Diese Arbeit wurde durch den deutschen Exzellenzinitiative (CellNetworks DFG-EXC 81) und eine Teilfinanzierung durch den Sonderforschungsbereich SFB638 vom deutschen Forschung Rat (DFG) finanziert.

<ol>
	<li>Scott, D. E., Bayly, A. R., Abell, C., Skidmore, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Small+molecules,+big+targets:+drug+discovery+faces+the+protein-protein+interaction+challenge.">Small molecules, big targets: drug discovery faces the protein-protein interaction challenge.</a> Nat Rev Drug Discov. 15 (8), 533-550 (2016).</li><li>Roux, K. J., Kim, D. I., Raida, M., Burke, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+promiscuous+biotin+ligase+fusion+protein+identifies+proximal+and+interacting+proteins+in+mammalian+cells.">A promiscuous biotin ligase fusion protein identifies proximal and interacting proteins in mammalian cells.</a> J Cell Biol. 196 (6), 801-810 (2012).</li><li>Lam, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+APEX2+for+electron+microscopy+and+proximity+labeling.">Directed evolution of APEX2 for electron microscopy and proximity labeling.</a> Nat Methods. 12 (1), 51-54 (2015).</li><li>Rhee, H. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteomic+mapping+of+mitochondria+in+living+cells+via+spatially+restricted+enzymatic+tagging.">Proteomic mapping of mitochondria in living cells via spatially restricted enzymatic tagging.</a> Science. 339 (6125), 1328-1331 (2013).</li><li>Kim, D. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+nuclear+pore+complex+architecture+with+proximity-dependent+biotinylation.">Probing nuclear pore complex architecture with proximity-dependent biotinylation.</a> P Natl Acad Sci USA. 111 (24), E2453-E2461 (2014).</li><li>Kim, D. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+smaller+biotin+ligase+for+BioID+proximity+labeling.">An improved smaller biotin ligase for BioID proximity labeling.</a> Mol Biol Cell. 27 (8), 1188-1196 (2016).</li><li>Lambert, J. P., Tucholska, M., Go, C., Knight, J. D., Gingras, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proximity+biotinylation+and+affinity+purification+are+complementary+approaches+for+the+interactome+mapping+of+chromatin-associated+protein+complexes.">Proximity biotinylation and affinity purification are complementary approaches for the interactome mapping of chromatin-associated protein complexes.</a> J Proteomics. 118, 81-94 (2015).</li><li>Morriswood, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+bilobe+components+in+Trypanosoma+brucei+identified+using+proximity-dependent+biotinylation.">Novel bilobe components in Trypanosoma brucei identified using proximity-dependent biotinylation.</a> Eukaryot Cell. 12 (2), 356-367 (2013).</li><li>Schopp, I. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Split-BioID+a+conditional+proteomics+approach+to+monitor+the+composition+of+spatiotemporally+defined+protein+complexes.">Split-BioID a conditional proteomics approach to monitor the composition of spatiotemporally defined protein complexes.</a> Nat Commun. 8, (2017).</li><li>B&#233;thune, J., Artus-Revel, C. G., Filipowicz, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinetic+analysis+reveals+successive+steps+leading+to+miRNA-mediated+silencing+in+mammalian+cells.">Kinetic analysis reveals successive steps leading to miRNA-mediated silencing in mammalian cells.</a> EMBO Rep. 13 (8), 716-723 (2012).</li><li>Inoue, H., Nojima, H., Okayama, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+efficiency+transformation+of+Escherichia+coli+with+plasmids.">High efficiency transformation of Escherichia coli with plasmids.</a> Gene. 96 (1), 23-28 (1990).</li><li>Weidenfeld, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+expression+of+coding+and+inhibitory+RNAs+from+retargetable+genomic+loci.">Inducible expression of coding and inhibitory RNAs from retargetable genomic loci.</a> Nucleic Acids Res. 37 (7), e50 (2009).</li><li>Dyballa, N., Metzger, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+and+sensitive+colloidal+coomassie+G-250+staining+for+proteins+in+polyacrylamide+gels.">Fast and sensitive colloidal coomassie G-250 staining for proteins in polyacrylamide gels.</a> J Vis Exp. (30), (2009).</li><li>Jonas, S., Izaurralde, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+a+molecular+understanding+of+microRNA-mediated+gene+silencing.">Towards a molecular understanding of microRNA-mediated gene silencing.</a> Nat Rev Genet. 16 (7), 421-433 (2015).</li><li>MacRae, I. J., Ma, E., Zhou, M., Robinson, C. V., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+reconstitution+of+the+human+RISC-loading+complex.">In vitro reconstitution of the human RISC-loading complex.</a> P Natl Acad Sci USA. 105 (2), 512-517 (2008).</li><li>Cox, J., Mann, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MaxQuant+enables+high+peptide+identification+rates,+individualized+p.p.b.-range+mass+accuracies+and+proteome-wide+protein+quantification.">MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification.</a> Nat Biotechnol. 26 (12), 1367-1372 (2008).</li><li>Tyanova, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Perseus+computational+platform+for+comprehensive+analysis+of+(prote)omics+data.">The Perseus computational platform for comprehensive analysis of (prote)omics data.</a> Nat Methods. 13 (9), 731-740 (2016).</li><li>Opitz, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Capturing+the+Asc1p/Receptor+for+Activated+C+Kinase+1+(RACK1)+Microenvironment+at+the+Head+Region+of+the+40S+Ribosome+with+Quantitative+BioID+in+Yeast.">Capturing the Asc1p/Receptor for Activated C Kinase 1 (RACK1) Microenvironment at the Head Region of the 40S Ribosome with Quantitative BioID in Yeast.</a> Mol Cell Proteomics. 16 (12), 2199-2218 (2017).</li><li>Mackmull, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Landscape+of+nuclear+transport+receptor+cargo+specificity.">Landscape of nuclear transport receptor cargo specificity.</a> Mol Syst Biol. 13 (12), 962 (2017).</li><li>Kim, D. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BioSITe:+A+Method+for+Direct+Detection+and+Quantitation+of+Site-Specific+Biotinylation.">BioSITe: A Method for Direct Detection and Quantitation of Site-Specific Biotinylation.</a> J Proteome Res. , (2017).</li><li>Udeshi, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibodies+to+biotin+enable+large-scale+detection+of+biotinylation+sites+on+proteins.">Antibodies to biotin enable large-scale detection of biotinylation sites on proteins.</a> Nat Methods. 14 (12), 1167-1170 (2017).</li><li>Chapat, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cap-binding+protein+4EHP+effects+translation+silencing+by+microRNAs.">Cap-binding protein 4EHP effects translation silencing by microRNAs.</a> P Natl Acad Sci USA. 114 (21), 5425-5430 (2017).</li><li>Luker, K. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinetics+of+regulated+protein-protein+interactions+revealed+with+firefly+luciferase+complementation+imaging+in+cells+and+living+animals.">Kinetics of regulated protein-protein interactions revealed with firefly luciferase complementation imaging in cells and living animals.</a> P Natl Acad Sci USA. 101 (33), 12288-12293 (2004).</li><li>De Munter, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Split-BioID:+a+proximity+biotinylation+assay+for+dimerization-dependent+protein+interactions.">Split-BioID: a proximity biotinylation assay for dimerization-dependent protein interactions.</a> FEBS Lett. 591 (2), 415-424 (2017).</li><li>Xue, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimizing+the+fragment+complementation+of+APEX2+for+detection+of+specific+protein-protein+interactions+in+live+cells.">Optimizing the fragment complementation of APEX2 for detection of specific protein-protein interactions in live cells.</a> Sci Rep. 7 (1), 12039 (2017).</li><li>Branon, T. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+TurboID+for+efficient+proximity+labeling+in+living+cells+and+organisms.">Directed evolution of TurboID for efficient proximity labeling in living cells and organisms.</a> bioRxiv. , (2017).</li></ol>

Die Autoren haben nichts preisgeben.

