The authors would like to acknowledge Hans de Graaf and Tomas Veenendaal for their technical assistance in culturing the ECs.

Ethics statement: Blood vessels used in this study were harvested as surplus material obtained from fresh canine cadavers (n= 4) from healthy dogs euthanized for other unrelated research (University 3R policy). Aberrant blood vessels (intra- and extrahepatic portosystemic shunts, n= 1 each) were harvested post-mortem after informed consent of the owners from dogs presented to the University Clinic for Companion Animals of Utrecht University.
1. Isolation and Culture of Primary Canine Endothelial Cells
<ol>
	<li>Pre-coat 6-well plates with 2 ml/well 0.5% w/v gelatin and leave for 2 hr in an incubator with a humidified atmosphere of 5% CO2 at 37 &#176;C. Remove excess gelatin solution prior to seeding the primary cells.</li>
	<li>Aseptically remove the blood vessel(s) of interest (e.g., aorta, vena cava, vena porta) from a fresh canine cadaver (Figure 1A). Maintain the anatomy of the vessel system by placing straight forceps on both ends of the vessel of interest. Avoid unnecessary manipulation of the tissue with forceps to prevent damage to the endothelial cells.
	<ol>
		<li>Cut the clamped vessel on both ends with surgical scissors and remove from the cadaver. Transport in Hank&#39;s Balanced Salt Solution (HBSS) on ice. 
		NOTE: A vessel length of approximately 5 cm is preferred for this procedure, but those that measure 1 cm will also provide enough cells to culture.</li>
	</ol>
	</li>
	<li>Transfer the blood vessel to a Petri dish filled with ice-cold HBSS. Using surgical scissors, remove any adherent tissue and fat from the outside of the vessel, keeping the vessel itself intact (Figure 1B). Make sure the vessel is clearly visible at all times when cutting: pull aside the surrounding tissue with a clamp or forceps for optimal view.
	<ol>
		<li>Close any branches of the vessel with ligatures (e.g., polyglactin 3-0) and subsequently remove them with surgical scissors or a scalpel.</li>
	</ol>
	</li>
	<li>Carefully enter a vessel end with a curved Halsted mosquito forceps, clamp the tip of the forceps at the other end of the vessel and then retract, slowly inverting the vessel until it is completely inside out (Figure 1C-G). The outside now consists of the endothelial cell layer. If any difficulty is encountered upon inverting the vessel, submerge in HBSS again to reduce friction.</li>
	<li>Place purse-string sutures at both ends of the vessel to close it completely and to prevent exposure of any non-endothelial vascular tissue to the digestion procedure (Figure 1H). Use the ligature ends to manipulate the inverted vessel.</li>
	<li>If digestion and culture is performed later, cryopreserve the inverted vessel prior to the digestion protocol (step 1.7).
	<ol>
		<li>Place the inverted vessel in a cryovial and fill with cell culture freezing medium. Freeze down to -80 &#176;C using a freezing container. Store at -80 &#176;C if vessels are to be used within one week. For long term storage, place cryovials at -180 &#176;C. When performing the EC isolation, thaw the cryovials rapidly in a water bath (37 &#176;C) and immediately place in ice-cold HBSS. Proceed as indicated in 1.7. 
		NOTE: Take into account that the total yield of ECs after isolation will be lower due to loss of viability during the freezing process.</li>
	</ol>
	</li>
	<li>Transfer the vessel to a 50 ml tube and rinse it twice in HBSS to remove erythrocytes (or residual freezing medium in case of thawing) (Figure 1I).</li>
	<li>Digest the vessel in a 50 ml tube with a solution of 30 ml collagenase type II (0.15 U/ml) and dispase (0.15 U/ml) in Canine Endothelial Cells Growth Medium (CECGM) for 1 hr at 37 &#176;C with intermittent gentle agitation.</li>
	<li>Remove the vessel from the tube and centrifuge the cell suspension for 5 min at 250 x g.</li>
	<li>Resuspend the cell pellet in CECGM and seed 2 ml cell suspension per well (1 - 3 wells depending on vessel size). Culture the cells at 37 &#176;C in a humidified atmosphere with 5% CO2 in air and change the culture medium twice a week.</li>
	<li>Passage the cells when a confluency of 70 - 80% is reached.
	<ol>
		<li>Wash the cells with pre-warmed HBSS to remove dead or non-attached cells. Add 200 &#181;l recombinant cell-dissociation enzyme (1x) to each well and place back in the incubator for 5 min or until all cells are detached.</li>
		<li>Transfer the cells to a 15 ml tube and stop trypsinization by adding 10 ml of culture media (CEGM) including 10% Fetal Calf Serum (FCS). Centrifuge for 5 min at 250 x g. Continue the culture in a gelatin pre-coated plate or flask.</li>
	</ol>
	</li>
</ol>
2. Characterization
<ol>
	<li>Culture Canine Aortic Endothelial Cells (CnAOECs) and compare the morphology of the primary and commercial cell lines twice weekly with a microscope. 
	NOTE: The typical growing pattern of ECs in patches can best be observed when a confluency of &#62; 70% is reached.
	<ol>
		<li>Culture CnAOECs in CECGM on a 0.5% w/v gelatin pre-coated T75 flask. Passage cells once a week when the confluency is 70 - 80%.
		<ol>
			<li>For passaging, wash the cells once with pre-warmed HBSS and add 1 ml recombinant cell-dissociation enzyme (1x). Place the flask back in the incubator for 5 min or until all cells are detached. Inactivate trypsin by adding 10 ml culture medium (CEGM) including 10% FCS. Centrifuge the cell suspension for 5 min at 250 x g, discard the supernatant and resuspend the cells in 1 ml culture medium.</li>
			<li>Take a 10 &#181;l aliquot of the cell suspension and dilute 1:1 with 0.4% trypan blue. Count the cells using an automated cell counter, and plate out 4.0 x 105 viable cells in a new T75 flask. Add 10 ml of pre-warmed CECGM to the flask and culture at 37 &#176;C in a humidified atmosphere with 5% CO2.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Isolate RNA from passage 1 of the cultured CaPECs and CnAOECs.
	<ol>
		<li>Collect at least 1 x 103 cells as a pellet, add 20 &#181;l of sample preparation reagent (SPR) and incubate for 1 min to lyse the cells. After incubation, carefully collect the cell lysate containing total RNA and store at -70 &#176;C.</li>
	</ol>
	</li>
	<li>Convert mRNA to cDNA using a cDNA synthesis kit (e.g., iScript) following the instructions of the manufacturer. Store cDNA at 4 &#176;C up to one week, or at -20 &#176;C for long term until ready to perform the qPCR.</li>
	<li>Measure gene expression of the endothelial marker CD31 to confirm endothelial cell origin. Perform experimental setup and quantification using the MIQE pr&#233;cis guidelines10. For normalization, measure expression of reference genes GAPDH, RPS19, and B2MG11.
	<ol>
		<li>Prepare a 10-fold dilution of the obtained cDNA in nuclease free water.</li>
		<li>Prepare a 4-fold dilution from pooled cDNA samples for the standard line and use nuclease free water as a non-template control. Dilute the samples five times to reach a 50-fold total dilution for qPCR reactions. Pipette 10 &#181;l reactions in duplicate in a 384-well format using 4 &#181;l cDNA and 6 &#181;l of the fluorophore mixed with 20 pmol of reverse and forward primer (Table 1).</li>
