이 작품 혁신 존 R. 에반스 지도자 기금 (35017), 캠퍼스 앨버타 혁신 프로그램 및 앨버타 정부는 자연과학 및 공학 연구 위원회의 캐나다 발견 그랜트 (RGPIN-2017-05463), 캐나다 기초에 의해 투자 되었다 경제 개발 및 무역입니다.

참고: RNA는 ribonucleases (RNases)에 의해 저하에 매우 취약. RNA를 그대로 유지 하는 표준 예방 조치. 글러브를 자주 변경 합니다. 프로토콜의 모든 단계에서 필터링 된 피 펫 팁, nuclease 무료 plasticware 및 nuclease 없는 화학 물질을 사용 합니다. Nuclease 무료 사용 또는 diethyl pyrocarbonate (DEPC)-모든 솔루션에 대 한 물 처리.
1입니다. 솔루션의 준비
<ol><li>Toeprinting 버퍼 준비: 20 mM Tris HCl (pH 7.6), 100 mM KOAc, 2.5 m m Mg(OAc)2, 5% (w/v) 자당, 2 m m dithiothreitol (DTT), 그리고 0.5 m m spermidine.<ol>
<li>DTT와 spermidine 반복된 freeze-thaw 주기를 피하기 위해-20 ° C에서 단일 사용 aliquots에 저장. 참고: DTT와 spermidine는 사용 하기 바로 전에 toeprinting 버퍼에 추가 되어야 합니다. DTT와 spermidine 솔루션-20 ° c.에 저장 될 수 있다</li>
	</ol>
</li>
	<li>85 m m 5'-guanylyl imidodiphosphate (GMP PNP)와 91 m m 아데노신 3 인산 염 (ATP)의 aliquots를 준비 합니다. -20 ° c.에 aliquots 저장</li>
	<li>450 mL 6 %polyacrylamide-7 M 요소 젤 믹스의 준비: 40 %acrylamide:bis 67.5 mL-아크릴 (19:1), 요소, TBE (트리 스/borate/thylenediaminetetraacetic 산 (EDTA)), x 5의 112.5 mL 및 물 120 mL의 189 g. 37 ° C 물 목욕 또는 감동과 뜨거운 접시에 온난 하 여는 요소를 분해. 필터링 솔루션 (예., 0.2 μ m 니트로 진공 필터). 참고: 솔루션 저장할 수 있습니다 4 ° C에서 한 달 이상. 주의: 아크릴 단위체는 피부를 통해 흡수 될 수 있는 neurotoxin입니다. 피부 접촉을 피하기 위해 상당한 주의 (즉., 장갑, 실험실 외 투를 착용 하 고 눈 보호). 으로 중 합을 100% 완료 진행 하지 않을 수 있습니다 polyacrylamide 또한 주의 처리 되어야 합니다.</li>
	<li>Formamide 로드 염료 준비: 95 %formamide, 18 mM EDTA, 0.025% (w/v) 나트륨 라우릴 황산 염 (SDS), 0.025% (w/v) bromophenol 블루, 0.025% (w/v) 자일 렌 cyanol. -20 ° c.에 게</li>
	<li>10 pmol/μ의 작업 집중에 대 한 물 100 μ로 1 nmol 뇌관 (5' CTCGATATGTGCATCTGTA; 5' 끝-IRDye 800으로 표시)의 분해. 빛에서 보호 하에 단일 사용 aliquots (약 10 µ L),-20 ° C에서 저장 합니다.</li>
</ol>2입니다. mRNA의 준비
<ol><li>적절 한 서식 파일에서 중 합 효소 연쇄 반응 (PCR)에 의해 mRNA의 합성에 대 한 서식 파일 DNA 증폭 (즉., 게놈 DNA 또는 플라스 미드 DNA, 적절 한). 높은 충실도 제조업체의 지침에 따라 DNA 중 합 효소를 사용 하 여 다음 반응 조건 (35 주기): 녹기, 98 ° C, 10 s; anneal, 53 ° C, 20 s; 확장, 72 ° C, 30 s. 참고: 앞으로 뇌관 (5' AAGCTTAATACGACTCACTATAG) 통합 RNA 녹음 방송; 있도록 T7 발기인 순서 반전 뇌관 (5' T51GAATTCGGATCCGACCGTGG) 51 thymine 잔류물 베낀된 RNA에 대 한 폴 리 A 꼬리를 제공 하기 위해 포함 되어 있습니다. Note RNA에 생체 외에서 플라스 미드 DNA에서에서 복사할 수도 있습니다.</li>
	<li>체 외에 적절 한 전송 키트를 사용 하 여 IRES 포함 된 RNA 또는 DNA 템플렛에서 출장된 RNA를 고쳐 쓰다 제조업체의 지침을 따릅니다. 표준 20 μ 반응 볼륨에서 RNA 샘플을 준비 합니다. 37 ° c.에 30 분 동안 RNase 무료 DNase의 2 대와 새로 합성 RNA를 취급</li>
	<li>110 DNase 취급 RNA 희석 nuclease 무료 물 µ L 110 µ L 산 페 놀, 소용돌이 5 s와 3 분 동안 원심 분리기 실 온에서 20000 x g에 추가. 새로운 1.5 mL microfuge 관에 수성 단계의 100 µ L를 제거 3m 나트륨 아세테이트, 및 소용돌이 2 미 추가, 100% 에탄올, 소용돌이 5 s의 3 볼륨 10 µ L을 추가 하 고 하룻밤-20 ° C에서 RNA 침전.</li>
	<li>원심 > 삭제는 상쾌한 4 ° C에서 30 분 동안 20000 x g. 얼음 처럼 차가운 70% (v/v) 에탄올의 500 µ L와 펠 릿을 세척 하 고는 원심 분리를 반복. 많은 가능한 상쾌한으로 발음 하 고 5-10 분에는 펠 릿을 꺼내 려 하지 않도록 주의 대 한 펠 릿을 건조.</li>
	<li>Nuclease 무료 물 0.5 μ g/μ의 작업 농도를 적절 한 볼륨에는 RNA를 resuspend. 이-80 ° C에 저장 하거나 즉시 사용 될 수 있습니다.</li>
</ol>3. Toeprinting 반응
<ol><li>토끼 1 μ (40 대) RNase 억제제, 1 µ L 91 mM ATP의 (최종 1.82 m m) 및 1.5 mL microfuge 관 85 mM GMP PNP (최종 1.7 m m)의 1 μ의 Reticulocyte Lysate (RRL, nuclease 치료 하지 않을)의 혼합 15 μ. 5 분 30 ° C에서 품 어. 참고:는 RRL 반복적인 동결 해빙을 피하기 위해 단일 사용에 대 한 aliquoted 이어야 한다. 중요 한 제어 RRL, 반전 녹음 방송 RNA의 이차 구조 때문의 자연 일시 중지를 명료 하 게 하기 위해 부족 한 반응입니다. Toeprinting 버퍼 RRL이이 컨트롤에 대 한 대체를 추가 합니다.</li>
	<li>RNA의 0.5 µ g (1 µ L)를 추가 하 고 5 분 30 ° C에서 품 어.</li>
	<li>Toeprinting 버퍼의 22 µ L을 추가 하 고 3 분 동안 30 ° C에서 품 어.</li>
	<li>IRDye 표시 된 뇌관의 0.5 µ L (5 pmol)를 추가 하 고 10 분 동안 얼음에 품 어.</li>
	<li>2 µ L 25 mM dNTPs의 추가 (최종 농도: 1 m m), 2 µ L 100 mM Mg(OAc)2, 1 µ L의 조류 Myeloblastosis 바이러스 역전사 (AMV-RT)과 Toeprinting 버퍼의 3.5 µ L의. 마지막 볼륨은 50 μ.</li>
	<li>45 분 30 ° C에서 반응을 품 어.</li>
	<li>Nuclease 무료 물 200 µ L을 추가 하 고 즉시 25:24:1 페 놀: 클로 프롬: isoamyl 알콜 (pH 약 8.0)의 250 µ L를 추출. 소용돌이 5 s 하 고 실 온에서 3 분 20000 x g에서 원심 분리기. 새로운 1.5 mL microfuge 관에 수성 단계 제거 100% 에탄올, 소용돌이 5 s의 3 볼륨을 추가 하 고 하룻밤-20 ° C에서 침전.</li>
	<li>원심 > 삭제는 상쾌한 4 ° C에서 30 분 동안 20000 x g. 얼음 처럼 차가운 70% (v/v) 에탄올의 500 µ L로 DNA 펠 릿을 세척. 원심 > 20000 x g 4 ° c.에서 15 분 Aspirate 가능한 및 5-10 분에 대 한 펠 릿은 펠 릿을 꺼내 려 하지 않도록 주의 해야 건조 공기 만큼 표면에 뜨는.</li>
	<li>Nuclease 무료 물 6 μ에 펠 릿을 녹이 고 염료를 로드 하는 formamide의 3 μ를 추가.</li>
</ol>4. 연속 반응
<ol><li>2.1에서 DNA 템플렛 및 3.4 단계에서 IRDye 라는 뇌관을 사용 하 여 체인 출현으로 dideoxynucleotides (ddNTPs)를 사용 하 여 표준 연속 반응에 대 한. 적절 한 DNA 시퀀싱 장비를 사용 하 고 제조업체의 지침을 따르십시오.</li>
	<li>Formamide 로드 하는 염료의 3 μ와 각 연속 반응의 믹스 6 μ</li>
</ol>5입니다. 시퀀싱 하는 젤 전기 이동 법의 준비
참고:이 프로토콜 사용 하 여 형광 젤 기반 영상 고는 21 cm x 23cm x 0.2 m m 젤 하지만 필요한 경우 다른 시퀀서 또는 젤-크기, 적응 시킬 수 있다.
<ol><li>0.2 m m 간격으로 짧은 (23 × 25 cm) 및 긴 100% 에탄올 (30 × 25 cm) 유리 접시를 철저 하 게 청소. 건조 공기.</li>
	<li>6 %polyacrylamide-7 M 우 레 아 젤의 믹스 30 mL 200 μ 10% (w/v) 암모늄 persulfate (AP)의 혼합 및 tetramethylethylenediamine (TEMED)의 20 μ. 젤, 거품을 피하기 위해 돌을 부 어 하 고 ' 상어 이빨 ' 젤 빗을 삽입 합니다. 실 온에서 1 h에 대 한 유해를 젤을 수 있습니다.</li>
	<li>시퀀싱 기구를 조립 하 고 1 저수지를 채울 x TBE.</li>
	<li>사전 실행 15 분 1500 V에서 55 ° C의 최적의 온도 달성 될 때까지.</li>
	<li>샘플/로드 염료 혼합 (3.9 또는 4.2 단계)에서 85 ° C 5 분 부하 1 μ 시퀀싱 젤에 대 한 열.</li>
	<li>1500 V 8 h에 젤을 실행 합니다. 기계는 실시간으로 밴드를 읽을 것 이다.</li>
	<li>분해 장치, 그리고 아크릴 아 미드 젤 실행 버퍼를 처분.</li>
</ol>