Das skizzierte Verfahren beschreibt, wie Gene von Interesse in der Split-BioID Klonen Plasmide, wie Interaktion-induzierte biotinylierungen getestet und biotinylierte Proteine für Massenspektrometrie Analyse isolieren. Wir beschreiben hier die Prozedur beruht auf Transiente Transfektion. Während der Ausdruck die Fusionsproteine um den Betrag der Dox hinzugefügt, um das Medium angepasst werden kann, kann Transiente Transfektion zu inhomogenen Proteinexpression mit einigen Zellen führen, die grob die Fusionsproteine im Vergleich zu den endogenen overexpress Pendants. Dies kann zu Verzerrungen des entsprechenden Interactomes und PPI, die nicht treu die Interaktionen widerspiegeln, die die körpereigene Proteine beinhalten. Es empfiehlt sich also in der Regel zu stabilen Zelllinien zu konstruieren, nach Split-BioID mit dem transient System etabliert hat. Plasmide sind kompatibel mit dem Flp-vermittelten Rekombinationssystem und legen beide Gene von Interesse im Rahmen der Verordnung des gleichen Tet-responsive Elements. Bei Bedarf und bei Verwendung mit kompatiblen Säugerzellen, ermöglichen sie die einfache Erstellung von stabil induzierbaren Zelllinien. Zum Beispiel verwenden wir die HeLa-EM2-11-Linie, die drückt den RtTA Tetracyclin-aktivierte Transkription Aktivator und eine einzigartige Aktionsleisten genomischen Locus aus dem Tetracyclin-vermittelten Genexpression streng regulierte12sein kann. Mit dieser Zelllinie und Flp-vermittelten Rekombination, stabilen Zelllinien, die nur eine Kopie des Transgens enthalten innerhalb von zwei bis drei Wochen erhalten. Alternativ könnte man auch aktuelle Genom Schnitttechniken verwenden, einzuführen die BirA * Fragmente in den nativen genomic Loci der Gene von Interesse.
Wie in jedem Assay, das Tagging ein Protein angewiesen ist, muss man prüfen, ob die resultierende Fusionsproteine funktionsfähig sind. Verfügbare Daten in die interessierenden Proteine (z. B. mit GFP für bildgebenden Verfahren) markiert wurden und funktional getestet eignen sich zu entscheiden, ob die BirA * Fragmente werden sollte geklont stromaufwärts oder stromabwärts die Gene von Interesse. Wenn keine solchen Daten verfügbar sind, sollte man N-Terminal Testen oder C-Terminal Tag Proteine in eine funktionelle Assay. Beispielsweise kann die Aktivität der Schmelzverfahren Proteine in einer Zelllinie getestet werden, in denen das körpereigene Protein herausgetrennten und wurde im Vergleich zu Wildtyp. Wenn die Proteine des Interesses beide N und C-terminalen Tags vertragen, sollten beide getestet werden. In der Tat kann die Ausrichtung des Fusionsproteins in BioID Experimente, die Effizienz der Kennzeichnung22beeinflussen. Darüber hinaus haben wir beobachtet, dass wenn ein paar Proteine Split-BioID zuweisen, welche der beiden Proteine, entweder die NBirA angehängt wird * oder CBirA * fragment auch Einfluss die Effizienz der Beschriftung9. In den Split-BioID Plasmiden die 16 Aminosäuren lange Glycin/Serin Reich Linker Kopplung der interessierenden Proteine an die BirA * Fragmente wurden weitere PCA23 entnommen und für uns tätig sind, damit alle interagierenden Proteine haben wir bisher getestet. Allerdings sollte man bedenken, dass einige Protein-Paare mit kürzeren oder längeren Linker besser funktionieren könnte. Der letzte Hinweis wurde ein weiterer Test von Bollen Gruppe24beschrieben. In diesem Assay BirA * an einem anderen Standort (E140/Q141) als bei uns (E256/G257) gliedert. Wir haben beide Split-BioID Aromen Side-by-Side getestet und festgestellt, dass E256/G257, beschrieben in diesem Protokoll zu stärkeren Re-Aktivierung führt, wenn Sie an zwei interagierenden Proteine gekoppelt9.
Ein allgemeiner Nachteil dieser Methode ist die langsame Geschwindigkeit der Beschriftung. 6 bis 24 h Inkubationszeit mit Biotin ist normalerweise notwendig, spürbare biotinylierungen6, die Nutzung dieser Technik zur Untersuchung dynamischer Umbau von Proteinkomplexen ausschließt zu erhalten. Während dieser Assay teilweise diesem Vorbehalt befasst, da es nur aktiviert wird, wenn zwei Proteine interagieren, die langsame Geschwindigkeit der Kennzeichnung schließt seine Verwendung für das Studium als Reaktion auf sehr dynamische Prozesse oder kurzlebige Proteine zu analysieren. Veränderter Peroxidase bekanntermaßen APEX2 fördern effiziente Kennzeichnung der proximalen Proteine innerhalb von 1 min-3. Ein Partnerschafts-und Kooperationsabkommen basierend auf APEX2 könnte so die Grenzen der Kennzeichnung langsame BioID abgeleitet Assays einzugehen. Eine Proof of Principle Studie beschrieben so ein Split-APEX2 Assay25. Obwohl ein Homodimerizing Protein biotinylierte erfolgreich war, bleibt ob der Test auch verwendet werden kann, zu kennzeichnen und identifizieren Proteine, die zusammenbauen, um ein paar der interagierenden Proteine jedoch um nachgewiesen werden. Vor kurzem wurde gerichtete Evolution zur Erstellung TurboID und MiniTurbo, zwei Varianten der BirA * mit verstärkten Aktivität, die viel kürzer Kennzeichnung Zeitfenster, bis zu 10 min26zu ermöglichen. Anpassung der Split-BioID für diese neuen Varianten wird die Verwendung dieser Technik, um ein breiteres Anwendungsfeld weiter ausbauen.

