Bu çalışmalar Alman Araştırma Konseyi (DFG) Alman mükemmellik girişimi (CellNetworks DFG-hariç 81) ve SFB638 ortak araştırma merkezi tarafından kısmi bir finansman yoluyla destekleriyle gerçekleştirilmiştir.

<ol>
	<li>Scott, D. E., Bayly, A. R., Abell, C., Skidmore, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Small+molecules,+big+targets:+drug+discovery+faces+the+protein-protein+interaction+challenge.">Small molecules, big targets: drug discovery faces the protein-protein interaction challenge.</a> Nat Rev Drug Discov. 15 (8), 533-550 (2016).</li><li>Roux, K. J., Kim, D. I., Raida, M., Burke, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+promiscuous+biotin+ligase+fusion+protein+identifies+proximal+and+interacting+proteins+in+mammalian+cells.">A promiscuous biotin ligase fusion protein identifies proximal and interacting proteins in mammalian cells.</a> J Cell Biol. 196 (6), 801-810 (2012).</li><li>Lam, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+APEX2+for+electron+microscopy+and+proximity+labeling.">Directed evolution of APEX2 for electron microscopy and proximity labeling.</a> Nat Methods. 12 (1), 51-54 (2015).</li><li>Rhee, H. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteomic+mapping+of+mitochondria+in+living+cells+via+spatially+restricted+enzymatic+tagging.">Proteomic mapping of mitochondria in living cells via spatially restricted enzymatic tagging.</a> Science. 339 (6125), 1328-1331 (2013).</li><li>Kim, D. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+nuclear+pore+complex+architecture+with+proximity-dependent+biotinylation.">Probing nuclear pore complex architecture with proximity-dependent biotinylation.</a> P Natl Acad Sci USA. 111 (24), E2453-E2461 (2014).</li><li>Kim, D. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+smaller+biotin+ligase+for+BioID+proximity+labeling.">An improved smaller biotin ligase for BioID proximity labeling.</a> Mol Biol Cell. 27 (8), 1188-1196 (2016).</li><li>Lambert, J. P., Tucholska, M., Go, C., Knight, J. D., Gingras, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proximity+biotinylation+and+affinity+purification+are+complementary+approaches+for+the+interactome+mapping+of+chromatin-associated+protein+complexes.">Proximity biotinylation and affinity purification are complementary approaches for the interactome mapping of chromatin-associated protein complexes.</a> J Proteomics. 118, 81-94 (2015).</li><li>Morriswood, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+bilobe+components+in+Trypanosoma+brucei+identified+using+proximity-dependent+biotinylation.">Novel bilobe components in Trypanosoma brucei identified using proximity-dependent biotinylation.</a> Eukaryot Cell. 12 (2), 356-367 (2013).</li><li>Schopp, I. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Split-BioID+a+conditional+proteomics+approach+to+monitor+the+composition+of+spatiotemporally+defined+protein+complexes.">Split-BioID a conditional proteomics approach to monitor the composition of spatiotemporally defined protein complexes.</a> Nat Commun. 8, (2017).</li><li>B&#233;thune, J., Artus-Revel, C. G., Filipowicz, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinetic+analysis+reveals+successive+steps+leading+to+miRNA-mediated+silencing+in+mammalian+cells.">Kinetic analysis reveals successive steps leading to miRNA-mediated silencing in mammalian cells.</a> EMBO Rep. 13 (8), 716-723 (2012).</li><li>Inoue, H., Nojima, H., Okayama, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+efficiency+transformation+of+Escherichia+coli+with+plasmids.">High efficiency transformation of Escherichia coli with plasmids.</a> Gene. 96 (1), 23-28 (1990).</li><li>Weidenfeld, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+expression+of+coding+and+inhibitory+RNAs+from+retargetable+genomic+loci.">Inducible expression of coding and inhibitory RNAs from retargetable genomic loci.</a> Nucleic Acids Res. 37 (7), e50 (2009).</li><li>Dyballa, N., Metzger, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+and+sensitive+colloidal+coomassie+G-250+staining+for+proteins+in+polyacrylamide+gels.">Fast and sensitive colloidal coomassie G-250 staining for proteins in polyacrylamide gels.</a> J Vis Exp. (30), (2009).</li><li>Jonas, S., Izaurralde, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+a+molecular+understanding+of+microRNA-mediated+gene+silencing.">Towards a molecular understanding of microRNA-mediated gene silencing.</a> Nat Rev Genet. 16 (7), 421-433 (2015).</li><li>MacRae, I. J., Ma, E., Zhou, M., Robinson, C. V., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+reconstitution+of+the+human+RISC-loading+complex.">In vitro reconstitution of the human RISC-loading complex.</a> P Natl Acad Sci USA. 105 (2), 512-517 (2008).</li><li>Cox, J., Mann, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MaxQuant+enables+high+peptide+identification+rates,+individualized+p.p.b.-range+mass+accuracies+and+proteome-wide+protein+quantification.">MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification.</a> Nat Biotechnol. 26 (12), 1367-1372 (2008).</li><li>Tyanova, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Perseus+computational+platform+for+comprehensive+analysis+of+(prote)omics+data.">The Perseus computational platform for comprehensive analysis of (prote)omics data.</a> Nat Methods. 13 (9), 731-740 (2016).</li><li>Opitz, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Capturing+the+Asc1p/Receptor+for+Activated+C+Kinase+1+(RACK1)+Microenvironment+at+the+Head+Region+of+the+40S+Ribosome+with+Quantitative+BioID+in+Yeast.">Capturing the Asc1p/Receptor for Activated C Kinase 1 (RACK1) Microenvironment at the Head Region of the 40S Ribosome with Quantitative BioID in Yeast.</a> Mol Cell Proteomics. 16 (12), 2199-2218 (2017).</li><li>Mackmull, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Landscape+of+nuclear+transport+receptor+cargo+specificity.">Landscape of nuclear transport receptor cargo specificity.</a> Mol Syst Biol. 13 (12), 962 (2017).</li><li>Kim, D. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BioSITe:+A+Method+for+Direct+Detection+and+Quantitation+of+Site-Specific+Biotinylation.">BioSITe: A Method for Direct Detection and Quantitation of Site-Specific Biotinylation.</a> J Proteome Res. , (2017).</li><li>Udeshi, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibodies+to+biotin+enable+large-scale+detection+of+biotinylation+sites+on+proteins.">Antibodies to biotin enable large-scale detection of biotinylation sites on proteins.</a> Nat Methods. 14 (12), 1167-1170 (2017).</li><li>Chapat, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cap-binding+protein+4EHP+effects+translation+silencing+by+microRNAs.">Cap-binding protein 4EHP effects translation silencing by microRNAs.</a> P Natl Acad Sci USA. 114 (21), 5425-5430 (2017).</li><li>Luker, K. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinetics+of+regulated+protein-protein+interactions+revealed+with+firefly+luciferase+complementation+imaging+in+cells+and+living+animals.">Kinetics of regulated protein-protein interactions revealed with firefly luciferase complementation imaging in cells and living animals.</a> P Natl Acad Sci USA. 101 (33), 12288-12293 (2004).</li><li>De Munter, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Split-BioID:+a+proximity+biotinylation+assay+for+dimerization-dependent+protein+interactions.">Split-BioID: a proximity biotinylation assay for dimerization-dependent protein interactions.</a> FEBS Lett. 591 (2), 415-424 (2017).</li><li>Xue, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimizing+the+fragment+complementation+of+APEX2+for+detection+of+specific+protein-protein+interactions+in+live+cells.">Optimizing the fragment complementation of APEX2 for detection of specific protein-protein interactions in live cells.</a> Sci Rep. 7 (1), 12039 (2017).</li><li>Branon, T. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+TurboID+for+efficient+proximity+labeling+in+living+cells+and+organisms.">Directed evolution of TurboID for efficient proximity labeling in living cells and organisms.</a> bioRxiv. , (2017).</li></ol>

Yazarlar ifşa gerek yok.