		<li>Set the program to 95 &#176;C for 5 min for Taq polymerase activation, followed by 39 cycles of 10 sec at 95 &#176;C for denaturation, and 30 sec at Tm for annealing and elongation. The Tm for each primer set is shown in Table 1.</li>
		<li>Perform melting curve analyses following every run to ensure only one product is amplified. Normalize the expression levels of the samples using the average relative amount of the reference genes, and calculate the &#916;Ct if reaction efficiency is between 95% and 105%.</li>
	</ol>
	</li>
	<li>Assess EC functionality with an angiogenesis assay.
	<ol>
		<li>Add 10 &#181;l of extracellular matrix to each well of a pre-cooled angiogenesis slide and spread with a pipette tip to cover the surface of the well. Keep the extracellular matrix on ice and avoid the introduction of air bubbles into the gel. Solidify the gel by placing the slide in a Petri dish with water soaked paper towels in an incubator at 37 &#176;C with 5% CO2 for 30 min.</li>
		<li>Add 1.0 x 104 primary ECs in 50 &#181;l Endothelial Growth Medium per well. Incubate the slide for 6 hr at 37 &#176;C with 5% CO2.</li>
		<li>After 6 hr take photographs with a 20X magnification, making sure to include the whole well in the image.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Haidara, M. A., Assiri, A. S., Yassin, H. Z., Ammar, H. I., Obradovic, M. M., Isenovic, E. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heart+Failure+Models:+Traditional+and+Novel+Therapy.">Heart Failure Models: Traditional and Novel Therapy.</a> Curr. Vasc. Pharmacol. 13 (5), 658-669 (2015).</li><li>van Steenbeek, F. G., van den Bossche, L., Leegwater, P. A., Rothuizen, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inherited+liver+shunts+in+dogs+elucidate+pathways+regulating+embryonic+development+and+clinical+disorders+of+the+portal+vein.">Inherited liver shunts in dogs elucidate pathways regulating embryonic development and clinical disorders of the portal vein.</a> Mamm. Genome. 23 (1-2), 76-84 (2012).</li><li>Murai, A., Asa, S. A., Kodama, A., Hirata, A., Yanai, T., Sakai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Constitutive+phosphorylation+of+the+mTORC2/Akt/4E-BP1+pathway+in+newly+derived+canine+hemangiosarcoma+cell+lines.">Constitutive phosphorylation of the mTORC2/Akt/4E-BP1 pathway in newly derived canine hemangiosarcoma cell lines.</a> BMC Vet. Res. 8 (1), 128 (2012).</li><li>Boilson, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+circulating+progenitor+cells+in+left+ventricular+dysfunction.">Regulation of circulating progenitor cells in left ventricular dysfunction.</a> Circ. Heart Fail. 3 (5), 635-642 (2010).</li><li>Gonzalez-Miguel, J., Morchon, R., Siles-Lucas, M., Simon, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fibrinolysis+and+proliferative+endarteritis:+two+related+processes+in+chronic+infections?+The+model+of+the+blood-borne+pathogen+Dirofilaria+immitis.">Fibrinolysis and proliferative endarteritis: two related processes in chronic infections? The model of the blood-borne pathogen Dirofilaria immitis.</a> PLoS One. 10 (4), e0124445 (2015).</li><li>Sacks, T., Moldow, C. F., Craddock, P. R., Bowers, T. K., Jacob, H. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oxygen+radicals+mediate+endothelial+cell+damage+by+complement-stimulated+granulocytes.+An+in+vitro+model+of+immune+vascular+damage.">Oxygen radicals mediate endothelial cell damage by complement-stimulated granulocytes. An in vitro model of immune vascular damage.</a> J. Clin. Invest. 61 (5), 1161-1167 (1978).</li><li>Aranguren, X. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unraveling+a+novel+transcription+factor+code+determining+the+human+arterial-specific+endothelial+cell+signature.">Unraveling a novel transcription factor code determining the human arterial-specific endothelial cell signature.</a> Blood. 122 (24), 3982-3992 (2013).</li><li>van Balkom, B. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endothelial+cells+require+miR-214+to+secrete+exosomes+that+suppress+senescence+and+induce+angiogenesis+in+human+and+mouse+endothelial+cells.">Endothelial cells require miR-214 to secrete exosomes that suppress senescence and induce angiogenesis in human and mouse endothelial cells.</a> Blood. 121 (19), 3997-4006 (2013).</li><li>Crampton, S. P., Davis, J., Hughes, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+human+umbilical+vein+endothelial+cells+(HUVEC).">Isolation of human umbilical vein endothelial cells (HUVEC).</a> J. Vis. Exp. (3), e183 (2007).</li><li>Bustin, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MIQE+precis:+Practical+implementation+of+minimum+standard+guidelines+for+fluorescence-based+quantitative+real-time+PCR+experiments.">MIQE precis: Practical implementation of minimum standard guidelines for fluorescence-based quantitative real-time PCR experiments.</a> BMC Mol. Biol. 11, 74 (2010).</li><li>Brinkhof, B., Spee, B., Rothuizen, J., Penning, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+evaluation+of+canine+reference+genes+for+accurate+quantification+of+gene+expression.">Development and evaluation of canine reference genes for accurate quantification of gene expression.</a> Anal. Biochem. 356 (1), 36-43 (2006).</li><li>Heishima, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA-214+and+MicroRNA-126+Are+Potential+Biomarkers+for+Malignant+Endothelial+Proliferative+Diseases.">MicroRNA-214 and MicroRNA-126 Are Potential Biomarkers for Malignant Endothelial Proliferative Diseases.</a> Int. J. Mol. Sci. 16 (10), 25377-25391 (2015).</li><li>Liu, M. M., Flanagan, T. C., Lu, C. C., French, A. T., Argyle, D. J., Corcoran, B. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Culture+and+characterisation+of+canine+mitral+valve+interstitial+and+endothelial+cells.">Culture and characterisation of canine mitral valve interstitial and endothelial cells.</a> Vet. J. 204 (1), 32-39 (2015).</li><li>van den Bossche, L., van Steenbeek, F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Canine+congenital+portosystemic+shunts:+disconnections+dissected.">Canine congenital portosystemic shunts: disconnections dissected.</a> The Veterinary Journal. 211, 14-20 (2015).</li><li>Sobczynska-Rak, A., Polkowska, I., Silmanowicz, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elevated+Vascular+Endothelial+Growth+Factor+(VEGF)+levels+in+the+blood+serum+of+dogs+with+malignant+neoplasms+of+the+oral+cavity.">Elevated Vascular Endothelial Growth Factor (VEGF) levels in the blood serum of dogs with malignant neoplasms of the oral cavity.</a> Acta Vet. Hung. 62 (3), 362-371 (2014).</li><li>Zhang, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+and+in+vivo+study+of+hydralazine,+a+potential+anti-angiogenic+agent.">In vitro and in vivo study of hydralazine, a potential anti-angiogenic agent.</a> Eur. J. Pharmacol. 779, 138-146 (2016).</li></ol>