Da die zelluläre Funktionen von Proteinen, die dynamisch, makromolekulare Komplexe durchgeführt werden zusammenbauen, ist die Identifizierung von Protein-Protein-Wechselwirkungen (PPI) eine große Bemühung in der biomedizinischen Forschung. In der Tat PPI sind oft bei Krankheit dereguliert und mögliche Ziele für Therapeutik1vertreten. Die am weitesten verbreitete Methode für die Identifizierung von PPI die Affinität Reinigung (AP) Ansatz in dem ist, nach Lyse der Zelle, ein Protein des Interesses wird speziell auf eine Matrix gereinigt und damit verbundenen Proteine werden anschließend durch Massenspektrometrie identifiziert (MS). AP-MS eine leistungsstarke Ansatz ist, wird in der Regel nicht ausgeführt auf schwerlösliche Proteinkomplexe, sehr flüchtigen Interaktionen oder PPI, die eine intakte subzelluläre Struktur erfordern. Darüber hinaus kann die Interpretation der Daten durch die dynamische Natur der PPI-Netzwerke, kompliziert werden, da ein einziges Protein oft mehrere verschiedene Proteinkomplexe gehört.
Nähe-Kennzeichnung Techniken wie BioID2 oder APEX23,4 wurden vor kurzem entwickelt, um einige der Einschränkungen der AP-MS Ansätze zu beheben. In BioID katalysiert das Enzym BirA * (entspricht eine G115R Variante des Enzyms Wildtyp E. Coli ) die Bildung von labiler Biotinyl-AMP (Bio-AMP), die mit primären Aminen reagieren kann. Im Gegensatz zu der Wildtyp-Enzym, das Bio-AMP in seinem aktiven Zentrum behält, löst BirA * Bio-AMP, so dass ihre Verbreitung auf die benachbarte Umgebung. Daher können beim verschmolzen zu einem Protein des Interesses und in Zellen exprimiert, proximalen Proteine biotinylierte innerhalb einer Schätzung von 10 nm5sein. Diese gekennzeichnet proximalen Proteine werden dann durch Streptavidin Pulldown isoliert und identifiziert durch MS. Im Gegensatz zu AP-MS erfordert BioID Ausdruck ein Fusionsprotein. Es kann also nur an Proteine angewendet werden deren Funktion durch die Kennzeichnung nicht behindert wird. Darüber hinaus die Kennzeichnung ist langsam, in der Regel 6 – 24 h2,6, machen die Erkennung von kurzlebigen Proteine herausfordernd. Jedoch im Vergleich zu AP-MS, BioID-MS bietet mehrere Vorteile: Erstens sein nehmen die Interaktionen in ihrer natürlichen zellulären Umgebung; zweite, beschriftete Proteine anstatt montierten Anlagen sind isoliert nach Lyse der Zelle; Drittens können Streptavidin Pulldowns mit Geruchsstoffen Puffer und harte Wäsche Bedingungen. Daher ist die Methode mehr empfindlich, um vorübergehende oder schwachen Wechselwirkungen7 oder Interaktionen, die auf ein bestimmtes auftreten und schwer zu isolieren, subzelluläre Struktur8.
Die meisten Proteine sind jedoch in der Regel Teil des größeren komplexen, die umgestalten können, laut zelluläre Signale oder die Funktion, die ausgeführt werden muss. Ein einziges Protein gehört daher in der Regel mehrere komplexe, entsprechend unterschiedlichen Funktionseinheiten, an denen unterschiedliche und/oder überlappende PPI. Beide Ansätze geben einen Überblick über alle Vereine, die ein gegebenes Protein haben kann, doch sie scheitern an den Kontext der einzelnen PPI. Um die Auflösung des letzteren zu erhöhen, haben wir einen PROTEINFRAGMENTE Ergänzung Assay (PCA) entwickelt, in welche zwei inaktive Fragmente von BirA * (NBirA *, die die katalytische Domäne enthält, und CBirA *, die wie die Re-Aktivierung-Domäne angezeigt werden können) können wieder in ein aktives Enzym, wenn in der Nähe von zwei brachte Interaktion Proteine9. Die daraus resultierende Split-BioID Assay Nähe-abhängige biotinylierungen konzentriert sich auf Proteine, die um ein paar der interagierenden Proteine versammeln und somit ermöglicht die Identifikation von Kontext abhängige Protein Baugruppen. Wir demonstriert vor kurzem die herausragende Auflösung macht der Split-BioID durch Lösen von zwei verschiedene Proteinkomplexe der MiRNA-vermittelten gen-silencing Weg9beteiligt.
Insgesamt kann in einem einheitlichen und einfachen Assay Split-BioID entdecken und speziell definierten funktionalen Einheiten, in denen ein gegebenen Proteins beteiligt, sofern eine zusätzliche interagierenden Proteins des entsprechenden Proteins komplexe bekannt ist, PPI zuweisen.

