The authors would like to acknowledge Hans de Graaf and Tomas Veenendaal for their technical assistance in culturing the ECs.

윤리 문 : 본 연구에 사용 된 혈관은 신선한 개 사체에서 얻은 잉여 재료로 수확 (N = 4) 기타 관련이없는 연구 (대학 3R 정책)에 대한 안락사 건강한 개에서. 비정상적인 혈관 (인트라과 간외 문맥 정맥 션트, N = 1 각) 위트레흐트 대학의 반려 동물에 대한 대학 병원에 제출 개에서 소유자의 동의 후 사후을 수확했다. 1. 분리 및 문화 차 개 내피 세포의 <ol><li> 2 ㎖ /도 0.5 % w / v를 젤라틴과와 사전 코트 6 웰 플레이트는 37 ° C에서 5 % CO 2의 가습 분위기 인큐베이터에서 2 시간 동안 둡니다. 이전의 기본 세포를 파종을 초과 젤라틴 용액을 제거합니다. </li><li> 무균 신선한 개 사체 (그림 1A)에서 혈관 (들)의 관심 (예를 들어, 대동맥, 대정맥, 대정 간이)를 제거합니다. 용기 시스템의 해부학 유지관심있는 선박의 양단에 직선 집게를 배치하여. 내피 세포의 손상을 방지하기 위해 집게로 조직의 불필요한 조작을하지 마십시오. <ol><li> 수술 가위로 양쪽 끝에있는 고정 용기를 잘라 시신에서 제거합니다. 얼음에 행크의 균형 소금 솔루션 (HBSS)에 전송. 참고 : 약 5cm의 혈관 길이는이 절차 바람직하지만 1cm를 측정하는 것과도 문화에 충분한 세포를 제공 할 것입니다. </li></ol></li><li> 얼음처럼 차가운 HBSS 가득 페트리 접시에 혈관을 전송합니다. 수술 가위를 사용하여 용기 자체의 손상 (그림 1B)를 유지, 용기의 외부에서 모든 부착 조직과 지방을 제거합니다. 최적의 뷰의 클램프 또는 집게로 옆으로 주변 조직을 당겨 : 절단시 반드시 선박이 항상 명확하게 볼 수 있습니다합니다. <ol><li> 합자로 선박의 어떤 지점을 닫습니다 (예를 들면, 3-0 polyglactin)이어서 제거수술 가위 나 메스와. </li></ol></li><li> 주의 깊게 만곡 홀스 테드 모기 집게 용기 단부 입력 용기의 타 단부에 나이프의 선단부를 클램핑하고 외부 (도 1C-G)를 완전히 안쪽까지 서서히 상기 용기를 반전 후퇴. 외부는 이제 내피 세포 층으로 구성되어 있습니다. 어떤 어려움이 용기 반전시에 발생되는 경우, 마찰을 줄이기 위해 다시 HBSS에 잠기. </li><li> 완전히 폐쇄하고 소화 절차 (그림 1H)에 비 내피 혈관 조직의 노출을 방지하기 위해 선박의 양쪽 끝에서 지갑 문자열 봉합을 놓습니다. 반전 용기를 조작 할 수 합자 끝을 사용합니다. </li><li> 소화 배양 후에 수행되면, 소화 프로토콜 (단계 170) 전에 반전 용기 cryopreserve. <ol><li> cryovial에 반전 용기를 놓고 세포 배양 매체를 동결 채우기. 동결 공동 사용 아래 -80 ° C에 고정의 ntainer. -80 ℃에서 저장은 선박 1 주일 이내에 사용하는 경우. 장기 보관, -180 ° C에서 장소 크리오 바이알 (cryovial)하십시오. EC의 격리를 수행 할 때, 수조 (37 ℃)에서 급속 해동 크리오 바이알 (cryovial)를 즉시 얼음처럼 차가운 HBSS에 놓는다. 1.7에 표시된대로 진행합니다. 참고 : 분리 후 내장 컴퓨터의 총 생산량이 때문에 냉동 과정에서 생존 능력의 손실에 낮은 것을 고려. </li></ol></li><li> 50 ML 튜브에 용기를 전송하고 (그림 1I) (해동의 경우 또는 잔류 동결 매체) 적혈구를 제거 HBSS로 두 번 씻어. </li><li> 간헐 부드러운 37 ° C에서 1 시간 동안 개 내피 세포에서 30 ㎖의 콜라게나 제 유형 II (0.15 U / ml) 및 디스 파제 (0.15 U / ㎖)의 용액 성장 중간 (CECGM)와 50ml의 튜브 용기 다이제스트 동요. </li><li> g 튜브로부터 상기 용기를 분리하고, X (250)에서 5 분 동안 세포 현탁액을 원심 분리. </li><li> CECGM A의 세포 펠렛을 재현 탁ND 시드 2ml의 세포 현탁액은 웰 당 (1 - 웰 용기의 크기에 따라). 문화 공기에서 5 % CO 2의 가습 분위기 37 ℃에서 세포는 일주일에 두 번 배지를 변경. </li><li> 80 % 도달 - 70의 포화 상태가 통로 셀. <ol><li> 죽은 또는 비 부착 세포를 제거하기 위해 미리 예열 HBSS로 세포를 씻으십시오. 각 웰에 200 ㎕의 재조합 세포 분해 효소 (1 배)를 추가하고 5 분 동안 또는 모든 셀이 분리 될 때까지 다시 인큐베이터에 배치합니다. </li><li> 15 ㎖의 튜브에 세포를 옮기고, 10 % 소 태아 혈청 (FCS)을 포함한 배지 10 ㎖ (CEGM)을 첨가함으로써 트립신을 멈춘다. 250 × g에서 5 분 동안 원심 분리기. 젤라틴 미리 코팅 된 플레이트 또는 플라스크에 문화를 계속합니다. </li></ol></li></ol> 2. 특성 <ol><li> 문화 개 대동맥 내피 세포 (CnAOECs)와 현미경으로 두 번 주간 기본 및 상업 세포주의 형태를 비교합니다. 참고 : T그 대표적인&gt; 70 %의 컨 플루 언시에 도달 할 때 가장 잘 관찰 될 수있는 패치의 ECS에 패턴을 성장. <ol><li> 0.5 % W / V 젤라틴은 미리 코팅 T75 플라스크에 CECGM 문화 CnAOECs. 일주일에 한번 통과 셀 생장이 70 - 80 %. <ol><li> 계대를 들어, 미리 예열 HBSS 한 번 세포를 씻어 1 ml의 재조합 세포 분해 효소 (1 배)를 추가합니다. 5 분 동안 또는 모든 셀이 분리 될 때까지 다시 인큐베이터에서 플라스크를 놓습니다. 10 % FCS를 포함한 10 ㎖ 배지 (CEGM)을 첨가함으로써 트립신을 비활성화한다. 250 XG에서 5 분 동안 세포 현탁액을 원심 분리하여 상등액을 버리고 1 ml의 배양 배지에서 세포를 재현 탁. </li><li> 세포 현탁액의 10 μL 나누어지는을 가지고 1 희석 : 0.4 % 트리 판 블루로 1. 자동 세포 계수기를 사용하여 세포 수 및 새로운 T75 플라스크에서 4.0 × 10 5 생세포를 접시. 5 % CO 2와 가습 분위기에서 37 ° C에서 플라스크와 문화에 미리 예열 CECGM의 10 ML을 추가합니다. </li></ol></li></ol></li><li> 배양 CaPECs 및 CnAOECs의 통과 일로부터 RNA를 분리합니다. <ol><li> , 펠릿 적어도 1 × 103 세포를 수집 시료 전처리 시약 (SPR)의 20 μL를 추가하고, 세포를 용균 1 분 동안 배양한다. 배양 후, 조심스럽게 -70 ℃에서 총 RNA 및 저장을 포함하는 세포 용 해물을 모은다. </li></ol></li><li> 제조업체의 지시에 따르는 cDNA 합성 키트 (예를 들어, iScript)를 사용하여 cDNA를에 mRNA의 변환합니다. qPCR에를 수행 할 준비가 될 때까지 오랜 기간 동안 4 ° C 일주까지, 또는 -20 ° C에서의 저장소의 cDNA. </li><li> 내피 세포 원점을 확인하기 위해 내피 세포 마커 CD31의 유전자 발현을 측정한다. MIQE의 PRECIS 가이드 라인 (10)을 사용하여 실험 장치 및 정량화를 수행합니다. 정규화, 참조 GAPDH 유전자, RPS19 및 B2MG 11의 발현을 측정한다. <ol><li> 뉴 클레아없는 물에서 얻어진 cDNA를 10 배 희석을 준비합니다. </li><li> 준비표준 라인 풀링 된 cDNA 샘플로부터 4 배 희석하고 비 템플릿 대조군 클레아없는 물을 사용한다. qPCR의 반응에 대한 50 배의 총 희석 도달 샘플 다섯 배 희석. 4 ㎕의 cDNA를 역방향 및 정방향 프라이머 (표 1) 20 pmol의 혼합 형광 6 μl를 이용하여 384 웰 포맷에서 중복 피펫 10 μL 반응. </li><li> 변성 95 ° C에서 10 초 39주기 다음 Taq 중합 효소 활성화를위한 5 분, 어닐링 및 신장을위한 Tm은 30 초 동안 95 ° C에 프로그램을 설정합니다. 각 프라이머 세트에 대한 Tm은 표 1에 나타낸다. </li><li> 곡선을 용융 수행하는 증폭 단 하나의 제품을 보장하기 위해 모든 실행에 따라 분석한다. 참조 유전자의 상대적인 양을 평균하여 샘플의 발현 수준을 정상화하고, 반응 효율은 95 %와 105 % 사이 인 경우 ΔCT을 계산한다. </li></ol></li><li> ANGI와 EC의 기능을 평가ogenesis 분석. <ol><li> 미리 냉각 된 혈관 슬라이드의 각 웰에 세포 외 기질의 10 μl를 첨가하고 잘의 표면을 덮도록 피펫 팁으로 확산. 얼음에 세포 외 매트릭스를 유지하고, 겔에 기포의 도입을 피한다. 30 분 동안 5 % CO 2, 37 ℃에서 항온 물로 적신 페이퍼 타월로 페트리 접시에 슬라이드를 배치하여 겔 고화. </li><li> 1.0 × 10 4 차 추가 되는 EC 50 μl의 내피 성장 중간마다 잘. 5 % CO 2와 37 ° C에서 6 시간 동안 슬라이드를 품어. </li><li> 6 시간 후 이미지의 전체도를 포함해야하고, 20 배 배율로 사진을 찍을. </li></ol></li></ol>