The authors have no competing financial interests.

In studies focusing on canine ECs the CnAOEC primary line is used to model the endothelial lineages of the dog3, 12, 13. In human studies, the HUVEC culture is still considered the gold standard. Clearly, focusing merely on ECs derived from umbilical cord is a firm restriction in cardiovascular research. Endothelial cells have a specific gene expression pattern determining arteriovenous specification. In order to account for these differences in postnatal vessels we present this novel isolation method based on the specific anatomical location of the endothelial cells. The methods commonly used for primary EC isolation are flushing the vessel with an enzyme solution or mincing the vessel prior to digestion, two methods that both have a risk of contamination with non-ECs. We established a technique for the isolation of Canine Primary Endothelial Cells (CaPECs) with a lesser chance of contamination that can also be used on small vessels. This isolation method of endothelial cells is based on the inversion of the vessel, which avoids digestion of all other vessel cell types. It is important to remove the vessels aseptically, as illustrated in Figure 1A, to prevent bacterial or fungal contamination of the endothelial cultures. In case of bacterial growth an additional antimicrobial agent (e.g., gentamycin) can be added to the culture medium. In case of fungal infection treatment is often not successful in our experience.
In order for the inversion to succeed, it is critical to obtain a vessel that is approximately 5 cm in length. A second important step to facilitate inversion of the blood vessel is the removal of any adherent tissue and fat with surgical scissors. Inverting the vessel is done carefully by clamping the forceps at the opposite end and slowly inverting the vessel. When placing the purse-string sutures make sure to touch the endothelial layer as little as possible. Damage of the endothelium can result in poor yield of viable endothelial cells and access of the digestion media to underlying tissue. This can also happen if the vessel is not closed completely. The vessel can easily be handled by picking it up at the end of a ligature.
In specific cases a modification of the technique can be applied. In blood vessels with a small diameter it is sometimes impossible to insert a Mosquito forceps in order to invert the vessel. A solution is to place stay sutures on one end of the vessel and push their ligatures through the blood vessel using the forceps. At the other end they can then be secured with a Mosquito forceps and pulled, thereby inverting the vessel. Sometimes the vessel will tear as a consequence of the extra sutures, so this modification is not the preferred approach. Another problem that can arise is when many erythrocytes are present in the culture plates upon seeding of the primary cells. This can be the result of insufficient washing of the blood vessel prior to digestion. When this occurs, washing the wells on day 2 with warm HBSS is often sufficient to remove the majority of the erythrocytes. In any case, the erythrocytes will not persist in the culture and are lost upon passaging of the CaPECs.
The isolated CaPECs expressed CD31, indicating that the population of cells that was digested from the blood vessel is indeed of endothelial origin. As recently published, this marker is also expressed in endothelial cells from the canine mitral valve14. The formation of colonies in culture indicates the cultures start from either single cells or from small cell clusters. Rapid growth on endothelial specific media is also indicative of correct cell type. The primary cells can be cultured for eight passages, after which the cultures cease expansion. This is an indication of senescence and makes it less likely that stem/progenitor cells are cultured with this protocol. In an angiogenesis assay, CaPECs from aorta, vena cava and vena porta showed branching within 6 hr. This endothelial functionality provides solid evidence for their origin.
Based on availability only canine material was studied, but the isolation method has possible applications for isolation of human primary endothelial cells or endothelial cells from other organisms. The technique is also possible for very small vessels (1 cm length), but will yield less isolated cells. For this reason CaPECs obtained from small vessels will require an extra passage before they have reached a sufficient number for experiments.
The ability to perform the isolation method on small vessels is a great advantage for studies in vascular disease. ECs could be isolated from diseased or aberrant vessels like portosystemic shunts. These are vessels connecting the portal vein and the systemic circulation which causes blood to bypass the liver2. The shunt itself can be as small as 1 cm. Comparing the ECs from a shunt vessel with cells originating from a healthy caval vein and portal vein could give new information relevant for the shunt-development since the pathogenesis is still not completely understood. In addition, new angiogenic genes could be investigated on a functional level by performing genetic modifications such as siRNA mediated gene silencing. In conclusion, this novel isolation method can be a powerful model to study (congenital) cardiovascular diseases, disease modelling, and (tumor) angiogenesis15, 16.

