mutagenesis of a target gene in fission yeast. As an example, we target rpt4+, which encodes a subunit of the 19S proteasome, and screen for mutations that destabilize heterochromatin. 

Video: Gene-targeted Random Mutagenesis to Select Heterochromatin-destabilizing Proteasome Mutants in Fission Yeast

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most mutagenesis-based screens, researchers have relied on the use of toxic chemicals, carcinogens, or irradiation, which requires designated equipment, safety setup, and/or disposal of hazardous materials. We have developed a simple approach to induce heritable mutations in C. elegans using germline-expressed histone-miniSOG, a light-inducible potent generator of reactive oxygen species. This mutagenesis method is free of toxic chemicals and requires minimal laboratory safety and waste management. The induced DNA modifications include single-nucleotide changes and small deletions, and complement those caused by classical chemical mutagenesis. This methodology can also be used to induce integration of extrachromosomal transgenes. Here, we provide the details of the LED setup and protocols for standard mutagenesis and transgene integration.

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Genetically-encoded histone-miniSOG induces genome-wide heritable mutations in a blue&#160;light-dependent manner. This mutagenesis method is simple, fast, free of toxic chemicals, and well-suited for forward genetic screening and transgene integration.

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most ...

High-Throughput Robotically Assisted Isolation of Temperature-sensitive Lethal Mutants in Chlamydomonas reinhardtii

Systematic identification and characterization of genetic perturbations have proven useful to decipher gene function and cellular pathways. However, the conventional approaches of permanent gene deletion cannot be applied to essential genes. We have pioneered a unique collection of ~70 temperature-sensitive (ts) lethal mutants for studying cell cycle regulation in the unicellular green algae Chlamydomonas reinhardtii1. These mutations identify essential genes, and the ts alleles can be conditionally inactivated by temperature shift, providing valuable tools to identify and analyze essential functions. Mutant collections are much more valuable if they are close to comprehensive, since scattershot collections can miss important components. However, this requires the efficient collection of a large number of mutants, especially in a wide-target screen. Here, we describe a robotics-based pipeline for generating ts lethal mutants and analyzing their phenotype in Chlamydomonas. This technique can be applied to any microorganism that grows on agar. We have collected over 3000 ts mutants, probably including mutations in most or all cell-essential pathways, including about 200 new candidate cell cycle mutations. Subsequent molecular and cellular characterization of these mutants should provide new insights in plant cell biology; a comprehensive mutant collection is an essential prerequisite to ensure coverage of a broad range of biological pathways. These methods are integrated with downstream genetics and bioinformatics procedures for efficient mapping and identification of the causative mutations that are beyond the scope of this manuscript.

High-Throughput Robotically Assisted Isolation of Temperature-sensitive Lethal Mutants in Chlamydomonas reinhardtii

Temperature-sensitive (ts) lethal mutants are valuable tools to identify and analyze essential functions. Here we describe methods to generate and classify ts lethal mutants in high throughput.

Systematic identification and characterization of genetic perturbations have proven useful to decipher gene function and cellular pathways. However, the ...

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

We describe a PCR- and homologous recombination-based system for generating targeted mutations in histone genes in budding yeast cells. The resulting mutant alleles reside at their endogenous genomic sites and no exogenous DNA sequences are left in the genome following the procedure. Since in haploid yeast cells each of the four core histone proteins is encoded by two non-allelic genes with highly homologous open reading frames (ORFs), targeting mutagenesis specifically to one of two genes encoding a particular histone protein can be problematic. The strategy we describe here bypasses this problem by utilizing sequences outside, rather than within, the ORF of the target genes for the homologous recombination step. Another feature of this system is that the regions of DNA driving the homologous recombination steps can be made to be very extensive, thus increasing the likelihood of successful integration events. These features make this strategy particularly well-suited for histone gene mutagenesis, but can also be adapted for mutagenesis of other genes in the yeast genome.

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

A strategy for generating mutations in histone genes at their endogenous location in Saccharomyces cerevisiae is presented.

We describe a PCR- and homologous recombination-based system for generating targeted mutations in histone genes in budding yeast cells. The resulting ...

Using a Fluorescent PCR-capillary Gel Electrophoresis Technique to Genotype CRISPR/Cas9-mediated Knockout Mutants in a High-throughput Format

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play in the functioning of cells and whole organisms. This cause has been tremendously aided by the recent introduction of the CRISPR/Cas9 system-a versatile tool that allows researchers to manipulate the genome and transcriptome in order to, among other things, knock out, knock down, or knock in genes in a targeted manner. For the purpose of knocking out a gene, CRISPR/Cas9-mediated double-strand breaks recruit the non-homologous end-joining DNA repair pathway to introduce the frameshift-causing insertion or deletion of nucleotides at the break site. However, an individual guide RNA may cause undesirable off-target effects, and to rule these out, the use of multiple guide RNAs is necessary. This multiplicity of targets also means that a high-volume screening of clones is required, which in turn begs the use of an efficient high-throughput technique to genotype the knockout clones. Current genotyping techniques either suffer from inherent limitations or incur high cost, hence rendering them unsuitable for high-throughput purposes. Here, we detail the protocol for using fluorescent PCR, which uses genomic DNA from crude cell lysate as a template, and then resolving the PCR fragments via capillary gel electrophoresis. This technique is accurate enough to differentiate one base-pair difference between fragments and hence is adequate in indicating the presence or absence of a frameshift in the coding sequence of the targeted gene. This precise knowledge effectively precludes the need for a confirmatory sequencing step and allows users to save time and cost in the process. Moreover, this technique has proven to be versatile in genotyping various mammalian cells of various tissue origins targeted by guide RNAs against numerous genes, as shown here and elsewhere.