<ol>
	<li>Haidara, M. A., Assiri, A. S., Yassin, H. Z., Ammar, H. I., Obradovic, M. M., Isenovic, E. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heart+Failure+Models:+Traditional+and+Novel+Therapy.">Heart Failure Models: Traditional and Novel Therapy.</a> Curr. Vasc. Pharmacol. 13 (5), 658-669 (2015).</li><li>van Steenbeek, F. G., van den Bossche, L., Leegwater, P. A., Rothuizen, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inherited+liver+shunts+in+dogs+elucidate+pathways+regulating+embryonic+development+and+clinical+disorders+of+the+portal+vein.">Inherited liver shunts in dogs elucidate pathways regulating embryonic development and clinical disorders of the portal vein.</a> Mamm. Genome. 23 (1-2), 76-84 (2012).</li><li>Murai, A., Asa, S. A., Kodama, A., Hirata, A., Yanai, T., Sakai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Constitutive+phosphorylation+of+the+mTORC2/Akt/4E-BP1+pathway+in+newly+derived+canine+hemangiosarcoma+cell+lines.">Constitutive phosphorylation of the mTORC2/Akt/4E-BP1 pathway in newly derived canine hemangiosarcoma cell lines.</a> BMC Vet. Res. 8 (1), 128 (2012).</li><li>Boilson, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+circulating+progenitor+cells+in+left+ventricular+dysfunction.">Regulation of circulating progenitor cells in left ventricular dysfunction.</a> Circ. Heart Fail. 3 (5), 635-642 (2010).</li><li>Gonzalez-Miguel, J., Morchon, R., Siles-Lucas, M., Simon, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fibrinolysis+and+proliferative+endarteritis:+two+related+processes+in+chronic+infections?+The+model+of+the+blood-borne+pathogen+Dirofilaria+immitis.">Fibrinolysis and proliferative endarteritis: two related processes in chronic infections? The model of the blood-borne pathogen Dirofilaria immitis.</a> PLoS One. 10 (4), e0124445 (2015).</li><li>Sacks, T., Moldow, C. F., Craddock, P. R., Bowers, T. K., Jacob, H. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oxygen+radicals+mediate+endothelial+cell+damage+by+complement-stimulated+granulocytes.+An+in+vitro+model+of+immune+vascular+damage.">Oxygen radicals mediate endothelial cell damage by complement-stimulated granulocytes. An in vitro model of immune vascular damage.</a> J. Clin. Invest. 61 (5), 1161-1167 (1978).</li><li>Aranguren, X. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unraveling+a+novel+transcription+factor+code+determining+the+human+arterial-specific+endothelial+cell+signature.">Unraveling a novel transcription factor code determining the human arterial-specific endothelial cell signature.</a> Blood. 122 (24), 3982-3992 (2013).</li><li>van Balkom, B. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endothelial+cells+require+miR-214+to+secrete+exosomes+that+suppress+senescence+and+induce+angiogenesis+in+human+and+mouse+endothelial+cells.">Endothelial cells require miR-214 to secrete exosomes that suppress senescence and induce angiogenesis in human and mouse endothelial cells.</a> Blood. 121 (19), 3997-4006 (2013).</li><li>Crampton, S. P., Davis, J., Hughes, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+human+umbilical+vein+endothelial+cells+(HUVEC).">Isolation of human umbilical vein endothelial cells (HUVEC).</a> J. Vis. Exp. (3), e183 (2007).</li><li>Bustin, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MIQE+precis:+Practical+implementation+of+minimum+standard+guidelines+for+fluorescence-based+quantitative+real-time+PCR+experiments.">MIQE precis: Practical implementation of minimum standard guidelines for fluorescence-based quantitative real-time PCR experiments.</a> BMC Mol. Biol. 11, 74 (2010).</li><li>Brinkhof, B., Spee, B., Rothuizen, J., Penning, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+evaluation+of+canine+reference+genes+for+accurate+quantification+of+gene+expression.">Development and evaluation of canine reference genes for accurate quantification of gene expression.</a> Anal. Biochem. 356 (1), 36-43 (2006).</li><li>Heishima, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA-214+and+MicroRNA-126+Are+Potential+Biomarkers+for+Malignant+Endothelial+Proliferative+Diseases.">MicroRNA-214 and MicroRNA-126 Are Potential Biomarkers for Malignant Endothelial Proliferative Diseases.</a> Int. J. Mol. Sci. 16 (10), 25377-25391 (2015).</li><li>Liu, M. M., Flanagan, T. C., Lu, C. C., French, A. T., Argyle, D. J., Corcoran, B. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Culture+and+characterisation+of+canine+mitral+valve+interstitial+and+endothelial+cells.">Culture and characterisation of canine mitral valve interstitial and endothelial cells.</a> Vet. J. 204 (1), 32-39 (2015).</li><li>van den Bossche, L., van Steenbeek, F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Canine+congenital+portosystemic+shunts:+disconnections+dissected.">Canine congenital portosystemic shunts: disconnections dissected.</a> The Veterinary Journal. 211, 14-20 (2015).</li><li>Sobczynska-Rak, A., Polkowska, I., Silmanowicz, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elevated+Vascular+Endothelial+Growth+Factor+(VEGF)+levels+in+the+blood+serum+of+dogs+with+malignant+neoplasms+of+the+oral+cavity.">Elevated Vascular Endothelial Growth Factor (VEGF) levels in the blood serum of dogs with malignant neoplasms of the oral cavity.</a> Acta Vet. Hung. 62 (3), 362-371 (2014).</li><li>Zhang, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+and+in+vivo+study+of+hydralazine,+a+potential+anti-angiogenic+agent.">In vitro and in vivo study of hydralazine, a potential anti-angiogenic agent.</a> Eur. J. Pharmacol. 779, 138-146 (2016).</li></ol>

