This work was funded by a Natural Sciences and Engineering Research Council of Canada-Discovery Grant (RGPIN-2017-05463), the Canada Foundation for Innovation-John R. Evans Leaders Fund (35017), the Campus Alberta Innovates Program and the Alberta Ministry of Economic Development and Trade.

NOTE: RNA is highly susceptible to degradation by ribonucleases (RNases). Take standard precautions to keep the RNA intact. Change gloves frequently. Use filtered pipette tips, nuclease-free plasticware, and nuclease-free chemicals in all steps of the protocol. Use nuclease-free or diethyl pyrocarbonate (DEPC)-treated water for all solutions.
1. Preparation of Solutions
<ol>
	<li>Prepare Toeprinting buffer: 20 mM Tris-HCl (pH 7.6), 100 mM KOAc, 2.5 mM Mg(OAc)2, 5% (w/v) sucrose, 2 mM dithiothreitol (DTT), and 0.5 mM spermidine.
	<ol>
		<li>Store DTT and spermidine in single-use aliquots at -20 &#176;C to avoid repeated freeze-thaw cycles. 
		NOTE: DTT and spermidine should be added to the toeprinting buffer immediately before use. A solution lacking DTT and spermidine can be stored at -20 &#176;C.</li>
	</ol>
	</li>
	<li>Prepare aliquots of 85 mM 5&#39;-guanylyl imidodiphosphate (GMP-PNP) and 91 mM adenosine triphosphate (ATP). Store the aliquots at -20 &#176;C.</li>
	<li>Prepare 450 mL of 6% polyacrylamide-7M urea gel mix: 67.5 mL of 40% acrylamide:bis-acrylamide (19:1), 189 g of urea, 112.5 mL of 5x TBE (Tris/borate/thylenediaminetetraacetic acid (EDTA)), and 120 mL of water. Dissolve the urea by warming in a 37 &#176;C water bath or on a hot plate with stirring. Filter the solution (e.g., 0.2 &#956;m nitrocellulose vacuum filter). 
	NOTE: The solution can be stored at 4 &#176;C for at least one month. 
	Caution: Monomeric acrylamide is a neurotoxin which can be absorbed through the skin. Take great care to avoid skin contact (i.e., wear gloves, a lab coat, and eye protection). Polyacrylamide should also be handled with care, as polymerization may not proceed to 100% completion.</li>
	<li>Prepare formamide loading dye: 95% formamide, 18 mM EDTA, 0.025% (w/v) sodium dodecyl sulfate (SDS), 0.025% (w/v) bromophenol blue, 0.025% (w/v) xylene cyanol. Store at -20 &#176;C.</li>
	<li>Dissolve 1 nmol of primer (5&#39; CTCGATATGTGCATCTGTA; 5&#39; end-labeled with IRDye 800) into 100 &#956;L of water for a working concentration of 10 pmol/&#956;L. Store at -20 &#176;C in single-use aliquots (approximately 10 &#181;L), protected from light.</li>
</ol>
2. Preparation of mRNA
<ol>
	<li>Amplify DNA templates for the synthesis of mRNA by polymerase chain reaction (PCR) from appropriate templates (i.e., genomic DNA or plasmid DNA, as appropriate). Use a high-fidelity DNA polymerase according to the manufacturer&#39;s instructions, with the following reaction conditions (35 cycles): melt, 98 &#176;C, 10 s; anneal, 53 &#176;C, 20 s; extend, 72 &#176;C, 30 s. 
	NOTE: The forward primer (5&#39; AAGCTTAATACGACTCACTATAG) incorporates the T7 promoter sequence to allow for RNA transcription; the reverse primer (5&#39; T51GAATTCGGATCCGACCGTGG) includes 51 thymine residues to provide a poly-A tail for the transcribed RNA. Note that RNA can also be in vitro transcribed from plasmid DNA.</li>
	<li>Use an appropriate transcription kit to in vitro transcribe IRES-containing RNA or capped RNA from the DNA template. Follow the manufacturer&#39;s instructions. Prepare the RNA sample in standard 20 &#956;L reaction volumes. Treat the newly-synthesized RNA with 2 units of RNase-free DNase for 30 min at 37 &#176;C.</li>
	<li>Dilute the DNase-treated RNA to 110 &#181;L with nuclease-free water add 110 &#181;L acid phenol,&#160;vortex 5 s and centrifuge for 3 min at 20,000 x g at room temperature. Remove 100 &#181;L of the aqueous phase to a new 1.5 mL microfuge tube, add 10 &#181;L of 3 M sodium acetate, and vortex 2 s.&#160;Add, 3 volumes of 100% ethanol, vortex 5 s, and precipitate the RNA at -20 &#176;C overnight.</li>
	<li>Centrifuge at &#62;20,000 x g for 30 min at 4 &#176;C and discard the supernatant. Wash the pellet with 500 &#181;L of ice-cold 70% (v/v) ethanol and repeat the centrifugation. Aspirate as much of the supernatant as possible and air-dry the pellet for 5 - 10 min. Be careful not to dislodge the pellet.</li>
	<li>Resuspend the RNA in the appropriate volume of nuclease-free water to yield a working concentration of 0.5 &#956;g/&#956;L. This can be stored at -80 &#176;C or used immediately.</li>
</ol>
3. Toeprinting Reaction
<ol>
	<li>Mix 15 &#956;L of Rabbit Reticulocyte Lysate (RRL, not nuclease-treated), 1 &#956;L (40 units) of RNase Inhibitor, 1 &#181;L of 91 mM ATP (1.82 mM final) and 1 &#956;L of 85 mM GMP-PNP (1.7 mM final) in a 1.5 mL microfuge tube. Incubate at 30 &#176;C for 5 min. 
	NOTE: The RRL should be aliquoted for single use to avoid repetitive freeze-thawing. A critical control is a reaction lacking RRL, in order to elucidate the natural pauses of reverse transcription due to the secondary structure of the RNA.&#160;Add toeprinting buffer to replace RRL for this control.&#160;</li>
	<li>Add 0.5 &#181;g (1 &#181;L) of RNA and incubate at 30 &#176;C for 5 min.</li>
	<li>Add 22 &#181;L of Toeprinting buffer and incubate at 30 &#176;C for 3 min.</li>
	<li>Add 0.5 &#181;L (5 pmol) of IRDye-labeled primer and incubate on ice for 10 min.</li>
	<li>Add 2 &#181;L of 25 mM dNTPs (final concentration: 1 mM each), 2 &#181;L of 100 mM Mg(OAc)2, 1 &#181;L of Avian Myeloblastosis Virus Reverse Transcriptase (AMV-RT) and 3.5 &#181;L of Toeprinting buffer. The final volume is 50 &#956;L.</li>
	<li>Incubate the reaction at 30 &#176;C for 45 min.</li>
	<li>Add 200 &#181;L of nuclease-free water and immediately extract with 250 &#181;L of 25:24:1 phenol:chloroform:isoamyl alcohol (pH approximately 8.0). Vortex 5 s and centrifuge at 20,000 x g for 3 min at room temperature. Remove the aqueous phase to a new 1.5 mL microfuge tube, add 3 volumes of 100% ethanol, vortex 5 s, and precipitate at -20 &#176;C overnight.</li>
	<li>Centrifuge at &#62;20,000 x g for 30 min at 4 &#176;C and discard the supernatant. Wash the DNA pellet with 500 &#181;L of ice-cold 70% (v/v) ethanol. Centrifuge at &#62;20,000 x g for 15 min at 4 &#176;C. Aspirate as much supernatant as possible and air dry the pellet for 5 - 10 min. Be careful not to dislodge the pellet.</li>
	<li>Dissolve the pellet in 6 &#956;L of nuclease-free water and add 3 &#956;L of formamide loading dye.</li>
</ol>
4. Sequencing Reactions
<ol>
	<li>Use the DNA template from 2.1 and the IRDye-labeled primer from step 3.4 for standard sequencing reactions, using dideoxynucleotides (ddNTPs) as chain terminators. Use an appropriate DNA sequencing kit and follow the manufacturer&#39;s instructions.</li>
	<li>Mix 6 &#956;L of each sequencing reaction with 3 &#956;L of formamide loading dye.</li>
</ol>
5. Preparation of Sequencing Gel and Electrophoresis
NOTE: This protocol uses a fluorescence gel-based imager and a 21 cm x 23 cm x 0.2 mm gel, but can be adapted for other sequencers or gel-sizes, if required.
<ol>
	<li>Thoroughly clean the 0.2 mm spacers as well as the short (23 &#215; 25 cm) and long (30 &#215; 25 cm) glass plates with 100% ethanol. Air dry.</li>
	<li>Mix 30 mL of 6% polyacrylamide-7M urea gel mix with 200 &#956;L of 10% (w/v) ammonium persulfate (APS) and 20 &#956;L of tetramethylethylenediamine (TEMED). Pour the gel, taking care to avoid bubbles, and insert the &#39;shark-tooth&#39; gel comb. Allow the gel to polymerize for 1 h at room temperature.</li>
	<li>Assemble the sequencing apparatus and fill the reservoirs with 1x TBE.</li>
	<li>Pre-run for 15 min at 1500 V until the optimal temperature of 55 &#176;C is achieved.</li>
	<li>Heat the sample/loading dye mix (from steps 3.9 or 4.2) to 85 &#176;C for 5 min. Load 1 &#956;L onto the sequencing gel.</li>
	<li>Run the gel at 1500 V for 8 h. The machine will read the bands in real time.</li>
	<li>Disassemble the apparatus, and dispose the acrylamide gel and running buffer.</li>
</ol>