Dogs are used as large animal model for cardiovascular disease research and can also suffer from inborn (genetic) vascular abnormalities1, 2. To study these diseases commercial endothelial cell lines are often used to assess endothelial cell (EC) functionality. For dogs there is one commercial endothelial cell line available (CnAOEC), derived from canine aorta. This cell line is mostly used in studies as control normal ECs3-5. In human cardiovascular research the most commonly used endothelial cell lines are Human Umbilical Vein Endothelial Cells (HUVECs) and Human Umbilical Artery Endothelial Cells (HUAECs) derived from human umbilical cord vein and artery, respectively. HUVECs have been used as the golden standard in vascular research since the 1980s6. They are considered to be the classic model system to study endothelial function and disease adaptation. Endothelial cells isolated from different blood vessels vary in appearance and functionality due to genetic background and exposure to the microenvironment7. In addition, HUVECs and HUAECs are derived from umbilical cord, a developmental vascular structure that might not fully mimic adult blood vessels with respect to the conditions they are exposed to and response to disease. Hence, translating results found in HUVECs and HUAECs to cardiovascular disease in general is inadequate.
When studying adaptation and behavior of adult ECs, primary ECs from the vessel of interest should be used as a more direct approach. To isolate these cells, several methods have been reported. A widely described method, which is also used for HUVECs, is flushing the vessel with an enzymatic digestion solution8. This often results in contamination with non-ECs such as smooth muscle cells and fibroblasts9. Another frequently used method for isolation is enzymatic digestion of minced vessel tissue followed by fluorescence-activated cell sorting (FACS) based on endothelial cell marker Cluster of Differentiation (CD)317, 8. FACS sorting and subsequent cell culture requires relatively large amounts of cells and is therefore not suitable for the isolation of endothelium from small blood vessels. We therefore aimed at developing a new robust method for isolating a pure endothelial cell population from various canine blood vessels with high purity. To test the efficiency of the new isolation method, we isolated and obtained pure Canine Primary Endothelial Cell (CaPEC) cultures from different canine arteries and veins, both large and small. This method also enables the culture of endothelial cells originating from diseased and/or aberrant vessels such as inborn intra- or extra-hepatic portosystemic shunts, a common disease in dogs2. The method allows the isolation of additional relevant cell types of the same vessel such as vascular smooth muscle cells since most of the vessel remains intact during the procedure.

<table><tbody><tr><td>Collagenase type II</td><td>Life Technologies</td><td>17101-015</td><td></td></tr><tr><td>Dispase</td><td>Life Technologies</td><td>17105-041</td><td></td></tr><tr><td>DMEM (1x) + GlutaMAX</td><td>Life Technologies</td><td>31966-021</td><td></td></tr><tr><td>Hank&#039;s Balanced Salt Solution</td><td>Life Technologies</td><td>14025-050</td><td></td></tr><tr><td>Canine Endothelial Cells Growth Medium&amp;nbsp;</td><td>Cell Applications</td><td>Cn211-500</td><td></td></tr><tr><td>CnAOECs</td><td>Cell Applications</td><td>Cn304-05</td><td></td></tr><tr><td>Fetal Calf Serum (FCS)&amp;nbsp;</td><td>GE Healthcare</td><td>16000-044</td><td></td></tr><tr><td>TrypLE Express</td><td>Life Technologies</td><td>12604-013</td><td></td></tr><tr><td>SPR</td><td>Bio-Rad</td><td>170-8898</td><td></td></tr><tr><td>iScript synthesis kit</td><td>Bio-Rad</td><td>170-8891</td><td></td></tr><tr><td>SYBR green super mix</td><td>Bio-Rad</td><td>170-8886</td><td></td></tr><tr><td>Recovery Cell Freezing Medium</td><td>Gibco/Life Technologies</td><td>12648-010</td><td>Keep on ice prior to use</td></tr><tr><td>Freezing container, Nalgene Mr. Frosty</td><td>Sigma-Aldrich</td><td>C1562</td><td></td></tr><tr><td>Gelatin</td><td>Sigma-Aldrich</td><td>G1890</td><td></td></tr><tr><td>Surgical scissors (Mayo or Metzenbaum)</td><td>B. Braun Medical</td><td>BC555R</td><td></td></tr><tr><td>Mosquito forceps&amp;nbsp;</td><td>B. Braun Medical</td><td>FB440R</td><td></td></tr><tr><td>Mosquito forceps curved</td><td>B. Braun Medical</td><td>FB441R</td><td></td></tr><tr><td>polyglactin 3-0</td><td>Ethicon</td><td>VCP311H</td><td></td></tr><tr><td>Trypan blue</td><td>Bio-Rad</td><td>145-0013</td><td></td></tr><tr><td>Automated counting chamber</td><td>Bio-Rad</td><td>145-0102</td><td></td></tr><tr><td>Counting Slides, Dual Chamber</td><td>Bio-Rad</td><td>145-0011</td><td></td></tr><tr><td>Matrigel</td><td>BD Biosciences</td><td>BD356231</td><td>Slowly thaw on ice</td></tr><tr><td>&amp;micro;-Slide Angiogenesis</td><td>Ibidi</td><td>81501</td><td></td></tr><tr><td>Endothelial Growth Medium</td><td>Lonza</td><td>CC-3156</td><td></td></tr><tr><td>EGM-2 SingleQuot Kit&amp;nbsp;</td><td>Lonza</td><td>CC-4176</td><td></td></tr></tbody></table>

isolation and culture of primary endothelial cells from canine arteries and veins

Cardiovascular disease is studied in both human and veterinary medicine. Endothelial cells have been used extensively as an in vitro model to study vasculogenesis, (tumor) angiogenesis, and atherosclerosis. The current standard for in vitro research on human endothelial cells (ECs) is the use of Human Umbilical Vein Endothelial Cells (HUVECs) and Human Umbilical Artery Endothelial Cells (HUAECs). For canine endothelial research, only one cell line (CnAOEC) is available, which is derived from canine aortic endothelium. Although currently not completely understood, there is a difference between ECs originating from either arteries or veins. For a more direct approach to in vitro functionality studies on ECs, we describe a new method for isolating Canine Primary Endothelial Cells (CaPECs) from a variety of vessels. This technique reduces the chance of contamination with fast-growing cells such as fibroblasts and smooth muscle cells, a problem that is common in standard isolation methods such as flushing the vessel with enzymatic solutions or mincing the vessel prior to digestion of the tissue containing all cells. The technique we describe was optimized for the canine model, but can easily be utilized in other species such as human.