The authors have no competing financial interests.

송곳니되는 EC에 초점을 맞춘 연구에서 CnAOEC 기본 회선은 개 3, 12, 13의 내피 계통을 모델링하는 데 사용됩니다. 인간의 연구에서, HUVEC 문화는 여전히 황금 표준으로 간주됩니다. 분명히, 탯줄에서 파생되는 EC에 단지 집중하는 것은 심장 혈관 연구에서 확고한 제한입니다. 내피 세포는 동정맥 사양을 결정하는 특정 유전자의 발현 패턴을 갖는다. 생후 혈관 이러한 차이를 고려하기 위해, 우리는 내피 세포의 특정 해부학 적 위치에 기초하여이 새로운 분리 방법을 제시한다. 일반적으로 기본 EC 분리에 사용하는 방법은, 모두 EC에 비 - 오염의 위험이 두 가지 방법을 효소 용액으로 용기를 세척하거나 소화 이전에 용기를 닦지된다. 우리는 또한 작은 혈관에서 사용할 수있는 오염의 적은 기회와 개 주 내피 세포의 분리 (CaPECs)하는 기술을 설립했다. 이 격리 m내피 세포의 ethod 모든 다른 혈관 세포 유형의 소화를 방지 용기의 반전에 기초한다. 또한도 1a에 도시 된 바와 같이, 무균 용기를 제거하는 내피 세포 배양 세균 또는 진균의 오염을 방지하는 것이 중요하다. 박테리아의 성장의 경우에는 추가적인 항균제 (예를 들어, 겐타 마이신)를 배지에 첨가 할 수있다. 진균 감염 치료의 경우 종종 우리의 경험에서 성공하지 못합니다. 성공하기위한 반전 위해서는 약 5 ㎝ 길이이다 용기를 얻는 것이 중요하다. 혈관의 반전을 용이하게하기 위해 두번째 중요한 단계는 수술 용 가위로 임의 부착 조직과 지방의 제거이다. 용기를 반전하는 대향 단부에 나이프 클램핑 천천히 용기 반전 심하게된다. 지갑 문자열을 배치 할 때 봉합사는 가능한 한 적은 내피 층을 터치해야합니다. DAMA내피의 GE는 가능한 내피 세포 및 기본 조직에 소화 매체의 접근 가난한 수율이 발생할 수 있습니다. 용기가 완전히 닫혀 있지 않은 경우에도 발생할 수 있습니다. 용기 용이 끈의 단부의 상황을 선택하여 처리 할 수있다. 특정 경우에 그 기술의 변형을 적용 할 수있다. 직경이 작은 혈관는 용기를 반전시키기 위해 모기 겸자를 삽입 때로는 불가능하다. 용액을 용기의 한쪽 끝에서 숙박 봉합을 배치하고 집게를 사용하여 혈관을 통해 자신의 합자를 밀어하는 것입니다. 타단 그들은 그 모기 집게로 고정함으로써, 상기 용기를 반전 당겨질 수있다. 때로는 용기는 별도의 봉합의 결과로 눈물, 그래서이 수정 바람직한 방법이 아니다. 많은 적혈구가 일차 세포의 파종시 배양 접시에있을 때 발생할 수있는 또 다른 문제점이다. 이것의 결과 일 수있다소화 전에 혈관의 불충분 한 세척. 이 때 따뜻한 HBSS로 2 일에, 웰을 세척하는 적혈구의 대부분을 제거하는 것이 충분하다. 어떤 경우에는, 적혈구가 배양 지속되지 않으며 CaPECs의 계대시 소실된다. 분리 된 CaPECs은 혈관에서 분해하고 세포의 인구가 실제로 내피 기원임을 나타내는 CD31를 표명했다. 최근 발표 된 바와 같이,이 마커는 송곳니 승모판 14 내피 세포에서 발현된다. 문화 식민지의 형성은 문화가 하나의 세포 하나에서 작은 세포 클러스터에서 시작을 나타냅니다. 내피 특정 미디어의 급속한 성장은 올바른 세포 형태를 나타낸다. 일차 세포 배양 확장을 중지 한 후, 여덟 통로 배양 할 수있다. 이것은 노화의 표시이며, 줄기 / 전구 세포가이 프로토 배양 것을 덜 가능성이 있습니다안부. 혈관 신생 분석에서, 대동맥, 대정맥과 대정 간이에서 CaPECs는 6 시간 내에 분기 보였다. 이 내피 기능은 자신의 기원에 대한 확실한 증거를 제공합니다. 가용성에 따라 전용 송곳니 물질이 연구 되었으나, 상기 분리 방법은 인간 차 내피 세포 또는 다른 생물체에서 내피 세포의 분리에 대한 응용 가능성을 갖는다. 이 기술은 매우 작은 혈관 (1cm 길이)에 대해도 가능하지만, 덜 분리 된 세포를 수득한다. 그들은 실험에 대한 충분한 수에 도달하기 전에 이러한 이유로 작은 혈관에서 얻은 CaPECs는 별도의 통로가 필요합니다. 작은 용기에 분리 방법을 수행하는 능력은 혈관 질환의 연구에 큰 이점이다. 되는 EC는 문맥 정맥 션트 같은 질병 또는 비정상적인 혈관으로부터 분리 될 수있다. 이들은 문맥 혈액이 간을 우회시킨다 전신 순환 연결 혈관이 </s&gt;입니다. 션트 자체가 1cm만큼 작을 수있다. 발병 기전은 아직 완전히 이해되지 않기 때문에 건강한 대정맥 정맥과 문맥에서 발생하는 세포 션트 용기에서되는 EC 비교하면 션트 개발에 대한 새로운 정보 관련 줄 수 있습니다. 또한, 새로운 혈관 신생 유전자 등의 siRNA 중재 유전자 침묵으로 유전 적 변형을 수행하여 기능 수준에 조사 할 수있다. 결론적으로,이 신규 한 분리 방법은 강력한 모델 (선천성) 심혈관 질환, 질병 모델링 및 (종양) 혈관 (15, 16)을 연구 할 수있다.