<ol>
	<li>Holcik, M., Sonenberg, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+control+in+stress+and+apoptosis.">Translational control in stress and apoptosis.</a> Nat Rev Mol Cell Biol. 6 (4), 318-327 (2005).</li><li>Lacerda, R., Menezes, J., Romao, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=More+than+just+scanning:+the+importance+of+cap-independent+mRNA+translation+initiation+for+cellular+stress+response+and+cancer.">More than just scanning: the importance of cap-independent mRNA translation initiation for cellular stress response and cancer.</a> Cell Mol Life Sci. 74 (9), 1659-1680 (2017).</li><li>Sharma, D. K., Bressler, K., Patel, H., Balasingam, N., Thakor, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+Eukaryotic+Initiation+Factors+during+Cellular+Stress+and+Cancer+Progression.">Role of Eukaryotic Initiation Factors during Cellular Stress and Cancer Progression.</a> J Nucleic Acids. 2016, 8235121 (2016).</li><li>Gebauer, F., Hentze, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanisms+of+translational+control.">Molecular mechanisms of translational control.</a> Nat Rev Mol Cell Biol. 5 (10), 827-835 (2004).</li><li>Anthony, D. D., Merrick, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+40+S+and+80+S+complexes+with+mRNA+as+measured+by+sucrose+density+gradients+and+primer+extension+inhibition.">Analysis of 40 S and 80 S complexes with mRNA as measured by sucrose density gradients and primer extension inhibition.</a> J Biol Chem. 267 (3), 1554-1562 (1992).</li><li>Hartz, D., McPheeters, D. S., Traut, R., Gold, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extension+inhibition+analysis+of+translation+initiation+complexes.">Extension inhibition analysis of translation initiation complexes.</a> Methods Enzymol. 164, 419-425 (1988).</li><li>Shirokikh, N. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+ribosome-mRNA+complexes+at+different+translation+stages.">Quantitative analysis of ribosome-mRNA complexes at different translation stages.</a> Nucleic Acids Res. 38 (3), 15 (2010).</li><li>Thakor, N., Holcik, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRES-mediated+translation+of+cellular+messenger+RNA+operates+in+eIF2alpha-+independent+manner+during+stress.">IRES-mediated translation of cellular messenger RNA operates in eIF2alpha- independent manner during stress.</a> Nucleic Acids Res. 40 (2), 541-552 (2012).</li><li>Liwak, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+suppressor+PDCD4+represses+internal+ribosome+entry+site-mediated+translation+of+antiapoptotic+proteins+and+is+regulated+by+S6+kinase+2.">Tumor suppressor PDCD4 represses internal ribosome entry site-mediated translation of antiapoptotic proteins and is regulated by S6 kinase 2.</a> Mol Cell Biol. 32 (10), 1818-1829 (2012).</li><li>Thakor, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+mRNA+recruits+the+ribosome+via+eIF3-PABP+bridge+to+initiate+internal+translation.">Cellular mRNA recruits the ribosome via eIF3-PABP bridge to initiate internal translation.</a> RNA Biol. , 1-15 (2016).</li><li>Thoma, C., Bergamini, G., Galy, B., Hundsdoerfer, P., Hentze, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancement+of+IRES-mediated+translation+of+the+c-myc+and+BiP+mRNAs+by+the+poly(A)+tail+is+independent+of+intact+eIF4G+and+PABP.">Enhancement of IRES-mediated translation of the c-myc and BiP mRNAs by the poly(A) tail is independent of intact eIF4G and PABP.</a> Mol Cell. 15 (6), 925-935 (2004).</li><li>Baird, S. D., Lewis, S. M., Turcotte, M., Holcik, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+search+for+structurally+similar+cellular+internal+ribosome+entry+sites.">A search for structurally similar cellular internal ribosome entry sites.</a> Nucleic Acids Res. 35 (14), 4664-4677 (2007).</li><li>Merrick, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+that+a+single+GTP+is+used+in+the+formation+of+80+S+initiation+complexes.">Evidence that a single GTP is used in the formation of 80 S initiation complexes.</a> J Biol Chem. 254 (10), 3708-3711 (1979).</li><li>Arnaud, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+New+34-Kilodalton+Isoform+of+Human+Fibroblast+Growth+Factor+2+Is+Cap+Dependently+Synthesized+by+Using+a+Non-AUG+Start+Codon+and+Behaves+as+a+Survival+Factor.">A New 34-Kilodalton Isoform of Human Fibroblast Growth Factor 2 Is Cap Dependently Synthesized by Using a Non-AUG Start Codon and Behaves as a Survival Factor.</a> Mol Cell Biol. 19 (1), 505-514 (1999).</li><li>Dmitriev, S. E., Pisarev, A. V., Rubtsova, M. P., Dunaevsky, Y. E., Shatsky, I. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conversion+of+48S+translation+preinitiation+complexes+into+80S+initiation+complexes+as+revealed+by+toeprinting.">Conversion of 48S translation preinitiation complexes into 80S initiation complexes as revealed by toeprinting.</a> FEBS Lett. 533 (1-3), 99-104 (2003).</li><li>Faye, M. D., Graber, T. E., Holcik, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessment+of+selective+mRNA+translation+in+mammalian+cells+by+polysome+profiling.">Assessment of selective mRNA translation in mammalian cells by polysome profiling.</a> J Vis Exp. (92), e52295 (2014).</li><li>Duncan, C. D. S., Mata, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+cycloheximide+on+the+interpretation+of+ribosome+profiling+experiments+in+Schizosaccharomyces+pombe.">Effects of cycloheximide on the interpretation of ribosome profiling experiments in Schizosaccharomyces pombe.</a> Sci Rep. 7 (1), 10331 (2017).</li><li>Beck, H. J., Janssen, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+Translation+Initiation+Regulation+Mechanism+in+Escherichia+coli+ptrB+Mediated+by+a+5'-Terminal+AUG.">Novel Translation Initiation Regulation Mechanism in Escherichia coli ptrB Mediated by a 5'-Terminal AUG.</a> J Bacteriol. 199 (14), (2017).</li></ol>