<ol>
	<li>Holcik, M., Sonenberg, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+control+in+stress+and+apoptosis.">Translational control in stress and apoptosis.</a> Nat Rev Mol Cell Biol. 6 (4), 318-327 (2005).</li><li>Lacerda, R., Menezes, J., Romao, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=More+than+just+scanning:+the+importance+of+cap-independent+mRNA+translation+initiation+for+cellular+stress+response+and+cancer.">More than just scanning: the importance of cap-independent mRNA translation initiation for cellular stress response and cancer.</a> Cell Mol Life Sci. 74 (9), 1659-1680 (2017).</li><li>Sharma, D. K., Bressler, K., Patel, H., Balasingam, N., Thakor, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+Eukaryotic+Initiation+Factors+during+Cellular+Stress+and+Cancer+Progression.">Role of Eukaryotic Initiation Factors during Cellular Stress and Cancer Progression.</a> J Nucleic Acids. 2016, 8235121 (2016).</li><li>Gebauer, F., Hentze, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanisms+of+translational+control.">Molecular mechanisms of translational control.</a> Nat Rev Mol Cell Biol. 5 (10), 827-835 (2004).</li><li>Anthony, D. D., Merrick, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+40+S+and+80+S+complexes+with+mRNA+as+measured+by+sucrose+density+gradients+and+primer+extension+inhibition.">Analysis of 40 S and 80 S complexes with mRNA as measured by sucrose density gradients and primer extension inhibition.</a> J Biol Chem. 267 (3), 1554-1562 (1992).</li><li>Hartz, D., McPheeters, D. S., Traut, R., Gold, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extension+inhibition+analysis+of+translation+initiation+complexes.">Extension inhibition analysis of translation initiation complexes.</a> Methods Enzymol. 164, 419-425 (1988).</li><li>Shirokikh, N. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+ribosome-mRNA+complexes+at+different+translation+stages.">Quantitative analysis of ribosome-mRNA complexes at different translation stages.</a> Nucleic Acids Res. 38 (3), 15 (2010).</li><li>Thakor, N., Holcik, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRES-mediated+translation+of+cellular+messenger+RNA+operates+in+eIF2alpha-+independent+manner+during+stress.">IRES-mediated translation of cellular messenger RNA operates in eIF2alpha- independent manner during stress.</a> Nucleic Acids Res. 40 (2), 541-552 (2012).</li><li>Liwak, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+suppressor+PDCD4+represses+internal+ribosome+entry+site-mediated+translation+of+antiapoptotic+proteins+and+is+regulated+by+S6+kinase+2.">Tumor suppressor PDCD4 represses internal ribosome entry site-mediated translation of antiapoptotic proteins and is regulated by S6 kinase 2.</a> Mol Cell Biol. 32 (10), 1818-1829 (2012).</li><li>Thakor, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+mRNA+recruits+the+ribosome+via+eIF3-PABP+bridge+to+initiate+internal+translation.">Cellular mRNA recruits the ribosome via eIF3-PABP bridge to initiate internal translation.</a> RNA Biol. , 1-15 (2016).</li><li>Thoma, C., Bergamini, G., Galy, B., Hundsdoerfer, P., Hentze, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancement+of+IRES-mediated+translation+of+the+c-myc+and+BiP+mRNAs+by+the+poly(A)+tail+is+independent+of+intact+eIF4G+and+PABP.">Enhancement of IRES-mediated translation of the c-myc and BiP mRNAs by the poly(A) tail is independent of intact eIF4G and PABP.</a> Mol Cell. 15 (6), 925-935 (2004).</li><li>Baird, S. D., Lewis, S. M., Turcotte, M., Holcik, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+search+for+structurally+similar+cellular+internal+ribosome+entry+sites.">A search for structurally similar cellular internal ribosome entry sites.</a> Nucleic Acids Res. 35 (14), 4664-4677 (2007).</li><li>Merrick, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+that+a+single+GTP+is+used+in+the+formation+of+80+S+initiation+complexes.">Evidence that a single GTP is used in the formation of 80 S initiation complexes.</a> J Biol Chem. 254 (10), 3708-3711 (1979).</li><li>Arnaud, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+New+34-Kilodalton+Isoform+of+Human+Fibroblast+Growth+Factor+2+Is+Cap+Dependently+Synthesized+by+Using+a+Non-AUG+Start+Codon+and+Behaves+as+a+Survival+Factor.">A New 34-Kilodalton Isoform of Human Fibroblast Growth Factor 2 Is Cap Dependently Synthesized by Using a Non-AUG Start Codon and Behaves as a Survival Factor.</a> Mol Cell Biol. 19 (1), 505-514 (1999).</li><li>Dmitriev, S. E., Pisarev, A. V., Rubtsova, M. P., Dunaevsky, Y. E., Shatsky, I. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conversion+of+48S+translation+preinitiation+complexes+into+80S+initiation+complexes+as+revealed+by+toeprinting.">Conversion of 48S translation preinitiation complexes into 80S initiation complexes as revealed by toeprinting.</a> FEBS Lett. 533 (1-3), 99-104 (2003).</li><li>Faye, M. D., Graber, T. E., Holcik, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessment+of+selective+mRNA+translation+in+mammalian+cells+by+polysome+profiling.">Assessment of selective mRNA translation in mammalian cells by polysome profiling.</a> J Vis Exp. (92), e52295 (2014).</li><li>Duncan, C. D. S., Mata, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+cycloheximide+on+the+interpretation+of+ribosome+profiling+experiments+in+Schizosaccharomyces+pombe.">Effects of cycloheximide on the interpretation of ribosome profiling experiments in Schizosaccharomyces pombe.</a> Sci Rep. 7 (1), 10331 (2017).</li><li>Beck, H. J., Janssen, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+Translation+Initiation+Regulation+Mechanism+in+Escherichia+coli+ptrB+Mediated+by+a+5'-Terminal+AUG.">Novel Translation Initiation Regulation Mechanism in Escherichia coli ptrB Mediated by a 5'-Terminal AUG.</a> J Bacteriol. 199 (14), (2017).</li></ol>