개는 심혈관 질환의 연구에 큰 동물 모델로서 사용하고 또한 선천적 (유전 적), 혈관 이상 (1, 2)으로 고생 할 수있다. 상업적 내피 세포주 종종 내피 세포 (EC)의 기능을 평가하기 위해 사용되는 이들 질병을 연구. 개를위한 개 대동맥에서 파생 된 (CnAOEC) 가능한 한 상업 내피 세포 라인이있다. 이 세포주는 주로 제어되는 EC 통상 3-5과 같은 연구에 사용된다. 인간 심장 연구에서 가장 일반적으로 사용되는 내피 세포주 각각 인간 제대 정맥 및 동맥 유래의 인간 제대 정맥 내피 세포 (HUVEC를) 및 인간 배꼽 동맥 내피 세포 (HUAECs)가있다. HUVECs를 1980 년대 6 이후 혈관 연구의 황금 표준으로 사용되어왔다. 그들은 내피 세포의 기능과 질병 적응을 연구하는 고전적인 모델 시스템으로 간주됩니다. 다른 혈관 내피 세포로부터 분리는 외관 창출 다양전자 및 미세 7 유전 적 배경과 노출로 인한 기능을 제공합니다. 또한, HUVECs를하고 HUAECs은 탯줄에서 조건에 대해 완벽하게 모방 성인 혈관 그들이에 질병에 대응하여 노출되지 않을 수 있습니다 발달 혈관 구조를 유도된다. 따라서, 일반적으로 심혈관 질환에 HUVECs를 발견 결과와 HUAECs을 번역하는 것은 부적절하다. 적응과 성인되는 EC의 행동을 연구 할 때, 관심있는 선박에서 주되는 ​​EC는보다 직접적인 방법으로 사용되어야한다. 이들 세포를 분리하기 위해 여러 가지 방법이보고되어있다. 또한 HUVECs를 위해 사용되는 광범위하게 설명 된 방법은, 효소 적 소화 용액 (8)과 용기를 세척한다. 이것은 종종 평활 근육 세포 및 섬유 아세포 9 비되는 EC의 오염을 초래한다. 분리를위한 또 다른 자주 사용되는 방법은 다음 fluorescence- 다진 혈관 조직의 소화 효소 인분화 (CD) (31) (7, 8). FACS 분류의 내피 세포 마커 클러스터 이후 세포 배양에 기초한 (FACS)를 정렬 활성화 전지 셀의 비교적 대용량을 필요로하며, 따라서 작은 혈관의 내피 세포의 분리에는 적합하지 않다. 우리는 따라서, 고순도의 각종 송곳니 혈관으로부터 순수한 내피 세포 집단을 분리하기위한 새로운 강력한 방법을 개발 목표로. 새로운 분리 방법의 효율성을 테스트하기 위해, 우리는 고립과 크고 작은 여러 개 동맥과 정맥에서 순수한 개 주 내피 세포 (CaPEC) 문화를 획득했습니다. 이 방법은 또한 선천적 인트라 또는 여분 간 문맥 정맥 션트, 개 2에서 일반적인 질환과 같은 질병 및 / 또는 비정상적인 혈관에서 발생하는 내피 세포의 배양을 할 수 있습니다. 용기의 대부분이 남아 INT 이후 방법은 혈관 평활근 세포와 같은 용기의 추가적인 중요한 세포 유형의 분리를 허용절차를 수행하는 동안 역할을합니다.

<table border="0" cellpadding="0" cellspacing="0" width="904">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Collagenase type II</td>
			<td style="width:164px;">Life Technologies</td>
			<td style="width:211px;">17101-015</td>
			<td style="width:201px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dispase</td>
			<td style="width:164px;">Life Technologies</td>
			<td style="width:211px;">17105-041</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">DMEM (1X) + GlutaMAX</td>
			<td style="width:164px;">Life Technologies</td>
			<td style="width:211px;">31966-021</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Hank&#39;s Balanced Salt Solution</td>
			<td style="width:164px;">Life Technologies</td>
			<td style="width:211px;">14025-050</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Canine Endothelial Cells Growth Medium&#160;</td>
			<td style="width:164px;">Cell Applications</td>
			<td style="width:211px;">Cn211-500</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">CnAOECs</td>
			<td style="width:164px;">Cell Applications</td>
			<td>Cn304-05</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Fetal Calf Serum (FCS)&#160;</td>
			<td style="width:164px;">GE Healthcare</td>
			<td style="width:211px;">16000-044</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TrypLE Express</td>
			<td style="width:164px;">Life Technologies</td>
			<td style="width:211px;">12604-013</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">SPR</td>
			<td style="width:164px;">Bio-Rad</td>
			<td>170-8898</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">iScript synthesis kit</td>
			<td style="width:164px;">Bio-Rad</td>
			<td style="width:211px;">170-8891</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">SYBR green super mix</td>
			<td style="width:164px;">Bio-Rad</td>
			<td style="width:211px;">170-8886</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Recovery Cell Freezing Medium</td>
			<td style="width:164px;">Gibco/Life Technologies</td>
			<td style="width:211px;">12648-010</td>
			<td>Keep on ice prior to use</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Freezing container, Nalgene Mr. Frosty</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:211px;">C1562</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Gelatin</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:211px;">G1890</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Surgical scissors (Mayo or Metzenbaum)</td>
			<td style="width:164px;">B. Braun Medical</td>
			<td style="width:211px;">BC555R</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Mosquito forceps&#160;</td>
			<td style="width:164px;">B. Braun Medical</td>
			<td style="width:211px;">FB440R</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Mosquito forceps curved</td>
			<td style="width:164px;">B. Braun Medical</td>
			<td style="width:211px;">FB441R</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">polyglactin 3-0</td>
			<td style="width:164px;">Ethicon</td>
			<td style="width:211px;">VCP311H</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Trypan blue</td>
			<td style="width:164px;">Bio-Rad</td>
			<td style="width:211px;">145-0013</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Automated counting chamber</td>
			<td style="width:164px;">Bio-Rad</td>
			<td style="width:211px;">145-0102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Counting Slides, Dual Chamber</td>
			<td style="width:164px;">Bio-Rad</td>
			<td style="width:211px;">145-0011</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Matrigel</td>
			<td style="width:164px;">BD Biosciences</td>
			<td style="width:211px;">BD356231</td>
			<td>Slowly thaw on ice</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">&#181;-Slide Angiogenesis</td>
			<td style="width:164px;">Ibidi</td>
			<td style="width:211px;">81501</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Endothelial Growth Medium</td>
			<td style="width:164px;">Lonza</td>
			<td style="width:211px;">CC-3156</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">EGM-2 SingleQuot Kit&#160;</td>
			<td style="width:164px;">Lonza</td>
			<td style="width:211px;">CC-4176</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation and culture of primary endothelial cells from canine arteries and veins