<table>
	<tbody>
		<tr>
			<td>Acetic acid (glacial)</td>
			<td>VWR</td>
			<td>20104.298</td>
			<td>To make TAE buffer</td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Sigma</td>
			<td>A9539</td>
			<td>Take TAE-agarose gels for DNA analysis and extraction</td>
		</tr>
		<tr>
			<td>Ammonia solution 25% NH3</td>
			<td>Bernd Kraft</td>
			<td>6012</td>
			<td>To dissolve biotin</td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Sigma</td>
			<td>A9518</td>
			<td>To select transformed bacteria</td>
		</tr>
		<tr>
			<td>Bioruptor plus sonification device</td>
			<td>Diagenode</td>
			<td>B01020001</td>
			<td>Other sonification devices are also ok</td>
		</tr>
		<tr>
			<td>Biotin</td>
			<td>Sigma</td>
			<td>B4639</td>
			<td>To be added to the growth medium to stimulate efficient biotinylation</td>
		</tr>
		<tr>
			<td>Bovine serum albumin fraction V</td>
			<td>Carl Roth</td>
			<td>8076</td>
			<td>Used in Western blot buffers and a protein standard in Bradford assays</td>
		</tr>
		<tr>
			<td>Bradford Ultra reagent</td>
			<td>Expedeon</td>
			<td>BFU05L</td>
			<td>Any other method/kit for protein determination is fine, this particular reagent is more tolerant to detergent than other Bradford reagents</td>
		</tr>
		<tr>
			<td>Cell scrappers</td>
			<td>TPP</td>
			<td>99002</td>
			<td>Any other model is also fine</td>
		</tr>
		<tr>
			<td>ClaI</td>
			<td>New England Biolabs</td>
			<td>R0197</td>
			<td>Restriction enzyme for cloning into the split-BioID plasmids (NBirA* fusion)</td>
		</tr>
		<tr>
			<td>DMEM medium</td>
			<td>Sigma</td>
			<td>D6046</td>
			<td>If using another cell line, use the corresponding optimal growth medium</td>
		</tr>
		<tr>
			<td>DNA miniprep kit</td>
			<td>Sigma</td>
			<td>PLN350</td>
			<td>Any other kit is also fine</td>
		</tr>
		<tr>
			<td>Doxycycline</td>
			<td>Applichem</td>
			<td>A2951</td>
			<td>Dox is light sensitive</td>
		</tr>
		<tr>
			<td>DTT</td>
			<td>Applichem</td>
			<td>A2948</td>
			<td>Make 1M stock solution, store at -20 &#176;C and always use fresh</td>
		</tr>
		<tr>
			<td>DyLight 680-conjugated streptavidin</td>
			<td>Thermo scientific</td>
			<td>21848</td>
			<td>to use with a LiCor Western blot scanning device</td>
		</tr>
		<tr>
			<td>Dynabeads MyOne Streptavidin C1</td>
			<td>Invitrogen</td>
			<td>65002</td>
			<td>The C1 beads are not BSA coated which is preferable for downstream MS applications (no leakthrough of BSA in the final elution)</td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Applichem</td>
			<td>A5097</td>
			<td>Make a 500 mM stock, adjust pH to 8 while dissolving the EDTA powder</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>Sigma</td>
			<td>32205</td>
			<td>Make a 70% stock solution in which Doxycycline can be dissolved at 10 mg.mL-1</td>
		</tr>
		<tr>
			<td>Fastgene Gel/PCR DNA Extraction Kit</td>
			<td>Nippon Genetics</td>
			<td>FG-91302</td>
			<td>Any other kit is also fine</td>
		</tr>
		<tr>
			<td>HCl 37%</td>
			<td>Merck</td>
			<td>1.00317.1000</td>
			<td>To adjust pH of biotin stock solution</td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Carl Roth</td>
			<td>6763</td>
			<td>Make a 500 mM stock solution, adjust the pH to 7.4</td>
		</tr>
		<tr>
			<td>Immobilon-FL PVDF membrane, 0.45&#160;&#181;m</td>
			<td>Millipore</td>
			<td>IPFL00010</td>
			<td>This membrane shows minimal autofluorescence when used with a LiCor Western blot scanning device</td>
		</tr>
		<tr>
			<td>LiCl</td>
			<td>Gr&#252;ssing GmbH</td>
			<td>12083</td>
			<td>Make a 5M stock solution</td>
		</tr>
		<tr>
			<td>Odyssey CLx imaging system</td>
			<td>LI-COR</td>
			<td>N/A</td>
			<td>To scan Western blot membrane decorated with fluorophore-labeled antibody</td>
		</tr>
		<tr>
			<td>Linear polyethylenimine (PEI)</td>
			<td>Polysciences</td>
			<td>23966-2</td>
			<td>Any other transfection reagent is also fine</td>
		</tr>
		<tr>
			<td>Milk powder</td>
			<td>Carl Roth</td>
			<td>T145</td>
			<td>To block Western blot membranes</td>
		</tr>
		<tr>
			<td>MluI-HF</td>
			<td>New England Biolabs</td>
			<td>R3198</td>
			<td>Restriction enzyme for cloning into the split-BioID plasmids (NBirA* fusion)</td>
		</tr>
		<tr>
			<td>Na-deoxycholate</td>
			<td>Sigma</td>
			<td>30970</td>
			<td>Make a 10% (w/v) stock solution</td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Sigma</td>
			<td>31434</td>
			<td>Make a 5M stock solution</td>
		</tr>
		<tr>
			<td>NP-40 (Nonidet P40 substitute)</td>
			<td>Sigma</td>
			<td>74385</td>
			<td>Make a 20% (v/v) stock solution</td>
		</tr>
		<tr>
			<td>PacI</td>
			<td>New England Biolabs</td>
			<td>R0547</td>
			<td>Restriction enzyme for cloning into the split-BioID plasmids (CBirA* fusion)</td>
		</tr>
		<tr>
			<td>Phosphate buffer saline (PBS)</td>
			<td>Sigma</td>
			<td>806552</td>
			<td>To wash cells before scrapping</td>
		</tr>
		<tr>
			<td>PmeI</td>
			<td>New England Biolabs</td>
			<td>R0560</td>
			<td>Restriction enzyme for cloning into the split-BioID plasmids (CBirA* fusion)</td>
		</tr>
		<tr>
			<td>Protease inhibitor cocktail</td>
			<td>Roche</td>
			<td>4693132001</td>
			<td>Added to the lysis buffer to prevent protein degradation</td>
		</tr>
		<tr>
			<td>pSF3-Flag-CBir-FRB_Myc-NBir-FKBP</td>
			<td>Addgene</td>
			<td>90003</td>
			<td>Split-BioID plasmid, mediates the co-expression of NBirA*-FKBP and CBirA*-FRB, FKBP and FRB can be replaced by two other ORFs</td>
		</tr>
		<tr>
			<td>pSF3-Flag-CBir-FRB_FKBP-Myc-Nbir</td>
			<td>Addgene</td>
			<td>90004</td>
			<td>Split-BioID plasmid, mediates the co-expression of FKBP-NBirA* and CBirA*-FRB, FKBP and FRB can be replaced by two other ORFs</td>
		</tr>
		<tr>
			<td>pSF3-Flag-FRB-Cbir_Myc-NBir-FKBP</td>
			<td>Addgene</td>
			<td>90008</td>
			<td>Split-BioID plasmid, mediates the co-expression of NBirA*-FKBP and FRB-CBirA*, FKBP and FRB can be replaced by two other ORFs</td>
		</tr>
		<tr>
			<td>pSF3-Flag-FRB-Cbir_FKBP-Myc-Nbir</td>
			<td>Addgene</td>
			<td>90009</td>
			<td>Split-BioID plasmid, mediates the co-expression of FKBP-NBirA* and FRB-CBirA*, FKBP and FRB can be replaced by two other ORFs</td>
		</tr>
		<tr>
			<td>Q5 High-Fidelity PCR kit</td>
			<td>New England Biolabs</td>
			<td>E0555S</td>
			<td>To amplify the ORF coding for the proteins to be tested. Any other thermostable DNA polymerase is fine.</td>
		</tr>
		<tr>
			<td>Quick ligation kit</td>
			<td>New England Biolabs</td>
			<td>M2200S</td>
			<td>To ligate DNA fragments into the split-BioID plasmids, any other DNA ligation system is fine.</td>
		</tr>
		<tr>
			<td>RunBlue 4-20% SDS precast gels</td>
			<td>Expedeon</td>
			<td>BCG42012</td>
			<td>To use when running samples for MS analysis</td>
		</tr>
		<tr>
			<td>RunBlue LDS Sample Buffer</td>
			<td>Expedeon</td>
			<td>NXB31010</td>
			<td>Running buffer for the RunBlue precast gels</td>
		</tr>
		<tr>
			<td>SDS</td>
			<td>Sigma</td>
			<td>5030</td>
			<td>Comes as a 20% stock solution</td>
		</tr>
		<tr>
			<td>tet-free serum</td>
			<td>Biowest</td>
			<td>S181T</td>
			<td>we use tet-free serum to minimize basal expression of the fusion proteins</td>
		</tr>
		<tr>
			<td>Trans-Blot Turbo Transfer system</td>
			<td>Bio-Rad</td>
			<td>1704150</td>
			<td>High speed Western blotting transfer system, any other transfer system is also fine</td>
		</tr>
		<tr>
			<td>Tris</td>
			<td>Carl Roth</td>
			<td>4855</td>
			<td>Make 1M stock solutions with adequate pH (7.4 and 8)</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Applichem</td>
			<td>A4975</td>
			<td>Make a 20% (v/v) stock solution</td>
		</tr>
		<tr>
			<td>Tween-20</td>
			<td>Carl Roth</td>
			<td>9127</td>
			<td>Used in Western blot buffers, Tween 20 leads to high background fluorescence and should be omitted in the blocking and last wash step</td>
		</tr>
	</tbody>
</table>

split-bioid &#8212; proteomic analysis of context-specific protein complexes in their native cellular environment

Ergänzend zur bestehenden Affinitätsreinigung (AP) nähert sich zur Identifizierung von Protein-Protein-Wechselwirkungen (PPI), Enzyme wurden eingeführt, die es ermöglichen die Nähe-abhängige Kennzeichnung der Proteine in lebenden Zellen. Ein solches Enzym, BirA * (verwendet in der BioID Ansatz), vermittelt die biotinylierungen der Proteine in einem Umkreis von ca. 10 nm. Daher können als zu einem Protein des Interesses verschmolzen und in Zellen exprimiert, die Kennzeichnung der proximalen Proteine in ihrer natürlichen Umgebung. Im Gegensatz zu AP, das stützt sich auf die Reinigung des montierten Proteinkomplexe, erkennt BioID Proteine, die gekennzeichnet worden sind, in den Zellen unabhängig davon, ob sie noch mit dem Protein von Interesse interagieren Wenn sie isoliert sind. Da es Biotinylates proximalen Proteine, man kann außerdem kapitalisieren die außergewöhnliche Affinität von Streptavidin für Biotin um sie sehr effizient zu isolieren. Während BioID besser als AP für identifizierende Transient oder schwachen Wechselwirkungen führt, bieten beide AP und BioID Mass Spectrometry Ansätze einen Überblick über alle möglichen Interaktionen, die ein gegebenes Protein haben kann. Jedoch bieten sie keine Informationen über den Kontext der einzelnen identifizierten PPI. In der Tat sind die meisten Proteine in der Regel Bestandteil mehrere komplexe, entsprechend unterschiedliche Reifung Schritte oder verschiedenen Funktionseinheiten. Um diese gemeinsamen Begrenzung beider Methoden zu lösen, haben wir einen PROTEINFRAGMENTE Ergänzung Assay basiert auf dem BirA * Enzym entwickelt. In diesem Test können zwei inaktive Fragmente von BirA * wieder zusammenbauen, in ein aktives Enzym, wenn in der Nähe von zwei interagierenden Proteine gebracht, die sie verschmolzen sind. Der daraus resultierende Split-BioID Test ermöglicht die Kennzeichnung der Proteine, die um ein paar der interagierenden Proteine zu montieren. Sofern diese beiden nur in einem bestimmten Kontext interagieren, ermöglicht Split-BioID dann die Analyse der spezifischen Kontext-abhängige Funktionseinheiten in ihrer natürlichen zellulären Umgebung. Hier bieten wir eine Schritt für Schritt-Protokoll zu testen und ein paar von interagierenden Proteine Split-BioID zuweisen.