Different blood vessels were successfully subjected to the described isolation protocol (Figure 2). It was possible to dissect and invert aorta, vena cava, vena porta, and coronary artery from healthy dogs (all vessels from each dog, n= 4). With the same approach ECs were isolated from two congenital portosystemic shunts (extrahepatic and intrahepatic, n= 1 each). Although aorta was easily inverted, thoracic aorta segments were more challenging than abdominal aorta. In thoracic segments the aorta has many intercostal arteries branching from it, which need to be ligated individually to ensure strictly endothelial exposure to the digestion solution. The dissected segment of caudal vena cava included the branching point of the renal veins, which needed to be ligated before inversion. For the portal vein the contributing branch of the vena gastroduodenalis was ligated before inversion of the blood vessel. The coronary artery in dogs is a much smaller blood vessel (approximately 1 - 2 mm diameter in a medium sized dog), from which we excised a segment of the circumflex branch. Because it has a small diameter, it proved to be easier to invert a rather short segment of 1 cm because the Mosquito forceps could not be inserted much further.
One day post isolation adhered cells were visible in the culture plate. In culture, CaPECs had a polygonal shape and displayed a tendency to grow in patches as shown in Figure 3. Numerous colonies of endothelial cells could be observed 3 - 6 days after isolation. After approximately 10 days in culture a confluency of 80% was reached and cells could be surpassed. On average the primary endothelial cultures could be maintained for a maximum of 8 passages (once weekly at a split rate of 1:4) at which point they stopped growing.
Isolated endothelial cells expressed endothelial cell marker CD31 as indicated by qPCR (Figure 4). The expression in endothelial cells derived from aorta, vena cava, and vena porta from four dogs was compared with a control culture of CnAOECs. The cultured primary cells had a comparable CD31 expression with the control ECs (Kruskall-Wallis, p=0.856).
CaPECs derived from aorta, vena cava and vena porta showed branching after 6 hr incubation on the angiogenesis slide as shown in Figure 5.
<img alt="Figure 1" src="/files/ftp_upload/54786/54786fig1.jpg" /> 
Figure 1: Dissecting and Inverting Blood Vessels for Endothelial Cell Isolation. A) The blood vessel of interest is aseptically removed from a fresh canine cadaver. B) Adherent tissue and/or fat surrounding the vessel should be removed carefully with surgical scissors without damaging the vessel itself (canine vena cava, abdominal segment of 5 cm). C) With a curved Halsted Mosquito forceps, the vessel can be entered without perforating the endothelial layer. D-G) Secure the forceps on the other end of the blood vessel and gently retract, thereby completely inverting the blood vessel. The endothelial layer is now on the outside of the vessel. H) Purse-string sutures are placed at the ends closing off the non-endothelial surface of the inverted vessel. I) The blood vessel is transferred to a 50 ml tube for washing and subsequent digestion. Scale bars indicate 2 cm. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54786/54786fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/54786/54786fig2.jpg" /> 
Figure 2: Inverted Vessels of Different Origin. A) An inverted aorta segment (healthy dog). B) An inverted vena porta (healthy dog). C) An inverted vena cava segment (healthy dog). D) An inverted coronary artery segment (healthy dog). E) An inverted extrahepatic portosystemic shunt derived from a Cairn terrier (age: 6 weeks old). F) An inverted intrahepatic portosystemic shunt derived from an Irish wolfhound (age: 8 weeks old). Scale bars indicate 2 cm. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54786/54786fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/54786/54786fig3.jpg" /> 
Figure 3: Cell Morphology. Pictures were taken two weeks after digestion of the vessels. A) ECs derived from canine aorta in passage 2. B) ECs derived from canine vena cava in passage 2. C) ECs derived from canine vena porta in passage 2. All pictures are taken with 4X original magnification. Scale bars indicate 500 &#181;m. Insert shows 10X magnification. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54786/54786fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" src="/files/ftp_upload/54786/54786fig4.jpg" /> 
Figure 4: Gene Expression of CD31. Expression of CD31 in endothelial cells in passage 1 derived from aorta, vena cava, and vena porta (n= 4 dogs). No significant expression differences were observed between the CaPECs and the CnAOECs. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54786/54786fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" src="/files/ftp_upload/54786/54786fig5.jpg" /> 
Figure 5: Angiogenesis. Photographs of CnAOECs and CaPECs from aorta, vena cava and vena porta after 6 hr incubation on an angiogenesis slide (20X magnification). Branch formation is visible after 6 hr in culture. A) CnAOECs. B) CaPECs derived from aorta. C) CaPECs derived from vena cava. D) CaPECs derived from vena porta. All cells were in passage 3. Scale bars indicate 1 mm. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54786/54786fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>GOI</td>
			<td>Direction</td>
			<td colspan="2">5&#8217;-Sequence-3&#8217;</td>
			<td>Tm annealing</td>
			<td>Product size (bp)</td>
			<td>Genebank number</td>
		</tr>
		<tr>
			<td>CD31</td>
			<td>Forward</td>
			<td colspan="2">GTTCTGCGTGTCAAGGTG</td>
			<td>59 &#176;C</td>
			<td>85</td>
			<td>XM_005624261.1</td>
		</tr>
		<tr>
			<td></td>
			<td>Reverse</td>
			<td colspan="2">TGTCCTTCCCAAACTCCA</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>beta-actin&#160;</td>
			<td>Forward</td>
			<td colspan="2">GATATCGCTGCGCTTGTGGTC</td>
			<td>58 &#176;C</td>
			<td>384</td>
			<td>NM_001195845</td>
		</tr>
		<tr>
			<td></td>
			<td>Reverse</td>
			<td colspan="2">GGCTGGGGTGTTGAAAGTCTC</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>RPS19</td>
			<td>Forward</td>
			<td colspan="2">CCTTCCTCAAAAAGTCTGGG</td>
			<td>63 &#176;C</td>
			<td>95</td>
			<td>XM_005616513</td>
		</tr>
		<tr>
			<td></td>
			<td>Reverse</td>
			<td colspan="2">GTTCTCATCGTAGGGAGCAAG</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>B2MG</td>
			<td>Forward</td>
			<td colspan="2">TCCTCATCCTCCTCGCT</td>
			<td>63 &#176;C</td>
			<td>85</td>
			<td>AB745507</td>
		</tr>
		<tr>
			<td></td>
			<td>Reverse</td>
			<td colspan="2">TTCTCTGCTGGGTGTCG</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 1: qPCR Primer Sets. qPCR primers for canine reference genes and CD31.

