이 작품은 독일 우수 이니셔티브 (CellNetworks DFG 실 81)와 공동 연구 센터 SFB638 부분 회계를 통해 독일 연구 위원회 (DFG)에 의해 융자 되었다.

<ol>
	<li>Scott, D. E., Bayly, A. R., Abell, C., Skidmore, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Small+molecules,+big+targets:+drug+discovery+faces+the+protein-protein+interaction+challenge.">Small molecules, big targets: drug discovery faces the protein-protein interaction challenge.</a> Nat Rev Drug Discov. 15 (8), 533-550 (2016).</li><li>Roux, K. J., Kim, D. I., Raida, M., Burke, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+promiscuous+biotin+ligase+fusion+protein+identifies+proximal+and+interacting+proteins+in+mammalian+cells.">A promiscuous biotin ligase fusion protein identifies proximal and interacting proteins in mammalian cells.</a> J Cell Biol. 196 (6), 801-810 (2012).</li><li>Lam, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+APEX2+for+electron+microscopy+and+proximity+labeling.">Directed evolution of APEX2 for electron microscopy and proximity labeling.</a> Nat Methods. 12 (1), 51-54 (2015).</li><li>Rhee, H. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteomic+mapping+of+mitochondria+in+living+cells+via+spatially+restricted+enzymatic+tagging.">Proteomic mapping of mitochondria in living cells via spatially restricted enzymatic tagging.</a> Science. 339 (6125), 1328-1331 (2013).</li><li>Kim, D. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+nuclear+pore+complex+architecture+with+proximity-dependent+biotinylation.">Probing nuclear pore complex architecture with proximity-dependent biotinylation.</a> P Natl Acad Sci USA. 111 (24), E2453-E2461 (2014).</li><li>Kim, D. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+smaller+biotin+ligase+for+BioID+proximity+labeling.">An improved smaller biotin ligase for BioID proximity labeling.</a> Mol Biol Cell. 27 (8), 1188-1196 (2016).</li><li>Lambert, J. P., Tucholska, M., Go, C., Knight, J. D., Gingras, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proximity+biotinylation+and+affinity+purification+are+complementary+approaches+for+the+interactome+mapping+of+chromatin-associated+protein+complexes.">Proximity biotinylation and affinity purification are complementary approaches for the interactome mapping of chromatin-associated protein complexes.</a> J Proteomics. 118, 81-94 (2015).</li><li>Morriswood, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+bilobe+components+in+Trypanosoma+brucei+identified+using+proximity-dependent+biotinylation.">Novel bilobe components in Trypanosoma brucei identified using proximity-dependent biotinylation.</a> Eukaryot Cell. 12 (2), 356-367 (2013).</li><li>Schopp, I. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Split-BioID+a+conditional+proteomics+approach+to+monitor+the+composition+of+spatiotemporally+defined+protein+complexes.">Split-BioID a conditional proteomics approach to monitor the composition of spatiotemporally defined protein complexes.</a> Nat Commun. 8, (2017).</li><li>B&#233;thune, J., Artus-Revel, C. G., Filipowicz, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinetic+analysis+reveals+successive+steps+leading+to+miRNA-mediated+silencing+in+mammalian+cells.">Kinetic analysis reveals successive steps leading to miRNA-mediated silencing in mammalian cells.</a> EMBO Rep. 13 (8), 716-723 (2012).</li><li>Inoue, H., Nojima, H., Okayama, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+efficiency+transformation+of+Escherichia+coli+with+plasmids.">High efficiency transformation of Escherichia coli with plasmids.</a> Gene. 96 (1), 23-28 (1990).</li><li>Weidenfeld, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+expression+of+coding+and+inhibitory+RNAs+from+retargetable+genomic+loci.">Inducible expression of coding and inhibitory RNAs from retargetable genomic loci.</a> Nucleic Acids Res. 37 (7), e50 (2009).</li><li>Dyballa, N., Metzger, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+and+sensitive+colloidal+coomassie+G-250+staining+for+proteins+in+polyacrylamide+gels.">Fast and sensitive colloidal coomassie G-250 staining for proteins in polyacrylamide gels.</a> J Vis Exp. (30), (2009).</li><li>Jonas, S., Izaurralde, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+a+molecular+understanding+of+microRNA-mediated+gene+silencing.">Towards a molecular understanding of microRNA-mediated gene silencing.</a> Nat Rev Genet. 16 (7), 421-433 (2015).</li><li>MacRae, I. J., Ma, E., Zhou, M., Robinson, C. V., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+reconstitution+of+the+human+RISC-loading+complex.">In vitro reconstitution of the human RISC-loading complex.</a> P Natl Acad Sci USA. 105 (2), 512-517 (2008).</li><li>Cox, J., Mann, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MaxQuant+enables+high+peptide+identification+rates,+individualized+p.p.b.-range+mass+accuracies+and+proteome-wide+protein+quantification.">MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification.</a> Nat Biotechnol. 26 (12), 1367-1372 (2008).</li><li>Tyanova, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Perseus+computational+platform+for+comprehensive+analysis+of+(prote)omics+data.">The Perseus computational platform for comprehensive analysis of (prote)omics data.</a> Nat Methods. 13 (9), 731-740 (2016).</li><li>Opitz, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Capturing+the+Asc1p/Receptor+for+Activated+C+Kinase+1+(RACK1)+Microenvironment+at+the+Head+Region+of+the+40S+Ribosome+with+Quantitative+BioID+in+Yeast.">Capturing the Asc1p/Receptor for Activated C Kinase 1 (RACK1) Microenvironment at the Head Region of the 40S Ribosome with Quantitative BioID in Yeast.</a> Mol Cell Proteomics. 16 (12), 2199-2218 (2017).</li><li>Mackmull, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Landscape+of+nuclear+transport+receptor+cargo+specificity.">Landscape of nuclear transport receptor cargo specificity.</a> Mol Syst Biol. 13 (12), 962 (2017).</li><li>Kim, D. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BioSITe:+A+Method+for+Direct+Detection+and+Quantitation+of+Site-Specific+Biotinylation.">BioSITe: A Method for Direct Detection and Quantitation of Site-Specific Biotinylation.</a> J Proteome Res. , (2017).</li><li>Udeshi, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibodies+to+biotin+enable+large-scale+detection+of+biotinylation+sites+on+proteins.">Antibodies to biotin enable large-scale detection of biotinylation sites on proteins.</a> Nat Methods. 14 (12), 1167-1170 (2017).</li><li>Chapat, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cap-binding+protein+4EHP+effects+translation+silencing+by+microRNAs.">Cap-binding protein 4EHP effects translation silencing by microRNAs.</a> P Natl Acad Sci USA. 114 (21), 5425-5430 (2017).</li><li>Luker, K. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinetics+of+regulated+protein-protein+interactions+revealed+with+firefly+luciferase+complementation+imaging+in+cells+and+living+animals.">Kinetics of regulated protein-protein interactions revealed with firefly luciferase complementation imaging in cells and living animals.</a> P Natl Acad Sci USA. 101 (33), 12288-12293 (2004).</li><li>De Munter, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Split-BioID:+a+proximity+biotinylation+assay+for+dimerization-dependent+protein+interactions.">Split-BioID: a proximity biotinylation assay for dimerization-dependent protein interactions.</a> FEBS Lett. 591 (2), 415-424 (2017).</li><li>Xue, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimizing+the+fragment+complementation+of+APEX2+for+detection+of+specific+protein-protein+interactions+in+live+cells.">Optimizing the fragment complementation of APEX2 for detection of specific protein-protein interactions in live cells.</a> Sci Rep. 7 (1), 12039 (2017).</li><li>Branon, T. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+TurboID+for+efficient+proximity+labeling+in+living+cells+and+organisms.">Directed evolution of TurboID for efficient proximity labeling in living cells and organisms.</a> bioRxiv. , (2017).</li></ol>

저자는 공개 없다.