Cardiovascular disease is studied in both human and veterinary medicine. Endothelial cells have been used extensively as an in vitro model to study vasculogenesis, (tumor) angiogenesis, and atherosclerosis. The current standard for in vitro research on human endothelial cells (ECs) is the use of Human Umbilical Vein Endothelial Cells (HUVECs) and Human Umbilical Artery Endothelial Cells (HUAECs). For canine endothelial research, only one cell line (CnAOEC) is available, which is derived from canine aortic endothelium. Although currently not completely understood, there is a difference between ECs originating from either arteries or veins. For a more direct approach to in vitro functionality studies on ECs, we describe a new method for isolating Canine Primary Endothelial Cells (CaPECs) from a variety of vessels. This technique reduces the chance of contamination with fast-growing cells such as fibroblasts and smooth muscle cells, a problem that is common in standard isolation methods such as flushing the vessel with enzymatic solutions or mincing the vessel prior to digestion of the tissue containing all cells. The technique we describe was optimized for the canine model, but can easily be utilized in other species such as human.

다른 혈관 성공적 설명 분리 프로토콜 (도 2)을 행 하였다. 해부하고 건강한 개에서 대동맥, 대정맥, 대정 간이 및 관상 동맥 반전 할 수 있었다 (각 개 모든 혈관을, N = 4). 같은 접근되는 EC는이 선천성 문맥 정맥 션트 (간외 및 간내, N = 1 각)에서 분리 하였다으로. 대동맥 쉽게 반전되었지만 대동맥 세그먼트 복부 대동맥 이상 도전했다. 흉부 세그먼트에서 대동맥은 소화 솔루션 엄격하게 내피 노출을 보장하기 위해 개별적으로 결찰 할 필요가 그것에서 분기 많은 늑간 동맥을 가지고 있습니다. 꼬리 대정맥의 절개 부분을 반전 전에 게이션 될 필요가 신장 정맥의 분기점을 포함했다. 베나의 gastroduodenalis의 기여 분기 정맥 포털 들어 혈관 반전 전에 결찰시켰다. coronar우리가 곡절 분기의 세그먼트를 잘라내어되는 - (중형 개 2 mm 직경 약 1) 개에서 Y 동맥 훨씬 작은 혈관이다. 이 작은 직경을 가지고 있기 때문에, 모기 집게가 훨씬 더 삽입 할 수 없기 때문에 1cm의 비교적 짧은 세그먼트를 반전하기 쉬운 것을 알았다. 어느 날 후 격리 부착 된 세포는 배양 접시에서 볼 수 있었다. 문화, CaPECs은 다각형 형상을 가지고,도 3에 도시 된 바와 같이 패치에서 성장하는 경향을 표시 내피 세포의 다수의 콜로니를 관찰 (3) 수 -. 6일 차단 후. 문화에서 약 10 일 후에 80 %의 포화 상태에 도달하고, 세포를 능가 할 수있다. 어떤 시점에서 그들이 성장 정지 : 평균적으로 기본 내피 문화 (4 일의 분할 비율로 1 회) 8 통로의 최대 유지 될 수 있습니다. 솔qPCR에 (그림 4)로 나타낸 바와 같이 테드 내피 세포는 내피 세포 마커 CD31를 표명했다. 네 개에서 대동맥, 대정맥, 및 대정 간이에서 파생 된 내피 세포에서 발현 CnAOECs의 제어 문화를 비교 하였다. 배양 일차 전지는 제어되는 EC (채택 Kruskall-월리스, P = 0.856)와 비교 CD31 식을했다. 그림 5와 같이 대동맥, 대정맥과 대정 간이에서 파생 된 CaPECs는 혈관 신생 슬라이드에 6 시간 배양 후 분기 보였다. <img alt="그림 1" src="/files/ftp_upload/54786/54786fig1.jpg" /> 그림 1 : 해부 및 내피 세포 분리에 대한 혈관 반전. A) 관심 혈관 무균 신선한 송곳니 사체. B) 자기편 조직 및 / 또는 remov되어야 용기 주변 지방으로부터 제거에드는 조심스럽게 곡선 홀스 테드 모기 집게와 용기 자체 (5cm의 송곳니 대정맥, 복부 세그먼트). C)을 손상시키지 않고 수술 가위, 용기는 내피 층을 관통하지 않고 입력 할 수 있습니다. DG)이 다른에 집게를 고정 혈관의 일단 부드럽게하여 완전히 혈관 반전 후퇴. 내피 층 지갑 문자열 봉합사는 혈관 세척 한 50㎖ 튜브로 전송 반전 용기. I)의 비 - 내피 표면으로부터 폐쇄 단부에 배치 된) 용기. H의 외측 중이며 이후 소화. 스케일 바는 2cm를 나타냅니다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54786/54786fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/54786/54786fig2.jpg" /> <st룽&gt; 그림 2 : 다른 원산지의 반전 선박. A) 역 대동맥 세그먼트 (건강 개). B) 거꾸로 대정 간이 (건강 개). C) 거꾸로 대정맥 세그먼트 (건강 개). D) 역 관상 동맥 세그먼트 (건강 개). E) 역 . F)는 아이리시 울프 하운드 (나이에서 파생 거꾸로 간내 문맥 정맥 션트 : 8 주 이전) : 케른 테리어 (6 주 나이)에서 파생 된 간외 문맥 정맥 션트. 스케일 바는 2cm를 나타냅니다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54786/54786fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" src="/files/ftp_upload/54786/54786fig3.jpg" /> 그림 3 :.. 세포 형태학 사진은 2 주 선박의 소화 한 후 촬영 한 A)되는 EC 파생 FR통로 2. B에서 옴 개 대동맥)되는 EC 통로 2. C에서 개 대정맥에서 파생 된) 통로 2. 모든 사진에 개 대정 간이에서 파생되는 EC는 4 배 원래 배율로 촬영하고 있습니다. 스케일 바는 500 μm의를 나타냅니다. 삽입 10 배의 배율을 보여줍니다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54786/54786fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 4" src="/files/ftp_upload/54786/54786fig4.jpg" /> 그림 4 : CD31의 유전자 발현. 대동맥, 대정맥, 및 대정 간이 (N = 4 개)에서 파생 된 통로 1 내피 세포의 CD31의 발현. 유의 한 발현의 차이가 CaPECs과 CnAOECs 사이에 관찰되지 않았다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54786/54786fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <p유지-together.within 페이지 = &quot;1&quot;&gt; : FO 클래스 = &quot;jove_content&quot; <img alt="그림 5" src="/files/ftp_upload/54786/54786fig5.jpg" /> 그림 5 :. 혈관 신생 슬라이드 (20X 배율)에서 6 시간 배양 후 대동맥, 대정맥과 대정 간이에서 CnAOECs 및 CaPECs의 혈관 사진. 대동맥. C에서 파생 된 문화. A) CnAOECs. B) CaPECs) 대정맥. D에서 파생 된 CaPECs) CaPECs에 6 시간은 대정 간이에서 파생 된 후 지점 형성을 볼 수 있습니다. 모든 세포는 3 스케일 바 1mm를 나타내는 통로에 있었다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54786/54786fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> GOI </td><td> 방향 </td><td colspan="2"> 5&#39;- 서열-3 &#39; </강한&gt; </td><td> TM 어닐링 </td><td> 제품 크기 (BP) </td><td> 유전자 은행 번호 </td></tr><tr><td> CD31 </td><td> 앞으로 </td><td colspan="2"> GTTCTGCGTGTCAAGGTG </td><td> 59 ° C </td><td> (85) </td><td> XM_005624261.1 </td></tr><tr><td></td><td> 역 </td><td colspan="2"> TGTCCTTCCCAAACTCCA </td><td></td><td></td><td></td></tr><tr><td> 베타 - 액틴 </td><td> 앞으로 </td><td colspan="2"> GATATCGCTGCGCTTGTGGTC </td><td> 58 ° C </td><td> 384 </td><td> NM_001195845 </td></tr><tr><td></td><td> 역 </td><td colspan="2"> GGCTGGGGTGTTGAAAGTCTC </td><td></td><td></td><td></td></tr><tr><td> RPS19 </td><td> 앞으로 </td><td colspan="2"> CCTTCCTCAAAAAGTCTGGG </td><td> 63 ° C </td><td> (95) </td><td> XM_005616513 </td></tr><tr><td></td><td> 역 </td><td colspan="2"> GTTCTCATCGTAGGGAGCAAG </td><td></td><td></td><td></td></tr><tr><td> B2MG </td><td> 앞으로 </td><td colspan="2"> TCCTCATCCTCCTCGCT </td><td> 63 ° C </td><td> (85) </td><td> AB745507 </td></tr><tr><td></td><td> 역 </td><td colspan="2"> TTCTCTGCTGGGTGTCG </td><td></td><td></td><td></td></tr></tbody></table> 표 1 : qPCR에 프라이머를 설정합니다 qPCR에 프라이머를 개 기준 유전자와 CD31에 대한..