Um zu veranschaulichen, wie diese Methode funktioniert, die open Reading Frames (ORFs) der Proteine Ago2, waren TNRC6C und Dicer (alle Beteiligten in der MiRNA-vermittelten gen-silencing Weg) in Split-BioID Plasmiden geklont. Ago2 ist bekannt, in einem MiRNA-induzierte stummschaltungs-Komplex (MiRISC), die Übersetzung unterdrückt mit TNRC6C interagieren und Zerfall des Ziels mRNAs14zu stimulieren. Vor dem montieren der MiRISC, Ago2 interagieren mit Dicer, das Enzym, das produziert Reifen MiRNAs, in einem Komplex, in dem es mit einem MiRNA15geladen werden kann. Daher wurde Split-BioID Ago2/Dicer Paar oder das Ago2/TNRC6C paar angewendet. Für jedes Paar von geprüften Proteinen war Ago2 entweder mit NBirA * oder CBirA * über unsere Split-BioID Plasmide (Abbildung 2) verschmolzen und Dicer und TNRC6C zu den entsprechenden cognate BirA * fragment. Darüber hinaus war jedes Protein mit CBirA * verschmolzen und gepaart mit einer NBirA *-GFP Fusion als Negativkontrolle. Dies führt zu testen vier Iterationen für jedes Paar von getesteten Protein (Tabelle 1).
Um zu testen ob Split-BioID auf das Zusammenspiel der beiden getesteten Proteine aktiviert ist, folgten wir das Schema in Abbildung 1dargestellt. Die Plasmide wurden vorübergehend in einer Tet-System kompatibel HeLa Zelllinie transfiziert. Der Ausdruck der Fusionsproteine mit Doxycyclin (Dox) induziert wurde und biotinylierungen wurde angeregt, indem das Wachstumsmedium überschüssiges Biotin hinzufügen. Nach einer Inkubationszeit von 20 h mit Dox und Biotin wurden Zellen lysiert und analysiert durch westliche Beflecken mit konjugierten Streptavidin biotinylierte Proteine erkennen. In Säugetierzellen zwei großen Bands werden in der Regel von der konjugierten Streptavidin im untransfected Beispiel (Abbildung 3, Sterne) erkannt und endogen biotinylierte Proteine (höchstwahrscheinlich mitochondriale Carboxylases) entsprechen. Diese beiden Bands sind vorhanden in allen Proben und können bequem als interne Belastung Steuerelemente verwendet werden, also die Erkennung eines Housekeeping Proteins, das Laden der gleichen Protein-Mengen zu kontrollieren ist überflüssig. Typisch für ein BioID/Split-BioID Experiment, sind die zusätzlichen großen Bands, die beobachtet werden können die Fusionsproteine, die selbst-biotinylierte bekam. Auch wenn kein anderer biotinylierte Protein zu sehen ist, zeigt biotinylierungen die Fusionsproteine bereits in diesem Stadium zu erkennen, dass die beiden getesteten Proteine in den Zellen interagiert. Im Experiment auf Abbildung 3dargestellt, es ist klar, dass ein NBirA *-Ago2 Fusionsproteins gepaart mit CBirA * Fusionen, TNRC6C oder Dicer ist effizienter als die gegenüberliegenden Kombinationen in der CBirA *-Ago2 paart sich zu NBirA * Fusionen der beiden anderen Proteine (Abbildung 3, obere Leiste vergleichen die Intensitäten der Fahrspuren 2-3 Bahnen 6-7). Darüber hinaus war die Aktivierung spezifisch, da keiner der Fusionen CBirA * NBirA * aktivieren konnte-GFP Kontrolle Schmelzverfahren Protein zu spürbaren Niveaus (Abbildung 3, vergleichen Bahnen 1, 4-5 auf Bahn 8, die untransfected Zellen entspricht). Da in unserem Plasmide NBirA * verfügt über ein Myc-Tag und CBirA * verfügt über ein FLAG-Tag (Abbildung 2), können die Ausdruck Ebenen der einzelnen Schmelzverfahren Protein mit Antikörpern gegen diese zwei Tags (Abbildung 3, Bodenplatte) analysiert werden.
Interaktion-induzierte biotinylierungen beobachtet wird, das Experiment kann hochskaliert werden, als die biotinylierte Proteine isoliert auf Streptavidin-gekoppelten Perlen wie in Ziffer 4 des Protokolls (Abbildung 4) angegeben. Wenn Sie die Isolierung zum ersten Mal durchführen, können alle Schritte der Reinigung durch Western Blot (Abbildung 5) analysiert werden. In der Regel sollte Bindung an die Perlen fast quantitative und praktisch kein Leck durch in den Waschungen beachtet werden. Vor der Verarbeitung der Proben für die Massenspektrometrie, empfehlen wir die Ausführung ein Western-Blot damit induzierte biotinylierungen arbeitete als erwartet und die Fusionsproteine zum Ausdruck gebracht wurden. Das Fehlen des Ausdrucks die Fusionsproteine ist aufgrund schlechter Transfektion Effizienz oder fehlerhafte Dox Induktion. Wenn die Fusionsproteine zum Ausdruck gebracht wurden, aber keine biotinylierungen beobachtet, überprüfen Sie, wenn überschüssiges Biotin (50 μM) tatsächlich auf das Medium hinzugefügt wurde und dass die Lager Biotin noch aktiv ist. Wenn der eluierten Material auf einem Coomassie gefärbt Protein Gel (Abbildung 6), in der Regel analysiert wurde, die stärkste Band zu beachten läuft bei etwa 17 kDa und Monomeren Streptavidin entspricht. Bands, die entsprechend der endogenen biotinylierte Proteine und die Fusionsproteine können auch beobachtet werden. Wir schneiden in der Regel Bereich der Probe Spur über dem Streptavidin-Band bis zu den Laden gut (Abbildung 6). Die ausgeschnittene Band kann in eine 1,5 mL-Tube gespeichert und an eine Massenspektrometrie-Anlage gesendet. Alternativ können gebundene Proteine auch an den Streptavidin-gekoppelten Perlen Trypsin verdaut und eluiert verdauten Peptide bilden die Spalte. Wir nutzen regelmäßig die MaxQuant Software16 (mit meist Standardparameter und Lysin biotinylierungen als eine mögliche Post-translationale Modifikation hinzufügen, finden Sie unter Referenz 9 für weitere Einzelheiten und typische MS-Ergebnisse), die MS-raw-Daten zu analysieren und die Perseus Suite17 für die anschließende statistische Analyse, beide sind freie Software. Beispiele sind in der Regel in drei biologische Wiederholungen ausgeführt. Verwendung von markierungsfreie Quantifizierung können speziell angereicherte Proteine über Kontrolle Bedingungen identifiziert werden. Um zu Filtern für endogen biotinylierte Proteine und Proteine, die nicht ausdrücklich durch das Enzym BirA * gekennzeichnet sind, betrachten wir nur Proteine, die deutlich über Hits aus sechs Datensätze generiert mit sechs unabhängigen Proteinen angereichert sind. Darüber hinaus berücksichtigen wir nur Hits, die über ein Split-BioID Dataset angereichert sind, wurden durch NBirA * NBirA * Fusionsproteine ersetzt-GFP. Andere Daten-Analyse-Strategien sind vor allem mit stabilen Isotopen Etikettierung mit Aminosäuren in der Zellkultur (SILAC) für quantitative Proteomik18vorgeschlagen worden. Darüber hinaus wurden verschiedene Strategien für die direkte Isolierung biotinylierte Peptide mit einer Streptavidin-Variante mit geschwächten Affinität zu Biotin18, spezielle Elution Bedingungen mit organischen Lösungsmitteln19 oder Biotin-spezifische beschrieben Antikörper-20,-21. Während nicht unbedingt führt zur Entdeckung von mehr Proteine, die Identifizierung von biotinylierungen Websites hinzufügen mehr Vertrauen hinsichtlich der Spezifität der Hits und ist nützlich, wenn Adressierung der Topologie einer Interaktion.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57479/57479fig1.jpg"> Abbildung 1: Überblick über das Split-BioID Verfahren. Eiweiß 1 interagiert mit Protein 2 im Rahmen der komplexen A oder Protein 3 als Teil der komplexen B. Um speziell die Zusammensetzung der Komplex A Sonde, kann Proteine 1 und 2 Split-BioID zugewiesen werden. Das Foto des Massenspektrometers ist unter einer Creative Commons Attribution-Share gleichermaßen 3.0 Unported Lizenz und wurde von https://commons.wikimedia.org mit Dateinamen von ThermoScientificOrbitrapElite.JPG heruntergeladen. <a href="/files/ftp_upload/57479/57479fig1large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57479/57479fig2.jpg"> Abbildung 2: Split-BioID Plasmide Expressionskassetten. Wir bieten vier Plasmide um alle Kombinationen von NBirA * und CBirA * Fusionsproteine testen zu können. Die Plasmide und komplette Karten sind erhältlich bei addgene.org unter den angegebenen Nummern. Die Plasmide haben einen Tet-responsive Element (7 X TetO) und müssen in einer Zelllinie verwendet werden, die mit dem Tet-Ausdruck-System kompatibel ist. Beachten Sie auch, dass in allen Plasmiden ORFs FKBP und FRB zu NBirA verschmolzen * und CBirA * bzw. Fragmente. Diese beiden Proteine interagieren nur in Anwesenheit von Rapamycin und daher können Plasmide verwendet werden, um das System schnell in das Vorhandensein oder Fehlen von diesem chemischen9zu testen. Die angegebenen Restriktionsschnittstellen sind einzigartig. <a href="/files/ftp_upload/57479/57479fig2large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57479/57479fig3.jpg"> Abbildung 3: typische Western-Blot für ein Split-BioID Experiment. Obere Leiste: Erkennung von biotinylierte Proteine mit Gewebekulturen beschrifteten Streptavidin. Untere Leiste: Erkennung von Fusionsproteinen mit Anti-Myc und Anti-FLAG Antikörper. Zwei Paare der Proteine wurden getestet: Ago2/TNRC6C und Ago2/Dicer. In Gassen, 2 & 3 war das CBirA * Fragment Ago2 angefügt. In Gassen 6 & 7 war das NBirA * Fragment Ago2 angefügt. Kein signifikantes Signal wurde beobachtet, wenn jede der drei Proteine mit NBirA * kombiniert wurden-GLP (Bahnen 1, 4-5). Die Sterne zeigen die Bänder entsprechend endogen biotinylierte Proteine, die als interne laden Kontrollen dienen können. Diese Zahl ist aus Abbildung 5 b von Schopp Et Al. adaptiert 9 unter einer Creative Commons Namensnennung 4.0 International-Lizenz. <a href="/files/ftp_upload/57479/57479fig3large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57479/57479fig4.jpg"> Abbildung 4: Überblick über die Streptavidin-Pulldown-Verfahren. Wichtige Schritte für die Isolierung von biotinylierte Proteine für Massenspektrometrie Analyse werden dargestellt. <a href="/files/ftp_upload/57479/57479fig4large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57479/57479fig5.jpg"> Abbildung 5: typische Western-Blot für ein Streptavidin-Pulldown-Experiment. Gleiche Volumina der angegebenen Samples auf ein SDS-Polyacrylamid-Gel geladen wurden. Nach Western blotting, wurden mit HRP-gekoppelte Streptavidin biotinylierte Proteine entdeckt. Bands, die entsprechenden NBirA *-TNRC6C und CBirA *-Ago2 angegeben. <a href="/files/ftp_upload/57479/57479fig5large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/57479/57479fig6.jpg"> Abbildung 6: typische Coomassie gefärbt Protein Gel für Massenspektrometrie Analyse. Die eluierten Probe von Streptavidin-gekoppelten Perlen war auf einem vorgefertigten Protein Gel geladen und ausgeführt, bis die Probe Migrieren von 2-3 cm. Die großen Band gesehen bei etwa 17 kDa ist Streptavidin. Direkt oberhalb der Band ist ausgeschnitten und an einer Massenspektrometrie-Anlage gesendet. Bands, die entsprechenden NBirA *-TNRC6C und CBirA *-Ago2 angegeben. <a href="/files/ftp_upload/57479/57479fig6large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Transfektion Probe</td>
			<td colspan="3">Zustand geprüft</td>
		</tr>
<tr>
<td>1</td>
			<td colspan="3">NBirA *-protein1 / CBirA *-protein2</td>
		</tr>
<tr>
<td>2</td>
			<td colspan="3">CBirA *-protein1 / NBirA *-protein2</td>
		</tr>
<tr>
<td>3</td>
			<td colspan="3">NBirA *-GLP / CBirA *-protein1</td>
		</tr>
<tr>
<td>4</td>
			<td colspan="3">NBirA *-GLP / CBirA *-protein2</td>
		</tr>
<tr>
<td>5</td>
			<td colspan="3">keine Transfektion</td>
		</tr>
</tbody></table>Tabelle 1: In der Regel getestet Bedingungen beim Split-BioID anwenden auf zwei Proteine.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Sequenzierung Grundierung</td>
			<td>Sequenz</td>
		</tr>
<tr>
<td>Kassette 1 rückwärts-Primer (CBirA * Fusion)</td>
			<td>TATACTTTCTAGAGAATAGGAAC</td>
		</tr>
<tr>
<td>Kassette 2 rückwärts-Primer (NBirA * Fusion)</td>
			<td>GTGGTTTGTCCAAACTCATC</td>
		</tr>
</tbody></table>Tabelle 2: Sequenzierung Primer für die Split-BioID Plasmide.