저자 관심을가지고 아무 충돌-의-공개.

Toeprinting 직접 고도로 제어 된 상황에서 번역 개시 복합물의 대형을 지원 하기 위해의 RNA의 능력을 측정 하는 강력한 기술입니다. Toeprinting에 대 한 단순화 된이 프로토콜 설명 포유류 RNAs. 토끼 reticulocyte lysate (RRL) 리보솜, eIFs, 초기자의 편리한 원본으로 사용 되, tRNA와 IRES 트랜스-행동 요인 (ITAFs). 실험 선택의 그들의 RNA를 제공 하 고 또한 그들의 선택의 특정 공동 인자와 toeprinting 반응을 보충할 수 있다. 예를 들어, 번역 개시 단지 대 80 48S toeprints7의 형광 농도의 분포에 따라 분화 될 수 있습니다. 관찰 개시 복잡 한 사용 하는 구 아닌 뉴클레오티드의 종류에 따라 달라 집니다. 여기 논의 XIAP IRES 경우 GMP PNP 플러스 ATP 안정화 48S 전 개시 복합물, toeprint 메일 + 17≥ + 18 특징 > + 19. GMP PNP nonhydrolyzable GTP ribosomal 소 단위, 따라서 차단 48S 단계13번역 개시를 억제 하는 아날로그 이다. 반면, GTP, ATP, 또는 ATP와 GTP 80 개시 복합물, toeprint 메일 17 < 18 > + 198특징을 안정화.
사용자는 toeprint 하고자 하는 RNA의 유형을 고려해 야 해야 합니다. 목표 IRES 요소, 같은 모자 독립적인 메커니즘을 연구 하는 RNA에 생체 외에서 어떤 상용 키트와 함께 복사할 수 있습니다. 그러나, 어떤 포유류 RNA 5' 모자 구조는 제공이 toeprinting 메서드에 메시지를 받지 수 있습니다. 출장된 mRNA는 적절 한 키트를 사용 하 여 생성 되어야 합니다. 어떤 경우에, 제조 업체의 프로토콜 밀접 하 게 지켜져야 한다, 높은-품질 RNA의 준비 절차의 주요 단계를 나타냅니다. 또 다른 중요 한 요점은 중립 pH; 이상 단계 3.7에서에서 페 놀 추출 밖으로 실행 되어야 한다 이 단계에서 산 페 놀을 사용 하는 경우 새로 합성된 cDNA 손실 될 것입니다. 그것은 3.5 단계에서 사용 되는 마그네슘 아세테이트의 농도 반전 녹음 방송의 효율성에 영향을 미칠 수 및 각 mRNA에 대 한 최적화를 할 수 있습니다 지적 가치가 있다.
몇 가지 주요 컨트롤은 toeprint의 특이성을 보장 하기 위해 필요 하다. 첫째, RRL 또는 뉴클레오티드의 부재에서 더 강력한 toeprint은 관찰 해야. 그러면 관찰된 반전 녹음 방송 일시 중지 리보솜 RNA 복합물 보다는 안정적인 RNA 이차 구조 또는 자체 반전 녹음 방송 반응 몇 가지 결함을 예정 이다. 둘째, 아무 toeprint 해야 시작 codon 돌연변이 관찰. 이렇게 하면 리보솜 RNA의 시작 codon로 복잡 한 형성 시작 codon 3' 복잡 한 리보솜의 가장자리를 동일시 사용자가 올바르게 합니다. 이것은 양자 택일 시작 codon14리보솜을 모집 수 있습니다 IRES 요소에 대 한 특히 중요 하다입니다. 마찬가지로,는 toeprint XIAP IRES8의 경우 처럼 폴 리 A 꼬리의 부재에 손상 될 수도 있습니다. 그러나, 일부 IRES 요소 CrPV IRES10등 폴 리 A 꼬리의 부재에서 toeprints를 형성 한다. 마지막으로, 적절 한 toeprint 이외에 다른 반전 녹음 방송 일시를 관찰할 수 있습니다. 이들은 단순히 RNA에 안정 보조 구조 때문에 일시 중지를 나타낼 수 있습니다 또는 그들이 어떤 점에서 리보솜에서에서 슬라이드 시작 codon 다른 위치에 RNA15에 불리는 "리보솜 점프", 현상 때문일 수 있었다. 이러한 가능성을 구별, toeprinting 반응 존재 cycloheximide8, 효과적으로 시작 codon에서 리보솜을 움직이게 하 고 점프 하는 리보솜으로 대체 toeprints를 감소 해야 수행할 수 있습니다. 특히, 다른 mRNAs는 구조가 다른 보조, 수와의 반전 녹음 방송 일시 중지 의미 (즉., 밴드 배경) 다를 것 이다.
이 기술은의 가능한 한계가 이다 mRNA 시험관, 리보솜 채용을 측정 하지만 복잡 한 번역 개시의 형성 뜻은 아닙니다 번역에 비보를 발생 합니다. 따라서, toeprinting는 특히 강력한 기술로 vivo에서 번역을 측정 하기 위해 결합 될 때 (예.,16프로 파일링 polysome) 및 결과 단백질 수준 (예., 서쪽 분석).
최근 기술 이다 "리보솜 프로 파일링" ("리보솜 프린팅" 라고도 함) 총 세포 mRNA에 리보솜의 존재를 측정 하는 높은 처리량 RNA 시퀀싱 사용 됩니다. 이것은 리보솜 모집 transcriptome 전체 규모를 측정 하는 강력한 기술 이다. 고유한 리보솜 프로 파일링 시 약, cycloheximide, mRNAs에 리보솜 안정화 등의 사용이 이다. 이 잠재적으로 결점을, 리보솜의 불균형 수 비 특히 5' 되지 않은 지역에서 (UTR), 정식이 아닌 번역 개시17로 잘못 해석 될 수 있는 지연 수 있습니다 나타냅니다. 에 toeprinting, cycloheximide 같은 잘못 된 반응의 가능성을 negating 절차의 중요 한 부분이 아니다. 또한, 모든 단일 mRNA 공부 될 수 있다 더 자세히 toeprinting에 의해 그것이 많은 제어 실험 및 반복 실시 손쉬운 (예를 들어, 여러 점 돌연변이의 효과 또는 리보솜 모집에 폴 리 A 꼬리 없는 테스트). 그것은 시간과 해당 배열 제어 실험 실험을 프로 파일링 하는 리보솜의 맥락에서의 수행 비용 금지 것입니다. Toeprinting 따라서 높은 처리량 시퀀싱 기반 기술, 상호 보완적인 접근 이며 명료 번역 규정8,,910의 메커니즘을 연구를 위해 아직도 일반적으로 사용 되 18.