Watch this Scientific Journal Video about Isolation and Culture of Primary Endothelial Cells from Canine Arteries and Veins at JoVE.com

Isolation and Culture of Primary Endothelial Cells from Canine Arteries and Veins

Novel isolation methods of primary endothelial cells from blood vessels are needed. This protocol describes a new technique that completely inverts blood vessels of interest, exposing only the endothelial side to enzymatic digestion. The resulting pure endothelial cell culture can be used to study cardiovascular diseases, disease modelling, and angiogenesis.

개 동맥과 정맥에서 차 내피 세포의 분리 및 문화

Cardiovascular disease is studied in both human and veterinary medicine. Endothelial cells have been used extensively as an in vitro model to study ...

isolation-culture-primary-endothelial-cells-from-canine-arteries

Universidad San Sebastian

Research

JoVE Journal

Medicine

11.2K 조회수.  Utrecht University. Novel isolation methods of primary endothelial cells from blood vessels are needed. This protocol describes a new technique that completely inverts blood vessels of interest, exposing only the endothelial side to enzymatic digestion. The resulting pure endothelial cell culture can be used to study cardiovascular diseases, disease modelling, and angiogenesis.

비디오: Isolation and Culture of Primary Endothelial Cells from Canine Arteries and Veins

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human pulp-derived stem cells (hDPSCs) possess high proliferation potential with multi-lineage differentiation capacity compare to the ordinary source of adult stem cells1-8; therefore, hDPSCs could be the good candidates for autologous transplantation in tissue engineering and regenerative medicine. Along with these benefits, possessing the mesenchymal stem cells (MSC) features, such as immunolodulatory effect, make hDPSCs more valuable, even in the case of allograft transplantation6,9,10. Therefore, the primary step for using this source of stem cells is to select the best protocol for isolating hDPSCs from pulp tissue. In order to achieve this goal, it is crucial to investigate the effect of various isolation conditions on different cellular behaviors, such as their common surface markers &amp; also their differentiation capacity.
Thus, here we separate human pulp tissue from impacted third molar teeth, and then used both existing protocols based on literature, for isolating hDPSCs,11-13 i.e. enzymatic dissociation of pulp tissue (DPSC-ED) or outgrowth from tissue explants (DPSC-OG). In this regards, we tried to facilitate the isolation methods by using dental diamond disk. Then, these cells characterized in terms of stromal-associated Markers (CD73, CD90, CD105 &amp; CD44), hematopoietic/endothelial Markers (CD34, CD45 &amp; CD11b), perivascular marker, like CD146 and also STRO-1. Afterwards, these two protocols were compared based on the differentiation potency into odontoblasts by both quantitative polymerase chain reaction (QPCR) &amp; Alizarin Red Staining. QPCR were used for the assessment of the expression of the mineralization-related genes (alkaline phosphatase; ALP, matrix extracellular phosphoglycoprotein; MEPE &amp; dentin sialophosphoprotein; DSPP).14

The method described isolation and characterization of human Dental Pulp Stem Cells (hDPSCs) by using either enzymatic dissociation of pulp (DPSC-ED) or direct outgrowth of stem cells from pulp tissue explants (DPSC-OG). Then followed by in vitro comparative differentiation of both types of hDPSCs into odontoblasts.

인간 치과 펄프의 줄기 세포의 분리, 특성화 및 비교 차별화 두 가지 방법을 사용하여 영구 치아에서 파생

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

연구

의학

Patient Derived Cell Culture and Isolation of CD133+ Putative Cancer Stem Cells from Melanoma

Despite improved treatments options for melanoma available today, patients with advanced malignant melanoma still have a poor prognosis for progression-free and overall survival. Therefore, translational research needs to provide further molecular evidence to improve targeted therapies for malignant melanomas. In the past, oncogenic mechanisms related to melanoma were extensively studied in established cell lines. On the way to more personalized treatment regimens based on individual genetic profiles, we propose to use patient-derived cell lines instead of generic cell lines. Together with high quality clinical data, especially on patient follow-up, these cells will be instrumental to better understand the molecular mechanisms behind melanoma progression.
Here, we report the establishment of primary melanoma cultures from dissected fresh tumor tissue. This procedure includes mincing and dissociation of the tissue into single cells, removal of contaminations with erythrocytes and fibroblasts as well as primary culture and reliable verification of the cells' melanoma origin.
Recent reports revealed that melanomas, like the majority of tumors, harbor a small subpopulation of cancer stem cells (CSCs), which seem to exclusively fuel tumor initiation and progression towards the metastatic state. One of the key markers for CSC identification and isolation in melanoma is CD133. To isolate CD133+ CSCs from primary melanoma cultures, we have modified and optimized the Magnetic-Activated Cell Sorting (MACS) procedure from Miltenyi resulting in high sorting purity and viability of CD133+ CSCs and CD133- bulk, which can be cultivated and functionally analyzed thereafter.