Seviyelendirilmiş yordamı genler ilgi Böl-BioID clone Plazmidler, etkileşim kaynaklı biotinylation için test edileceğini ve kütle spektrometresi analiz için biotinylated proteinler yalıtmak nasıl açıklar. Biz burada geçici transfection dayalı bir açıklayınız. Ifade füzyon proteinlerin Orta olarak eklendi dox miktarına göre ayarlanmış olsa da, geçici transfection fena halde endojen için karşılaştırıldığında füzyon protein overexpress bazı hücreler homojen olmayan protein ifadeyle neden olabilir meslektaşları. Bu distorsiyonları karşılık gelen interactomes ve sadakatle endojen protein içeren etkileşimlerin yansıtmıyor PPI neden olabilir. Böylece Böl-BioID ile geçici sistem kurulduktan sonra istikrarlı hücre hatları oluşturmak için genellikle tavsiye edilir. Plazmid Flp aracılı rekombinasyon sistemi ile uyumlu ve faiz aynı tet-yanıt veren öğe düzenleme altında her iki genler yer. Gerekirse ve uyumlu memeli hücreleri ile kullanıldığında, onlar istikrarlı indüklenebilir hücre hatları kolay oluşturulmasına olanak sağlar. Örneğin, rtTA transkripsiyon tetrasiklin-harekete geçirmek harekete geçirmek ve benzersiz bir targetable genomik locus tetrasiklin-aracılı gen ekspresyonu sıkıca düzenlenmiş12olabilen ifade HeLa-EM2-11 satırını kullanın. Bu hücre kültürünü ve Flp aracılı rekombinasyon kullanarak, tek bir kopyasını transgene içeren istikrarlı hücre hatları iki-üç hafta içinde elde edilebilir. Alternatif olarak, bir de yerel genomik loci ilgi genlerin içinde BirA * parçaları tanıtmak için geçerli genom düzenleme teknikleri kullanabilirsiniz.
Bir protein etiketleme dayanır herhangi bir tahlil olduğu gibi bir sonuç füzyon protein fonksiyonel olup olmadığını düşünün gerekir. Kullanılabilir veri hangi faiz proteinler (örneğin için çalışmalar düşsel GFP) takip ve işlevsel test yararlıdır BirA * parçaları olmalıdır karar için yukarı veya aşağı faiz genler klonlanmış. Böyle bir veri yoksa, bir N-ölümcül sınamanız gerekir veya C-ölümcül öğesini proteinler işlevsel bir tahlil. Örneğin, füzyon proteinlerin etkinlik içinde endojen protein edilmiş çaldı-out ve vahşi türü duruma kıyasla bir hücre kültürünü test edilebilir. Proteinler ilgi her iki N ve C terminali Etiketler hoş görürsen, her ikisi de test edilmelidir. Gerçekten de, BioID deneylerde füzyon protein yönünü22etiketleme verimliliğini etkileyebilir. Böl-BioID protein bir çift için uygulamak, hangi iki proteinlerin ya NBirA * için eklenir veya CBirA * parçalara ayırması da etkisi9etiketleme verimliliğini biz bu Ayrıca, gözlemledim. Böl-BioID plazmid 16 amino asit uzun glisin/zengin bağlayıcı proteinler ilgi BirA * parçaları için kaplin başka bir PCA23 almış ve bizim için tüm etkileşen proteinler için çalıştı serin defa test ettik. Ancak, bir bazı protein çiftleri daha kısa veya daha uzun halkalı ile daha iyi işe yarayabilecek düşünmelisiniz. Son Not başka bir tahlil Bollen grup24tarafından tanımlanmıştır. Bu tahlil, BirA * bizimkinden (E256/G257) başka bir yerinde (E140/Q141) ayrılmıştır. Biz her iki Böl-BioID tatlar-yan yana test ve E256/G257, bu protokol için açıklanan iki etkileşen protein birleştiğinde daha güçlü yeniden etkinleştirme yol açar bulunan9.
Bu yöntemin bir dezavantajı genel etiketleme yavaş hızıdır. Tipik olarak, 6-24 h kuluçka biotin zamanla kayda değer biotinylation6protein kompleksleri dinamik modelleme eğitimi için bu tekniğin kullanımı engellemek, elde etmek gereklidir. İki protein etkileşim kurulduğunda sadece aktif olarak bu tahlil kısmen bu bilmeniz gereken adresleri ise çok dinamik süreçler için ya da kısa ömürlü proteinlerin analiz etmek için çalışmak için kullanımı engel etiketleme yavaş hızı. Mühendislik peroksidaz APEX2 1 dk3içinde proksimal proteinlerin verimli etiketleme teşvik bilinmektedir. APEX2 üzerinde dayalı bir PCA böylece BioID kaynaklı deneyleri yavaş etiketleme hız sınırlamaları adresi. Bir kanıt prensibi çalışma böyle bir split-APEX2 tahlil25nitelendirdi. Bir homodimerizing protein başarıyla biotinylated olsa da, ancak, tahlil de etiket ve etkileşen proteinler bir çift bir araya proteinler tanımlamak için kullanılıp kullanılamayacağı göstermiş kalmaya devam eder. Son zamanlarda, yönlendirilmiş evrim TurboID ve miniTurbo, 10 dk26aşağı daha kısa etiketleme zaman windows sağlayan iki çeşidini BirA * gelişmiş aktivite ile oluşturmak için kullanılan. Böl-BioID bu yeni çeşitleri için adapte uygulamaların daha geniş bir alana bu tekniğin kullanımı daha da uzatır.