개요 절차 플라스 미드, biotinylation 상호 작용 유도 대 한 테스트 하는 방법 및 질량 분석 분석에 대 한 biotinylated 단백질을 분리 하는 방법 분할 BioID에 관심사의 유전자를 복제 하는 방법을 설명 합니다. 여기 과도 transfection에 따라 절차를 설명 합니다. 융해 단백질의 표정은 dox 매체에 추가 금액에 의해 조정 될 수 있다, 그러나 과도 transfection 조잡 한 overexpress 융합 단백질은 내 생에 비교 될 때 일부 셀과 비 균질 단백질 식으로 이어질 수 있습니다. 대조 물입니다. 이 해당 interactomes의 왜곡 하 고 충실 하 게 내 인 성 단백질을 포함 하는 상호 작용을 반영 하지 않는 PPI로 이어질 수 있습니다. 그것은 따라서 일반적으로 분할 BioID 과도 시스템으로 설정 된 후 안정 된 세포를 구성 하는 것이 좋습니다. 플라스 미드 Flp 중재 재결합 시스템과 호환 되며 동일한 tet 응답 요소의 규정의 두 유전자 장소. 필요한 경우, 그리고 호환 포유류 세포와 함께 사용 하는 경우, 안정적인 유도할 수 있는 세포의 쉽게 만들을 수 있습니다. 예를 들어 우리 rtTA 항생물질 활성화 녹음 방송 활성 제와 항생물질 중재 하는 유전자 발현 단단히 규제12수 있는 독특한 대상 게놈 소재 시를 표현 하는 헬러-EM2-11 줄을 사용 합니다. 이 세포 선 및 재결합 Flp 중재를 사용 하 여, 2-3 주 이내는 transgene의 복사본을 하나만 포함 하는 안정적인 셀 라인을 얻을 수 있습니다. 또는, 하나 또한 관심사의 유전자의 네이티브 게놈 loci에 BirA * 조각 소개 현재 게놈 편집 기술을 사용할 수 있습니다.
태그는 단백질에 의존 하는 모든 분석 결과에서 하나 결과 융해 단백질 기능 인지 고려 해야 합니다. 사용할 수 있는 데이터는 관심사의 단백질 (GFP 이미징 연구에 대 한)와 예 태그 기능 테스트는 유용 BirA * 조각 한다 결정을 복제 상류 또는 하류 관심의 유전자. 이러한 데이터를 사용할 수 있는 하나 N 말기 테스트 해야 또는 C 말기 단백질 기능 분석 결과에 태그. 예를 들어 있는 생 단백질 노크 아웃 되었고 야생 타입 상황에 비해 셀 라인에서 융해 단백질의 활동을 테스트할 수 있습니다. 관심사의 단백질 모두 N 및 C 터미널 태그 경우, 둘 다 시험 되어야 한다. 실제로, BioID 실험, 융해 단백질의 방향22라벨의 효율성을 좌우할 수 있다. 또한, 우리는 관찰 그 때 분할 BioID 단백질의 쌍에 적용, 두 단백질의는 추가 중 하나는 NBirA * CBirA * 조각 또한 영향9라벨의 효율성. 분할-BioID 플라스 미드에는 16 아미노산 긴 글리신/떠들고 풍부한 링커 BirA * 조각에 관심사의 단백질을 결합 했다 다른 PCA23 에서 촬영 하 고 모든 상호 작용 단백질에 대 한 우리를 위해 일했다 테스트 했습니다 지금까지. 그러나, 하나는 일부 단백질 쌍 짧은 지 또는 긴지를 링커 함께 잘 작동 수 있습니다 고려해 야 합니다. 최종적인 노트의 또 다른 분석 결과 Bollen 그룹24에 의해 설명 되었다. 이 분석 결과에 BirA * 우리 (E256/G257) 보다 다른 사이트 (E140/Q141)에서 분할 됩니다. 우리 모두 분할 BioID 맛 측면-의해-측면 테스트 한 E256/G257,이 프로토콜에 설명 된 두 개의 상호 작용 단백질에 결합 될 때 더 강한 재 활성화를 이끌어 발견9.
이 방법의 1 개의 일반적인 결점은 라벨의 느린 속도. 일반적으로 6 ~ 24 h 보육 시간 biotin 감지할 수 biotinylation6, 단백질 복합물의 동적 개장 공부에 대 한이 기술의 사용을 제외를 얻을 필요가 있다. 이 분석 결과 부분적으로 상호 작용 하는 두 단백질 활성화만이 경고를 해결, 하는 동안 라벨의 저속 응답 매우 동적 프로세스 또는 짧은 단백질 분석 공부에 대 한 그것의 사용을 배제. 설계 된 과산화 효소 APEX2 1 분3이내 근 단백질의 효율적인 라벨 홍보로 알려져 있다. APEX2에 따라 PCA BioID 파생 분석 실험의 느린 표시 속도 한계를 주소 따라서 수 있습니다. 증거의 원리 연구 같은는 분할 APEX2 분석 결과25설명. 그러나, homodimerizing 단백질은 성공적으로 biotinylated, 증명 남아 여부 분석 결과 또한 사용할 수 있습니다 레이블 및 단백질 단백질 상호 작용의 한 쌍의 주위에 조립 확인 하. 최근 감독된 진화 했다 TurboID 그리고 miniTurbo, 10 분26으로 훨씬 짧은 표시 시간 창을 허용 하는 향상 된 활동의 BirA * 2 개의 이체를 만드는 데 사용 됩니다. 분할-BioID이 새로운 변종에 적응 추가 애플 리 케이 션의 광범위 한 분야에이 기술의 사용을 확장할 것입니다.