으로 번역 가장 세포 에너지 소비, 그것은 말 번역은 단단히 규제1. 반대로, 번역의 dysregulation-그리고 단백질 출력에 따른 변경-암1,2등, 스트레스 반응과 질병의 상태에서 자주 관찰 됩니다. 변환 제어의 주요 장점은 속도는 셀 다양 한 자극3에 대응 하기 위해 그들의 단백질 출력 변경할 수입니다. 번역 규정 따라서 세포 생존과 죽음1,2,3에 영향을 미칠 수 있는 중요 한 메커니즘을 나타냅니다. 번역의 단계의 개시는 대부분 높은 규제 하 고 복잡 한3입니다. 짧게, 가장 진 핵 mRNAs 포함 5' m7G 모자는 거의 항상 그들의 번역에 대 한 필수. 모자-종속 개시 진 핵 개시 요인 eIF4E, eIF4A, 및 eIF4G 필요 (모자 인식 복합)는 mRNA의 5' 끝에 상호 작용. 43S preinitiation 리보솜, eIF2 바인딩된 초기자를 포함 하는 mRNA를 통해 eIF3와 eIF4G의 상호 작용의 5' 끝에 tRNA와 eIF3, 모집. 복잡 한 괴롭힘 스캔 mRNA, eIF4A에 의해도 왔 생각 된다 (RNA helicase) 시작 codon (8 월)는 때까지. 복잡 한 48S 개시 이후에 형성 그리고 tRNA는 리보솜의 P 사이트에 전달 됩니다. 마지막으로, 60와 40 리보솜 소 단위 번역 신장1,,34다음 80 개시, 복잡 한 형태로 결합 된다. 반면, 내부 리보솜 입장 위치 (IRESes) 개시 코 돈3에 직접 40 ribosomal 소 단위를 모집 하 여 5' 모자에 대 한 요구 사항을 무시할. 생리 적 스트레스 상태 감소 글로벌 mRNA 번역 키 일반 진 핵 개시 요인 (eIFs)의 수정으로 인. 그러나, 종종 스트레스 대응 단백질을 인코딩하는 특정 mRNAs의 선택적 번역 비 정식 번역 개시 메커니즘을 사용 하 고 비 정식 번역 개시의 dysregulation 암 같은 질병 상태에 연루 1 , 2. 세포 IRESes 등 신중 RNA 규제 요소 같은 mRNAs2,3의 번역에 대 한 허용.
변환 제어의 1 개의 특히 재미 있는 양상은 특정된 mRNA의 비 정식 번역 대 정식의 메커니즘을 이해 하는 것입니다. Toeprinting 특정 RNAs 체 외의 번역 개시의 상세한 기계 연구를 허용 하는 기술입니다. Toeprinting의 전반적인 목표는 시퀀스, 구조 요소 또는 액세서리 결정 하기 위해 다양 한 조건에서 리보솜으로 복잡 한 번역 개시의 형성을 nucleate 관심의 RNA의 능력을 평가 하는 요소는 효율적인 번역 개시에 대 한 필요 합니다. 예를 들어, 리보솜 모집 5' 캡의 부재에 방해 수도 있습니다 하지만 한 IRES의 존재에 의해 자극.
체 외에서 하는 것입니다 기술의 원리 개시 단지 형태로, 그리고 반전 녹음 수 있도록 변환 컴포넌트 (또는 순화 된 구성 요소)을 포함 하는 세포 추출의 존재 그것을 품 어 관심, RNA 녹음 특정 뇌관는 RNA 안정적인 RNA 리보솜 단지 반전 녹음 방송에 리보솜의 소위 'toeprint'5,,67의 3' 가장자리에 발생 합니다.
이 프로토콜, ribosomal 소 단위, eIFs, tRNAs, 및 IRES 트랜스-행동 요인 (ITAFs)는 편리 하 게 토끼 reticulocyte lysate (RRL)에 의해 기여. 이 프로토콜의 또 다른 장점은 붙일 표시 된 뇌관 및 형광 젤 기반 영상, 보다는 오히려 방사선된 뇌관의 사용 이다. 이 등 radiolabeling 뇌관로 젤을 건조 강화 화면에 노출 하는 추가 단계를 제거 합니다. 형광 밴드는 큰 해상도 대 한 허용 젤 실행으로 실시간으로 기록 됩니다. 비록 출장된 mRNAs 또한이 기술을8에 의해 분석 될 수 있다 apoptosis 단백질 (XIAP) IRES RNA의 세척제 X 연결 억제제 여기, 예를 들어 사용 됩니다.
세포 lysates의 번역 과정의 최종 출력을 측정, 서쪽 분석, 달리 toeprinting은 번역 개시는 RNA에 복잡 한 대형을 측정 하기 위해 생체 외에서 접근 이다. 이 reductionist 접근 기판 또는 번역 개시 통제 요인의 매우 상세한 연구에 대 한 수 있습니다 (예., 출장 또는 취소 출장 mRNA, IRES 구조, 존재 또는 부재 특정 단백질 요인의, 폴 리 A 꼬리의 등)입니다. 따라서, toeprinting 번역8 다른 모드 또는 mRNA, 같은 구조 IRESes, 단백질 합성9,10의 효과 연구에 사용할 수 있습니다.