En hücresel işlevler dinamik olarak makromoleküllerin kompleksleri araya proteinler tarafından gerçekleştirilen gibi protein-protein etkileşimleri (PPI) kimlik Biyomedikal Araştırma büyük bir çaba değildir. Nitekim, ÜFE kez hastalığında deregüle ve tedavi1için potansiyel hedefleri temsil eder. ÜFE tanımlaması benzeşme arıtma (AP) yaklaşım olan, için en yaygın yöntem kullanılan hücre lizis, ardından bir protein ilgi özellikle bir matris üzerinde saflaştırılmış ve ilişkili proteinler daha sonra kütle spektrometresi tarafından tespit (MS). AP-MS güçlü bir yaklaşım olmakla birlikte, bu genellikle de kötü çözünür protein kompleksleri, geçici çok etkileşimler veya sağlam bir hücre altı yapısı gerektiren PPI gerçekleştirmez. Ayrıca, tek bir protein genellikle birkaç farklı protein kompleksleri parçası olarak verilerin yorumlanması PPI ağlar, dinamik doğası gereği karmaşık.
BioID2 veya APEX23,4 gibi teknikleri yakınlık etiketleme son zamanlarda bazı AP-MS yaklaşımlar sınırlamaları gidermek üzere geliştirilmiştir. BioID içinde enzim BirA * (yabani tip e.coli enzimi G115R değişkenine karşılık gelen) değişken biotinyl-AMP ile Birincil aminler tepki verebilir (biyo-AMP) tromboksan. Biyo-AMFİ için aktif merkezini korur, vahşi türü enzim aksine BirA * biyo-AMP kendi Difüzyon komşu çevresi için izin serbest bırakır. Bu nedenle, faiz bir protein için erimiş ve hücrelerde ifade, proksimal proteinler 10 nm5tahmini bir yelpazesi içinde biotinylated olabilir. Bunlar işaretlenmiş proksimal proteinler sonra streptavidin açılan tarafından izole ve MS tarafından tanımlanan. AP-MS karşı BioID bir füzyon protein ifadesi gerektirir. Bu böylece sadece fonksiyonu etiketleyerek engel değil proteinler için uygulanabilir. Ayrıca, etiketleme hızı genellikle yavaş, 6-24 h2,6kısa ömürlü proteinlerin algılama zorlu yapma,. Henüz, AP-MS için karşılaştırıldığında, BioID-MS birkaç önemli avantajlar sunuyor: ilk, onun yakalar etkileşimleri kendi yerel hücresel ortamında; birleştirilmiş kompleksleri yerine ikinci, etiketli proteinler hücre lizis izole edilmiştir; Üçüncü olarak, streptavidin pulldowns denaturing arabellekleri ve sert çamaşır koşulları kullanarak izin veriyoruz. Bu nedenle, daha hassas geçici veya zayıf etkileşimler7 veya belirli bir ortaya etkileşimleri algılamaya ve hücre altı yapısı8yalıtmak zor yöntemidir.
Ancak, çoğu proteinler genellikle hücresel cues göre ya da yapılması gereken işlevine yeni model daha büyük kompleksler bir parçasıdır. Bu nedenle, tek bir protein genellikle birkaç kompleksleri, farklı işlevsel birimler için karşılık gelen, farklı içeren ve/veya ÜFE örtüşen bir parçasıdır. Her iki yaklaşımın tüm ilişkilendirmeleri verilen bir protein olabilir genel bir bakış vermek, ama onlar bireysel PPI bağlamında adrese başarısız. İkinci çözünürlüğü artırmak için biz bir protein parçaları uluslara tahlil (PCA) hangi iki etkin olmayan parçaları BirA * (NBirA * katalitik etki alanı içeren ve CBirA * yeniden etkinleştirme etki alanı olarak görüntülenebilir) olabilir tasarladık tekrar yakın iki tarafından getirdiğinde etkin bir enzim içine proteinler9etkileşim. Elde edilen Böl-BioID tahlil yakınlık bağımlı biotinylation etkileşen proteinler bir çift bir araya ve böylece bağlam kimliği bağımlı protein derlemeler sağlayan proteinler üzerinde odaklanır. Son zamanlarda iki ayrı protein kompleksleri miRNA-aracılı gen susturmak yolu9' dahil çözülerek Böl-BioID en iyi çözünürlük gücünü gösterdi.
Özet olarak, bir tek ve basit yöntemi, keşfetmek ve özellikle PPI içinde belirli bir protein dahil, karşılık gelen protein kompleksi ek bir etkileşen protein bilinen sağlanan tanımlanmış işlevsel birimleri için atama Böl-BioID sağlar.