The genotyping technique described here, which couples fluorescent polymerase chain reaction (PCR) to capillary gel electrophoresis, allows for high-throughput genotyping of nuclease-mediated knockout clones. It circumvents limitations faced by other genotyping techniques and is more cost effective than sequencing methods.

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play ...

CRISPR/Cas9 Gene Editing to Make Conditional Mutants of Human Malaria Parasite P. falciparum

Malaria is a significant cause of morbidity and mortality worldwide. This disease, which primarily affects those living in tropical and subtropical regions, is caused by infection with Plasmodium parasites. The development of more effective drugs to combat malaria can be accelerated by improving our understanding of the biology of this complex parasite. Genetic manipulation of these parasites is key to understanding their biology; however, historically the genome of P. falciparum has been difficult to manipulate. Recently, CRISPR/Cas9 genome editing has been utilized in malaria parasites, allowing for easier protein tagging, generation of conditional protein knockdowns, and deletion of genes. CRISPR/Cas9 genome editing has proven to be a powerful tool for advancing the field of malaria research. Here, we describe a CRISPR/Cas9 method for generating glmS-based conditional knockdown mutants in P. falciparum. This method is highly adaptable to other types of genetic manipulations, including protein tagging and gene knockouts.

CRISPR/Cas9 Gene Editing to Make Conditional Mutants of Human Malaria Parasite P. falciparum

We describe a method for generating glmS-based conditional knockdown mutants in Plasmodium falciparum using CRISPR/Cas9 genome editing.

Malaria is a significant cause of morbidity and mortality worldwide. This disease, which primarily affects those living in tropical and subtropical ...

Mating-based Overexpression Library Screening in Yeast

Budding yeast has been widely used as a model in studying proteins associated with human diseases. Genome-wide genetic screening is a powerful tool commonly used in yeast studies. The expression of a number of neurodegenerative disease-associated proteins in yeast causes cytotoxicity and aggregate formation, recapitulating findings seen in patients with these disorders. Here, we describe a method for screening a yeast model of the Amyotrophic Lateral Sclerosis-associated protein FUS for modifiers of its toxicity. Instead of using transformation, this new screening platform relies on the mating of yeast to introduce an arrayed library of plasmids into the yeast model. The mating method has two clear advantages: first, it is highly efficient; second, the pre-transformed arrayed library of plasmids can be stored for long-term as a glycerol stock, and quickly applied to other screens without the labor-intensive step of transformation into the yeast model each time. We demonstrate how this method can successfully be used to screen for genes that modify the toxicity of FUS.

This article presents a mating-based method to facilitate overexpression screening in budding yeast using an arrayed plasmid library.

Budding yeast has been widely used as a model in studying proteins associated with human diseases. Genome-wide genetic screening is a powerful tool ...

Characterizing Histone Post-translational Modification Alterations in Yeast Neurodegenerative Proteinopathy Models

Neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and Parkinson&#39;s disease (PD), cause the loss of hundreds of thousands of lives each year. Effective treatment options able to halt disease progression are lacking. Despite the extensive sequencing efforts in large patient populations, the majority of ALS and PD cases remain unexplained by genetic mutations alone. Epigenetics mechanisms, such as the post-translational modification of histone proteins, may be involved in neurodegenerative disease etiology and progression and lead to new targets for pharmaceutical intervention. Mammalian in vivo and in vitro models of ALS and PD are costly and often require prolonged and laborious experimental protocols. Here, we outline a practical, fast, and cost-effective approach to determining genome-wide alterations in histone modification levels using Saccharomyces cerevisiae as a model system. This protocol allows for comprehensive investigations into epigenetic changes connected to neurodegenerative proteinopathies that corroborate previous findings in different model systems while significantly expanding our knowledge of the neurodegenerative disease epigenome.

This protocol outlines experimental procedures to characterize genome-wide changes in the levels of histone post-translational modifications (PTM) occurring in connection with the overexpression of proteins associated with ALS and Parkinson&#39;s disease in Saccharomyces cerevisiae models. After SDS-PAGE separation, individual histone PTM levels are detected with modification-specific antibodies via Western blotting.

Neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and Parkinson&#39;s disease (PD), cause the loss of hundreds of thousands of lives ...