The authors have no conflict-of-interest to disclose.

Toeprinting is a powerful technique to directly measure the ability of an RNA of interest to support the formation of translation initiation complexes under highly controlled circumstances. This protocol describes a simplified technique for toeprinting mammalian RNAs. Rabbit reticulocyte lysate (RRL) is used as a convenient source of ribosomes, eIFs, initiator tRNA, and IRES trans-acting factors (ITAFs). The experimenter provides their RNA of choice, and can also supplement the toeprinting reaction with specific cofactors of their choosing. For instance, 48S versus 80S translation initiation complexes can be differentiated based on the distribution of fluorescence intensities of the toeprints7. The initiation complex observed will depend on the type of guanine nucleotide used. In the case of the XIAP IRES discussed here, GMP-PNP plus ATP stabilizes 48S pre-initiation complexes, characterized by a toeprint distribution +17&#8805;+18&#62;+19. GMP-PNP is a nonhydrolyzable GTP analog that inhibits ribosomal subunit joining, thus blocking translation initiation at the 48S step13. In contrast, GTP, ATP, or ATP plus GTP stabilizes 80S initiation complexes, characterized by toeprint distribution +17&#60;+18&#62; +198.
The user will have to consider the type of RNA they wish to toeprint. If the aim is to study a cap-independent mechanism, such as an IRES element, the RNA can be in vitro transcribed with any commercially available kit. However, any mammalian RNA can be subjected to this toeprinting method, provided that it has a 5&#39; cap structure. Capped mRNA must be generated using an appropriate kit. In any case, the manufacturer&#39;s protocols should be closely followed, as the preparation of high-quality RNA represents a key step in the procedure. Another critical point is that the phenol extraction in step 3.7 must be carried out at or above neutral pH; if acid phenol is used at this stage, the newly synthesized cDNA will be lost. It is worth noting that the concentration of magnesium acetate used in step 3.5 can influence the efficiency of reverse transcription, and may have to be optimized for each mRNA.
A few key controls are necessary to ensure the specificity of the toeprint. First, no robust toeprint should be observed in the absence of RRL or nucleotide. This ensures that the observed reverse transcription pause is due to a ribosome-RNA complex rather than a stable RNA secondary structure or some defect with the reverse transcription reaction itself. Second, no toeprint should be observed if the start codon is mutated. This ensures that the ribosome has formed a complex specifically with the start codon of the RNA and that the user has correctly identified the 3&#39; edge of the ribosome in complex with the start codon. This is particularly important for IRES elements, which might recruit the ribosome to an alternative start codon14. Similarly, the toeprint might be impaired in the absence of a poly-A tail, as was the case for the XIAP IRES8. However, some IRES elements form toeprints in the absence of a poly-A tail, such as the CrPV IRES10. Finally, in addition to the toeprint proper, other reverse transcription pauses might be observed. These can simply represent pauses due to stable secondary structures in the RNA, or they could be due to a phenomenon dubbed &#34;ribosome jumping&#34;, wherein the ribosome slides from the start codon to other locations on the RNA15. To differentiate between these possibilities, the toeprinting reaction can be performed in the presence of cycloheximide8, which effectively immobilizes the ribosome at the start codon and should reduce alternative toeprints due to ribosome jumping. Notably, different mRNAs will have different secondary structures, meaning that the number and intensity of reverse transcription pauses (i.e., background bands) will also vary.
A possible limitation of this technique is that it measures ribosome recruitment to an mRNA in vitro, but the formation of a translation initiation complex does not necessarily mean that translation will occur in vivo. Therefore, toeprinting is particularly powerful when combined with in vivo techniques to measure translation (e.g., polysome profiling16) and the resulting protein levels (e.g., western analysis).
A more recent technique is &#34;ribosome profiling&#34; (also called &#34;ribosome footprinting&#34;), wherein high-throughput RNA sequencing is used to measure the presence of ribosomes on total cellular mRNA. This is a powerful technique to measure ribosome recruitment on a transcriptome-wide scale. Inherent to ribosome profiling is the use of reagents, such as cycloheximide, to stabilize ribosomes on mRNAs. This potentially represents a drawback, as a disproportionate number of ribosomes can be non-specifically stalled in the 5&#39; untranslated region (UTR), which can be misinterpreted as non-canonical translation initiation17. In toeprinting, cycloheximide is not an integral part of the procedure, negating the possibility of such false positives. Moreover, any single mRNA can be studied in greater detail by toeprinting, as it is facile to conduct many control experiments and iterations (for instance, testing the effect of several point mutations, or the absence of a poly-A tail, on ribosome recruitment). It would be time-consuming and cost-prohibitive to carry out an equivalent array of control experiments in the context of a ribosome profiling experiment. Toeprinting is thus a complementary approach to high-throughput sequencing-based techniques, and is still commonly used for studies aiming to elucidate mechanisms of translation regulation8,9,10,18.