<table>
	<tbody>
		<tr>
			<td>Acetic acid (glacial)</td>
			<td>VWR</td>
			<td>20104.298</td>
			<td>To make TAE buffer</td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Sigma</td>
			<td>A9539</td>
			<td>Take TAE-agarose gels for DNA analysis and extraction</td>
		</tr>
		<tr>
			<td>Ammonia solution 25% NH3</td>
			<td>Bernd Kraft</td>
			<td>6012</td>
			<td>To dissolve biotin</td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Sigma</td>
			<td>A9518</td>
			<td>To select transformed bacteria</td>
		</tr>
		<tr>
			<td>Bioruptor plus sonification device</td>
			<td>Diagenode</td>
			<td>B01020001</td>
			<td>Other sonification devices are also ok</td>
		</tr>
		<tr>
			<td>Biotin</td>
			<td>Sigma</td>
			<td>B4639</td>
			<td>To be added to the growth medium to stimulate efficient biotinylation</td>
		</tr>
		<tr>
			<td>Bovine serum albumin fraction V</td>
			<td>Carl Roth</td>
			<td>8076</td>
			<td>Used in Western blot buffers and a protein standard in Bradford assays</td>
		</tr>
		<tr>
			<td>Bradford Ultra reagent</td>
			<td>Expedeon</td>
			<td>BFU05L</td>
			<td>Any other method/kit for protein determination is fine, this particular reagent is more tolerant to detergent than other Bradford reagents</td>
		</tr>
		<tr>
			<td>Cell scrappers</td>
			<td>TPP</td>
			<td>99002</td>
			<td>Any other model is also fine</td>
		</tr>
		<tr>
			<td>ClaI</td>
			<td>New England Biolabs</td>
			<td>R0197</td>
			<td>Restriction enzyme for cloning into the split-BioID plasmids (NBirA* fusion)</td>
		</tr>
		<tr>
			<td>DMEM medium</td>
			<td>Sigma</td>
			<td>D6046</td>
			<td>If using another cell line, use the corresponding optimal growth medium</td>
		</tr>
		<tr>
			<td>DNA miniprep kit</td>
			<td>Sigma</td>
			<td>PLN350</td>
			<td>Any other kit is also fine</td>
		</tr>
		<tr>
			<td>Doxycycline</td>
			<td>Applichem</td>
			<td>A2951</td>
			<td>Dox is light sensitive</td>
		</tr>
		<tr>
			<td>DTT</td>
			<td>Applichem</td>
			<td>A2948</td>
			<td>Make 1M stock solution, store at -20 &#176;C and always use fresh</td>
		</tr>
		<tr>
			<td>DyLight 680-conjugated streptavidin</td>
			<td>Thermo scientific</td>
			<td>21848</td>
			<td>to use with a LiCor Western blot scanning device</td>
		</tr>
		<tr>
			<td>Dynabeads MyOne Streptavidin C1</td>
			<td>Invitrogen</td>
			<td>65002</td>
			<td>The C1 beads are not BSA coated which is preferable for downstream MS applications (no leakthrough of BSA in the final elution)</td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Applichem</td>
			<td>A5097</td>
			<td>Make a 500 mM stock, adjust pH to 8 while dissolving the EDTA powder</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>Sigma</td>
			<td>32205</td>
			<td>Make a 70% stock solution in which Doxycycline can be dissolved at 10 mg.mL-1</td>
		</tr>
		<tr>
			<td>Fastgene Gel/PCR DNA Extraction Kit</td>
			<td>Nippon Genetics</td>
			<td>FG-91302</td>
			<td>Any other kit is also fine</td>
		</tr>
		<tr>
			<td>HCl 37%</td>
			<td>Merck</td>
			<td>1.00317.1000</td>
			<td>To adjust pH of biotin stock solution</td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Carl Roth</td>
			<td>6763</td>
			<td>Make a 500 mM stock solution, adjust the pH to 7.4</td>
		</tr>
		<tr>
			<td>Immobilon-FL PVDF membrane, 0.45&#160;&#181;m</td>
			<td>Millipore</td>
			<td>IPFL00010</td>
			<td>This membrane shows minimal autofluorescence when used with a LiCor Western blot scanning device</td>
		</tr>
		<tr>
			<td>LiCl</td>
			<td>Gr&#252;ssing GmbH</td>
			<td>12083</td>
			<td>Make a 5M stock solution</td>
		</tr>
		<tr>
			<td>Odyssey CLx imaging system</td>
			<td>LI-COR</td>
			<td>N/A</td>
			<td>To scan Western blot membrane decorated with fluorophore-labeled antibody</td>
		</tr>
		<tr>
			<td>Linear polyethylenimine (PEI)</td>
			<td>Polysciences</td>
			<td>23966-2</td>
			<td>Any other transfection reagent is also fine</td>
		</tr>
		<tr>
			<td>Milk powder</td>
			<td>Carl Roth</td>
			<td>T145</td>
			<td>To block Western blot membranes</td>
		</tr>
		<tr>
			<td>MluI-HF</td>
			<td>New England Biolabs</td>
			<td>R3198</td>
			<td>Restriction enzyme for cloning into the split-BioID plasmids (NBirA* fusion)</td>
		</tr>
		<tr>
			<td>Na-deoxycholate</td>
			<td>Sigma</td>
			<td>30970</td>
			<td>Make a 10% (w/v) stock solution</td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Sigma</td>
			<td>31434</td>
			<td>Make a 5M stock solution</td>
		</tr>
		<tr>
			<td>NP-40 (Nonidet P40 substitute)</td>
			<td>Sigma</td>
			<td>74385</td>
			<td>Make a 20% (v/v) stock solution</td>
		</tr>
		<tr>
			<td>PacI</td>
			<td>New England Biolabs</td>
			<td>R0547</td>
			<td>Restriction enzyme for cloning into the split-BioID plasmids (CBirA* fusion)</td>
		</tr>
		<tr>
			<td>Phosphate buffer saline (PBS)</td>
			<td>Sigma</td>
			<td>806552</td>
			<td>To wash cells before scrapping</td>
		</tr>
		<tr>
			<td>PmeI</td>
			<td>New England Biolabs</td>
			<td>R0560</td>
			<td>Restriction enzyme for cloning into the split-BioID plasmids (CBirA* fusion)</td>
		</tr>
		<tr>
			<td>Protease inhibitor cocktail</td>
			<td>Roche</td>
			<td>4693132001</td>
			<td>Added to the lysis buffer to prevent protein degradation</td>
		</tr>
		<tr>
			<td>pSF3-Flag-CBir-FRB_Myc-NBir-FKBP</td>
			<td>Addgene</td>
			<td>90003</td>
			<td>Split-BioID plasmid, mediates the co-expression of NBirA*-FKBP and CBirA*-FRB, FKBP and FRB can be replaced by two other ORFs</td>
		</tr>
		<tr>
			<td>pSF3-Flag-CBir-FRB_FKBP-Myc-Nbir</td>
			<td>Addgene</td>
			<td>90004</td>
			<td>Split-BioID plasmid, mediates the co-expression of FKBP-NBirA* and CBirA*-FRB, FKBP and FRB can be replaced by two other ORFs</td>
		</tr>
		<tr>
			<td>pSF3-Flag-FRB-Cbir_Myc-NBir-FKBP</td>
			<td>Addgene</td>
			<td>90008</td>
			<td>Split-BioID plasmid, mediates the co-expression of NBirA*-FKBP and FRB-CBirA*, FKBP and FRB can be replaced by two other ORFs</td>
		</tr>
		<tr>
			<td>pSF3-Flag-FRB-Cbir_FKBP-Myc-Nbir</td>
			<td>Addgene</td>
			<td>90009</td>
			<td>Split-BioID plasmid, mediates the co-expression of FKBP-NBirA* and FRB-CBirA*, FKBP and FRB can be replaced by two other ORFs</td>
		</tr>
		<tr>
			<td>Q5 High-Fidelity PCR kit</td>
			<td>New England Biolabs</td>
			<td>E0555S</td>
			<td>To amplify the ORF coding for the proteins to be tested. Any other thermostable DNA polymerase is fine.</td>
		</tr>
		<tr>
			<td>Quick ligation kit</td>
			<td>New England Biolabs</td>
			<td>M2200S</td>
			<td>To ligate DNA fragments into the split-BioID plasmids, any other DNA ligation system is fine.</td>
		</tr>
		<tr>
			<td>RunBlue 4-20% SDS precast gels</td>
			<td>Expedeon</td>
			<td>BCG42012</td>
			<td>To use when running samples for MS analysis</td>
		</tr>
		<tr>
			<td>RunBlue LDS Sample Buffer</td>
			<td>Expedeon</td>
			<td>NXB31010</td>
			<td>Running buffer for the RunBlue precast gels</td>
		</tr>
		<tr>
			<td>SDS</td>
			<td>Sigma</td>
			<td>5030</td>
			<td>Comes as a 20% stock solution</td>
		</tr>
		<tr>
			<td>tet-free serum</td>
			<td>Biowest</td>
			<td>S181T</td>
			<td>we use tet-free serum to minimize basal expression of the fusion proteins</td>
		</tr>
		<tr>
			<td>Trans-Blot Turbo Transfer system</td>
			<td>Bio-Rad</td>
			<td>1704150</td>
			<td>High speed Western blotting transfer system, any other transfer system is also fine</td>
		</tr>
		<tr>
			<td>Tris</td>
			<td>Carl Roth</td>
			<td>4855</td>
			<td>Make 1M stock solutions with adequate pH (7.4 and 8)</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Applichem</td>
			<td>A4975</td>
			<td>Make a 20% (v/v) stock solution</td>
		</tr>
		<tr>
			<td>Tween-20</td>
			<td>Carl Roth</td>
			<td>9127</td>
			<td>Used in Western blot buffers, Tween 20 leads to high background fluorescence and should be omitted in the blocking and last wash step</td>
		</tr>
	</tbody>
</table>

split-bioid &#8212; proteomic analysis of context-specific protein complexes in their native cellular environment

Varolan benzeşme arıtma (AP) tamamlayacak protein-protein etkileşimleri (PPI) tanımlanması için yaklaşımlar, enzimler yakınlık bağımlı yaşayan hücrelerde proteinlerin etiketleme izin tanıttı. Bir tür enzim, BirA * (BioID yaklaşımda kullanılır), aracılık eder yaklaşık 10 tonluk bir içindeki proteinlerin biotinylation nm. Bu nedenle, faiz bir protein için erimiş ve hücrelerde ifade zaman, kendi doğal ortamlarında proksimal proteinler etiketlerine göre sağlar. Birleştirilmiş protein kompleksleri arıtma üzerinde dayanır AP aksine, BioID olursa olsun izole olduklarında olup olmadığı hala faiz protein ile etkileşim vardır hücrelerin içindeki işaretlenmiş proteinler algılar. Çünkü biotinylates proksimal proteinler, bir Ayrıca yararlanmak için çok verimli bir şekilde onları ayırmak biotin streptavidin olağanüstü benzeşme hakkında. BioID AP daha iyi tanımlayıcı geçici veya zayıf etkileşimler için yapar iken, her iki AP ve BioID kütle spektrometresi yaklaşım tüm olası etkileşim belirli bir protein olabilir genel bir bakış sağlar. Ancak, onlar her tanımlanan PPI içeriğine bilgi vermeyin. Gerçekten de, çoğu proteinler genellikle birkaç kompleksleri, farklı olgunlaşma adımları veya farklı işlevsel birimler için karşılık gelen bir parçasıdır. Her iki yöntem de bu ortak sınırlama adrese, BirA * enzim üzerinde dayalı bir protein parçaları uluslara tahlil mühendislik. Bu tahlil, iki etkin olmayan parçaları BirA * yakın hangi onlar erimiş iki etkileşen proteinler tarafından getirdiğinde etkin bir enzim içine yeniden monte. Elde edilen Böl-BioID tahlil böylece etkileşen proteinler bir çift bir araya proteinler etiketlerine göre sağlar. Bu iki yalnızca belirli bir bağlamda etkileşim sağlanan bölme-BioID onların yerel hücresel ortamlarında belirli içerik bağımlı işlevsel birimler analiz sonra sağlar. Burada, test etmek ve split-BioID etkileşen proteinler çiftine uygulanan adım adım bir protokol sağlar.