대부분 세포 기능 동적으로 조립 고분자 복합물 단백질에 의해 수행 됩니다, 단백질 단백질 상호 작용 (PPI)의 식별 생물 의학 연구에서 주요 노력 이다. 실제로, PPI 자주 질병에 폐지 하 고 치료제1에 대 한 잠재적인 목표를 나타냅니다. 가장 널리 사용 되는 메서드 PPI의 식별, 친 화력 정화 (AP) 접근을 위한 세포 세포의 용 해, 관심사의 단백질은 특히 행렬에 정화 하 고 관련된 단백질 질량 분석에 의해 확인 이후에 (MS)입니다. AP-MS는 강력한 접근, 그것은 일반적으로 수행 하지 않습니다 가난 하 게 녹는 단백질 복합물, 아주 일시적인 상호 작용 또는 subcellular 구조를 필요로 하는 PPI에 잘. 또한, 데이터의 해석 단일 단백질은 종종 여러 가지 단백질 복합물의 부분으로 PPI 네트워크의 동적 특성에 의해 복잡 될 수 있습니다.
BioID2 APEX23,4 등 근접 라벨 기술은 최근 AP MS 접근의 제한 사항 중 일부를 해결 하기 위해 개발 되었다. BioID에서 효소 BirA * (에 해당 하는 야생 타입 대장균 효소의 G115R 이체) catalyzes 정한 biotinyl-앰프 (바이오-앰프) 주 아민과 반응의 형성. 야생 타입 효소, 바이오-앰프의 활성 중심에 유지, 반대로 BirA * 해제 바이오 앰프 주변 환경에의 확산을 허용 합니다. 그러므로, 관심사의 단백질을 융합 하 고 셀에 표현, 근 단백질 biotinylated 10 nm5의 예상된 범위 내에서 될 수 있습니다. 이러한 근 위 표시는 다음 streptavidin 풀 다운에 의해 고립 된 단백질과 MS로 식별. AP-MS, 반대로 BioID 융합 단백질의 식이 필요합니다. 그것은 따라서만 적용할 수 있습니다 단백질 누구의 기능 태그 방해 하지. 또한, 라벨의 속도 느린, 일반적으로 6-24 h2,6, 도전 짧은 단백질의 탐지를 만들기. 아직, AP-MS에 비해, BioID MS 제공 합니다 여러 주요 장점: 첫 번째, 그 캡처 그들의 네이티브 셀룰러 환경에서 상호 작용 두 번째, 레이블이 단백질 보다는 조립된 단지 세포 세포의 용 해; 다음 격리 됩니다. 셋째, streptavidin pulldowns 변성 버퍼 및 거친 세척 상태를 사용 하 여 허용 합니다. 따라서, 방법은 더 과도 또는 약한 상호 작용7 또는 특정에서 발생 하는 상호 작용에 민감하고 subcellular 구조8을 하드입니다.
그러나, 대부분의 단백질 보통 세포 신호 또는 수행 해야 하는 함수에 개장 수 큰 단지의 일부입니다. 따라서, 단일 단백질은 일반적으로 여러 단지, 뚜렷한 기능 단위에 대응, 고유 포함 및 PPI 중복의 부분 이다. 두 방법 모두 게 주어진된 단백질이 있을 수 있습니다, 모든 협회의 개요를 제공 하지만 그들은 개별 PPI의 상황을 해결 하기 위해 실패 합니다. 후자의 해상도 높이기 위해 설계 된 단백질 조각을 보완성 분석 결과 (PCA)는 2 개의 비활성 파편 BirA * (촉매 도메인에 포함 된 NBirA *, 그리고 CBirA * 재 활성화 도메인으로 볼 수 있는)의 수에 재어셈블 때 가까이에 두는 활성 효소로 단백질9상호 작용. 결과 분할 BioID 분석 결과는 단백질 상호 작용 단백질의 쌍의 주위에 조립 및 따라서 컨텍스트 식별 종속 단백질 어셈블리에 근접 종속 biotinylation을 집중 한다. 우리는 최근 중재 하는 miRNA 유전자 침묵 통로9에 관련 된 두 가지 단백질 복합물을 해결 하 여 분할-BioID의 뛰어난 해상도 파워를 시연.
전부, 단일 및 간단한 분석 결과, 분할 BioID 수 있습니다 발견 하 고 구체적으로 정의 된 기능 단위는 주어진된 단백질 관련, 해당 단백질 복잡 한의 추가 상호 작용 단백질 알려져 제공에 PPI를 할당.

<table><tbody><tr><td>Acetic acid (glacial)</td><td>VWR</td><td>20104.298</td><td>To make TAE buffer</td></tr><tr><td>Agarose</td><td>Sigma</td><td>A9539</td><td>Take TAE-agarose gels for DNA analysis and extraction</td></tr><tr><td>Ammonia solution 25% NH&lt;sub&gt;3&lt;/sub&gt;</td><td>Bernd Kraft</td><td>6012</td><td>To dissolve biotin</td></tr><tr><td>Ampicillin</td><td>Sigma</td><td>A9518</td><td>To select transformed bacteria</td></tr><tr><td>Bioruptor plus sonification device</td><td>Diagenode</td><td>B01020001</td><td>Other sonification devices are also ok</td></tr><tr><td>Biotin</td><td>Sigma</td><td>B4639</td><td>To be added to the growth medium to stimulate efficient biotinylation</td></tr><tr><td>Bovine serum albumin fraction V</td><td>Carl Roth</td><td>8076</td><td>Used in Western blot buffers and a protein standard in Bradford assays</td></tr><tr><td>Bradford Ultra reagent</td><td>Expedeon</td><td>BFU05L</td><td>Any other method/kit for protein determination is fine, this particular reagent is more tolerant to detergent than other Bradford reagents</td></tr><tr><td>Cell scrappers</td><td>TPP</td><td>99002</td><td>Any other model is also fine</td></tr><tr><td>ClaI</td><td>New England Biolabs</td><td>R0197</td><td>Restriction enzyme for cloning into the split-BioID plasmids (NBirA* fusion)</td></tr><tr><td>DMEM medium</td><td>Sigma</td><td>D6046</td><td>If using another cell line, use the corresponding optimal growth medium</td></tr><tr><td>DNA miniprep kit</td><td>Sigma</td><td>PLN350</td><td>Any other kit is also fine</td></tr><tr><td>Doxycycline</td><td>Applichem</td><td>A2951</td><td>Dox is light sensitive</td></tr><tr><td>DTT</td><td>Applichem</td><td>A2948</td><td>Make 1M stock solution, store at -20 &amp;deg;C and always use fresh</td></tr><tr><td>DyLight 680-conjugated streptavidin</td><td>Thermo scientific</td><td>21848</td><td>to use with a LiCor Western blot scanning device</td></tr><tr><td>Dynabeads MyOne Streptavidin C1</td><td>Invitrogen</td><td>65002</td><td>The C1 beads are not BSA coated which is preferable for downstream MS applications (no leakthrough of BSA in the final elution)</td></tr><tr><td>EDTA</td><td>Applichem</td><td>A5097</td><td>Make a 500 mM stock, adjust pH to 8 while dissolving the EDTA powder</td></tr><tr><td>Ethanol</td><td>Sigma</td><td>32205</td><td>Make a 70% stock solution in which Doxycycline can be dissolved at 10 mg.mL&lt;sup&gt;-1&lt;/sup&gt;</td></tr><tr><td>Fastgene Gel/PCR DNA Extraction Kit</td><td>Nippon Genetics</td><td>FG-91302</td><td>Any other kit is also fine</td></tr><tr><td>HCl 37%</td><td>Merck</td><td>1.00317.1000</td><td>To adjust pH of biotin stock solution</td></tr><tr><td>HEPES</td><td>Carl Roth</td><td>6763</td><td>Make a 500 mM stock solution, adjust the pH to 7.4</td></tr><tr><td>Immobilon-FL PVDF membrane, 0.45&amp;nbsp;&amp;micro;m</td><td>Millipore</td><td>IPFL00010</td><td>This membrane shows minimal autofluorescence when used with a LiCor Western blot scanning device</td></tr><tr><td>LiCl</td><td>Gr&amp;uuml;ssing GmbH</td><td>12083</td><td>Make a 5M stock solution</td></tr><tr><td>Odyssey CLx imaging system</td><td>LI-COR</td><td>N/A</td><td>To scan Western blot membrane decorated with fluorophore-labeled antibody</td></tr><tr><td>Linear polyethylenimine (PEI)</td><td>Polysciences</td><td>23966-2</td><td>Any other transfection reagent is also fine</td></tr><tr><td>Milk powder</td><td>Carl Roth</td><td>T145</td><td>To block Western blot membranes</td></tr><tr><td>MluI-HF</td><td>New England Biolabs</td><td>R3198</td><td>Restriction enzyme for cloning into the split-BioID plasmids (NBirA* fusion)</td></tr><tr><td>Na-deoxycholate</td><td>Sigma</td><td>30970</td><td>Make a 10% (w/v) stock solution</td></tr><tr><td>NaCl</td><td>Sigma</td><td>31434</td><td>Make a 5M stock solution</td></tr><tr><td>NP-40 (Nonidet P40 substitute)</td><td>Sigma</td><td>74385</td><td>Make a 20% (v/v) stock solution</td></tr><tr><td>PacI</td><td>New England Biolabs</td><td>R0547</td><td>Restriction enzyme for cloning into the split-BioID plasmids (CBirA* fusion)</td></tr><tr><td>Phosphate buffer saline (PBS)</td><td>Sigma</td><td>806552</td><td>To wash cells before scrapping</td></tr><tr><td>PmeI</td><td>New England Biolabs</td><td>R0560</td><td>Restriction enzyme for cloning into the split-BioID plasmids (CBirA* fusion)</td></tr><tr><td>Protease inhibitor cocktail</td><td>Roche</td><td>4693132001</td><td>Added to the lysis buffer to prevent protein degradation</td></tr><tr><td>pSF3-Flag-CBir-FRB_Myc-NBir-FKBP</td><td>Addgene</td><td>90003</td><td>Split-BioID plasmid, mediates the co-expression of NBirA*-FKBP and CBirA*-FRB, FKBP and FRB can be replaced by two other ORFs</td></tr><tr><td>pSF3-Flag-CBir-FRB_FKBP-Myc-Nbir</td><td>Addgene</td><td>90004</td><td>Split-BioID plasmid, mediates the co-expression of FKBP-NBirA* and CBirA*-FRB, FKBP and FRB can be replaced by two other ORFs</td></tr><tr><td>pSF3-Flag-FRB-Cbir_Myc-NBir-FKBP</td><td>Addgene</td><td>90008</td><td>Split-BioID plasmid, mediates the co-expression of NBirA*-FKBP and FRB-CBirA*, FKBP and FRB can be replaced by two other ORFs</td></tr><tr><td>pSF3-Flag-FRB-Cbir_FKBP-Myc-Nbir</td><td>Addgene</td><td>90009</td><td>Split-BioID plasmid, mediates the co-expression of FKBP-NBirA* and FRB-CBirA*, FKBP and FRB can be replaced by two other ORFs</td></tr><tr><td>Q5 High-Fidelity PCR kit</td><td>New England Biolabs</td><td>E0555S</td><td>To amplify the ORF coding for the proteins to be tested. Any other thermostable DNA polymerase is fine.</td></tr><tr><td>Quick ligation kit</td><td>New England Biolabs</td><td>M2200S</td><td>To ligate DNA fragments into the split-BioID plasmids, any other DNA ligation system is fine.</td></tr><tr><td>RunBlue 4-20% SDS precast gels</td><td>Expedeon</td><td>BCG42012</td><td>To use when running samples for MS analysis</td></tr><tr><td>RunBlue LDS Sample Buffer</td><td>Expedeon</td><td>NXB31010</td><td>Running buffer for the RunBlue precast gels</td></tr><tr><td>SDS</td><td>Sigma</td><td>5030</td><td>Comes as a 20% stock solution</td></tr><tr><td>tet-free serum</td><td>Biowest</td><td>S181T</td><td>we use tet-free serum to minimize basal expression of the fusion proteins</td></tr><tr><td>Trans-Blot Turbo Transfer system</td><td>Bio-Rad</td><td>1704150</td><td>High speed Western blotting transfer system, any other transfer system is also fine</td></tr><tr><td>Tris</td><td>Carl Roth</td><td>4855</td><td>Make 1M stock solutions with adequate pH (7.4 and 8)</td></tr><tr><td>Triton X-100</td><td>Applichem</td><td>A4975</td><td>Make a 20% (v/v) stock solution</td></tr><tr><td>Tween-20</td><td>Carl Roth</td><td>9127</td><td>Used in Western blot buffers, Tween 20 leads to high background fluorescence and should be omitted in the blocking and last wash step</td></tr></tbody></table>