As translation consumes most cellular energy, it makes sense that translation is tightly regulated1. Conversely, dysregulation of translation-and the consequent alterations in protein output-is often observed in stress-response and disease states, such as cancer1,2. A major advantage of translational control is the speed with which cells can alter their protein output in order to respond to various stimuli3. Translation regulation thus represents an important mechanism that can influence cell survival and death1,2,3. Of the steps of translation, initiation is the most highly regulated and complex3. Briefly, most eukaryotic mRNAs contain a 5&#39; m7G cap that is almost always essential for their translation. Cap-dependent initiation requires eukaryotic initiation factors eIF4E, eIF4A, and eIF4G (the cap-recognition complex) to interact with the 5&#39; end of the mRNA. The 43S preinitiation ribosome complex, which contains eIF2-bound initiator tRNA and eIF3, is recruited to the 5&#39; end of the mRNA via an interaction of eIF4G with eIF3. The preinitiation complex is thought to scan mRNA, aided by eIF4A (an RNA helicase) until the start codon (AUG) is located. The 48S initiation complex is subsequently formed and tRNA is delivered into the P-site of the ribosome. Finally, the 60S and 40S ribosome subunits are united to form the 80S initiation complex, followed by translation elongation1,3,4. In contrast, internal ribosome entry sites (IRESes) bypass the requirement for a 5&#39; cap by recruiting the 40S ribosomal subunit directly to the initiation codon3. Physiological stress conditions attenuate global mRNA translation due to modifications of key general eukaryotic initiation factors (eIFs). However, non-canonical translation initiation mechanisms allow for selective translation of certain mRNAs which often encode stress-response proteins, and dysregulation of non-canonical translation initiation is implicated in disease states like cancer1,2. Discreet RNA regulatory elements, such as cellular IRESes, allow for the translation of such mRNAs2,3.
One particularly interesting aspect of translational control is to understand mechanisms of canonical versus non-canonical translation of a given mRNA. Toeprinting is a technique that allows the detailed mechanistic study of translation initiation of specific RNAs in vitro. The overall goal of toeprinting is to assess the ability of an RNA of interest to nucleate the formation of a translation initiation complex with the ribosome under a variety of conditions, in order to determine which sequences, structural elements, or accessory factors are required for efficient translation initiation. For instance, ribosome recruitment might be hindered in the absence of a 5&#39; cap but stimulated by the presence of an IRES.
The principle of the technique is to in vitro transcribe an RNA of interest, incubate it in the presence of cellular extracts containing translation components (or the purified components) to allow initiation complexes to form, and to reverse transcribe the RNA with a specific primer. Stable RNA-ribosome complexes will cause reverse transcription to stall at the 3&#39; edge of the ribosome-the so-called &#39;toeprint&#39;5,6,7.
In this protocol, the ribosomal subunits, eIFs, tRNAs, and IRES trans-acting factors (ITAFs) are conveniently contributed by rabbit reticulocyte lysate (RRL). Another advantage of this protocol is the use of a fluorescently-labeled primer and fluorescence gel-based imager, rather than a radiolabeled primer. This eliminates extra steps, including radiolabeling the primer, as well as drying the gel and exposing it to an intensifying screen. The fluorescent bands are recorded in real time, as the gel runs, allowing for greater resolution. Uncapped X-linked inhibitor of apoptosis protein (XIAP) IRES RNA is used as an example here, although capped mRNAs can also be analyzed by this technique8.
Unlike western analysis, which measures the final output of the translation process in cell lysates, toeprinting is an in vitro approach to measure translation initiation complex formation on an RNA. This reductionist approach allows for the highly detailed study of substrates or factors that regulate translation initiation (e.g., capped or un-capped mRNA, IRES structure, presence or absence of poly-A tail, provision of specific protein factors, etc.). Hence, toeprinting can be used to study different modes of translation8 or the effects of mRNA structures, such as IRESes, on protein synthesis9,10.