<table border="0" cellpadding="0" cellspacing="0" style="width:1045px;" width="1043">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:405px;">DEPC (Diethyl pyrocarbonate)</td>
			<td style="width:159px;">Sigma</td>
			<td style="width:191px;">D5758-100ML</td>
			<td style="width:291px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">TRIS base, Ultrapure</td>
			<td>JT Baker</td>
			<td>4109-01</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">KOAc (Potassium acetate)</td>
			<td>Bio Basic</td>
			<td>PB0438</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Mg(OAc)2 (Magnesium acetate tetrahydrate)</td>
			<td>Bio Basic</td>
			<td>MB0326</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Sucrose, molecular biology grade</td>
			<td>Calbiochem</td>
			<td>573113-1KG</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Spermidine</td>
			<td>Sigma</td>
			<td>85558</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GMP-PNP (Guanosine 5&#8242;-[&#946;,&#947;-imido]triphosphate trisodium salt hydrate) 0.1 M solution</td>
			<td>Sigma</td>
			<td>G0635</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">ATP (Adenosine 5&#8242;-triphosphate) disodium salt, 100 mM solution</td>
			<td>Sigma</td>
			<td>A6559</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">19:1 Acrylamide:bis-acrylamide, 40%</td>
			<td>Bio Basic</td>
			<td>A0006</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Urea</td>
			<td>Bio Basic</td>
			<td>UB0148</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">500mL bottle top filtration units, 0.2 &#181;m</td>
			<td>Sarstedt</td>
			<td>83.1823.101</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Formamide</td>
			<td>Sigma</td>
			<td>F9037-100ML</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">EDTA (disodium salt, dihydrate)</td>
			<td>Bio Basic</td>
			<td>EB0185</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">SDS</td>
			<td>Bio Basic</td>
			<td>SB0485</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Bromophenol blue</td>
			<td>Bio Basic</td>
			<td>BDB0001</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Xylene cyanol FF</td>
			<td>Bio Basic</td>
			<td>XB0005</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">MEGAshortscript T7 transcription kit</td>
			<td>Ambion</td>
			<td>AM1354</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">mMESSAGE mMACHINE T7 transcription kit</td>
			<td>Ambion</td>
			<td>AM1344</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Acid Phenol:Chloroform (5:1)</td>
			<td>Ambion</td>
			<td>AM9722</td>
			<td></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:405px;">25:24:1 Phenol:Chloroform:Isoamyl Alcohol</td>
			<td style="width:159px;">Invitrogen</td>
			<td style="width:191px;">15593-049</td>
			<td style="width:291px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Rabbit Reticulocyte Lysate (RRL). Should NOT be nuclease-treated.</td>
			<td>Green Hectares, USA</td>
			<td></td>
			<td>Contact Green Hectares, ask for 1:1 RRL:water</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RiboLock RNase Inhibitor (40 U/&#181;L)</td>
			<td>Thermo Fisher</td>
			<td>E00382</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">100 mM dNTPs</td>
			<td>Invitrogen</td>
			<td>56172, 56173, 56174, 56175</td>
			<td>Mix equal parts for a stock of 25 mM each.</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">AMV-RT, 10 U/&#181;L</td>
			<td>Promega</td>
			<td>M5101</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Sequenase Version 2.0 DNA Sequencing Kit</td>
			<td>Thermo Fisher</td>
			<td>707701KT</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Model 4200 IR2 DNA analyzer</td>
			<td>LI-COR</td>
			<td></td>
			<td>Product has been discontinued</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">APS (Ammonium Persulfate)</td>
			<td>Bio Basic</td>
			<td>AB0072</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">TEMED</td>
			<td>Bio Basic</td>
			<td>TB0508</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:405px;">Phusion High Fidelity Polymerase</td>
			<td style="width:159px;">New England Biolabs</td>
			<td style="width:191px;">M0530</td>
			<td style="width:291px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Turbo Dnase</td>
			<td>Thermo Fisher</td>
			<td>AM2238</td>
			<td></td>
		</tr>
	</tbody>
</table>

toeprinting analysis of translation initiation complex formation on mammalian mrnas

번역 개시 단백질 합성의 속도 제한 단계 이며, 세포 단백질 출력을 조절 하는 핵심을 나타냅니다. 단백질 합성의 세포질 긴장 응답, 열쇠 이며 dysregulation 암 등 많은 질병 상태에 중앙 이다. 예를 들어, 세포 스트레스 글로벌 번역의 억제를 약하게 모자 종속 개시 리드, 비록 특정 스트레스 응답 단백질에 모자 독립적인 방식으로 선택적으로 변환 됩니다. 신중한 RNA 규제 등의 요소, 세포 내부 리보솜 입장 위치 (IRESes),이 특정 한 mRNAs의 번역에 대 한 수 있습니다. 이러한 mRNAs의 식별 및 그들의 규제 메커니즘의 특성 분자 생물학에는 핵심 영역 되었습니다. Toeprinting 번역 개시에 관련 된 RNA 구조와 기능 연구에 대 한 방법입니다. Toeprinting의 목표는 생체 외에서 의 능력을 평가 하는 시퀀스, 구조 요소 또는 액세서리 요인 리보솜에 참여를 결정 하기 위해 다양 한 조건에서 리보솜과 안정 되어 있는 복합물을 형성 하는 RNA 베 껴 바인딩-효율적인 번역 개시에 대 한 사전 커서. 서쪽 분석 및 polysome 프로 파일링와 같은 다른 기술 함께 toeprinting 번역 개시의 규칙에 대 한 메커니즘의 강력한 특성에 대 한 수 있습니다.