Watch this Scientific Journal Video about Split-BioID Ã¢â‚¬â€ Proteomic Analysis of Context-specific Protein Complexes in Their Native Cellular Environment at JoVE.com

Split-BioID &#8212; Proteomic Analysis of Context-specific Protein Complexes in Their Native Cellular Environment

Wir bieten eine schrittweise Protokoll für Split-BioID, ein Protein-Fragmente-Ergänzung-Assay basiert auf der Nähe-labeling Technik BioID. Auf das Zusammenspiel der zwei bestimmte Proteine aktiviert, ermöglicht es die Proteomik-Analyse der Kontext-abhängige Proteinkomplexe in ihrer natürlichen zellulären Umgebung. Die Methode ist einfach, kostengünstig und erfordert nur standard Laborgeräten.

Split-BioID — Proteomic Analyse der kontextspezifischen Proteinkomplexe in ihrer natürlichen zellulären Umgebung

To complement existing affinity purification (AP) approaches for the identification of protein-protein interactions (PPI), enzymes have been introduced ...

split-bioid-proteomic-analysis-context-specific-protein-complexes

Nanyang Technological University

Research

JoVE Journal

Biochemistry

19.6K Aufrufe.  Heidelberg University. Wir bieten eine schrittweise Protokoll für Split-BioID, ein Protein-Fragmente-Ergänzung-Assay basiert auf der Nähe-labeling Technik BioID. Auf das Zusammenspiel der zwei bestimmte Proteine aktiviert, ermöglicht es die Proteomik-Analyse der Kontext-abhängige Proteinkomplexe in ihrer natürlichen zellulären Umgebung. Die Methode ist einfach, kostengünstig und erfordert nur standard Laborgeräten.