Watch this Scientific Journal Video about Isolation and Culture of Primary Endothelial Cells from Canine Arteries and Veins at JoVE.com

Isolation and Culture of Primary Endothelial Cells from Canine Arteries and Veins

Novel isolation methods of primary endothelial cells from blood vessels are needed. This protocol describes a new technique that completely inverts blood vessels of interest, exposing only the endothelial side to enzymatic digestion. The resulting pure endothelial cell culture can be used to study cardiovascular diseases, disease modelling, and angiogenesis.

Cardiovascular disease is studied in both human and veterinary medicine. Endothelial cells have been used extensively as an in vitro model to study ...

isolation-culture-primary-endothelial-cells-from-canine-arteries

Nanyang Technological University

Research

JoVE Journal

Medicine

11.2K Views.  Utrecht University. Novel isolation methods of primary endothelial cells from blood vessels are needed. This protocol describes a new technique that completely inverts blood vessels of interest, exposing only the endothelial side to enzymatic digestion. The resulting pure endothelial cell culture can be used to study cardiovascular diseases, disease modelling, and angiogenesis.

Video: Isolation and Culture of Primary Endothelial Cells from Canine Arteries and Veins

Isolation and Culture of Endothelial Cells from the Embryonic Forebrain

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two vascular networks of the embryonic forebrain, pial and periventricular, are spatially distinctive and have different origins and growth patterns. Endothelial cells from the pial and periventricular vascular networks have unique gene expression profiles and functions. Here we present a step-by-step protocol for isolation, culture, and verification of pure populations of endothelial cells from the periventricular vascular network (PVECs) of the embryonic forebrain (telencephalon). In this approach, telencephalon devoid of pial membrane obtained from embryonic day 15 mice is minced, digested with collagenase/dispase, and dispersed mechanically into a single cell suspension. PVECs are purified from cell suspension using positive selection with anti-CD-31/PECAM-1 antibody conjugated to MicroBeads using a strong magnetic separation method. Purified cells are cultured on collagen 1&#160;coated culture dishes in endothelial cell culture medium until they become confluent and further subcultured. PVECs obtained with this protocol exhibit cobblestone and spindle shaped phenotypes, as visualized by phase-contrast light microscopy and fluorescence microscopy. Purity of PVEC cultures was established with endothelial cell markers. In our hands, this method reliably and consistently yields pure populations of PVECs. This protocol will benefit studies aimed at gaining mechanistic insights into forebrain angiogenesis, understanding PVEC interactions, and cross-talks with neuronal cell types and holds tremendous potential for therapeutic angiogenesis.

This video demonstrates an easy and reliable strategy for preparation of pure cultures of endothelial cells from the embryonic forebrain within 10-12 days and will be useful for research focused on many aspects of cerebral angiogenesis.

Embryonic brain endothelial cells can serve as an important tool in the study of angiogenesis and neurovascular development and interactions. The two ...

Neuroscience

Isolation of Valvular Endothelial Cells

Heart valves are solely responsible for maintaining unidirectional blood flow through the cardiovascular system. These thin, fibrous tissues are subjected to significant mechanical stresses as they open and close several billion times over a lifespan. The incredible endurance of these tissues is due to the resident valvular endothelial (VEC) and interstitial cells (VIC) that constantly repair and remodel in response to local mechanical and biological signals. Only recently have we begun to understand the unique behaviors of these cells, for which in vitro experimentation has played a key role. Particularly challenging is the isolation and culture of VEC. Special care must be used from the moment the tissue is removed from the host through final plating. Here we present protocols for direct isolation, side specific isolation, culture, and verification of pure populations of VEC. We use enzymatic digestion followed by a gentle swab scraping technique to dislodge only surface cells. These cells are then collected into a tube and centrifuged into a pellet. The pellet is then resuspended and plated into culture flasks pre-coated with collagen I matrix. VEC phenotype is confirmed by contact inhibited growth and the expression of endothelial specific markers such as PECAM1 (CD31), Von Willebrand Factor (vWF), and negative expression of alpha-smooth muscle actin (&alpha;-SMA). The functional characteristics of VEC are associated with high levels of acetylated LDL. Unlike vascular endothelial cells, VEC have the unique capacity to transform into mesenchyme, which normally occurs during embryonic valve formation1. This can also occur during significantly prolonged post confluent in vitro culture, so care should be made to passage at or near confluence. After VEC isolation, pure populations of VIC can then be easily acquired.

We provide a method for isolating and culturing pure populations of heart valve endothelial cells (VEC). VEC can be isolated from either side of the cusp or leaflet and immediately following, underlying interstitial cell (VIC) isolation is straightforward.

Heart valves are solely responsible for maintaining unidirectional blood flow through the cardiovascular system.  These thin, fibrous tissues are ...