우리는 이전 모자 독립적인 번역 개시 생체 외에서8,10을 지원 하기 위해 XIAP IRES의 능력을 설명 했습니다. Toeprinting 복잡 한 XIAP IRES 개시의 기계적 세부가 핵심 기술 했다. 인코딩 XIAP IRES (그림 1A)를 포함 하는 mRNA는 DNA 구조에 생체 외에서 복사할 및 toeprinting 분석을 받게 했다. 여기 사용 IRES XIAP mRNA의 돌연변이 변종 그림 1B에 표시 됩니다. 반전 녹음 방송 XIAP mRNA 리보솜 복잡 한의 전형적인 toeprints + 17 + 19 나왔고 nt 하류 (그림 1C, 레인 1) 8 월의. 이것은 리보솜 채용 시작 codon 그리고 안정적인 리보솜-RNA 단지5,,67의 대형의 지표 이다. 리보솜 모집 했다 이전에 보고 된11로 (그림 1C, 9 레인), 폴 리 A 꼬리의 부재에서 강력 하 게 손상 된다. Toeprint 형성 했다 또한 강력 하 게 관찰 된 toeprint는 구조 유도 확인 부재 RRL 및 GMP PNP (그림 1C, 레인 8) 및 (그림 1C, 7 레인), 시작 codon 돌연변이 대 한 장애 반전 녹음 방송의 일시 중지 하지만, 사실입니다, 시작 복잡 한 형성에 특정. Toeprint 형성 했다 IRES 구조 (그림 1B) 중단 5' polypyrimidine로 (PPT) 돌연변이 (그림 1C, 2 차선)과 3' PPT 돌연변이 (그림 1C, 4 레인), 대 한 장애인8 ,10,12. Toeprint 대형 PPT 돌연변이 했다 5' 모자 (그림 1C, 3, 5 차선)와 함께 문자 화 될 때 복구 되었다. Toeprint 형성 또한 PPT 이중 돌연변이 (그림 1C, 6 레인), 이차 구조 (그림 1B)10복원 합니다에 대 한 복원 되었습니다. 함께, 이러한 데이터는 XIAP IRES의 이차 구조는 유엔 출장된 RNA의 번역 개시에 대 한 중요 및 IRES 구조는 모자 종속 번역 개시를 위한 불가결을 나타냅니다. 더 설명 하기 위해 IRES 구조 부재에 5' 모자에 대 한 특정 요구 사항, 인간의 β-globin (HBB) mRNA는 toeprinting 분석 (그림 1의D)를 복종 되었다. 아니 toeprint 5' 모자 (그림 1D, 레인 1)의 부재에서 관찰 되었다 하지만 리보솜 성공적으로 출장된 HBB RNA (그림 12 차선)를 채용 했다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57519/57519fig1.jpg"> 그림 1 . Toeprinting 분석 IRES 세척제 XIAP IRES RNA에 번역 개시 복합물의 대형을 위한 이차 구조의 중요성을 확인합니다. (A) XIAP IRES RNA이이 분석에 사용 된 인코딩 DNA 구조물의 회로도. 3' toeprinting 뇌관의 끝은 42 시작 codon의 하류 혈압. (B) WT XIAP IRES (위 왼쪽), 5' PPT 돌연변이 (오른쪽 위), 3' PPT 돌연변이 (왼쪽 아래), 그리고 PPT 이중 돌연변이 (오른쪽 아래)의 보조 구조. 'PPT 돌연변이' IRES8,,1012의 이차 구조를 방해 하는 중요 한 polypyrimidine 관에서 점 돌연변이 (AA UU)를 말합니다. 시작 codon 박스형 이다; 점 돌연변이 별표 (*)로 표시 됩니다. (C) GMP PNP와 ATP RRL에서 양식 번역 개시 단지 XIAP IRES 이체의 수의 Toeprinting 분석 처리. 시작 codon 8 월 시작 Codon 돌연변이에서 AAC로 대체 되었습니다. RNA 폴 리 A 꼬리 부족을 하려면 역방향 뇌관 녹음 방송 생체 외에서 템플릿을 만드는 데 사용 되는 단순히 폴 리-T로 부족. (D) 에 (하지만 하지 취소 출장) 출장 5' UTR 인간의 β-globin (HBB)의 개시 복합체 형성 되었다. 패널 (C) (D), 가장 왼쪽 4 차선 각 레인; 위에 표시 된 미치기 뉴클레오티드와 시퀀싱 반응을 나타내는 시퀀스는 각 패널의 왼쪽에 표시 됩니다. 플로리다, 전체 길이입니다. 별도로 지정 하지 않는 한 모든 RNAs 초상 취소 되지 않았습니다. 이 그림은 이전 간행물8,10에서 수정 되었습니다. <a href="/files/ftp_upload/57519/57519fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>

Watch this Scientific Journal Video about Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs at JoVE.com

Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs

번역 개시 포유류 mRNAs에 복잡 한 대형의 Toeprinting 분석

Toeprinting 목표 체 외에서 의 능력을 측정 하는 다양 한 조건에서 리보솜과 양식 번역 개시 복합물에 RNA를 복사할 수 있습니다. 이 프로토콜 toeprinting 포유류 RNA에 대 한 메서드를 설명 하 고 모자-종속 및 IRES 기반 번역 공부 하는 데 사용할 수 있습니다.

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation ...

toeprinting-analysis-translation-initiation-complex-formation-on

Nanyang Technological University

Research

JoVE Journal

Biochemistry

12.4K 조회수.  University of Lethbridge. Toeprinting 목표 체 외에서 의 능력을 측정 하는 다양 한 조건에서 리보솜과 양식 번역 개시 복합물에 RNA를 복사할 수 있습니다. 이 프로토콜 toeprinting 포유류 RNA에 대 한 메서드를 설명 하 고 모자-종속 및 IRES 기반 번역 공부 하는 데 사용할 수 있습니다.

비디오: Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs

Protein Complex Affinity Capture from Cryomilled Mammalian Cells

Affinity capture is an effective technique for isolating endogenous protein complexes for further study. When used in conjunction with an antibody, this technique is also frequently referred to as immunoprecipitation. Affinity capture can be applied in a bench-scale and in a high-throughput context. When coupled with protein mass spectrometry, affinity capture has proven to be a workhorse of interactome analysis. Although there are potentially many ways to execute the numerous steps involved, the following protocols implement our favored methods. Two features are distinctive: the use of cryomilled cell powder to produce cell extracts, and antibody-coupled paramagnetic beads as the affinity medium. In many cases, we have obtained superior results to those obtained with more conventional affinity capture practices. Cryomilling avoids numerous problems associated with other forms of cell breakage. It provides efficient breakage of the material, while avoiding denaturation issues associated with heating or foaming. It retains the native protein concentration up to the point of extraction, mitigating macromolecular dissociation. It reduces the time extracted proteins spend in solution, limiting deleterious enzymatic activities, and it may reduce the non-specific adsorption of proteins by the affinity medium. Micron-scale magnetic affinity media have become more commonplace over the last several years, increasingly replacing the traditional agarose- and Sepharose-based media. Primary benefits of magnetic media include typically lower non-specific protein adsorption; no size exclusion limit because protein complex binding occurs on the bead surface rather than within pores; and ease of manipulation and handling using magnets.

Here we describe protocols to disrupt mammalian cells by solid-state milling at a cryogenic temperature, produce a cell extract from the resulting cell powder, and isolate protein complexes of interest by affinity capture upon antibody-coupled micron-scale paramagnetic beads.