Serie: Split-BioID — Proteomic Analysis of Context-specific Protein Complexes in Their Native Cellular Environment

Identification of Small Molecule-binding Proteins in a Native Cellular Environment by Live-cell Photoaffinity Labeling

Identifying the molecular target(s) of small molecules is a challenging but necessary step towards understanding their mechanism of action. While several target identification methods have been developed and used to successfully elucidate the binding proteins of a variety of small molecules, these techniques have drawbacks that make them unsuitable for detecting certain types of small molecule-target interactions. In particular, non-covalent interactions that depend on native cellular conditions, such as those of membrane proteins whose structures may be perturbed upon cell lysis, are often not amenable to affinity-based target identification methods. Here, we demonstrate a method wherein a probe containing a photolabile group is used to covalently crosslink to the small molecule binding protein within the environment of the live cell, allowing the detection and isolation of the target protein without the need for maintenance of the interaction after cell lysis. This technique is a valuable tool for studying biologically interesting small molecules with unknown mechanisms, both in the context of basic biology as well as drug discovery.

We describe here a method for identification of small molecule-binding proteins using photoaffinity labeling. The advantage of this technique is that binding and covalent labeling of the target proteins occurs within the live cellular environment, removing the risk of disrupting native protein structure and binding conditions upon cell lysis.

Identifizierung von kleinen Molekülen-bindende Proteine ​​in nativer zellulären Umgebung von lebenden Zellen Photoaffinitatsmarkierung

Identifying the molecular target(s) of small molecules is a challenging but necessary step towards understanding their mechanism of action. While several ...

Forschung

Biochemie

Synthesis of 1,2-Azaborines and the Preparation of Their Protein Complexes with T4 Lysozyme Mutants

We describe a general synthesis of 1,2-azaborines using standard air-free techniques and protein complex preparation with T4 lysozyme mutants by vapor diffusion. Oxygen- and moisture-sensitive compounds are prepared and isolated under an inert atmosphere (N2) using either a vacuum gas manifold or a glove box. As an example of azaborine synthesis, we demonstrate the synthesis and purification of the volatile N-H-B-ethyl-1,2-azaborine by a five-step sequence involving distillation and column chromatography for the isolation of products. T4 lysozyme mutants L99A and L99A/M102Q are expressed with Escherichia coli RR1 strain. Standard protocols for chemical cell lysis followed by purification using carboxymethyl ion exchange column affords protein of sufficiently high purity for crystallization. Protein crystallization is performed in various concentrations of precipitant at different pH ranges using the hanging drop vapor diffusion method. Complex preparation with the small molecules is carried out by vapor diffusion method under an inert atmosphere. X-ray diffraction analysis of the crystal complex provides unambiguous structural evidence of binding interactions between the protein binding site and 1,2-azaborines.

A protocol for the synthesis of 1,2-azaborines and the preparation of their protein complexes with T4 lysozyme mutants is presented.

Synthese von 1,2-Azaborines und die Vorbereitung ihrer Proteinkomplexe mit T4-Lysozym Mutants

We describe a general synthesis of 1,2-azaborines using standard air-free techniques and protein complex preparation with T4 lysozyme mutants by vapor ...

Tandem Affinity Purification of Protein Complexes from Eukaryotic Cells

The purification of active protein-protein and protein-nucleic acid complexes is crucial for the characterization of enzymatic activities and de novo identification of novel subunits and post-translational modifications. Bacterial systems allow for the expression and purification of a wide variety of single polypeptides and protein complexes. However, this system does not enable the purification of protein subunits that contain post-translational modifications (e.g., phosphorylation and acetylation), and the identification of novel regulatory subunits that are only present/expressed in the eukaryotic system. Here, we provide a detailed description of a novel, robust, and efficient tandem affinity purification (TAP) method using STREP- and FLAG-tagged proteins that facilitates the purification of protein complexes with transiently or stably expressed epitope-tagged proteins from eukaryotic cells. This protocol can be applied to characterize protein complex functionality, to discover post-translational modifications on complex subunits, and to identify novel regulatory complex components by mass spectrometry. Notably, this TAP method can be applied to study protein complexes formed by eukaryotic or pathogenic (viral and bacterial) components, thus yielding a wide array of downstream experimental opportunities. We propose that researchers working with protein complexes could utilize this approach in many different ways.

We describe here a novel, robust, and efficient tandem affinity purification (TAP) method for the expression, isolation, and characterization of protein complexes from eukaryotic cells. This protocol could be utilized for the biochemical characterization of discrete complexes as well as the identification of novel interactors and post-translational modifications that regulate their function.

Tandem Affinity Purification von Proteinkomplexen aus eukaryotischen Zellen

The purification of active protein-protein and protein-nucleic acid complexes is crucial for the characterization of enzymatic activities and de novo ...

Resolving Affinity Purified Protein Complexes by Blue Native PAGE and Protein Correlation Profiling

Most proteins act in association with others; hence, it is crucial to characterize these functional units in order to fully understand biological processes. Affinity purification coupled to mass spectrometry (AP-MS) has become the method of choice for identifying protein-protein interactions. However, conventional AP-MS studies provide information on protein interactions, but the organizational information is lost. To address this issue, we developed a strategy to unravel the distinct functional assemblies a protein might be involved in, by resolving affinity-purified protein complexes prior to their characterization by mass spectrometry. Protein complexes isolated through affinity purification of a bait protein using an epitope tag and competitive elution are separated through blue native electrophoresis. Comparison of protein migration profiles through correlation profiling using quantitative mass spectrometry allows assignment of interacting proteins to distinct molecular entities. This method is able to resolve protein complexes of close molecular weights that might not be resolved by traditional chromatographic techniques such as gel filtration. With little more work than conventional AP-geLC-MS/MS, we demonstrate this strategy may in many cases be adequate for obtaining protein complex topological information concomitantly to identifying protein interactions.

Here we present protocols for affinity purification of protein complexes and their separation by blue native PAGE, followed by protein correlation profiling using label free quantitative mass spectrometry. This method is useful to resolve interactomes into distinct protein complexes.

Auflösen von Affinity Purified Protein-Komplexen von Blue native PAGE und Protein Correlation Profilieren

Most proteins act in association with others; hence, it is crucial to characterize these functional units in order to fully understand biological ...

Horizontal Gel Electrophoresis for Enhanced Detection of Protein-RNA Complexes

Native polyacrylamide gel electrophoresis is a fundamental tool of molecular biology that has been used extensively for the biochemical analysis of RNA-protein interactions. These interactions have been traditionally analyzed with polyacrylamide gels generated between two glass plates and samples electrophoresed vertically. However, polyacrylamide gels cast in trays and electrophoresed horizontally offers several advantages. For example, horizontal gels used to analyze complexes between fluorescent RNA substrates and specific proteins can be imaged multiple times as electrophoresis progresses. This provides the unique opportunity to monitor RNA-protein complexes at several points during the experiment. In addition, horizontal gel electrophoresis makes it possible to analyze many samples in parallel. This can greatly facilitate time course experiments as well as analyzing multiple reactions simultaneously to compare different components and conditions. Here we provide a detailed protocol for generating and using horizontal native gel electrophoresis for analyzing RNA-Protein interactions.

Native polyacrylamide gel electrophoresis is a fundamental tool for analyzing RNA-protein interactions. Traditionally most experiments have used vertical gels. However, horizontal gels provide several advantages, such as the opportunity to monitor complexes during electrophoresis. We provide a detailed protocol for generating and using horizontal native gel electrophoresis.

Horizontale Gel-Elektrophorese zur verbesserten Nachweis von Protein-RNA-Komplexen

Native polyacrylamide gel electrophoresis is a fundamental tool of molecular biology that has been used extensively for the biochemical analysis of ...