Nasıl bu yöntem inşaat Ago2, proteinlerin açık okuma çerçevesi (ORFs) göstermek için TNRC6C ve Dicer (tüm yolu susturmak miRNA-aracılı gen içinde karıştırmak) Böl-BioID plazmid klonlanmış. Ago2 çeviri represses bir miRNA-induced silencing kompleksi içinde (miRISC) TNRC6C ile etkileşim ve hedef mRNA'ların14çürüme teşvik olduğu bilinmektedir. MiRISC, Ago2 birleştirmek için baş rahip Dicer, içinde miRNA15ile dolu bir kompleksi içinde olgun miRNAs üreten enzim ile etkileşim. Bu nedenle Böl-BioID Ago2/Dicer çifti veya Ago2/TNRC6C çift uygulandı. İçin her çifti test edilmiş proteinlerin Ago2 ya NBirA * veya CBirA * bizim split-BioID plazmid (Şekil 2) kullanarak için erimiş ve Dicer ve TNRC6C için karşılık gelen soydaş BirA * parçası oldu. Buna ek olarak, her protein CBirA * erimiş ve bir NBirA * ile eşleştirilmiş-GFP füzyon olarak bir negatif kontrol. Bu test protein (Tablo 1) birbirine çiftinin dört yinelemenin test sonuçlar.
Böl-BioID test edilmiş proteinlerin çifti etkileşim aktif olup olmadığını sınamak için şekil 1' de tasvir düzeni takip ettik. Plazmid geçici bir tet-sistem uyumlu HeLa hücre kültürünü transfected. Ifade füzyon proteinlerin Doksisiklin (dox) ile indüklenen ve biotinylation aşırı biotin büyüme ortamına ekleyerek teşvik. 20 h kuluçka ile bir süre dox ve biotin, hücreleri lysed ve biotinylated proteinler algılamaya konjuge streptavidin kullanarak Western Blot tarafından analiz edilebilir. Memeli hücrelerinde iki büyük grup genellikle konjuge streptavidin untransfected örnek (şekil 3, yıldız) tarafından algılanır ve endogenously biotinylated proteinler (en büyük olasılıkla mitokondrial karboksilaz) karşılık gelir. Bu iki grup tüm örneklerinde bulunması ve uygun iç yükleme denetimi olarak kullanılabilir, bu nedenle eşit protein miktarları yüklenmesini denetlemek için bir temizlik protein tespiti yersiz olur. Tipik bir BioID/Böl-BioID deney, gözlenen ek büyük gruplar kendi biotinylated var füzyon proteinlerdir. Diğer bir biotinylated protein görüldüğünde bile biotinylation füzyon proteinlerin zaten bu aşamada tespit iki test protein hücrelerde etkileşim gösterir. Şekil 3üzerinde tasvir deneyde, bu bir NBirA * olan belli ki-CBirA * TNRC6C veya Dicer füzyon ile eşleştirilmiş Ago2 füzyon proteinidir hangi CBirA ters kombinasyonları daha verimli-Ago2 diğer iki NBirA * füzyon için eşleştirilmiş proteinler (şekil 3, üst paneli, Kulvar 6-7 için 2-3 hatlarının yoğunluklarda karşılaştırın). Ayrıca, belgili tanımlık harekete geçirmek CBirA * füzyon hiçbiri NBirA * etkinleştirmek gibi belirli-GFP denetim füzyon protein kayda değer düzeyde (şekil 3, Karşılaştır şeritli 1, 4-5 untransfected hücrelere karşılık gelen lane 8). Bizim plazmid içinde NBirA * myc etiket ve CBirA * bir bayrak etiket (Şekil 2) vardır beri her füzyon protein ifade seviyede bu iki etiket (şekil 3, alt paneli) karşı antikor ile analiz edilebilir.
Etkileşim kaynaklı biotinylation gözlenen deney ölçeklendirilebilir ve biotinylated proteinler streptavidin birleştiğinde boncuk Protokolü (şekil 4) 4 paragrafta belirtildiği şekilde izole. Yalıtım ilk kez gerçekleştirilirken, tüm belgili tanımlık merdiven arıtma Western Blot (şekil 5tarafından) analiz. Genellikle, boncuk bağlama-meli var olmak neredeyse nicel ve hemen hemen hiçbir sızıntı yoluyla yıkar dikkat edilmelidir. Önce işleme örnekleri için kütle spektrometresi, indüklenen biotinylation beklendiği gibi çalıştı ve füzyon protein ifade edildi emin olmak için bir Western blot çalışan öneririz. Ya zavallı transfection verimlilik veya hatalı dox indüksiyon nedeniyle ifade füzyon proteinlerin eksikliğidir. Füzyon protein ifade edildi ancak hiçbir biotinylation gözlenen, aşırı biotin (50 mikron) aslında Orta olarak eklendi ve hisse senedi biotin hala etkin olduğunu denetleyin. Eluted malzeme üzerinde bir protein Coomassie lekeli jel (şekil 6), tipik olarak analiz edilir zaman, uyması gereken en güçlü grup yaklaşık 17 kDa çalışır ve monomeric streptavidin karşılık gelir. Endojen biotinylated proteinler ve füzyon protein karşılık gelen bantları da gözlenen. Biz genellikle streptavidin grup yükleme iyi (şekil 6) kadar yukarıda örnek lane alan tüketim. Eksize grubun bir 1,5 mL tüp içinde saklanır ve bir kütle spektrometresi tesisine gönderilir. Alternatif olarak, ilişkili proteinler de streptavidin birleştiğinde boncuk tripsin sindirmek olabilir ve eluted sindirilmiş peptidler sütun oluşturur. Biz düzenli olarak kullanın (çoğunlukla varsayılan parametrelerini kullanarak başvuru 9 tipik MS sonuçları ve daha fazla bilgi için bkz: lizin biotinylation mümkün translasyonel modifikasyon ekleme,) MaxQuant yazılım ve16 MS ham veri analiz etmek ve Perseus suite17 sonraki istatistiksel analiz için her ikisi de özgür yazılım olan. Örnekler genellikle üç biyolojik çoğaltır çalıştırılır. Etiket içermeyen miktar kullanarak, özel olarak zenginleştirilmiş proteinler denetim koşulları üzerinde tespit edilebilir. Endogenously biotinylated proteinleri ve özellikle sigara BirA * enzim tarafından etiketlenir proteinler için filtre uygulamak için yalnızca önemli ölçüde üzerinde sayısı altı ilgisiz proteinler ile oluşturulan altı veri kümesinden gelen zenginleştirilmiş proteinler düşünün. Buna ek olarak, biz sadece üzerinde bir split-BioID veri kümesi içinde NBirA * füzyon protein yerini almış NBirA * tarafından zenginleştirilmiş sayısı düşünün-GFP. Diğer veri analizi stratejileri özellikle hücre kültürü (SILAC) kantitatif proteomik18amino asitleri ile kararlı izotop etiketleme kullanarak önerilmiştir. Ayrıca, çeşitli stratejileri biotinylated peptidler organik çözücüler19 veya biotin özgü kullanarak özel elüsyon koşullar biotin18, zayıflamış benzeşimli bir streptavidin değişken kullanarak doğrudan yalıtımı için tarif var antikorlar20,21. Mutlaka daha fazla protein keşfi için önde gelen, biotinylation siteleri tanımlaması Ekle sayısı belirgin olarak daha fazla güven ve yararlı ne zaman bir etkileşim topolojisinin ele alıyor.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57479/57479fig1.jpg"> Şekil 1: split-BioID yordam bakış. Protein 1 protein 2 karmaşık bir parçası olarak ya da protein 3 karmaşık B. parçası olarak etkileşim kurar Özellikle karmaşık a kompozisyon soruşturma için protein 1 ve 2 Böl-BioID uygulanabilir. Kütle Spektrometre fotoğrafı bir Creative Commons Attribution-Share Alike 3,0 dağıtıma açıktır lisansı altında ve https://commons.wikimedia.org ThermoScientificOrbitrapElite.JPG dosya adı ile indirilen. <a href="/files/ftp_upload/57479/57479fig1large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57479/57479fig2.jpg"> Şekil 2: split-BioID plazmid ifade kasetleri. Biz NBirA * ve CBirA * füzyon protein tüm kombinasyonları test izin vermek için dört plazmid sağlar. Plazmid ve tam haritalar addgene.org belirtilen numaraları altında bulabilirsiniz. Plazmid tet-yanıt veren öğe (7 x tetO) ve tet ifade sistemi ile uyumlu bir hücre satır kullanılmak üzere gerekir. Ayrıca tüm plazmid FRB ve FKBP ORFs NBirA * erimiş ve parçaları CBirA * sırasıyla dikkat edin. Sadece rapamycin varlığında bu iki protein etkileşim ve bu nedenle plazmid sistemi bu kimyasal9içinde hızlı bir şekilde test için kullanılabilir. Belirtilen kısıtlama benzersiz sitelerdir. <a href="/files/ftp_upload/57479/57479fig2large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57479/57479fig3.jpg"> Resim 3: bir split-BioID deneme için tipik Western blot. Üst paneli: biotinylated proteinler fluorescently etiketli streptavidin ile tespiti. Alt paneli: Anti-Myc ve anti-bayrak antikorları ile füzyon proteinlerin algılama. İki çift proteinlerin test edildi: Ago2/TNRC6C ve Ago2/Dicer. Yolları 2 & 3, Ago2 CBirA * parçası için eklenen. Yolları 6 & 7, Ago2 NBirA * parçası için eklenen. Önemli sinyal yok ne zaman herhangi üç proteinlerin NBirA * ile kombine edilmiştir gözlendi-GFP (şerit 1, 4-5). Yıldızlar endogenously iç yükleme denetimi olarak hizmet verebilir biotinylated proteinler karşılık gelen grupları gösterir. Bu rakam Schopp vd. şekil 5B adapte 9 bir Creative Commons Attribution 4.0 uluslararası lisansı altında. <a href="/files/ftp_upload/57479/57479fig3large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57479/57479fig4.jpg"> Şekil 4: streptavidin açılan yordama genel bakış. Kütle spektrometresi analiz için biotinylated proteinlerin yalıtım için önemli adımlar tasvir edilmektedir. <a href="/files/ftp_upload/57479/57479fig4large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57479/57479fig5.jpg"> Şekil 5: tipik Western blot streptavidin açılan deneme için. Eşit hacimli belirtilen her örnek üzerinde bir SDS-polyacrylamide jel dolu. Western Blot takiben biotinylated proteinler HRP birleştiğinde streptavidin ile tespit edildi. NBirA * karşılık gelen bantları-TNRC6C ve CBirA *-Ago2 belirtilir. <a href="/files/ftp_upload/57479/57479fig5large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/57479/57479fig6.jpg"> Şekil 6: kütle spektrometresi analiz için tipik Coomassie lekeli protein jel. Streptavidin birleştiğinde boncuk eluted örnekten prekast protein jel üzerinde yüklü ve örnek göç kadar 2-3 cm çalıştırın. 17 kDa görülen büyük grubudur streptavidin. Hemen üstüne o grup alanı eksize ve kütle spektrometresi tesisine gönderdi. NBirA * karşılık gelen bantları-TNRC6C ve CBirA *-Ago2 belirtilir. <a href="/files/ftp_upload/57479/57479fig6large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Transfection örnek</td>
			<td colspan="3">Test durumu</td>
		</tr>
<tr>
<td>1</td>
			<td colspan="3">NBirA *-protein1 / CBirA *-protein2</td>
		</tr>
<tr>
<td>2</td>
			<td colspan="3">CBirA *-protein1 / NBirA *-protein2</td>
		</tr>
<tr>
<td>3</td>
			<td colspan="3">NBirA *-GFP / CBirA *-protein1</td>
		</tr>
<tr>
<td>4</td>
			<td colspan="3">NBirA *-GFP / CBirA *-protein2</td>
		</tr>
<tr>
<td>5</td>
			<td colspan="3">yok transfection</td>
		</tr>
</tbody></table>Tablo 1: Split-BioID için iki protein uygularken koşullar genellikle test edilmiştir.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Sıralama astar</td>
			<td>sıra</td>
		</tr>
<tr>
<td>Kaset 1 ters astar (CBirA füzyon)</td>
			<td>TATACTTTCTAGAGAATAGGAAC</td>
		</tr>
<tr>
<td>Kaset 2 ters astar (NBirA füzyon)</td>
			<td>GTGGTTTGTCCAAACTCATC</td>
		</tr>
</tbody></table>Tablo 2: astar için split-BioID plazmid sıralanıyor.