Cryomilled 포유 동물 세포에서 단백질 단지 선호도 캡처

Affinity capture is an effective technique for isolating endogenous protein complexes for further study. When used in conjunction with an antibody, this ...

연구

생화학

Preparation of Giant Vesicles Encapsulating Microspheres by Centrifugation of a Water-in-oil Emulsion

The constructive biology and the synthetic biology approach to creating artificial life involve the bottom-up assembly of biological or nonbiological materials. Such approaches have received considerable attention in research on the boundary between living and nonliving matter and have been used to construct artificial cells over the past two decades. In particular, Giant Vesicles (GVs) have often been used as artificial cell membranes. In this paper, we describe the preparation of GVs encapsulating highly packed microspheres as a model of cells containing highly condensed biomolecules. The GVs were prepared by means of a simple water-in-oil emulsion centrifugation method. Specifically, a homogenizer was used to emulsify an aqueous solution containing the materials to be encapsulated and an oil containing dissolved phospholipids, and the resulting emulsion was layered carefully on the surface of another aqueous solution. The layered system was then centrifuged to generate the GVs. This powerful method was used to encapsulate materials ranging from small molecules to microspheres.

Giant vesicles containing highly packed micrometer-sized components are useful cell models. The water-in-oil emulsion centrifugation method is a simple, powerful tool for the preparation of giant vesicles with encapsulated materials.

유 중수 에멀젼의 원심 분리에 의해 거 소포 캡슐화 미소 구의 제조

The constructive biology and the synthetic biology approach to creating artificial life involve the bottom-up assembly of biological or nonbiological ...

Quantitative Immunofluorescence to Measure Global Localized Translation

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and organogenesis, as well as in multiple diseases. Numerous publications have convincingly shown that specific mechanisms tightly regulate mRNA translation. Increased interest in the translation-induced regulation of protein expression has led to the development of novel methods to study and follow de novo protein synthesis in cellulo. However, most of these methods are complex, making them costly and often limiting the number of mRNA targets that can be studied. This manuscript proposes a method that requires only basic reagents and a confocal fluorescence imaging system to measure and visualize the changes in mRNA translation that occur in any cell line under various conditions. This method was recently used to show localized translation in the subcellular structures of adherent cells over a short period of time, thus offering the possibility of visualizing de novo translation for a short period during a variety of biological processes or of validating changes in translational activity in response to specific stimuli.

This manuscript describes a method to visualize and quantify localized translation events in subcellular compartments. The approach proposed in this manuscript requires a basic confocal imaging system and reagents and is rapid and cost-effective.

정량적 면역 형광 측정 글로벌 현지화 번역

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and ...

Biochemical and Structural Characterization of the Carbohydrate Transport Substrate-binding-protein SP0092

Development of new antimicrobials and vaccines for Streptococcus pneumoniae (pneumococcus) are necessary to halt the rapid rise in multiple resistant strains. Carbohydrate substrate binding proteins (SBPs) represent viable targets for the development of protein-based vaccines and new antimicrobials because of their extracellular localization and the centrality of carbohydrate import for pneumococcal metabolism, respectively. Described here is a rationalized integrated protocol to carry out a comprehensive characterization of SP0092, which can be extended to other carbohydrate SBPs from the pneumococcus and other bacteria. This procedure can aid the structure-based design of inhibitors for this class of proteins. Presented in the first part of this manuscript are protocols for biochemical analysis by thermal shift assay, multi angle light scattering (MALS), and size exclusion chromatography (SEC), which optimize the stability and homogeneity of the sample directed to crystallization trials and so enhance the probability of success. The second part of this procedure describes the characterization of the SBP crystals using a tunable wavelength anomalous diffraction synchrotron beamline, and data collection protocols for measuring data that can be used to resolve the crystallized protein structure.

A streamlined protocol for performing an extensive biochemical and structural characterization of a carbohydrate substrate binding protein from Streptococcus pneumoniae is presented.

탄수화물 전송 기질 바인딩 단백질 SP0092의 생 화 학적 및 구조적 특성

Development of new antimicrobials and vaccines for Streptococcus pneumoniae (pneumococcus) are necessary to halt the rapid rise in multiple resistant ...

Genome-wide Quantification of Translation in Budding Yeast by Ribosome Profiling

Translation of mRNA into proteins is a complex process involving several layers of regulation. It is often assumed that changes in mRNA transcription reflect changes in protein synthesis, but many exceptions have been observed. Recently, a technique called ribosome profiling (or Ribo-Seq) has emerged as a powerful method that allows identification, with high accuracy, which regions of mRNA are translated into proteins and quantification of translation at the genome-wide level. Here, we present a generalized protocol for genome-wide quantification of translation using Ribo-Seq in budding yeast. In addition, combining Ribo-Seq data with mRNA abundance measurements allows us to simultaneously quantify translation efficiency of thousands of mRNA transcripts in the same sample and compare changes in these parameters in response to experimental manipulations or in different physiological states. We describe a detailed protocol for generation of ribosome footprints using nuclease digestion, isolation of intact ribosome-footprint complexes via sucrose gradient fractionation, and preparation of DNA libraries for deep sequencing along with appropriate quality controls necessary to ensure accurate analysis of in vivo translation.

Translational regulation plays an important role in the control of protein abundance. Here, we describe a high-throughput method for quantitative analysis of translation in the budding yeast Saccharomyces cerevisiae.

리보솜을 프로 파일링 하 여 신진 효 모에 번역의 게놈 넓은 정량화

Translation of mRNA into proteins is a complex process involving several layers of regulation. It is often assumed that changes in mRNA transcription ...

A Simple Method for High Throughput Chemical Screening in Caenorhabditis Elegans

Caenorhabditis elegans is a useful organism for testing chemical effects on physiology. Whole organism small molecule screens offer significant advantages for identifying biologically active chemical structures that can modify complex phenotypes such as lifespan. Described here is a simple protocol for producing hundreds of 96-well culture plates with fairly consistent numbers of C. elegans in each well. Next, we specified how to use these cultures to screen thousands of chemicals for effects on the lifespan of the nematode C. elegans. This protocol makes use of temperature sensitive sterile strains, agar plate conditions, and simple animal handling to facilitate the rapid and high throughput production of synchronized animal cultures for screening.

A Simple Method for High Throughput Chemical Screening in Caenorhabditis Elegans

Here we describe a simple protocol for rapidly producing hundreds of nematode growth media agar, 96-well culture plates with consistent numbers of Caenorhhabditis elegans per well. These cultures are useful for the phenotypic screening of whole organisms. We focus here on using these cultures to screen chemicals for pro-longevity effects.

꼬마 선 충 에서 높은 처리량 화학 심사 하는 간단한 방법

Caenorhabditis elegans is a useful organism for testing chemical effects on physiology. Whole organism small molecule screens offer significant advantages ...