Biology

Isolation of Microvascular Endothelial Tubes from Mouse Resistance Arteries

The control of blood flow by the resistance vasculature regulates the supply of oxygen and nutrients concomitant with the removal of metabolic by-products, as exemplified by exercising skeletal muscle. Endothelial cells (ECs) line the intima of all resistance vessels and serve a key role in controlling diameter (e.g.&#160;endothelium-dependent vasodilation) and, thereby, the magnitude and distribution of tissue blood flow. The regulation of vascular resistance by ECs is effected by intracellular Ca2+ signaling, which leads to production of diffusible autacoids (e.g.&#160;nitric oxide and arachidonic acid metabolites)1-3 and hyperpolarization4,5 that elicit smooth muscle cell relaxation. Thus understanding the dynamics of endothelial Ca2+ signaling is a key step towards understanding mechanisms governing blood flow control. Isolating endothelial tubes eliminates confounding variables associated with blood in the vessel lumen and with surrounding smooth muscle cells and perivascular nerves, which otherwise influence EC structure and function. Here we present the isolation of endothelial tubes from the superior epigastric artery (SEA) using a protocol optimized for this vessel.
To isolate endothelial tubes from an anesthetized mouse, the SEA is ligated in situ to maintain blood within the vessel lumen (to facilitate visualizing it during dissection), and the entire sheet of abdominal muscle is excised. The SEA is dissected free from surrounding skeletal muscle fibers and connective tissue, blood is flushed from the lumen, and mild enzymatic digestion is performed to enable removal of adventitia, nerves and smooth muscle cells using gentle trituration. These freshly-isolated preparations of intact endothelium retain their native morphology, with individual ECs remaining functionally coupled to one another, able to transfer chemical and electrical signals intercellularly through gap junctions6,7. In addition to providing new insight into calcium signaling and membrane biophysics, these preparations enable molecular studies of gene expression and protein localization within native microvascular endothelium.

We present a preparation for visualizing and manipulating calcium signaling in native, intact microvascular endothelium. Endothelial tubes freshly isolated from mouse resistance arteries supplying skeletal muscle retain in vivo morphology and dynamic signaling within and between neighboring cells. Endothelial tubes can be prepared from microvessels of other tissues and organs.

The control of blood flow by the resistance vasculature regulates the supply of oxygen and nutrients concomitant with the removal of metabolic ...

Isolation of Primary Mouse Lung Endothelial Cells

Endothelial cells play critical roles in the regulation of vascular tone, immunity, coagulation, and permeability. Endothelial dysfunction occurs in medical conditions including diabetes, atherosclerosis, sepsis, and acute lung injury. A reliable and reproducible method to isolate pure endothelial cells from mice is needed to investigate the role of endothelial cells in the pathogenesis of these and other conditions. In this protocol, lung microvascular endothelial cells were prepared from 5-7 day old neonatal mouse pups. Lungs are harvested, minced, and enzymatically digested with collagenase I, and released cells are cultured overnight. Endothelial cells are then selected using anti-PECAM1 (CD-31) IgG conjugated to magnetic beads, and cells again are cultured to confluence. A secondary cell selection then occurs with anti-ICAM2 (CD-102) IgG conjugated to magnetic beads to increase the purity of the endothelial cells, and the cells again are cultured to confluence. The entire process takes approximately 7-10 days before the cells can be used for experimentation. This simple protocol yields highly pure (purity &#62;92%) endothelial cells that can be immediately used for in vitro studies, including the studies focused on endothelial cytokine and chemokine production, leukocyte-endothelial interactions, endothelial coagulation pathways, and endothelial permeability. With many knockouts and transgenic mouse lines available, this procedure also lends itself to understanding the function of specific genes expressed by endothelial cells in healthy and pathologic responses to injury, infection, and inflammation.

In this article, primary lung endothelial cells were isolated and cultured from neonatal mice.

Endothelial cells play critical roles in the regulation of vascular tone, immunity, coagulation, and permeability. Endothelial dysfunction occurs in ...

Immunology and Infection

Isolation and Primary Culture of Mouse Aortic Endothelial Cells

The vascular endothelium is essential to normal vascular homeostasis. Its dysfunction participates in various cardiovascular disorders. The mouse is an important model for cardiovascular disease research. This study demonstrates a simple method to isolate and culture endothelial cells from the mouse aorta without any special equipment. To isolate endothelial cells, the thoracic aorta is quickly removed from the mouse body, and the attached adipose tissue and connective tissue are removed from the aorta. The aorta is cut into 1 mm rings. Each aortic ring is opened and seeded onto a growth factor reduced matrix with the endothelium facing down. The segments are cultured in endothelial cell growth medium for about 4 days. The endothelial sprouting starts as early as day 2. The segments are then removed and the cells are cultured continually until they reach confluence. The endothelial cells are harvested using neutral proteinase and cultured in endothelial cell growth medium for another two passages before being used for experiments. Immunofluorescence staining indicated that after the second passage the majority of cells were double positive for Dil-ac-LDL uptake, Lectin binding, and CD31 staining, the typical characteristics of endothelial cells. It is suggested that cells at the second to third passages are suitable for in vitro and in vivo experiments to study the endothelial biology. Our protocol provides an effective means of identifying specific cellular and molecular mechanisms in endothelial cell physiopathology.

The vascular endothelial cells play a significant role in many important cardiovascular disorders. This article describes a simple method to isolate and expand endothelial cells from the mouse aorta without using any special equipment. Our protocol provides an effective means of identifying mechanisms in endothelial cell physiopathology.

The vascular endothelium is essential to normal vascular homeostasis. Its dysfunction participates in various cardiovascular disorders. The mouse is an ...

Isolation of Mouse Coronary Endothelial Cells

Endothelial cells line the inner wall of blood vessels and play an important role in the regulation of vascular tone, vascular permeability, and new vascular formation. Endothelial cell dysfunction is implicated in the development and progression of many cardiovascular diseases including ischemic heart disease. To examine the function and characterization of coronary endothelial cells, cell isolation is the first step and it requires high purity and quantity to conduct subsequent experiments. This protocol describes an efficient method to isolate adult mouse coronary endothelial cells. The mouse heart is dissected and minced into small pieces. After the digestion of the heart using dispase and collagenase II, cells are washed&#160;and incubated with magnetic beads which are conjugated with anti-CD31 antibody. The beads with endothelial cells are washed several times and are ready to use in various applications, including imaging and molecular biological experiments. Efficient isolation yields approximately 104 cells per one heart with over 90% purity.

This protocol is prepared to share our method of isolating mouse coronary endothelial cells for the purpose of imaging or to conduct molecular biological experiments.

Endothelial cells line the inner wall of blood vessels and play an important role in the regulation of vascular tone, vascular permeability, and new ...