<table border="0" cellpadding="0" cellspacing="0" style="width:1045px;" width="1043">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:405px;">DEPC (Diethyl pyrocarbonate)</td>
			<td style="width:159px;">Sigma</td>
			<td style="width:191px;">D5758-100ML</td>
			<td style="width:291px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">TRIS base, Ultrapure</td>
			<td>JT Baker</td>
			<td>4109-01</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">KOAc (Potassium acetate)</td>
			<td>Bio Basic</td>
			<td>PB0438</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Mg(OAc)2 (Magnesium acetate tetrahydrate)</td>
			<td>Bio Basic</td>
			<td>MB0326</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Sucrose, molecular biology grade</td>
			<td>Calbiochem</td>
			<td>573113-1KG</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Spermidine</td>
			<td>Sigma</td>
			<td>85558</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GMP-PNP (Guanosine 5&#8242;-[&#946;,&#947;-imido]triphosphate trisodium salt hydrate) 0.1 M solution</td>
			<td>Sigma</td>
			<td>G0635</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">ATP (Adenosine 5&#8242;-triphosphate) disodium salt, 100 mM solution</td>
			<td>Sigma</td>
			<td>A6559</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">19:1 Acrylamide:bis-acrylamide, 40%</td>
			<td>Bio Basic</td>
			<td>A0006</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Urea</td>
			<td>Bio Basic</td>
			<td>UB0148</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">500mL bottle top filtration units, 0.2 &#181;m</td>
			<td>Sarstedt</td>
			<td>83.1823.101</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Formamide</td>
			<td>Sigma</td>
			<td>F9037-100ML</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">EDTA (disodium salt, dihydrate)</td>
			<td>Bio Basic</td>
			<td>EB0185</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">SDS</td>
			<td>Bio Basic</td>
			<td>SB0485</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Bromophenol blue</td>
			<td>Bio Basic</td>
			<td>BDB0001</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Xylene cyanol FF</td>
			<td>Bio Basic</td>
			<td>XB0005</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">MEGAshortscript T7 transcription kit</td>
			<td>Ambion</td>
			<td>AM1354</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">mMESSAGE mMACHINE T7 transcription kit</td>
			<td>Ambion</td>
			<td>AM1344</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Acid Phenol:Chloroform (5:1)</td>
			<td>Ambion</td>
			<td>AM9722</td>
			<td></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:405px;">25:24:1 Phenol:Chloroform:Isoamyl Alcohol</td>
			<td style="width:159px;">Invitrogen</td>
			<td style="width:191px;">15593-049</td>
			<td style="width:291px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Rabbit Reticulocyte Lysate (RRL). Should NOT be nuclease-treated.</td>
			<td>Green Hectares, USA</td>
			<td></td>
			<td>Contact Green Hectares, ask for 1:1 RRL:water</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RiboLock RNase Inhibitor (40 U/&#181;L)</td>
			<td>Thermo Fisher</td>
			<td>E00382</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">100 mM dNTPs</td>
			<td>Invitrogen</td>
			<td>56172, 56173, 56174, 56175</td>
			<td>Mix equal parts for a stock of 25 mM each.</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">AMV-RT, 10 U/&#181;L</td>
			<td>Promega</td>
			<td>M5101</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Sequenase Version 2.0 DNA Sequencing Kit</td>
			<td>Thermo Fisher</td>
			<td>707701KT</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Model 4200 IR2 DNA analyzer</td>
			<td>LI-COR</td>
			<td></td>
			<td>Product has been discontinued</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">APS (Ammonium Persulfate)</td>
			<td>Bio Basic</td>
			<td>AB0072</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">TEMED</td>
			<td>Bio Basic</td>
			<td>TB0508</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:405px;">Phusion High Fidelity Polymerase</td>
			<td style="width:159px;">New England Biolabs</td>
			<td style="width:191px;">M0530</td>
			<td style="width:291px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Turbo Dnase</td>
			<td>Thermo Fisher</td>
			<td>AM2238</td>
			<td></td>
		</tr>
	</tbody>
</table>

toeprinting analysis of translation initiation complex formation on mammalian mrnas

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation of protein synthesis is the key to cellular stress-response, and dysregulation is central to many disease states, such as cancer. For instance, although cellular stress leads to the inhibition of global translation by attenuating cap-dependent initiation, certain stress-response proteins are selectively translated in a cap-independent manner. Discreet RNA regulatory elements, such as cellular internal ribosome entry sites (IRESes), allow for the translation of these specific mRNAs. Identification of such mRNAs, and the characterization of their regulatory mechanisms, have been a key area in molecular biology. Toeprinting is a method for the study of RNA structure and function as it pertains to translation initiation. The goal of toeprinting is to assess the ability of in vitro transcribed RNA to form stable complexes with ribosomes under a variety of conditions, in order to determine which sequences, structural elements, or accessory factors are involved in ribosome binding&#8212;a pre-cursor for efficient translation initiation. Alongside other techniques, such as western analysis and polysome profiling, toeprinting allows for a robust characterization of mechanisms for the regulation of translation initiation.