split-bioid &#8212; proteomic analysis of context-specific protein complexes in their native cellular environment

기존 친 화력 정화 (AP)를 보완 하기 위해 단백질 단백질 상호 작용 (PPI)의 식별에 대 한 접근, 효소는 살아있는 세포에 있는 단백질의 근접-종속 라벨 수 있도록 도입 되었습니다. 하나 같은 효소, BirA * (BioID 접근에서 사용), 중재 약 10의 범위 내에서 단백질의 biotinylation nm. 그러므로, 관심사의 단백질을 융합 하 고 셀에 표현, 그것은 그들의 네이티브 환경에서 근 단백질의 라벨 수 있습니다. 조립된 단백질 복합물의 정화에 의존 하는 AP, 반대로 BioID 아무리 여부 그들은 여전히와 상호 작용 하 관심사의 단백질 들은 고립 된 세포 내에서 표시 된 단백질을 감지 합니다. 이후 biotinylates 근 단백질, 하나 그들을 매우 효율적으로 biotin에 streptavidin의 뛰어난 선호도에 투자 또한 수 있습니다. BioID 식별 과도 또는 약한 상호 작용에 대 한 AP 보다 더 나은 수행 하는 동안 두 AP 및 BioID 질량 분석 방법 주어진된 단백질이 있을 수 있습니다 모든 가능한 상호 작용에 대 한 개요를 제공 합니다. 그러나, 그들은 각 확인 된 PPI의 맥락에서 정보를 제공 하지 않습니다. 실제로, 대부분의 단백질 일반적으로 뚜렷한 성숙 단계 나 다른 기능 단위에 해당 하는 여러 단지의 일부입니다. 두 방법의 일반적인 제한이를 해결 하기 위해 우리 BirA * 효소에 따라 단백질 조각 보완성 분석 결과 설계 했습니다. 이 분석 결과에 BirA *의 2 개의 비활성 파편 수 때 가까운 근접에서 있는 그들은 융합 하는 두 개의 상호 작용 단백질에 의해 활성 효소로 재조 립. 결과 분할 BioID 분석 결과 따라서 단백질 단백질 상호 작용의 한 쌍의 주위에 조립의 라벨 수 있습니다. 이 두 가지는 주어진 컨텍스트에서 상호, 제공 분할 BioID 그들의 네이티브 셀룰러 환경에서 특정 컨텍스트에 종속 기능 단위 분석을 다음 수 있습니다. 여기, 우리는 테스트 하 고 분할-BioID 상호 작용 단백질의 쌍에 적용 하는 단계별 프로토콜을 제공 합니다.