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

A genetic screen for mutant alleles that suppress phenotypic defects caused by a mutation is a powerful approach to identify genes that belong to closely related biochemical pathways. Previous methods such as the Synthetic Genetic Array (SGA) analysis, and random mutagenesis techniques using ultraviolet (UV) or chemicals like ethyl methanesulfonate (EMS) or N-ethyl-N- nitrosourea (ENU), have been widely used but are often costly and laborious. Also, these mutagen-based screening methods are frequently associated with severe side effects on the organism, inducing multiple mutations that add to the complexity of isolating the suppressors. Here, we present a simple and effective protocol to identify suppressor mutations in mutants which confer a growth defect in Schizosaccharomyces pombe. The fitness of cells with a growth deficiency in standard rich liquid media or synthetic liquid media can be monitored for recovery using an automated 96-well plate reader over an extended period. Once a cell acquires a suppressor mutation in the culture, its descendants outcompete those of the parental cells. The recovered cells that have a competitive growth advantage over the parental cells can then be isolated and backcrossed with the parental cells. The suppressor mutations are then identified using whole-genome sequencing. Using this approach, we have successfully isolated multiple suppressors that alleviate the severe growth defects caused by loss of Elf1, an AAA+ family ATPase that is important in nuclear mRNA transport and maintenance of genomic stability. There are currently over 400 genes in S. pombe with mutants conferring a growth defect. As many of these genes are uncharacterized, we propose that our method will hasten the identification of novel functional interactions with this user-friendly, high-throughput approach.

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

We present a simple suppressor screen protocol in fission yeast. This method is efficient, mutagen-free, and&#160; selective&#160; for&#160; mutations that&#160; often&#160; occur at&#160; &#160;a&#160; single&#160; genomic&#160; locus.&#160; The protocol is suitable for isolating suppressors that alleviate growth defects in liquid culture that are caused by a mutation or a drug.

A genetic screen for mutant alleles that suppress phenotypic defects caused by a mutation is a powerful approach to identify genes that belong to closely ...

Enhanced Yeast One-hybrid Screens To Identify Transcription Factor Binding To Human DNA Sequences

Identifying the sets of transcription factors (TFs) that regulate each human gene is a daunting task that requires integrating numerous experimental and computational approaches. One such method is the yeast one-hybrid (Y1H) assay, in which interactions between TFs and DNA regions are tested in the milieu of the yeast nucleus using reporter genes. Y1H assays involve two components: a &#8216;DNA-bait&#8217; (e.g., promoters, enhancers, silencers, etc.) and a &#8216;TF-prey,&#8217; which can be screened for reporter gene activation. Most published protocols for performing Y1H screens are based on transforming TF-prey libraries or arrays into DNA-bait yeast strains. Here, we describe a pipeline, called enhanced Y1H (eY1H) assays, where TF-DNA interactions are interrogated by mating DNA-bait strains with an arrayed collection of TF-prey strains using a high density array (HDA) robotic platform that allows screening in a 1,536 colony format. This allows for a dramatic increase in throughput (60 DNA-bait sequences against &#62;1,000 TFs takes two weeks per researcher) and reproducibility. We illustrate the different types of expected results by testing human promoter sequences against an array of 1,086 human TFs, as well as examples of issues that can arise during screens and how to troubleshoot them.

Here, we present an enhanced yeast one-hybrid screening protocol to identify the transcription factors (TFs) that can bind to a human DNA region of interest. This method uses a high-throughput screening pipeline that can interrogate the binding of &#62;1,000 TFs in a single experiment.

Identifying the sets of transcription factors (TFs) that regulate each human gene is a daunting task that requires integrating numerous experimental and ...

Embryo Microinjection Techniques for Efficient Site-Specific Mutagenesis in Culex quinquefasciatus

Culex quinquefasciatus is a vector of a diverse range of vector-borne diseases such as avian malaria, West Nile virus (WNV), Japanese encephalitis, Eastern equine encephalitis, lymphatic filariasis, and Saint Louis encephalitis. Notably, avian malaria has played a major role in the extinction of numerous endemic island bird species, while WNV has become an important vector-borne disease in the United States. To gain further insight into C. quinquefasciatus biology and expand their genetic control toolbox, we need to develop more efficient and affordable methods for genome engineering in this species. However, some biological traits unique to Culex mosquitoes, particularly their egg rafts, have made it difficult to perform microinjection procedures required for genome engineering. To address these challenges, we have developed an optimized embryo microinjection protocol that focuses on mitigating the technical obstacles associated with the unique characteristics of Culex mosquitoes. These procedures demonstrate optimized methods for egg collection, egg raft separation and other handling procedures essential for successful microinjection in C. quinquefasciatus. When coupled with the CRISPR/Cas9 genome editing technology, these procedures allow us to achieve site-specific, efficient and heritable germline mutations, which are required to perform advanced genome engineering and develop genetic control technologies in this important, but currently understudied, disease vector.

Embryo Microinjection Techniques for Efficient Site-Specific Mutagenesis in Culex quinquefasciatus

This protocol describes microinjection procedures for Culex quinquefasciatus embryos that are optimized to work with CRISPR/Cas9 gene editing tools. This technique can efficiently generate site-specific, heritable, germline mutations that can be used for building genetic technologies in this understudied disease vector.

Culex quinquefasciatus is a vector of a diverse range of vector-borne diseases such as avian malaria, West Nile virus (WNV), Japanese encephalitis, ...