Watch this Scientific Journal Video about Split-BioID Ã¢â‚¬â€ Proteomic Analysis of Context-specific Protein Complexes in Their Native Cellular Environment at JoVE.com

Split-BioID &#8212; Proteomic Analysis of Context-specific Protein Complexes in Their Native Cellular Environment

Böl-BioID, BioID yakınlık etiketleme tekniğine dayalı bir protein parçaları-uluslara tahlil için adım adım bir protokol sağlar. İki verilen protein etkileşimi harekete geçirmek, o kendi yerel hücresel ortamlarında içerik bağımlı protein kompleksleri proteomik analiz sağlar. Yöntemi basit, uygun maliyetli ve yalnızca standart Laboratuar donanımları gerektirir.

Split-BioID — Proteomik analiz onların yerel hücresel ortamında içeriğe özel Protein kompleksleri

To complement existing affinity purification (AP) approaches for the identification of protein-protein interactions (PPI), enzymes have been introduced ...

split-bioid-proteomic-analysis-context-specific-protein-complexes

Nanyang Technological University

Research

JoVE Journal

Biochemistry

19.6K Görüntüleme.  Heidelberg University. Böl-BioID, BioID yakınlık etiketleme tekniğine dayalı bir protein parçaları-uluslara tahlil için adım adım bir protokol sağlar. İki verilen protein etkileşimi harekete geçirmek, o kendi yerel hücresel ortamlarında içerik bağımlı protein kompleksleri proteomik analiz sağlar. Yöntemi basit, uygun maliyetli ve yalnızca standart Laboratuar donanımları gerektirir.

Video: Split-BioID — Proteomic Analysis of Context-specific Protein Complexes in Their Native Cellular Environment

Identification of Small Molecule-binding Proteins in a Native Cellular Environment by Live-cell Photoaffinity Labeling

Identifying the molecular target(s) of small molecules is a challenging but necessary step towards understanding their mechanism of action. While several target identification methods have been developed and used to successfully elucidate the binding proteins of a variety of small molecules, these techniques have drawbacks that make them unsuitable for detecting certain types of small molecule-target interactions. In particular, non-covalent interactions that depend on native cellular conditions, such as those of membrane proteins whose structures may be perturbed upon cell lysis, are often not amenable to affinity-based target identification methods. Here, we demonstrate a method wherein a probe containing a photolabile group is used to covalently crosslink to the small molecule binding protein within the environment of the live cell, allowing the detection and isolation of the target protein without the need for maintenance of the interaction after cell lysis. This technique is a valuable tool for studying biologically interesting small molecules with unknown mechanisms, both in the context of basic biology as well as drug discovery.