어떻게이 방법은, Ago2, 단백질의 열려있는 독서 프레임 (ORFs) 설명 하기 위해 TNRC6C 및 Dicer (모든 통로 입을 미르 중재 하는 유전자에 관련 된) 분할 BioID 플라스 미드에 복제 되었다. Ago2는 미르 유도 입을 단지 내 (miRISC)를 번역 명과 TNRC6C 상호 작용 및 대상 mRNAs14의 자극으로 알려져 있다. MiRISC, Ago2를 조립 하기 전에 Dicer, 성숙한 miRNAs는 그것 미르15로드 받을 수 있습니다 단지 내를 생성 하는 효소와 상호 작용. 따라서 분할 BioID Ago2/Dicer 쌍 또는 Ago2/TNRC6C 쌍에 적용 되었습니다. 테스트 단백질의 각 쌍에 대 한 Ago2 중 NBirA * 또는 CBirA * 우리의 분할 BioID 플라스 미드 (그림 2)를 사용 하 여 융합 Dicer와 TNRC6C는 해당 동족 BirA *를 조각 했다. 또한, 각 단백질에 CBirA * 융합 되었고와 NBirA *-부정적인 컨트롤로 GFP 융해. 이 테스트 단백질 (표 1)의 각 쌍에 대 한 4 개의 반복 테스트 결과.
분할 BioID 테스트 단백질의 쌍의 상호 작용에 따라 활성화 되어 있는지 여부를 테스트 하려면 우리는 그림 1에 표시 된 구성표를 따 랐 다. 플라스 미드는 tet 시스템 호환 HeLa 세포 라인에 페 뚜렷이 했다. 융해 단백질의 표정 doxycycline (dox)와 유도 되었다 그리고 biotinylation 성장 매체를 초과 biotin을 추가 하 여 자극 했다. Dox와 biotin 20 h 보육 시간, 다음 셀 lysed 되었고 서 부 럽 활용된 streptavidin를 사용 하 여 biotinylated 단백질을 검출 하 여 분석. 포유류 세포에서 두 주요 밴드 활용된 streptavidin untransfected 샘플 (그림 3, 별)에 의해 일반적으로 검색 하 고 endogenously biotinylated 단백질 (대부분의 아마 미토 콘 드 리아 carboxylases)에 해당. 이 두 밴드가 모든 샘플에는 내부 로드 컨트롤으로 편리 하 게 사용할 수 있습니다, 그리고 따라서, 동일한 단백질의 로딩을 제어 하는 가사 단백질의 검출은 불필요. BioID/분할-BioID 실험에 대 한 일반적인, 관찰 될 수 있다 추가 주요 밴드는 자체 biotinylated 있어 융해 단백질. 다른 biotinylated 단백질을 볼 경우에 이미이 단계에서 융합 단백질의 biotinylation를 감지 두 테스트 단백질 세포에 상호 작용을 나타냅니다. 그림 3에 표시 하는 실험에서 그것은 NBirA *는 데 분명-CBirA * TNRC6C 또는 Dicer 융해와 Ago2 융합 단백질에는 CBirA * 반대 조합 보다 더 효율적입니다-Ago2 NBirA * 다른 2의 융해를 결합 하 여 단백질 (그림 3, 위쪽 패널, 차선 2-3 차선 6-7의 농도 비교). 또한, 활성화 했다 특정 CBirA * 융해의 없음 활성화 수 NBirA *-GFP 제어 융합 단백질 감지할 수 수준 (그림 3, 비교 레인 1, 4-5 untransfected 세포에 해당 하는 8 레인). 와 있기 때문에 우리의 플라스 미드 NBirA * myc 태그 CBirA * 플래그 태그 (그림 2)는, 이러한 두 태그 (그림 3, 하단 패널)에 대 한 항 체와 각 융해 단백질의 표정 수준은 분석할 수 있습니다.
상호 작용 유도 biotinylation, 관찰 실험, 조정 될 수 있다 고 biotinylated 단백질 프로토콜 (그림 4)의 제 4에에서 표시 된 대로 streptavidin 결합 된 구슬에 격리. 처음으로 격리를 수행할 때 서쪽 더 럽 히 (그림 5) 정화의 모든 단계를 분석할 수 있습니다. 일반적으로, 바인딩 구슬에는 거의 양적 고 거의 통해 아무 누출은 세척 관찰 한다. 이전 질량 분석을 위한 샘플 처리, 유도-biotinylation 예상 대로 작동 하 고 융합 단백질 표현 되었다 서쪽 오 점 실행 권장 합니다. 표현의 융해 단백질의 부족 가난한 transfection 효율 또는 결함이 dox 유도 중 하나 이다. 융해 단백질 표현 되었다 그러나 아무 biotinylation 관찰, 경우 초과 biotin (50 μ M) 매체에 실제로 추가 했다 하 고 주식 biotin 여전히 활성 상태 인지 확인 합니다. Eluted 소재 Coomassie 스테인드 단백질 젤 (그림 6)에 일반적으로 분석은, 관찰 될 강한 밴드 약 17 kDa에 실행 하 고 해당 단위체 streptavidin 하. 밴드 내 생 biotinylated 단백질 및 융합 단백질에 해당 하는 또한 관찰 될 수 있습니다. 우리는 일반적으로 streptavidin 밴드 잘 로딩 (그림 6)까지 위의 샘플 레인의 영역을 삭제할. 삭제 밴드 1.5 mL 튜브에 저장 하 고 질량 분석 시설에 보낼 수 있습니다. 또는 바운드 단백질 결합 하는 streptavidin 구슬에 트립 신 소화 수도 있습니다 하 고 열을 형성 하는 eluted 소화 펩 티 드. 우리가 일상적으로 MaxQuant 소프트웨어16 (주로 기본 매개 변수를 사용 하 여 및 참조 9 및 일반적인 MS 결과 대 한 자세한 내용은 참조 가능한 포스트 번역 상 수정 추가 리 biotinylation,)를 사용 하 여 MS 원시 데이터를 분석 하 고 페르세우스 스위트17 후속 통계 분석을 위해 모두 자유 소프트웨어. 샘플 3 개의 생물 복제에 일반적으로 실행 됩니다. 레이블 없는 정량화를 사용 하 여, 특히 농축된 단백질 제어 상태에 확인할 수 있습니다. Endogenously biotinylated 단백질 및 단백질 비 특히 BirA * 효소에 의해 표시를 필터링 하려면 우리만 크게 6 없는 단백질 생성 된 6 개의 데이터 집합에서 히트 이상의 농축 단백질을 고려 하십시오. 또한, 우리는 NBirA * 퓨전 단백질 대체 되었다 NBirA * 분할 BioID 데이터 집합을 통해 풍성 하 게 안타 고려-GFP. 특히 세포 배양 (SILAC) 양이 많은 proteomics18아미노산 안정 동위 원소 라벨을 사용 하 여 다른 데이터 분석 전략 제안 되었습니다. 또한, 다양 한 전략의 biotinylated 펩 티 드를 사용 하 여 streptavidin 변종 약화 선호도 biotin18, 유기 용 제19 또는 biotin을 사용 하 여 특별 한 차입 조건을 직접 격리에 대 한 설명 되었습니다. 항 체20,21. 반드시 더 많은 단백질의 발견에 지도, 하는 동안 안타의 특이성으로 더 많은 자신감을 추가 하는 biotinylation 사이트의 식별 하 고 유용 때 상호 작용의 토폴로지를 주소입니다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57479/57479fig1.jpg"> 그림 1: 분할 BioID 절차의 개요. 단백질 1 상호 작용 단백질 2 복잡 한 A의 한 부분으로 또는 복잡 한 b.의 한 부분으로 단백질 3 특별히 복잡 한 A의 구성, 분할 BioID 단백질 1와 2에 적용할 수 있습니다. 질량 분석기의 사진 크리에이 티브 코몬즈 저작자 표시-공유 모두 3.0 Unported 라이센스 이며 https://commons.wikimedia.org ThermoScientificOrbitrapElite.JPG의 파일 이름에서 다운로드 한. <a href="/files/ftp_upload/57479/57479fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57479/57479fig2.jpg"> 그림 2: 분할 BioID 플라스 미드의 식 카세트. 4 개의 플라스 미드 NBirA * 및 CBirA * 융해 단백질의 모든 조합을 테스트할 수 있도록 제공 합니다. 플라스 미드 및 완전 한 지도 표시 번호 addgene.org에서 사용할 수 있습니다. 플라스 미드 tet 응답 요소 (7 x tetO) 및 tet 식 시스템과 호환 되는 셀 라인에 사용 해야. 또한 모든 플라스 미드에 ORFs의 FKBP와 FRB는 융합 NBirA * 및 CBirA * 조각 각각 note. Rapamycin의 존재만이 두 가지 단백질 작용 하 고 따라서 신속 하 게이 화학9의 유무에 시스템을 테스트 하는 플라스 미드를 사용할 수 있습니다. 표시 제한 사이트 독특합니다. <a href="/files/ftp_upload/57479/57479fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57479/57479fig3.jpg"> 그림 3: 분할 BioID 실험에 대 한 전형적인 서쪽 오 점. 상단 패널: 붙일 레이블된 streptavidin와 biotinylated 단백질의 검출. 하단 패널: 안티 Myc 및 반대로 플래그 항 체 융합 단백질의 검출. 단백질의 2 개 쌍에서 시험 되었다: Ago2/TNRC6C 및 Ago2/Dicer. 2 & 3 차선에서 Ago2 CBirA * 조각에 추가 했다. 레인 6 & 7, Ago2 NBirA * 조각에 추가 했다. 중요 한 신호 때 세 가지 단백질의 결합 했다 NBirA * 관찰 되었다-GFP (레인 1, 4-5). 별 내부 로드 컨트롤로 사용할 수 있는 endogenously biotinylated 단백질에 해당 하는 밴드를 나타냅니다. 이 그림은 그림 5B Schopp 외 의에서 적응 크리에이 티브 코몬즈 저작자 표시 4.0 국제 라이센스 하에서 9 . <a href="/files/ftp_upload/57479/57479fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57479/57479fig4.jpg"> 그림 4: streptavidin 풀 다운 절차의 개요. 질량 분석 분석에 대 한 biotinylated 단백질의 격리에 대 한 주요 단계 묘사 된다. <a href="/files/ftp_upload/57479/57479fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57479/57479fig5.jpg"> 그림 5: streptavidin 풀 다운 실험에 대 한 전형적인 서쪽 오 점. 표시 된 각 샘플의 볼륨을 동등 했다 SDS polyacrylamide 젤에 로드 된. 부 럽, 다음 biotinylated 단백질 결합 하는 HRP streptavidin과 감지 했다. NBirA *에 해당 하는 밴드-TNRC6C 및 CBirA *-Ago2 표시 됩니다. <a href="/files/ftp_upload/57479/57479fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/57479/57479fig6.jpg"> 그림 6: 질량 분석 분석에 대 한 일반적인 Coomassie 스테인드 단백질 젤. 결합 하는 streptavidin 구슬에서 eluted 샘플 캐스트 단백질 젤에 로드 하 고 샘플 2-3 cm를 마이그레이션할 때까지 실행 했다. 약 17 kDa에서 본 주요 밴드 streptavidin 이다. 바로 그 밴드 위에 지역 excised 이며 질량 분석 시설에 보낸. NBirA *에 해당 하는 밴드-TNRC6C 및 CBirA *-Ago2 표시 됩니다. <a href="/files/ftp_upload/57479/57479fig6large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Transfection 샘플</td>
			<td colspan="3">테스트 조건</td>
		</tr>
<tr>
<td>1</td>
			<td colspan="3">NBirA *-protein1 / CBirA *-protein2</td>
		</tr>
<tr>
<td>2</td>
			<td colspan="3">CBirA *-protein1 / NBirA *-protein2</td>
		</tr>
<tr>
<td>3</td>
			<td colspan="3">NBirA *-GFP / CBirA *-protein1</td>
		</tr>
<tr>
<td>4</td>
			<td colspan="3">NBirA *-GFP / CBirA *-protein2</td>
		</tr>
<tr>
<td>5</td>
			<td colspan="3">아니 transfection</td>
		</tr>
</tbody></table>표 1: 일반적으로 2 개의 단백질에 분할-BioID를 적용할 때 조건을 테스트.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>시퀀싱 뇌관</td>
			<td>시퀀스</td>
		</tr>
<tr>
<td>카세트 1 역 뇌관 (CBirA * 퓨전)</td>
			<td>TATACTTTCTAGAGAATAGGAAC</td>
		</tr>
<tr>
<td>카세트 2 역 뇌관 (NBirA * 퓨전)</td>
			<td>GTGGTTTGTCCAAACTCATC</td>
		</tr>
</tbody></table>표 2: 시퀀싱 분할 BioID 플라스 미드를 위한 뇌관.