Study on the Metabolism of Six Systemic Insecticides in a Newly Established Cell Suspension Culture Derived from Tea (Camellia Sinensis L.) Leaves

A platform for studying insecticide metabolism using in vitro tissues of tea plant was developed. Leaves from sterile tea plantlets were induced to form loose callus on Murashige and Skoog (MS) basal media with the plant hormones 2,4-dichlorophenoxyacetic acid (2,4-D, 1.0 mg L-1) and kinetin (KT, 0.1 mg L-1). Callus formed after 3 or 4 rounds of subculturing, each lasting 28 days. Loose callus (about 3 g) was then inoculated into B5 liquid media containing the same plant hormones and was cultured in a shaking incubator (120 rpm) in the dark at 25 &#177; 1 &#176;C. After 3&#8722;4 subcultures, a cell suspension derived from tea leaf was established at a subculture ratio ranging between 1:1 and 1:2 (suspension mother liquid: fresh medium). Using this platform, six insecticides (5 &#181;g mL-1 each thiamethoxam, imidacloprid, acetamiprid, imidaclothiz, dimethoate, and omethoate) were added into the tea leaf-derived cell suspension culture. The metabolism of the insecticides was tracked using liquid chromatography and gas chromatography. To validate the usefulness of the tea cell suspension culture, the metabolites of thiamethoxan and dimethoate present in treated cell cultures and intact plants were compared using mass spectrometry. In treated tea cell cultures, seven metabolites of thiamethoxan and two metabolites of dimethoate were found, while in treated intact plants, only two metabolites of thiamethoxam and one of dimethoate were found. The use of a cell suspension simplified the metabolic analysis compared to the use of intact tea plants, especially for a difficult matrix such as tea.

Study on the Metabolism of Six Systemic Insecticides in a Newly Established Cell Suspension Culture Derived from Tea Camellia Sinensis L. Leaves

This work presents a protocol for establishing a cell suspension culture derived from tea (Camellia sinensis L.) leaves that can be used to study the metabolism of external compounds that can be taken up by the whole plant, such as insecticides.

차에서 파생된 새로 설립된 세포 현탁액 배양에서 6개의 전신 살충제의 물질대사에 관한 연구(동백나무시넨시스 L.) 잎

A platform for studying insecticide metabolism using in vitro tissues of tea plant was developed. Leaves from sterile tea plantlets were induced to form ...

An In Vitro Single-Molecule Imaging Assay for the Analysis of Cap-Dependent Translation Kinetics

Cap-dependent protein synthesis is the predominant translation pathway in eukaryotic cells. While various biochemical and genetic approaches have allowed extensive studies of cap-dependent translation and its regulation, high resolution kinetic characterization of this translation pathway is still lacking. Recently, we developed an in vitro assay to measure cap-dependent translation kinetics with single-molecule resolution. The assay is based on fluorescently labeled antibody binding to nascent epitope-tagged polypeptide. By imaging the binding and dissociation of antibodies to and from nascent peptide&#8211;ribosome&#8211;mRNA complexes, the translation progression on individual mRNAs can be tracked. Here, we present a protocol for establishing this assay, including mRNA and PEGylated slide preparations, real-time imaging of translation, and analysis of single molecule trajectories. This assay enables tracking of individual cap-dependent translation events and resolves key translation kinetics, such as initiation and elongation rates. The assay can be widely applied to distinct translation systems and should broadly benefit in vitro studies of cap-dependent translation kinetics and translational control mechanisms.

An In Vitro Single-Molecule Imaging Assay for the Analysis of Cap-Dependent Translation Kinetics

Tracking individual translation events allows for high-resolution kinetic studies of cap-dependent translation mechanisms. Here we demonstrate an in vitro single-molecule assay based on imaging interactions between fluorescently labeled antibodies and epitope-tagged nascent peptides. This method enables single-molecule characterization of initiation and peptide elongation kinetics during active in vitro cap-dependent translation.

캡 의존형 번역 역학 분석을 위한 생체외 단일 분자 이미징 분석

Cap-dependent protein synthesis is the predominant translation pathway in eukaryotic cells. While various biochemical and genetic approaches have allowed ...

Complementation of Splicing Activity by a Galectin-3 - U1 snRNP Complex on Beads

Classic depletion-reconstitution experiments indicate that galectin-3 is a required splicing factor in nuclear extracts. The mechanism of incorporation of galectin-3 into the splicing pathway is addressed in this paper. Sedimentation of HeLa cell nuclear extracts on 12%-32% glycerol gradients yields fractions enriched in an endogenous ~10S particle that contains galectin-3 and U1 snRNP. We now describe a protocol to deplete nuclear extracts of U1 snRNP with concomitant loss of splicing activity. Splicing activity in the U1-depleted extract can be reconstituted by the galectin-3 - U1 snRNP particle trapped on agarose beads covalently coupled with anti-galectin-3 antibodies. The results indicate that the galectin-3 - U1 snRNP - pre-mRNA ternary complex is a functional E complex leading to intermediates and products of the splicing reaction and that galectin-3 enters the splicing pathway through its association with U1 snRNP. The scheme of using complexes affinity- or immuno-selected on beads to reconstitute splicing activity in extracts depleted of a specific splicing factor may be generally applicable to other systems.

This article describes the experimental procedures for (a) depletion of U1 snRNP from nuclear extracts, with concomitant loss of splicing activity; and (b) reconstitution of splicing activity in the U1-depleted extract by galectin-3 - U1 snRNP particles bound to beads covalently coupled with anti-galectin-3 antibodies.

구슬에 갈렉틴-3 - U1 snRNP 복합체에 의한 접합 활동의 보완

Classic depletion-reconstitution experiments indicate that galectin-3 is a required splicing factor in nuclear extracts. The mechanism of incorporation of ...

Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation

RNA adopts diverse structural folds, which are essential for its functions and thereby can impact diverse processes in the cell. In addition, the structure and function of an RNA can be modulated by various trans-acting factors, such as proteins, metabolites or other RNAs. Frameshifting RNA molecules, for instance, are regulatory RNAs located in coding regions, which direct translating ribosomes into an alternative open reading frame, and thereby act as gene switches. They may also adopt different folds after binding to proteins or other trans-factors. To dissect the role of RNA-binding proteins in translation and how they modulate RNA structure and stability, it is crucial to study the interplay and mechanical features of these RNA-protein complexes simultaneously.&#160;This work illustrates how to employ single-molecule-fluorescence-coupled optical tweezers to explore the conformational and thermodynamic landscape of RNA-protein complexes at a high resolution. As an example, the interaction of the SARS-CoV-2 programmed ribosomal frameshifting element with the trans-acting factor short isoform of zinc-finger antiviral protein is elaborated. In addition, fluorescence-labeled ribosomes were monitored using the confocal unit, which would ultimately enable the study of translation elongation. The fluorescence coupled OT assay can be widely applied to explore diverse RNA-protein complexes or trans-acting factors regulating translation and could facilitate studies of RNA-based gene regulation.

This protocol presents a complete experimental workflow for studying RNA-protein interactions using optical tweezers. Several possible experimental setups are outlined including the combination of optical tweezers with confocal microscopy.