Patient Derived Cell Culture and Isolation of CD133+ Putative Cancer Stem Cells from Melanoma

This article describes the preparation of freshly obtained melanoma tissue into primary cell cultures, and how to remove contaminations of erythrocytes and fibroblasts from the tumor cells. Finally, we describe how CD133+ putative melanoma stem cells are sorted from the CD133- bulk using Magnetic Activated Cell Sorting (MACS).

환자 유래 세포 배양 및 CD133의 절연<sup&gt; +</sup흑종에서&gt; Putative 암 줄기 세포

Despite improved treatments options for melanoma available today, patients with advanced malignant melanoma still have a poor prognosis for ...

Primary Culture of Human Vestibular Schwannomas

Vestibular schwannomas (VSs) represent Schwann cell (SC) tumors of the vestibular nerve, compromising 10% of all intracranial neoplasms. VSs occur in either sporadic or familial (neurofibromatosis type 2, NF2) forms, both associated with inactivating defects in the NF2 tumor suppressor gene. Treatment for VSs is generally surgical resection or radiosurgery, however the morbidity of such procedures has driven investigations into less invasive treatments. Historically, lack of access to fresh tissue specimens and the fact that schwannoma cells are not immortalized have significantly hampered the use of primary cultures for investigation of schwannoma tumorigenesis. To overcome the limited supply of primary cultures, the immortalized HEI193 VS cell line was generated by transduction with HPV E6 and E7 oncogenes. This oncogenic transduction introduced significant molecular and phenotypic alterations to the cells, which limit their use as a model for human schwannoma tumors. We therefore illustrate a simplified, reproducible protocol for culture of primary human VS cells. This easily mastered technique allows for molecular and cellular investigations that more accurately recapitulate the complexity of VS disease.

Vestibular Schwannomas (VSs) are non-malignant tumors of Schwann cell (SC) origin, associated with mutations in the NF2 tumor suppressor gene. We report a reproducible, efficient protocol for primary human VS cell culture that allows for molecular and cellular experimental manipulation and analysis and recapitulates the heterogeneous nature of human disease.

인간의 전정 신경초종의 차 문화

Vestibular schwannomas (VSs) represent Schwann cell (SC) tumors of the vestibular nerve, compromising 10% of all intracranial neoplasms. VSs occur in ...

Method for Obtaining Primary Ovarian Cancer Cells From Solid Specimens

Reliable tools for investigating ovarian cancer initiation and progression are urgently needed. While the use of ovarian cancer cell lines remains a valuable tool for understanding ovarian cancer, their use has many limitations. These include the lack of heterogeneity and the plethora of genetic alterations associated with extended in vitro passaging.&#160;Here we describe a method that allows for rapid establishment of primary ovarian cancer cells form solid clinical specimens collected at the time of surgery. The method consists of subjecting clinical specimens to enzymatic digestion for 30 min. The isolated cell suspension is allowed to grow and can be used for downstream application including drug screening. The advantage of primary ovarian cancer cell lines over established ovarian cancer cell lines is that they are representative of the original specific clinical specimens they are derived from and can be derived from different sites whether primary or metastatic ovarian cancer.

This study describes a detailed method for isolation and characterization of primary ovarian cancer cells from solid clinical specimens. Ovarian cancer clinical specimens are subjected to enzymatic digestion to obtain viable, fibroblast-free epithelial ovarian cancer (EOC) cells highly suitable for downstream applications.

고체 시편에서 기본 난소 암 세포를 얻는 방법

Reliable tools for investigating ovarian cancer initiation and progression are urgently needed. While the use of ovarian cancer cell lines remains a ...

Isolation, Cryopreservation and Culture of Human Amnion Epithelial Cells for Clinical Applications

Human amnion epithelial cells (hAECs) derived from term or pre-term amnion membranes have attracted attention from researchers and clinicians as a potential source of cells for regenerative medicine. The reason for this interest is evidence that these cells have highly multipotent differentiation ability, low immunogenicity, and anti-inflammatory functions. These properties have prompted researchers to investigate the potential of hAECs to be used to treat a variety of diseases and disorders in pre-clinical animal studies with much success.
hAECs have found widespread application for the treatment of a range of diseases and disorders. Potential clinical applications of hAECs include the treatment of stroke, multiple sclerosis, liver disease, diabetes and chronic and acute lung diseases. Progressing from pre-clinical animal studies into clinical trials requires a higher standard of quality control and safety for cell therapy products. For safety and quality control considerations, it is preferred that cell isolation protocols use animal product-free reagents. 
We have developed protocols to allow researchers to isolate, cryopreserve and culture hAECs using animal product-free reagents. The advantage of this method is that these cells can be isolated, characterized, cryopreserved and cultured without the risk of delivering potentially harmful animal pathogens to humans, while maintaining suitable cell yields, viabilities and growth potential. For researchers moving from pre-clinical animal studies to clinical trials, these methodologies will greatly accelerate regulatory approval, decrease risks and improve the quality of their therapeutic cell population.

We describe a protocol to isolate and culture human amnion epithelial cells (hAECs) using animal product-free reagents in accordance with current good manufacturing practices (cGMP) guidelines.

분리, 냉동 보존 및 문화 임상 응용 프로그램에 대한 인간 양막 상피 세포

Human amnion epithelial cells (hAECs) derived from term or pre-term amnion membranes have attracted attention from researchers and clinicians as a ...

Isolation of Human Lymphatic Endothelial Cells by Multi-parameter Fluorescence-activated Cell Sorting

Lymphatic system disorders such as primary lymphedema, lymphatic malformations and lymphatic tumors are rare conditions that cause significant morbidity but little is known about their biology. Isolating highly pure human lymphatic endothelial cells (LECs) from diseased and healthy tissue would facilitate studies of the lymphatic endothelium at genetic, molecular and cellular levels. It is anticipated that these investigations may reveal targets for new therapies that may change the clinical management of these conditions. A protocol describing the isolation of human foreskin LECs and lymphatic malformation lymphatic endothelial cells (LM LECs) is presented. To obtain a single cell suspension tissue was minced and enzymatically treated using dispase II and collagenase II. The resulting single cell suspension was then labelled with antibodies to cluster of differentiation (CD) markers CD34, CD31, Vascular Endothelial Growth Factor-3 (VEGFR-3) and PODOPLANIN. Stained viable cells were sorted on a fluorescently activated cell sorter (FACS) to separate the CD34LowCD31PosVEGFR-3PosPODOPLANINPos LM LEC population from other endothelial and non-endothelial cells. The sorted LM LECs were cultured and expanded on fibronectin-coated flasks for further experimental use.