Human Saphenous Vein Endothelial Cell Isolation and Exposure to Controlled Levels of Shear Stress and Stretch

Coronary artery bypass graft (CABG) surgery is a procedure to revascularize ischemic myocardium. Saphenous vein remains used as a CABG conduit despite the reduced long-term patency compared to arterial conduits. The abrupt increase of hemodynamic stress associated with the graft arterialization results in vascular damage, especially the endothelium, that may influence the low patency of the saphenous vein graft (SVG). Here, we describe the isolation, characterization, and expansion of human saphenous vein endothelial cells (hSVECs). Cells isolated by collagenase digestion display the typical cobblestone morphology and express endothelial cell markers CD31 and VE-cadherin. To assess the mechanical stress influence, protocols were used in this study to investigate the two main physical stimuli, shear stress and stretch, on arterialized SVGs. hSVECs are cultured in a parallel plate flow chamber to produce shear stress, showing alignment in the direction of the flow and increased expression of KLF2, KLF4, and NOS3. hSVECs can also be cultured in a silicon membrane that allows controlled cellular stretch mimicking venous (low) and arterial (high) stretch. Endothelial cells' F-actin pattern and nitric oxide (NO) secretion are modulated accordingly by the arterial stretch. In summary, we present a detailed method to isolate hSVECs to study the influence of hemodynamic mechanical stress on an endothelial phenotype.

We describe a protocol to isolate and culture human saphenous vein endothelial cells (hSVECs). We also provide detailed methods to produce shear stress and stretch to study mechanical stress in hSVECs.

Coronary artery bypass graft (CABG) surgery is a procedure to revascularize ischemic myocardium. Saphenous vein remains used as a CABG conduit despite the ...

Isolation and Culture of Primary Aortic Endothelial Cells from Miniature Pigs

Xenotransplantation is a promising way to resolve the shortage of human organs for patients with end-stage organ failure, and the pig is considered as a suitable organ source. Immune rejection and coagulation are two major hurdles for the success of xenotransplantation. Vascular endothelial cell (EC) injury and dysfunction are important for the development of the inflammation and coagulation responses in xenotransplantation. Thus, isolation of porcine aortic endothelial cells (pAECs) is necessary for investigating the immune rejection and coagulation responses. Here, we have developed a simple enzymatic approach for the isolation, characterization, and expansion of highly purified pAECs from miniature pigs. First, the miniature pig was anaesthetized with ketamine, and a length of aorta was excised. Second, the endothelial surface of aorta was exposed to 0.005% collagenase IV digestive solution for 15 min. Third, the endothelial surface of the aorta was scraped in only one direction with a cell scraper (&#60;10 times), and was not compressed during the process of scraping. Finally, the isolated pAECs of Day 3, and after passage 1 and passage 2, were identified by flow cytometry with an anti-CD31 antibody. The percentages of CD31-positive cells were 97.4% &#177; 1.2%, 94.4% &#177; 1.1%, and 92.4% &#177; 1.7% (mean &#177; SD), respectively. The concentration of Collagenase IV, the digestive time, the direction, and frequency and intensity of scraping are critical for decreasing fibroblast contamination and obtaining high-purity and a large number of ECs. In conclusion, our enzymatic method is a highly-effctive method for isolating ECs from the miniature pig aorta, and the cells can be expanded in vitro to investigate the immune and coagulation responses in xenotransplantation.

An effective enzymatic method for isolation of primary porcine aortic endothelial cells (pAECs) from miniature pigs is described. The isolated primary pAECs can be used to investigate the immune and coagulation response in xenotransplantation.

Xenotransplantation is a promising way to resolve the shortage of human organs for patients with end-stage organ failure, and the pig is considered as a ...

Isolation and Identification of Vascular Endothelial Cells from Distinct Adipose Depots for Downstream Applications

Vascular endothelial cells lining the wall of the vascular system play important roles in a variety of physiological processes, including vascular tone regulation, barrier functions, and angiogenesis. Endothelial cell dysfunction is a hallmark predictor and major driver for the progression of severe cardiovascular diseases, yet the underlying mechanisms remain poorly understood. The ability to isolate and perform analyses on endothelial cells from various vascular beds in their native form will give insight into the processes of cardiovascular disease. This protocol presents the procedure for the dissection of mouse subcutaneous and mesenteric adipose tissues, followed by isolation of their respective arterial vasculature. The isolated arteries are then digested using a specific cocktail of digestive enzymes focused on liberating functionally viable endothelial cells. The digested tissue is assessed by flow cytometry analysis using CD31+/CD45&#8722; cells as markers for positive endothelial cell identification. Cells can be sorted for immediate downstream functional assays or used to generate primary cell lines. The technique of isolating and digesting arteries from different vascular beds will provide options for researchers to evaluate freshly isolated vascular cells&#160;from arteries of interest and allow them to perform a wide range of functional tests on specific cell types.

This protocol details a method for the dissection of mouse adipose depots and the isolation and digestion of respective arteries to liberate and then identify the endothelial cell population. Freshly isolated cells used in downstream applications will advance the understanding of vascular cell biology and the mechanisms of vascular dysfunction.

Vascular endothelial cells lining the wall of the vascular system play important roles in a variety of physiological processes, including vascular tone ...

Isolation and Culture of Primary Brain Pericytes: A Procedure to Isolate and Culture Pericytes from Bovine Brain Capillaries Without Endothelial Cell Contamination

Source: H&#248;rlyck, S. et al. <a href="https://www-jove-com.remotexs.ntu.edu.sg/video/61253" target="_blank">Culture of Brain Capillary Pericytes for Cytosolic Calcium Measurements and Calcium Imaging Studies.</a>&#160;J. Vis. Exp. (2020)
In this video, we demonstrate the procedure to isolate and culture pericytes from bovine brain capillaries without endothelial cell contamination.

Izolacja i hodowla pierwotnych perycytów mózgu: procedura izolacji i hodowli perycytów z naczyń włosowatych mózgu bydła bez zanieczyszczenia komórek śródbłonka

Source: H&#248;rlyck, S. et al. Culture of Brain Capillary Pericytes for Cytosolic Calcium Measurements and Calcium Imaging Studies.&#160;J. Vis. Exp. ...