Dissection of Human Retina and RPE-Choroid for Proteomic Analysis

The human retina is composed of the sensory neuroretina and the underlying retinal pigmented epithelium (RPE), which is firmly complexed to the vascular choroid layer. Different regions of the retina are anatomically and molecularly distinct, facilitating unique functions and demonstrating differential susceptibility to disease. Proteomic analysis of each of these regions and layers can provide vital insights into the molecular process of many diseases, including Age-Related Macular Degeneration (AMD), diabetes mellitus, and glaucoma. However, separation of retinal regions and layers is essential before quantitative proteomic analysis can be accomplished. Here, we describe a method for dissection and collection of the foveal, macular, and peripheral retinal regions and underlying RPE-choroid complex, involving regional punch biopsies and manual removal of tissue layers from a human eye.One-dimensional SDS-PAGE as well as downstream proteomic analysis, such as liquid chromatography-tandem mass spectrometry (LC-MS/MS), can be used to identify proteins in each dissected retinal layer, revealing molecular biomarkers for retinal disease.

The human retina is composed of functionally and molecularly distinct regions, including the fovea, macula, and peripheral retina. Here, we describe a method using punch biopsies and manual removal of tissue layers from a human eye to dissect and collect these distinct retinal regions for downstream proteomic analysis.

Dissektion der menschlichen Netzhaut und RPE-Aderhaut für Proteomic Analysen

The human retina is composed of the sensory neuroretina and the underlying retinal pigmented epithelium (RPE), which is firmly complexed to the vascular ...

2 in 1: One-step Affinity Purification for the Parallel Analysis of Protein-Protein and Protein-Metabolite Complexes

Cellular processes are regulated by interactions between biological molecules such as proteins, metabolites, and nucleic acids. While the investigation of protein-protein interactions (PPI) is no novelty, experimental approaches aiming to characterize endogenous protein-metabolite interactions (PMI) constitute a rather recent development. Herein, we present a protocol that allows simultaneous characterization of the PPI and PMI of a protein of choice, referred to as bait. Our protocol was optimized for Arabidopsis cell cultures and combines affinity purification (AP) with mass spectrometry (MS)-based protein and metabolite detection. In short, transgenic Arabidopsis lines, expressing bait protein fused to an affinity tag, are first lysed to obtain a native cellular extract. Anti-tag antibodies are used to pull down protein and metabolite partners of the bait protein. The affinity-purified complexes are extracted using a one-step methyl tert-butyl ether (MTBE)/methanol/water method. Whilst metabolites separate into either the polar or the hydrophobic phase, proteins can be found in the pellet. Both metabolites and proteins are then analyzed by ultra-performance liquid chromatography-mass spectrometry (UPLC-MS or UPLC-MS/MS). Empty-vector (EV) control lines are used to exclude false positives. The major advantage of our protocol is that it enables identification of protein and metabolite partners of a target protein in parallel in near-physiological conditions (cellular lysate). The presented method is straightforward, fast, and can be easily adapted to biological systems other than plant cell cultures.

Protein-protein and protein-metabolite interactions are crucial for all cellular functions. Herein, we describe a protocol that allows parallel analysis of these interactions with a protein of choice. Our protocol was optimized for plant cell cultures and combines affinity purification with mass spectrometry-based protein and metabolite detection.

2 in 1: Affinitätsreinigung für die parallele Analyse von Protein-Protein und Protein-Metabolit komplexe in einem Schritt

Cellular processes are regulated by interactions between biological molecules such as proteins, metabolites, and nucleic acids. While the investigation of ...

Analysis of Thylakoid Membrane Protein Complexes by Blue Native Gel Electrophoresis

Photosynthetic electron transfer chain (ETC) converts solar energy to chemical energy in the form of NADPH and ATP. Four large protein complexes embedded in the thylakoid membrane harvest solar energy to drive electrons from water to NADP+ via two photosystems, and use the created proton gradient for production of ATP. Photosystem PSII, PSI, cytochrome b6f (Cyt b6f) and ATPase are all multiprotein complexes with distinct orientation and dynamics in the thylakoid membrane. Valuable information about the composition and interactions of the protein complexes in the thylakoid membrane can be obtained by solubilizing the complexes from the membrane integrity by mild detergents followed by native gel electrophoretic separation of the complexes. Blue native polyacrylamide gel electrophoresis (BN-PAGE) is an analytical method used for the separation of protein complexes in their native and functional form. The method can be used for protein complex purification for more detailed structural analysis, but it also provides a tool to dissect the dynamic interactions between the protein complexes. The method was developed for the analysis of mitochondrial respiratory protein complexes, but has since been optimized and improved for the dissection of the thylakoid protein complexes. Here, we provide a detailed up-to-date protocol for analysis of labile photosynthetic protein complexes and their interactions in Arabidopsis thaliana.

A protocol for the elucidation of plant thylakoid protein complex organization and composition with blue native polyacrylamide gel electrophoresis (BN-PAGE) and 2D-SDS-PAGE is described. The protocol is optimized for Arabidopsis thaliana, but can be used for other plant species with minor modifications.

Analyse der Thylakoidmembran Membran-Protein-komplexe durch blaue Native Gelelektrophorese

Photosynthetic electron transfer chain (ETC) converts solar energy to chemical energy in the form of NADPH and ATP. Four large protein complexes embedded ...

Proteomic Analysis of Human Macrophage Polarization Under a Low Oxygen Environment

Macrophages are innate immune cells involved in a number of physiological functions ranging from responses to infectious pathogens to tissue homeostasis. The various functions of these cells are related to their activation states, which is also called polarization. The precise molecular description of these various polarizations is a priority in the field of macrophage biology. It is currently acknowledged that a multidimensional approach is necessary to describe how polarization is controlled by environmental signals. In this report, we describe a protocol designed to obtain the proteomic signature of various polarizations in human macrophages. This protocol is based on a label-free quantification of macrophage protein expression obtained from in-gel fractionated and Lys C/trypsin-digested cellular lysis content. We also provide a protocol based on in-solution digestion and isoelectric focusing fractionation to use as an alternative. Because oxygen concentration is a relevant environmental parameter in tissues, we use this protocol to explore how atmospheric composition or a low oxygen environment affects the classification of macrophage polarization.

We present a protocol to obtain proteomic signatures of human macrophages and apply this to determination of the impact of a low oxygen environment on macrophage polarization.

Proteomic Analysen der menschlichen Makrophagen Polarisierung in einer sauerstoffarmen Umgebung

Macrophages are innate immune cells involved in a number of physiological functions ranging from responses to infectious pathogens to tissue homeostasis. ...

Analysis of Protein Folding, Transport, and Degradation in Living Cells by Radioactive Pulse Chase

Radioactive pulse-chase labeling is a powerful tool for studying the conformational maturation, the transport to their functional cellular location, and the degradation of target proteins in live cells. By using short (pulse) radiolabeling times (&lt;30 min) and tightly controlled chase times, it is possible to label only a small fraction of the total protein pool and follow its folding. When combined with nonreducing/reducing SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoprecipitation with (conformation-specific) antibodies, folding processes can be examined in great detail. This system has been used to analyze the folding of proteins with a huge variation in properties such as soluble proteins, single and multi-pass transmembrane proteins, heavily N- and O-glycosylated proteins, and proteins with and without extensive disulfide bonding. Pulse-chase methods are the basis of kinetic studies into a range of additional features, including co- and posttranslational modifications, oligomerization, and polymerization, essentially allowing the analysis of a protein from birth to death. Pulse-chase studies on protein folding are complementary with other biochemical and biophysical methods for studying proteins in vitro by providing increased temporal resolution and physiological information. The methods as described within this paper are adapted easily to study the folding of almost any protein that can be expressed in mammalian or insect-cell systems.

Here we describe a protocol for a general pulse-chase method that allows the kinetic analysis of folding, transport, and degradation of proteins to be followed in live cells.

Analyse der Proteinfaltung, Transport und Abbau in lebenden Zellen durch radioaktive Puls Chase

Radioactive pulse-chase labeling is a powerful tool for studying the conformational maturation, the transport to their functional cellular location, and ...