The goal of this protocol is to isolate lymphatic endothelial cells lining human lymphatic malformation cyst-like vessels and foreskins using fluorescence-activated cell sorting (FACS). Subsequent cell culturing and expansion of these cells permits a new level of experimental sophistication for genetic, proteomic, functional and cell differentiation studies.

다중 매개 변수 형광 활성화 된 셀 정렬하여 인간의 림프 내피 세포의 분리

Lymphatic system disorders such as primary lymphedema, lymphatic malformations and lymphatic tumors are rare conditions that cause significant morbidity ...

Isolation and Propagation of Circulating Tumor Cells from a Mouse Cancer Model

Cancer metastasis is the foremost cause of cancer-associated deaths. Recent studies have shown that circulating tumor cells (CTCs) are important in cancer metastasis. Indeed, the number of CTCs correlates with tumor size. Here, a detailed description is provided of a methodology for isolation and propagation of CTCs from a syngeneic mouse model of hepatocellular carcinoma (HCC) which allows for downstream analysis of potentially important molecular mechanisms of solid organ tumor metastasis. This method is efficient and reproducible. It is a non-invasive technique and, therefore, has potential to replace the invasive biopsy of tissues from humans which may be associated with complications. Therefore, the method discussed here allows for the isolation and propagation of CTCs from whole blood samples such that they can be examined and characterized. This has potential for future adaptation for clinical applications such as diagnosis, and personalized targeted therapy.

Circulating tumor cells (CTCs) have been shown to play an important role in tumor metastasis. Here, a method for the isolation and propagation of CTCs from the whole blood of a syngeneic mouse tumor model of hepatocellular carcinoma (HCC) metastasis is described.

마우스 종양 모델에서 종양 세포 순환의 분리 및 전파

Cancer metastasis is the foremost cause of cancer-associated deaths. Recent studies have shown that circulating tumor cells (CTCs) are important in cancer ...

Isolation and Culture Expansion of Tumor-specific Endothelial Cells

Freshly isolated tumor-specific endothelial cells (TEC) can be used to explore molecular mechanisms of tumor angiogenesis and serve as an in vitro model for developing new angiogenesis inhibitors for cancer. However, long-term in vitro expansion of murine endothelial cells (EC) is challenging due to phenotypic drift in culture (endothelial-to-mesenchymal transition) and contamination with non-EC. This is especially true for TEC which are readily outcompeted by co-purified fibroblasts or tumor cells in culture. Here, a high fidelity isolation method that takes advantage of immunomagnetic enrichment coupled with colony selection and in vitro expansion is described. This approach generates pure EC fractions that are entirely free of contaminating stromal or tumor cells. It is also shown that lineage-traced Cdh5cre:ZsGreenl/s/l reporter mice, used with the protocol described herein, are a valuable tool to verify cell purity as the isolated EC colonies from these mice show durable and brilliant ZsGreen fluorescence in culture.

We report a reliable method to isolate and culture primary tumor-specific endothelial cells from genetically engineered mouse models.

종양 특이 내피 세포의 분리 및 문화 확장

Freshly isolated tumor-specific endothelial cells (TEC) can be used to explore molecular mechanisms of tumor angiogenesis and serve as an in vitro model ...

Isolation of Endothelial Progenitor Cells from Healthy Volunteers and Their Migratory Potential Influenced by Serum Samples After Cardiac Surgery

Endothelial progenitor cells (EPCs) are recruited from the bone marrow under pathological conditions like hypoxia and are crucially involved in the neovascularization of ischemic tissues. The origin, classification and characterization of EPCs are complex; notwithstanding, two prominent sub-types of EPCs have been established: so-called &#34;early&#34; EPCs (subsequently referred to as early-EPCs) and late-outgrowth EPCs (late-EPCs). They can be classified by biological properties as well as by their appearance during in vitro culture. While &#34;early&#34; EPCs appear in less than a week after culture of peripheral blood-derived mononuclear cells in EC-specific media, late-outgrowth EPCs can be found after 2-3 weeks. Late-outgrowth EPCs have been recognized to be directly involved in neovascularization, mainly through their ability to differentiate into mature endothelial cells, whereas &#34;early&#34; EPCs express various angiogenic factors as endogenous cargo to promote angiogenesis in a paracrine manner. During myocardial ischemia/reperfusion (I/R), various factors control the homing of EPCs to regions of blood vessel formation.
Macrophage migration inhibitory factor (MIF) is a chemokine-like pro-inflammatory and ubiquitously expressed cytokine and was recently described to function as key regulator of EPCs migration at physiological concentrations1. Interestingly, MIF is stored in intracellular pools and can rapidly be released into the blood stream after several stimuli (e.g. myocardial infarction). 
This protocol describes a method for the reliable isolation and culture of early-EPCs from adult human peripheral blood based on CD34-positive selection with subsequent culture in medium containing endothelial growth factors on fibronectin-coated plates for use in in vitro migration assays against serum samples of cardiac surgical patients. Furthermore, the migratory influence of MIF on chemotaxis of EPCs compared to other well-known angiogenesis-stimulating cytokines is demonstrated.

Endothelial progenitor cells (EPCs) are crucially involved in the neovascularization of ischemic tissues. This method describes the isolation of human EPCs from peripheral blood, as well as the identification of their migratory potential against serum samples of cardiac surgical patients.

심장 수술 후 혈청 샘플의 영향을 건강한 자원 봉사자와 그들의 철새 잠재력에서 내피 전구 세포의 분리

Endothelial progenitor cells (EPCs) are recruited from the bone marrow under pathological conditions like hypoxia and are crucially involved in the ...

A Cell Culture Model of Resistance Arteries

The myoendothelial junction (MEJ), a unique signaling microdomain in small diameter resistance arteries, exhibits localization of specific proteins and signaling processes that can control vascular tone and blood pressure. As it is a projection from either the endothelial or smooth muscle cell, and due to its small size (on average, an area of ~1 &#181;m2), the MEJ is difficult to study in isolation. However, we have developed a cell culture model called the vascular cell co-culture (VCCC) that allows for in vitro MEJ formation, endothelial cell polarization, and dissection of signaling proteins and processes in the vascular wall of resistance arteries. The VCCC has a multitude of applications and can be adapted to suit different cell types. The model consists of two cell types grown on opposite sides of a filter with 0.4 &#181;m pores in which the in vitro MEJs can form. Here we describe how to create the VCCC via plating of cells and isolation of endothelial, MEJ, and smooth muscle fractions, which can then be used for protein isolation or activity assays. The filter with intact cell layers can be fixed, embedded, and sectioned for immunofluorescent analysis. Importantly, many of the discoveries from this model have been confirmed using intact resistance arteries, underscoring its physiological relevance.

A cell culture model of resistance arteries is described, allowing for the dissection of signaling pathways in endothelium, smooth muscle, or between endothelium and smooth muscle (the myoendothelial junction). The selective application of agonists or protein isolation, electron microscopy, or immunofluorescence can be utilized using this cell culture model.

저항 동맥의 세포 문화 모델

The myoendothelial junction (MEJ), a unique signaling microdomain in small diameter resistance arteries, exhibits localization of specific proteins and ...