We have previously described the ability of the XIAP IRES to support cap-independent translation initiation in vitro8,10. Toeprinting was the key technique to interrogate the mechanistic details of the XIAP IRES initiation complex. A DNA construct encoding an mRNA containing the XIAP IRES (Figure 1A) was in vitro transcribed and subjected to toeprinting analysis. The mutant variants of the XIAP IRES mRNA used here are represented in Figure 1B. Reverse transcription of the XIAP mRNA-ribosome complex yielded typical toeprints +17 to +19 nt downstream of AUG (Figure 1C, lane 1). This is indicative of ribosome recruitment to the start codon and the formation of stable ribosome-RNA complexes5,6,7. Ribosome recruitment was strongly impaired in the absence of a poly-A tail (Figure 1C, lane 9), as previously reported11. Toeprint formation was also strongly impaired in the absence of RRL and GMP-PNP (Figure 1C, lane 8) and for the start codon mutant (Figure 1C, lane 7), confirming that the observed toeprint is not a structure-induced pause of reverse transcription but is, in fact, specific to initiation complex formation. Toeprint formation was impaired for the 5&#39; polypyrimidine tract (PPT) mutant (Figure 1C, lane 2) and the 3&#39; PPT mutant (Figure 1C, lane 4), which disrupt IRES structure (Figure 1B)8,10,12. Toeprint formation was restored when the PPT mutants were transcribed with a 5&#39; cap (Figure 1C, lanes 3 and 5). Toeprint formation was also restored for the PPT double mutant (Figure 1C, lane 6), which restores the secondary structure (Figure 1B)10. Together, these data indicate that the secondary structure of the XIAP IRES is critical for translation initiation of un-capped RNA and that IRES structure is dispensable for cap-dependent translation initiation. To further demonstrate the specific requirement for a 5&#39; cap in the absence of an IRES structure, human &#946;-globin (HBB) mRNA was subjected to toeprinting analysis (Figure 1D). No toeprint was observed in the absence of a 5&#39; cap (Figure 1D, lane 1) but ribosomes were successfully recruited to capped HBB RNA (Figure 1D, lane 2).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57519/57519fig1.jpg" /> 
Figure 1. Toeprinting analysis confirms the importance of IRES secondary structure for the formation of translation initiation complexes on an uncapped XIAP IRES RNA.&#160;(A) Schematic diagram of the DNA construct encoding the XIAP IRES RNA used in this analysis. The 3&#39; end of the toeprinting primer is 42 bp downstream of the start codon. (B) Secondary structures of the WT XIAP IRES (upper left), the 5&#39; PPT mutant (upper right), the 3&#39; PPT mutant (lower left), and the PPT double mutant (lower right). &#39;PPT Mutant&#39; refers to a point mutation (UU to AA) in a critical polypyrimidine tract, which disrupts the secondary structure of the IRES8,10,12. The start codon is boxed; the point mutations are indicated with asterisks (*). (C) Toeprinting analysis of the ability of XIAP IRES variants to form translation initiation complexes in RRL treated with GMP-PNP and ATP. The start codon AUG was replaced with AAC in the Start Codon Mutant. To make RNA lacking a poly-A tail, the reverse primer used to make the in vitro transcription template simply lacked a poly-T tract. (D) Initiation complex was formed on the capped (but not the un-capped) 5&#39; UTR of human &#946;-globin (HBB). In&#160;panels (C) and (D), the left-most 4 lanes represent sequencing reactions with the dideoxy nucleotides indicated above each lane; the sequence is indicated to the left of each panel. FL, Full-length. All RNAs were un-capped unless otherwise specified. This figure has been modified from previous publications8,10. <a href="/files/ftp_upload/57519/57519fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs at JoVE.com

Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs

Toeprinting aims to measure the ability of in vitro transcribed RNA to form translation initiation complexes with ribosomes under a variety of conditions. This protocol describes a method for toeprinting mammalian RNA and can be used to study both cap-dependent and IRES-driven translation.

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation ...

toeprinting-analysis-translation-initiation-complex-formation-on

Nanyang Technological University

Research

JoVE Journal

Biochemistry

12.4K Views.  University of Lethbridge. Toeprinting aims to measure the ability of in vitro transcribed RNA to form translation initiation complexes with ribosomes under a variety of conditions. This protocol describes a method for toeprinting mammalian RNA and can be used to study both cap-dependent and IRES-driven translation.

Video: Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs

Protein Complex Affinity Capture from Cryomilled Mammalian Cells

Affinity capture is an effective technique for isolating endogenous protein complexes for further study. When used in conjunction with an antibody, this technique is also frequently referred to as immunoprecipitation. Affinity capture can be applied in a bench-scale and in a high-throughput context. When coupled with protein mass spectrometry, affinity capture has proven to be a workhorse of interactome analysis. Although there are potentially many ways to execute the numerous steps involved, the following protocols implement our favored methods. Two features are distinctive: the use of cryomilled cell powder to produce cell extracts, and antibody-coupled paramagnetic beads as the affinity medium. In many cases, we have obtained superior results to those obtained with more conventional affinity capture practices. Cryomilling avoids numerous problems associated with other forms of cell breakage. It provides efficient breakage of the material, while avoiding denaturation issues associated with heating or foaming. It retains the native protein concentration up to the point of extraction, mitigating macromolecular dissociation. It reduces the time extracted proteins spend in solution, limiting deleterious enzymatic activities, and it may reduce the non-specific adsorption of proteins by the affinity medium. Micron-scale magnetic affinity media have become more commonplace over the last several years, increasingly replacing the traditional agarose- and Sepharose-based media. Primary benefits of magnetic media include typically lower non-specific protein adsorption; no size exclusion limit because protein complex binding occurs on the bead surface rather than within pores; and ease of manipulation and handling using magnets.

Here we describe protocols to disrupt mammalian cells by solid-state milling at a cryogenic temperature, produce a cell extract from the resulting cell powder, and isolate protein complexes of interest by affinity capture upon antibody-coupled micron-scale paramagnetic beads.

Affinity capture is an effective technique for isolating endogenous protein complexes for further study. When used in conjunction with an antibody, this ...

Preparation of Giant Vesicles Encapsulating Microspheres by Centrifugation of a Water-in-oil Emulsion

The constructive biology and the synthetic biology approach to creating artificial life involve the bottom-up assembly of biological or nonbiological materials. Such approaches have received considerable attention in research on the boundary between living and nonliving matter and have been used to construct artificial cells over the past two decades. In particular, Giant Vesicles (GVs) have often been used as artificial cell membranes. In this paper, we describe the preparation of GVs encapsulating highly packed microspheres as a model of cells containing highly condensed biomolecules. The GVs were prepared by means of a simple water-in-oil emulsion centrifugation method. Specifically, a homogenizer was used to emulsify an aqueous solution containing the materials to be encapsulated and an oil containing dissolved phospholipids, and the resulting emulsion was layered carefully on the surface of another aqueous solution. The layered system was then centrifuged to generate the GVs. This powerful method was used to encapsulate materials ranging from small molecules to microspheres.