Watch this Scientific Journal Video about Split-BioID â€” Proteomic Analysis of Context-specific Protein Complexes in Their Native Cellular Environment at JoVE.com

Split-BioID &#8212; Proteomic Analysis of Context-specific Protein Complexes in Their Native Cellular Environment

우리는 분할-BioID, 근접 라벨 기술 BioID에 따라 단백질 조각-보완성 분석 결과 대 한 단계별 프로토콜을 제공 합니다. 두 주어진된 단백질의 상호 작용 활성화, 그것은 그들의 네이티브 셀룰러 환경에서 맞는 단백질 복합물의 proteomics 분석을 수 있습니다. 간단 하 고 비용 효율적인 메서드와 표준 실험실 장비에만 필요 합니다.

그들의 네이티브 셀룰러 환경에서 상황에 맞는 단백질 복합물의 분할-BioID-Proteomic 분석

To complement existing affinity purification (AP) approaches for the identification of protein-protein interactions (PPI), enzymes have been introduced ...

split-bioid-proteomic-analysis-context-specific-protein-complexes

Nanyang Technological University

Research

JoVE Journal

Biochemistry

19.6K 조회수.  Heidelberg University. 우리는 분할-BioID, 근접 라벨 기술 BioID에 따라 단백질 조각-보완성 분석 결과 대 한 단계별 프로토콜을 제공 합니다. 두 주어진된 단백질의 상호 작용 활성화, 그것은 그들의 네이티브 셀룰러 환경에서 맞는 단백질 복합물의 proteomics 분석을 수 있습니다. 간단 하 고 비용 효율적인 메서드와 표준 실험실 장비에만 필요 합니다.

비디오: Split-BioID — Proteomic Analysis of Context-specific Protein Complexes in Their Native Cellular Environment

Protein Complex Affinity Capture from Cryomilled Mammalian Cells

Affinity capture is an effective technique for isolating endogenous protein complexes for further study. When used in conjunction with an antibody, this technique is also frequently referred to as immunoprecipitation. Affinity capture can be applied in a bench-scale and in a high-throughput context. When coupled with protein mass spectrometry, affinity capture has proven to be a workhorse of interactome analysis. Although there are potentially many ways to execute the numerous steps involved, the following protocols implement our favored methods. Two features are distinctive: the use of cryomilled cell powder to produce cell extracts, and antibody-coupled paramagnetic beads as the affinity medium. In many cases, we have obtained superior results to those obtained with more conventional affinity capture practices. Cryomilling avoids numerous problems associated with other forms of cell breakage. It provides efficient breakage of the material, while avoiding denaturation issues associated with heating or foaming. It retains the native protein concentration up to the point of extraction, mitigating macromolecular dissociation. It reduces the time extracted proteins spend in solution, limiting deleterious enzymatic activities, and it may reduce the non-specific adsorption of proteins by the affinity medium. Micron-scale magnetic affinity media have become more commonplace over the last several years, increasingly replacing the traditional agarose- and Sepharose-based media. Primary benefits of magnetic media include typically lower non-specific protein adsorption; no size exclusion limit because protein complex binding occurs on the bead surface rather than within pores; and ease of manipulation and handling using magnets.

Here we describe protocols to disrupt mammalian cells by solid-state milling at a cryogenic temperature, produce a cell extract from the resulting cell powder, and isolate protein complexes of interest by affinity capture upon antibody-coupled micron-scale paramagnetic beads.

Cryomilled 포유 동물 세포에서 단백질 단지 선호도 캡처

Affinity capture is an effective technique for isolating endogenous protein complexes for further study. When used in conjunction with an antibody, this ...

연구

생화학

Resolving Affinity Purified Protein Complexes by Blue Native PAGE and Protein Correlation Profiling

Most proteins act in association with others; hence, it is crucial to characterize these functional units in order to fully understand biological processes. Affinity purification coupled to mass spectrometry (AP-MS) has become the method of choice for identifying protein-protein interactions. However, conventional AP-MS studies provide information on protein interactions, but the organizational information is lost. To address this issue, we developed a strategy to unravel the distinct functional assemblies a protein might be involved in, by resolving affinity-purified protein complexes prior to their characterization by mass spectrometry. Protein complexes isolated through affinity purification of a bait protein using an epitope tag and competitive elution are separated through blue native electrophoresis. Comparison of protein migration profiles through correlation profiling using quantitative mass spectrometry allows assignment of interacting proteins to distinct molecular entities. This method is able to resolve protein complexes of close molecular weights that might not be resolved by traditional chromatographic techniques such as gel filtration. With little more work than conventional AP-geLC-MS/MS, we demonstrate this strategy may in many cases be adequate for obtaining protein complex topological information concomitantly to identifying protein interactions.

Here we present protocols for affinity purification of protein complexes and their separation by blue native PAGE, followed by protein correlation profiling using label free quantitative mass spectrometry. This method is useful to resolve interactomes into distinct protein complexes.

블루 기본 페이지와 단백질 상관 관계 프로파일 링에 의한 선호도 정제 단백질 복합체 해결

Most proteins act in association with others; hence, it is crucial to characterize these functional units in order to fully understand biological ...