We describe here a method for identification of small molecule-binding proteins using photoaffinity labeling. The advantage of this technique is that binding and covalent labeling of the target proteins occurs within the live cellular environment, removing the risk of disrupting native protein structure and binding conditions upon cell lysis.

Canlı hücre fotoafinite Etiketleme tarafından Yerli Hücresel Ortamında Küçük Molekül bağlayıcı proteinlerin belirlenmesi

Identifying the molecular target(s) of small molecules is a challenging but necessary step towards understanding their mechanism of action. While several ...

Biyokimya

Synthesis of 1,2-Azaborines and the Preparation of Their Protein Complexes with T4 Lysozyme Mutants

We describe a general synthesis of 1,2-azaborines using standard air-free techniques and protein complex preparation with T4 lysozyme mutants by vapor diffusion. Oxygen- and moisture-sensitive compounds are prepared and isolated under an inert atmosphere (N2) using either a vacuum gas manifold or a glove box. As an example of azaborine synthesis, we demonstrate the synthesis and purification of the volatile N-H-B-ethyl-1,2-azaborine by a five-step sequence involving distillation and column chromatography for the isolation of products. T4 lysozyme mutants L99A and L99A/M102Q are expressed with Escherichia coli RR1 strain. Standard protocols for chemical cell lysis followed by purification using carboxymethyl ion exchange column affords protein of sufficiently high purity for crystallization. Protein crystallization is performed in various concentrations of precipitant at different pH ranges using the hanging drop vapor diffusion method. Complex preparation with the small molecules is carried out by vapor diffusion method under an inert atmosphere. X-ray diffraction analysis of the crystal complex provides unambiguous structural evidence of binding interactions between the protein binding site and 1,2-azaborines.

A protocol for the synthesis of 1,2-azaborines and the preparation of their protein complexes with T4 lysozyme mutants is presented.

1,2-Azaborines Sentezi ve T4 Lizozim Mutants ile Bunların Protein Kompleksleri hazırlanması

We describe a general synthesis of 1,2-azaborines using standard air-free techniques and protein complex preparation with T4 lysozyme mutants by vapor ...

Tandem Affinity Purification of Protein Complexes from Eukaryotic Cells

The purification of active protein-protein and protein-nucleic acid complexes is crucial for the characterization of enzymatic activities and de novo identification of novel subunits and post-translational modifications. Bacterial systems allow for the expression and purification of a wide variety of single polypeptides and protein complexes. However, this system does not enable the purification of protein subunits that contain post-translational modifications (e.g., phosphorylation and acetylation), and the identification of novel regulatory subunits that are only present/expressed in the eukaryotic system. Here, we provide a detailed description of a novel, robust, and efficient tandem affinity purification (TAP) method using STREP- and FLAG-tagged proteins that facilitates the purification of protein complexes with transiently or stably expressed epitope-tagged proteins from eukaryotic cells. This protocol can be applied to characterize protein complex functionality, to discover post-translational modifications on complex subunits, and to identify novel regulatory complex components by mass spectrometry. Notably, this TAP method can be applied to study protein complexes formed by eukaryotic or pathogenic (viral and bacterial) components, thus yielding a wide array of downstream experimental opportunities. We propose that researchers working with protein complexes could utilize this approach in many different ways.

We describe here a novel, robust, and efficient tandem affinity purification (TAP) method for the expression, isolation, and characterization of protein complexes from eukaryotic cells. This protocol could be utilized for the biochemical characterization of discrete complexes as well as the identification of novel interactors and post-translational modifications that regulate their function.

Ökaryotik Hücrelerde Protein Kompleksleri Tandem Affinity Arıtma

The purification of active protein-protein and protein-nucleic acid complexes is crucial for the characterization of enzymatic activities and de novo ...

Resolving Affinity Purified Protein Complexes by Blue Native PAGE and Protein Correlation Profiling

Most proteins act in association with others; hence, it is crucial to characterize these functional units in order to fully understand biological processes. Affinity purification coupled to mass spectrometry (AP-MS) has become the method of choice for identifying protein-protein interactions. However, conventional AP-MS studies provide information on protein interactions, but the organizational information is lost. To address this issue, we developed a strategy to unravel the distinct functional assemblies a protein might be involved in, by resolving affinity-purified protein complexes prior to their characterization by mass spectrometry. Protein complexes isolated through affinity purification of a bait protein using an epitope tag and competitive elution are separated through blue native electrophoresis. Comparison of protein migration profiles through correlation profiling using quantitative mass spectrometry allows assignment of interacting proteins to distinct molecular entities. This method is able to resolve protein complexes of close molecular weights that might not be resolved by traditional chromatographic techniques such as gel filtration. With little more work than conventional AP-geLC-MS/MS, we demonstrate this strategy may in many cases be adequate for obtaining protein complex topological information concomitantly to identifying protein interactions.

Here we present protocols for affinity purification of protein complexes and their separation by blue native PAGE, followed by protein correlation profiling using label free quantitative mass spectrometry. This method is useful to resolve interactomes into distinct protein complexes.

Mavi Yerli PAGE ve Protein İlişkisi Profil Yöntemi ile Affinity Saf protein Kompleksler çözümleniyor

Most proteins act in association with others; hence, it is crucial to characterize these functional units in order to fully understand biological ...

Horizontal Gel Electrophoresis for Enhanced Detection of Protein-RNA Complexes

Native polyacrylamide gel electrophoresis is a fundamental tool of molecular biology that has been used extensively for the biochemical analysis of RNA-protein interactions. These interactions have been traditionally analyzed with polyacrylamide gels generated between two glass plates and samples electrophoresed vertically. However, polyacrylamide gels cast in trays and electrophoresed horizontally offers several advantages. For example, horizontal gels used to analyze complexes between fluorescent RNA substrates and specific proteins can be imaged multiple times as electrophoresis progresses. This provides the unique opportunity to monitor RNA-protein complexes at several points during the experiment. In addition, horizontal gel electrophoresis makes it possible to analyze many samples in parallel. This can greatly facilitate time course experiments as well as analyzing multiple reactions simultaneously to compare different components and conditions. Here we provide a detailed protocol for generating and using horizontal native gel electrophoresis for analyzing RNA-Protein interactions.

Native polyacrylamide gel electrophoresis is a fundamental tool for analyzing RNA-protein interactions. Traditionally most experiments have used vertical gels. However, horizontal gels provide several advantages, such as the opportunity to monitor complexes during electrophoresis. We provide a detailed protocol for generating and using horizontal native gel electrophoresis.

Protein-RNA Komplekslerinin Geliştirilmiş Algılaması için Yatay Jel Elektroforezi

Native polyacrylamide gel electrophoresis is a fundamental tool of molecular biology that has been used extensively for the biochemical analysis of ...