Giant vesicles containing highly packed micrometer-sized components are useful cell models. The water-in-oil emulsion centrifugation method is a simple, powerful tool for the preparation of giant vesicles with encapsulated materials.

The constructive biology and the synthetic biology approach to creating artificial life involve the bottom-up assembly of biological or nonbiological ...

Quantitative Immunofluorescence to Measure Global Localized Translation

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and organogenesis, as well as in multiple diseases. Numerous publications have convincingly shown that specific mechanisms tightly regulate mRNA translation. Increased interest in the translation-induced regulation of protein expression has led to the development of novel methods to study and follow de novo protein synthesis in cellulo. However, most of these methods are complex, making them costly and often limiting the number of mRNA targets that can be studied. This manuscript proposes a method that requires only basic reagents and a confocal fluorescence imaging system to measure and visualize the changes in mRNA translation that occur in any cell line under various conditions. This method was recently used to show localized translation in the subcellular structures of adherent cells over a short period of time, thus offering the possibility of visualizing de novo translation for a short period during a variety of biological processes or of validating changes in translational activity in response to specific stimuli.

This manuscript describes a method to visualize and quantify localized translation events in subcellular compartments. The approach proposed in this manuscript requires a basic confocal imaging system and reagents and is rapid and cost-effective.

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and ...

Biochemical and Structural Characterization of the Carbohydrate Transport Substrate-binding-protein SP0092

Development of new antimicrobials and vaccines for Streptococcus pneumoniae (pneumococcus) are necessary to halt the rapid rise in multiple resistant strains. Carbohydrate substrate binding proteins (SBPs) represent viable targets for the development of protein-based vaccines and new antimicrobials because of their extracellular localization and the centrality of carbohydrate import for pneumococcal metabolism, respectively. Described here is a rationalized integrated protocol to carry out a comprehensive characterization of SP0092, which can be extended to other carbohydrate SBPs from the pneumococcus and other bacteria. This procedure can aid the structure-based design of inhibitors for this class of proteins. Presented in the first part of this manuscript are protocols for biochemical analysis by thermal shift assay, multi angle light scattering (MALS), and size exclusion chromatography (SEC), which optimize the stability and homogeneity of the sample directed to crystallization trials and so enhance the probability of success. The second part of this procedure describes the characterization of the SBP crystals using a tunable wavelength anomalous diffraction synchrotron beamline, and data collection protocols for measuring data that can be used to resolve the crystallized protein structure.

A streamlined protocol for performing an extensive biochemical and structural characterization of a carbohydrate substrate binding protein from Streptococcus pneumoniae is presented.

Development of new antimicrobials and vaccines for Streptococcus pneumoniae (pneumococcus) are necessary to halt the rapid rise in multiple resistant ...

Genome-wide Quantification of Translation in Budding Yeast by Ribosome Profiling

Translation of mRNA into proteins is a complex process involving several layers of regulation. It is often assumed that changes in mRNA transcription reflect changes in protein synthesis, but many exceptions have been observed. Recently, a technique called ribosome profiling (or Ribo-Seq) has emerged as a powerful method that allows identification, with high accuracy, which regions of mRNA are translated into proteins and quantification of translation at the genome-wide level. Here, we present a generalized protocol for genome-wide quantification of translation using Ribo-Seq in budding yeast. In addition, combining Ribo-Seq data with mRNA abundance measurements allows us to simultaneously quantify translation efficiency of thousands of mRNA transcripts in the same sample and compare changes in these parameters in response to experimental manipulations or in different physiological states. We describe a detailed protocol for generation of ribosome footprints using nuclease digestion, isolation of intact ribosome-footprint complexes via sucrose gradient fractionation, and preparation of DNA libraries for deep sequencing along with appropriate quality controls necessary to ensure accurate analysis of in vivo translation.

Translational regulation plays an important role in the control of protein abundance. Here, we describe a high-throughput method for quantitative analysis of translation in the budding yeast Saccharomyces cerevisiae.

Translation of mRNA into proteins is a complex process involving several layers of regulation. It is often assumed that changes in mRNA transcription ...

A Simple Method for High Throughput Chemical Screening in Caenorhabditis Elegans

Caenorhabditis elegans is a useful organism for testing chemical effects on physiology. Whole organism small molecule screens offer significant advantages for identifying biologically active chemical structures that can modify complex phenotypes such as lifespan. Described here is a simple protocol for producing hundreds of 96-well culture plates with fairly consistent numbers of C. elegans in each well. Next, we specified how to use these cultures to screen thousands of chemicals for effects on the lifespan of the nematode C. elegans. This protocol makes use of temperature sensitive sterile strains, agar plate conditions, and simple animal handling to facilitate the rapid and high throughput production of synchronized animal cultures for screening.

A Simple Method for High Throughput Chemical Screening in Caenorhabditis Elegans

Here we describe a simple protocol for rapidly producing hundreds of nematode growth media agar, 96-well culture plates with consistent numbers of Caenorhhabditis elegans per well. These cultures are useful for the phenotypic screening of whole organisms. We focus here on using these cultures to screen chemicals for pro-longevity effects.

Caenorhabditis elegans is a useful organism for testing chemical effects on physiology. Whole organism small molecule screens offer significant advantages ...