Identification of protein complexes with quantitative proteomics in S. cerevisiae

Lipids are the building blocks of cellular membranes that function as barriers and in compartmentalization of cellular processes, and recently, as important intracellular signalling molecules. However, unlike proteins, lipids are small hydrophobic molecules that traffic primarily by poorly described nonvesicular routes, which are hypothesized to occur at membrane contact sites (MCSs). MCSs are regions where the endoplasmic reticulum (ER) makes direct physical contact with a partnering organelle, e.g., plasma membrane (PM). The ER portion of ER-PM MCSs is enriched in lipid-synthesizing enzymes, suggesting that lipid synthesis is directed to these sites and implying that MCSs are important for lipid traffic. Yeast is an ideal model to study ER-PM MCSs because of their abundance, with over 1000 contacts per cell, and their conserved nature in all eukaryotes. Uncovering the proteins that constitute MCSs is critical to understanding how lipids traffic is accomplished in cells, and how they act as signaling molecules. We have found that an ER called Scs2p localize to ER-PM MCSs and is important for their formation. We are focused on uncovering the molecular partners of Scs2p. Identification of protein complexes traditionally relies on first resolving purified protein samples by gel electrophoresis, followed by in-gel digestion of protein bands and analysis of peptides by mass spectrometry. This often limits the study to a small subset of proteins. Also, protein complexes are exposed to denaturing or non-physiological conditions during the procedure. To circumvent these problems, we have implemented a large-scale quantitative proteomics technique to extract unbiased and quantified data. We use stable isotope labeling with amino acids in cell culture (SILAC) to incorporate staple isotope nuclei in proteins in an untagged control strain. Equal volumes of tagged culture and untagged, SILAC-labeled culture are mixed together and lysed by grinding in liquid nitrogen. We then carry out an affinity purification procedure to pull down protein complexes. Finally, we precipitate the protein sample, which is ready for analysis by high-performance liquid chromatography/ tandem mass spectrometry. Most importantly, proteins in the control strain are labeled by the heavy isotope and will produce a mass/ charge shift that can be quantified against the unlabeled proteins in the bait strain. Therefore, contaminants, or unspecific binding can be easily eliminated. By using this approach, we have identified several novel proteins that localize to ER-PM MCSs. Here we present a detailed description of our approach. 

Here we describe a new quantitative proteomics technique for identifying protein complexes in Saccharomyces cerevisiae. In this study, we have used the SILAC method together with affinity purification followed by tandem mass spectrometry to identify with high specificity the binding partners of an ER protein, Scs2p.

S. cerevisiae의의 양적 proteomics와 단백질 단지의 식별

Lipids are the building blocks of cellular membranes that function as barriers and in compartmentalization of cellular processes, and recently, as ...

생물학

High-Resolution Complexome Profiling by Cryoslicing BN-MS Analysis

Proteins generally exert biological functions through interactions with other proteins, either in dynamic protein assemblies or as a part of stably formed complexes. The latter can be elegantly resolved according to molecular size using native polyacrylamide gel electrophoresis (BN-PAGE). Coupling of such separations to sensitive mass spectrometry (BN-MS) has been well-established and theoretically allows for exhaustive assessment of the extractable complexome in biological samples. However, this approach is rather laborious and provides limited complex size resolution and sensitivity. Also, its application has remained restricted to abundant mitochondrial and plastid proteins. Thus, for a majority of proteins, information regarding integration into stable protein complexes is still lacking. Presented here is an optimized approach for complexome profiling comprising preparative-scale BN-PAGE separation, sub-millimeter sampling of broad gel lanes by cryomicrotome slicing, and mass spectrometric analysis with label-free protein quantification. The procedures and tools for critical steps are described in detail. As an application, the report describes complexome analysis of a solubilized endosome-enriched membrane fraction from mouse kidneys, with 2,545 proteins profiled in total. The results demonstrate identification of uniform, low-abundance membrane proteins such as intracellular ion channels as well as high resolution, complex protein assembly patterns, including glycosylation isoforms. The results are in agreement with independent biochemical analyses. In summary, this methodology allows for comprehensive and unbiased identification of protein (super)complexes and their subunit composition, providing a basis for investigating stoichiometry, assembly, and interaction dynamics of protein complexes in any biological system.

A versatile cryoslicing BN-MS protocol using a microtome is presented for high-resolution complexome profiling.

BN-MS 분석에 의한 고분해능 컴플렉스 프로파일링

Proteins generally exert biological functions through interactions with other proteins, either in dynamic protein assemblies or as a part of stably formed ...

Analyzing Protein Architectures and Protein-Ligand Complexes by Integrative Structural Mass Spectrometry

Proteins are an important class of biological macromolecules that play many key roles in cellular functions including gene expression, catalyzing metabolic reactions, DNA repair and replication. Therefore, a detailed understanding of these processes provides critical information on how cells function. Integrative structural MS methods offer structural and dynamical information on protein complex assembly, complex connectivity, subunit stoichiometry, protein oligomerization and ligand binding. Recent advances in integrative structural MS have allowed for the characterization of challenging biological systems including large DNA binding proteins and membrane proteins. This protocol describes how to integrate diverse MS data such as native MS and ion mobility-mass spectrometry (IM-MS) with molecular dynamics simulations to gain insights into a helicase-nuclease DNA repair protein complex. The resulting approach provides a framework for detailed studies of ligand binding to other protein complexes involved in important biological processes.

Mass spectrometry (MS) has emerged as an important tool for the investigation of structure and dynamics of macromolecular assemblies. Here, we integrate MS-based approaches to interrogate protein complex formation and ligand binding.

단백질 구조와 통합 구조 질량 분석, 단백질-리간드 단지 분석

Proteins are an important class of biological macromolecules that play many key roles in cellular functions including gene expression, catalyzing ...

화학

JUMPn: A Streamlined Application for Protein Co-Expression Clustering and Network Analysis in Proteomics

With recent advances in mass spectrometry-based proteomics technologies, deep profiling of hundreds of proteomes has become increasingly feasible. However, deriving biological insights from such valuable datasets is challenging. Here we introduce a systems biology-based software JUMPn, and its associated protocol to organize the proteome into protein co-expression clusters across samples and protein-protein interaction (PPI) networks connected by modules (e.g., protein complexes). Using the R/Shiny platform, the JUMPn software streamlines the analysis of co-expression clustering, pathway enrichment, and PPI module detection, with integrated data visualization and a user-friendly interface. The main steps of the protocol include installation of the JUMPn software, the definition of differentially expressed proteins or the (dys)regulated proteome, determination of meaningful co-expression clusters and PPI modules, and result visualization. While the protocol is demonstrated using an isobaric labeling-based proteome profile, JUMPn is generally applicable to a wide range of quantitative datasets (e.g., label-free proteomics). The JUMPn software and protocol thus provide a powerful tool to facilitate biological interpretation in quantitative proteomics.

We present a systems biology tool JUMPn to perform and visualize network analysis for quantitative proteomics data, with a detailed protocol including data pre-processing, co-expression clustering, pathway enrichment, and protein-protein interaction network analysis.

JUMPn: 프로테오믹스의 단백질 공동 발현 클러스터링 및 네트워크 분석을 위한 간소화된 응용 프로그램

With recent advances in mass spectrometry-based proteomics technologies, deep profiling of hundreds of proteomes has become increasingly feasible. ...

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification (BiCAP)

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research is deciphering how these dynamic protein complexes act to integrate signals from multiple sources in order to direct a specific biological response, and how this becomes deregulated in many disease settings. Despite the importance of this key biochemical mechanism, there is a lack of experimental techniques that can facilitate the specific and sensitive deconvolution of these multi-molecular signaling complexes.
Here this shortcoming is addressed through the combination of a protein complementation assay with a conformation-specific nanobody, which we have termed Bimolecular Complementation Affinity Purification (BiCAP). This novel technique facilitates the specific isolation and downstream proteomic characterization of any pair of interacting proteins, to the exclusion of un-complexed individual proteins and complexes formed with competing binding partners. 
The BiCAP technique is adaptable to a wide array of downstream experimental assays, and the high degree of specificity afforded by this technique allows more nuanced investigations into the mechanics of protein complex assembly than is currently possible using standard affinity purification techniques.