Dissection of Human Retina and RPE-Choroid for Proteomic Analysis

The human retina is composed of the sensory neuroretina and the underlying retinal pigmented epithelium (RPE), which is firmly complexed to the vascular choroid layer. Different regions of the retina are anatomically and molecularly distinct, facilitating unique functions and demonstrating differential susceptibility to disease. Proteomic analysis of each of these regions and layers can provide vital insights into the molecular process of many diseases, including Age-Related Macular Degeneration (AMD), diabetes mellitus, and glaucoma. However, separation of retinal regions and layers is essential before quantitative proteomic analysis can be accomplished. Here, we describe a method for dissection and collection of the foveal, macular, and peripheral retinal regions and underlying RPE-choroid complex, involving regional punch biopsies and manual removal of tissue layers from a human eye.One-dimensional SDS-PAGE as well as downstream proteomic analysis, such as liquid chromatography-tandem mass spectrometry (LC-MS/MS), can be used to identify proteins in each dissected retinal layer, revealing molecular biomarkers for retinal disease.

The human retina is composed of functionally and molecularly distinct regions, including the fovea, macula, and peripheral retina. Here, we describe a method using punch biopsies and manual removal of tissue layers from a human eye to dissect and collect these distinct retinal regions for downstream proteomic analysis.

İnsan Retina ve RPE koroid diseksiyon proteomik analizi için

The human retina is composed of the sensory neuroretina and the underlying retinal pigmented epithelium (RPE), which is firmly complexed to the vascular ...

2 in 1: One-step Affinity Purification for the Parallel Analysis of Protein-Protein and Protein-Metabolite Complexes

Cellular processes are regulated by interactions between biological molecules such as proteins, metabolites, and nucleic acids. While the investigation of protein-protein interactions (PPI) is no novelty, experimental approaches aiming to characterize endogenous protein-metabolite interactions (PMI) constitute a rather recent development. Herein, we present a protocol that allows simultaneous characterization of the PPI and PMI of a protein of choice, referred to as bait. Our protocol was optimized for Arabidopsis cell cultures and combines affinity purification (AP) with mass spectrometry (MS)-based protein and metabolite detection. In short, transgenic Arabidopsis lines, expressing bait protein fused to an affinity tag, are first lysed to obtain a native cellular extract. Anti-tag antibodies are used to pull down protein and metabolite partners of the bait protein. The affinity-purified complexes are extracted using a one-step methyl tert-butyl ether (MTBE)/methanol/water method. Whilst metabolites separate into either the polar or the hydrophobic phase, proteins can be found in the pellet. Both metabolites and proteins are then analyzed by ultra-performance liquid chromatography-mass spectrometry (UPLC-MS or UPLC-MS/MS). Empty-vector (EV) control lines are used to exclude false positives. The major advantage of our protocol is that it enables identification of protein and metabolite partners of a target protein in parallel in near-physiological conditions (cellular lysate). The presented method is straightforward, fast, and can be easily adapted to biological systems other than plant cell cultures.

Protein-protein and protein-metabolite interactions are crucial for all cellular functions. Herein, we describe a protocol that allows parallel analysis of these interactions with a protein of choice. Our protocol was optimized for plant cell cultures and combines affinity purification with mass spectrometry-based protein and metabolite detection.

2 in 1: tek adımlı benzeşme arıtma paralel analizi için Protein-Protein ve Protein-metaboliti kompleksleri

Cellular processes are regulated by interactions between biological molecules such as proteins, metabolites, and nucleic acids. While the investigation of ...

Analysis of Thylakoid Membrane Protein Complexes by Blue Native Gel Electrophoresis

Photosynthetic electron transfer chain (ETC) converts solar energy to chemical energy in the form of NADPH and ATP. Four large protein complexes embedded in the thylakoid membrane harvest solar energy to drive electrons from water to NADP+ via two photosystems, and use the created proton gradient for production of ATP. Photosystem PSII, PSI, cytochrome b6f (Cyt b6f) and ATPase are all multiprotein complexes with distinct orientation and dynamics in the thylakoid membrane. Valuable information about the composition and interactions of the protein complexes in the thylakoid membrane can be obtained by solubilizing the complexes from the membrane integrity by mild detergents followed by native gel electrophoretic separation of the complexes. Blue native polyacrylamide gel electrophoresis (BN-PAGE) is an analytical method used for the separation of protein complexes in their native and functional form. The method can be used for protein complex purification for more detailed structural analysis, but it also provides a tool to dissect the dynamic interactions between the protein complexes. The method was developed for the analysis of mitochondrial respiratory protein complexes, but has since been optimized and improved for the dissection of the thylakoid protein complexes. Here, we provide a detailed up-to-date protocol for analysis of labile photosynthetic protein complexes and their interactions in Arabidopsis thaliana.

A protocol for the elucidation of plant thylakoid protein complex organization and composition with blue native polyacrylamide gel electrophoresis (BN-PAGE) and 2D-SDS-PAGE is described. The protocol is optimized for Arabidopsis thaliana, but can be used for other plant species with minor modifications.

Thylakoid membran Protein kompleksleri tarafından mavi yerli jel elektroforez Analizi

Photosynthetic electron transfer chain (ETC) converts solar energy to chemical energy in the form of NADPH and ATP. Four large protein complexes embedded ...

Proteomic Analysis of Human Macrophage Polarization Under a Low Oxygen Environment

Macrophages are innate immune cells involved in a number of physiological functions ranging from responses to infectious pathogens to tissue homeostasis. The various functions of these cells are related to their activation states, which is also called polarization. The precise molecular description of these various polarizations is a priority in the field of macrophage biology. It is currently acknowledged that a multidimensional approach is necessary to describe how polarization is controlled by environmental signals. In this report, we describe a protocol designed to obtain the proteomic signature of various polarizations in human macrophages. This protocol is based on a label-free quantification of macrophage protein expression obtained from in-gel fractionated and Lys C/trypsin-digested cellular lysis content. We also provide a protocol based on in-solution digestion and isoelectric focusing fractionation to use as an alternative. Because oxygen concentration is a relevant environmental parameter in tissues, we use this protocol to explore how atmospheric composition or a low oxygen environment affects the classification of macrophage polarization.

We present a protocol to obtain proteomic signatures of human macrophages and apply this to determination of the impact of a low oxygen environment on macrophage polarization.

Düşük oksijen ortamı altında insan makrofaj polarizasyon proteomik analizi

Macrophages are innate immune cells involved in a number of physiological functions ranging from responses to infectious pathogens to tissue homeostasis. ...

Analysis of Protein Folding, Transport, and Degradation in Living Cells by Radioactive Pulse Chase

Radioactive pulse-chase labeling is a powerful tool for studying the conformational maturation, the transport to their functional cellular location, and the degradation of target proteins in live cells. By using short (pulse) radiolabeling times (&lt;30 min) and tightly controlled chase times, it is possible to label only a small fraction of the total protein pool and follow its folding. When combined with nonreducing/reducing SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoprecipitation with (conformation-specific) antibodies, folding processes can be examined in great detail. This system has been used to analyze the folding of proteins with a huge variation in properties such as soluble proteins, single and multi-pass transmembrane proteins, heavily N- and O-glycosylated proteins, and proteins with and without extensive disulfide bonding. Pulse-chase methods are the basis of kinetic studies into a range of additional features, including co- and posttranslational modifications, oligomerization, and polymerization, essentially allowing the analysis of a protein from birth to death. Pulse-chase studies on protein folding are complementary with other biochemical and biophysical methods for studying proteins in vitro by providing increased temporal resolution and physiological information. The methods as described within this paper are adapted easily to study the folding of almost any protein that can be expressed in mammalian or insect-cell systems.

Here we describe a protocol for a general pulse-chase method that allows the kinetic analysis of folding, transport, and degradation of proteins to be followed in live cells.

Protein katlanması, taşıma ve canlı hücreler radyoaktif darbe Chase tarafından bozulması Analizi

Radioactive pulse-chase labeling is a powerful tool for studying the conformational maturation, the transport to their functional cellular location, and ...