Study on the Metabolism of Six Systemic Insecticides in a Newly Established Cell Suspension Culture Derived from Tea (Camellia Sinensis L.) Leaves

A platform for studying insecticide metabolism using in vitro tissues of tea plant was developed. Leaves from sterile tea plantlets were induced to form loose callus on Murashige and Skoog (MS) basal media with the plant hormones 2,4-dichlorophenoxyacetic acid (2,4-D, 1.0 mg L-1) and kinetin (KT, 0.1 mg L-1). Callus formed after 3 or 4 rounds of subculturing, each lasting 28 days. Loose callus (about 3 g) was then inoculated into B5 liquid media containing the same plant hormones and was cultured in a shaking incubator (120 rpm) in the dark at 25 &#177; 1 &#176;C. After 3&#8722;4 subcultures, a cell suspension derived from tea leaf was established at a subculture ratio ranging between 1:1 and 1:2 (suspension mother liquid: fresh medium). Using this platform, six insecticides (5 &#181;g mL-1 each thiamethoxam, imidacloprid, acetamiprid, imidaclothiz, dimethoate, and omethoate) were added into the tea leaf-derived cell suspension culture. The metabolism of the insecticides was tracked using liquid chromatography and gas chromatography. To validate the usefulness of the tea cell suspension culture, the metabolites of thiamethoxan and dimethoate present in treated cell cultures and intact plants were compared using mass spectrometry. In treated tea cell cultures, seven metabolites of thiamethoxan and two metabolites of dimethoate were found, while in treated intact plants, only two metabolites of thiamethoxam and one of dimethoate were found. The use of a cell suspension simplified the metabolic analysis compared to the use of intact tea plants, especially for a difficult matrix such as tea.

Study on the Metabolism of Six Systemic Insecticides in a Newly Established Cell Suspension Culture Derived from Tea Camellia Sinensis L. Leaves

This work presents a protocol for establishing a cell suspension culture derived from tea (Camellia sinensis L.) leaves that can be used to study the metabolism of external compounds that can be taken up by the whole plant, such as insecticides.

A platform for studying insecticide metabolism using in vitro tissues of tea plant was developed. Leaves from sterile tea plantlets were induced to form ...

An In Vitro Single-Molecule Imaging Assay for the Analysis of Cap-Dependent Translation Kinetics

Cap-dependent protein synthesis is the predominant translation pathway in eukaryotic cells. While various biochemical and genetic approaches have allowed extensive studies of cap-dependent translation and its regulation, high resolution kinetic characterization of this translation pathway is still lacking. Recently, we developed an in vitro assay to measure cap-dependent translation kinetics with single-molecule resolution. The assay is based on fluorescently labeled antibody binding to nascent epitope-tagged polypeptide. By imaging the binding and dissociation of antibodies to and from nascent peptide&#8211;ribosome&#8211;mRNA complexes, the translation progression on individual mRNAs can be tracked. Here, we present a protocol for establishing this assay, including mRNA and PEGylated slide preparations, real-time imaging of translation, and analysis of single molecule trajectories. This assay enables tracking of individual cap-dependent translation events and resolves key translation kinetics, such as initiation and elongation rates. The assay can be widely applied to distinct translation systems and should broadly benefit in vitro studies of cap-dependent translation kinetics and translational control mechanisms.

An In Vitro Single-Molecule Imaging Assay for the Analysis of Cap-Dependent Translation Kinetics

Tracking individual translation events allows for high-resolution kinetic studies of cap-dependent translation mechanisms. Here we demonstrate an in vitro single-molecule assay based on imaging interactions between fluorescently labeled antibodies and epitope-tagged nascent peptides. This method enables single-molecule characterization of initiation and peptide elongation kinetics during active in vitro cap-dependent translation.

Cap-dependent protein synthesis is the predominant translation pathway in eukaryotic cells. While various biochemical and genetic approaches have allowed ...

Complementation of Splicing Activity by a Galectin-3 - U1 snRNP Complex on Beads

Classic depletion-reconstitution experiments indicate that galectin-3 is a required splicing factor in nuclear extracts. The mechanism of incorporation of galectin-3 into the splicing pathway is addressed in this paper. Sedimentation of HeLa cell nuclear extracts on 12%-32% glycerol gradients yields fractions enriched in an endogenous ~10S particle that contains galectin-3 and U1 snRNP. We now describe a protocol to deplete nuclear extracts of U1 snRNP with concomitant loss of splicing activity. Splicing activity in the U1-depleted extract can be reconstituted by the galectin-3 - U1 snRNP particle trapped on agarose beads covalently coupled with anti-galectin-3 antibodies. The results indicate that the galectin-3 - U1 snRNP - pre-mRNA ternary complex is a functional E complex leading to intermediates and products of the splicing reaction and that galectin-3 enters the splicing pathway through its association with U1 snRNP. The scheme of using complexes affinity- or immuno-selected on beads to reconstitute splicing activity in extracts depleted of a specific splicing factor may be generally applicable to other systems.

This article describes the experimental procedures for (a) depletion of U1 snRNP from nuclear extracts, with concomitant loss of splicing activity; and (b) reconstitution of splicing activity in the U1-depleted extract by galectin-3 - U1 snRNP particles bound to beads covalently coupled with anti-galectin-3 antibodies.

Classic depletion-reconstitution experiments indicate that galectin-3 is a required splicing factor in nuclear extracts. The mechanism of incorporation of ...

Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation

RNA adopts diverse structural folds, which are essential for its functions and thereby can impact diverse processes in the cell. In addition, the structure and function of an RNA can be modulated by various trans-acting factors, such as proteins, metabolites or other RNAs. Frameshifting RNA molecules, for instance, are regulatory RNAs located in coding regions, which direct translating ribosomes into an alternative open reading frame, and thereby act as gene switches. They may also adopt different folds after binding to proteins or other trans-factors. To dissect the role of RNA-binding proteins in translation and how they modulate RNA structure and stability, it is crucial to study the interplay and mechanical features of these RNA-protein complexes simultaneously.&#160;This work illustrates how to employ single-molecule-fluorescence-coupled optical tweezers to explore the conformational and thermodynamic landscape of RNA-protein complexes at a high resolution. As an example, the interaction of the SARS-CoV-2 programmed ribosomal frameshifting element with the trans-acting factor short isoform of zinc-finger antiviral protein is elaborated. In addition, fluorescence-labeled ribosomes were monitored using the confocal unit, which would ultimately enable the study of translation elongation. The fluorescence coupled OT assay can be widely applied to explore diverse RNA-protein complexes or trans-acting factors regulating translation and could facilitate studies of RNA-based gene regulation.

This protocol presents a complete experimental workflow for studying RNA-protein interactions using optical tweezers. Several possible experimental setups are outlined including the combination of optical tweezers with confocal microscopy.