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification BiCAP

This manuscript describes the protocol for Bimolecular Complementation Affinity Purification (BiCAP). This novel method facilitates the specific isolation and downstream proteomic characterization of any two interacting proteins, while excluding un-complexed individual proteins as well as complexes formed with competing binding partners.

해 다중 단백질 신호 복합물 분자 보완성 친 화력 정화 (BiCAP)에 의해

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research ...

면역학 및 감염병학

Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry

Since most cellular processes are mediated by macromolecular assemblies, the systematic identification of protein-protein interactions (PPI) and the identification of the subunit composition of multi-protein complexes can provide insight into gene function and enhance understanding of biological systems1, 2. Physical interactions can be mapped with high confidence vialarge-scale isolation and characterization of endogenous protein complexes under near-physiological conditions based on affinity purification of chromosomally-tagged proteins in combination with mass spectrometry (APMS). This approach has been successfully applied in evolutionarily diverse organisms, including yeast, flies, worms, mammalian cells, and bacteria1-6. In particular, we have generated a carboxy-terminal Sequential Peptide Affinity (SPA) dual tagging system for affinity-purifying native protein complexes from cultured gram-negative Escherichia coli, using genetically-tractable host laboratory strains that are well-suited for genome-wide investigations of the fundamental biology and conserved processes of prokaryotes1, 2, 7. Our SPA-tagging system is analogous to the tandem affinity purification method developed originally for yeast8, 9, and consists of a calmodulin binding peptide (CBP) followed by the cleavage site for the highly specific tobacco etch virus (TEV) protease and three copies of the FLAG epitope (3X FLAG), allowing for two consecutive rounds of affinity enrichment. After cassette amplification, sequence-specific linear PCR products encoding the SPA-tag and a selectable marker are integrated and expressed in frame as carboxy-terminal fusions in a DY330 background that is induced to transiently express a highly efficient heterologous bacteriophage lambda recombination system10. Subsequent dual-step purification using calmodulin and anti-FLAG affinity beads enables the highly selective and efficient recovery of even low abundance protein complexes from large-scale cultures. Tandem mass spectrometry is then used to identify the stably co-purifying proteins with high sensitivity (low nanogram detection limits).
Here, we describe detailed step-by-step procedures we commonly use for systematic protein tagging, purification and mass spectrometry-based analysis of soluble protein complexes from E. coli, which can be scaled up and potentially tailored to other bacterial species, including certain opportunistic pathogens that are amenable to recombineering. The resulting physical interactions can often reveal interesting unexpected components and connections suggesting novel mechanistic links. Integration of the PPI data with alternate molecular association data such as genetic (gene-gene) interactions and genomic-context (GC) predictions can facilitate elucidation of the global molecular organization of multi-protein complexes within biological pathways. The networks generated for E. coli can be used to gain insight into the functional architecture of orthologous gene products in other microbes for which functional annotations are currently lacking.

Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry

Affinity purification of tagged proteins in combination with mass spectrometry (APMS) is a powerful method for the systematic mapping of protein interaction networks and for investigating the mechanistic basis of biological processes. Here, we describe an optimized sequential peptide affinity (SPA) APMS procedure developed for the bacterium Escherichia coli that can be used to isolate and characterize stable multi-protein complexes to near homogeneity even starting from low copy numbers per cell.

의 단백질 단지의 식별<em&gt; 대장균</em&gt; 직렬 질량 분석법과 함께 순차적 펩타이드의 동질 정화를 사용하여

Since most cellular processes are mediated by macromolecular assemblies, the systematic identification of protein-protein interactions (PPI) and the ...

A New Approach for the Comparative Analysis of Multiprotein Complexes Based on 15N Metabolic Labeling and Quantitative Mass Spectrometry

The introduced protocol provides a tool for the analysis of multiprotein complexes in the thylakoid membrane, by revealing insights into complex composition under different conditions. In this protocol the approach is demonstrated by comparing the composition of the protein complex responsible for cyclic electron flow (CEF) in Chlamydomonas reinhardtii, isolated from genetically different strains. The procedure comprises the isolation of thylakoid membranes, followed by their separation into multiprotein complexes by sucrose density gradient centrifugation, SDS-PAGE, immunodetection and comparative, quantitative mass spectrometry (MS) based on differential metabolic labeling (14N/15N) of the analyzed strains. Detergent solubilized thylakoid membranes are loaded on sucrose density gradients at equal chlorophyll concentration. After ultracentrifugation, the gradients are separated into fractions, which are analyzed by mass-spectrometry based on equal volume. This approach allows the investigation of the composition within the gradient fractions and moreover to analyze the migration behavior of different proteins, especially focusing on ANR1, CAS, and PGRL1. Furthermore, this method is demonstrated by confirming the results with immunoblotting and additionally by supporting the findings from previous studies (the identification and PSI-dependent migration of proteins that were previously described to be part of the CEF-supercomplex such as PGRL1, FNR, and cyt f). Notably, this approach is applicable to address a broad range of questions for which this protocol can be adopted and e.g. used for comparative analyses of multiprotein complex composition isolated from distinct environmental conditions.

A New Approach for the Comparative Analysis of Multiprotein Complexes Based on 15N Metabolic Labeling and Quantitative Mass Spectrometry

The described comparative, quantitative proteomic approach aims at obtaining insights into the composition of multiprotein complexes&#160;under different conditions and is demonstrated by comparing genetically different strains. For quantitative analysis equal volumes of different fractions from a sucrose density gradient are mixed and analyzed by mass spectrometry.

multiprotein의 단지의 비교 분석을위한 새로운 접근 방식을 기반으로<sup&gt; 15</sup&gt; N 대사 라벨링 및 정량 질량 분석

The introduced protocol provides a tool for the analysis of multiprotein complexes in the thylakoid membrane, by revealing insights into complex ...

Combining Chemical Cross-linking and Mass Spectrometry of Intact Protein Complexes to Study the Architecture of Multi-subunit Protein Assemblies

Proteins interact with their ligands to form active and dynamic assemblies which carry out various cellular functions. Elucidating these interactions is therefore fundamental for the understanding of cellular processes. However, many protein complexes are dynamic assemblies and are not accessible by conventional structural techniques. Mass spectrometry contributes to the structural investigation of these assemblies, and particularly the combination of various mass spectrometric techniques delivers valuable insights into their structural arrangement.
In this article, we describe the application and combination of two complementary mass spectrometric techniques, namely chemical cross-linking coupled with mass spectrometry and native mass spectrometry. Chemical cross-linking involves the covalent linkage of amino acids in close proximity by using chemical reagents. After digestion with proteases, cross-linked di-peptides are identified by mass spectrometry and protein interactions sites are uncovered. Native mass spectrometry on the other hand is the analysis of intact protein assemblies in the gas phase of a mass spectrometer. It reveals protein stoichiometries as well as protein and ligand interactions. Both techniques therefore deliver complementary information on the structure of protein-ligand assemblies and their combination proved powerful in previous studies.

The architecture of protein complexes is essential for their function. Combining various mass spectrometric techniques proved powerful to study their assembly. We provide protocols for chemical cross-linking and native mass spectrometry and show how these complementary techniques help to elucidate the architecture of multi-subunit protein assemblies.

화학 Cross-linking 및 여러 소 단위 단백질 어셈블리의 건축을 그대로 단백질 복합물의 질량 분석

Proteins interact with their ligands to form active and dynamic assemblies which carry out various cellular functions. Elucidating these interactions is ...

그들의 네이티브 셀룰러 환경에서 상황에 맞는 단백질 복합물의 분할-BioID-Proteomic 분석

요약

더 많은 비디오 탐색

이 비디오의 챕터