The authors would like to thank Prof. Sze-Bi Hsu and Ms. Zhenzhen for useful discussions and help in the theoretical analysis and numerical simulation. Y. T. Y. would like to acknowledge funding support from the Ministry of Science and Technology under grant numbers MOST 103-2220-E-007-026 and MOST 104-2220-E-007-011, and from the National Tsing Hua University under grant numbers 103N2042E1, 104N2042E1, and 105N518CE1.

Morbidostat 장치의 1 조립 및 사전 테스트 <ol><li> Morbidostat 조립 <ol><li> 18 G 주사기 바늘 문화 유리 병의 뚜껑에 3 홀 펀치. ~ 길이 7cm를 폴리에틸렌 튜브의 세 가지를 잘라. 캡에 폴리에틸렌 튜브의이 세 가지를 삽입합니다. </li><li> 폴리 디메틸 실록산 (PDMS) 혼합물의 주조로 사용하기 위해 캡의 가장자리를 감싸 테이프를 사용합니다. 이쑤시개 수동으로 교반하여 성분 5 g 및 150 ml의 플라스틱 컨테이너에 PDMS의 B 성분의 0.5 g을 혼합한다. 10 ML의 주사기에 혼합로드합니다. <ol><li> 주사기와 캡의 PDMS 혼합물을 붓고. 70 ° C의 오븐에서 8 시간에 대한 PDMS를 경화 전체 캡을 굽는다. </li></ol></li><li> 납땜 인두와 탄소 저항과 24 게이지 와이어 및 LED 음극과 양극 LED를 납땜. 24 G 와이어와 680 Ω 탄소 저항을 납땜. 전기 테이프를 사용하여 와이어 연결을 절연. </li><li> 그래서24 G 선 및 100 kΩ의 탄소 저항기 검출기의 이미 터와 광 검출기의 콜렉터 lder. 전기 테이프를 사용하여 와이어 연결을 절연. </li><li> 문화 유리 병 홀더에 발광 다이오드를 배치합니다. 부가도 2의 회로도를 수행함으로써, LED는 IR (예를 들어, 이동 전화 카메라)를 검출 할 수있는 디지털 카메라를 사용하여 작동하도록 5 V.의 전원 공급 다이오드와 전원을 발광 연결한다. </li><li> 문화 유리 병 홀더 광 검출기를 배치합니다. 부가도 2의 회로도에 따라, 전자 제어 보드를 가로 지르는 전압을 측정하는 검출기 저항의 양측에 와이어를 연결 5 V.의 전원과 광 검출기 및 전원에 연결. </li><li> 교반기 수단 인 냉각 팬의 축에 자석을 붙인다. alignm합니다배양 병에 팬 및 배양 바이알과 자석 사이의 간격의 축부의 엔트 자기 교반 장치의 적절한 기능에 매우 중요하다. </li><li> 마이크로 펌프, 중간 병, 폐기물 병 실리콘 튜브의 대응 조각으로 배양 병의 폴리에틸렌 튜브의 각 부분을 연결합니다. 1 시간 동안 펌프를 켜고 전체 볼륨이 펌프 속도를 결정하기 위해 문화 유리 병에 매체 병에서 펌핑되는 측정한다. 일반적인 펌핑 속도가 희석 비율 D = 0.33 시간 -1 문화 유리 병의 볼륨을 작동하는 12 ml의 용에 해당 ~ 4 ㎖ / 시간이어야합니다. </li><li> 중간 크기 (34cm X 34cm X 43.5 cm) 진탕 배양기에 전체 어셈블리를 놓습니다. </li></ol></li><li> Morbidostat을 사전 테스트 <ol><li> 5 V로 냉각 팬의 집합 전원 전압은 자기 교반 막대를 테스트하기 위해 그 모터를 시작한다. 교반 작용 육안 검사 할 수 있습니다. 구동 전압냉각 팬 모터는 정확히 펄스 폭 변조 (PWM)에 의해 제어된다 s는. </li><li> 야생형 E. 일련의 준비 600에서 광학 밀도를 갖는 대장균 시료는 일반적으로 0.07에서 교정 0.3 nm의 범위. 테스트 E. 배치 배양 병에 대장균 샘플과 검출기 전압을 기록한다. <ol><li> 장소 ~ 100 플레이트 판독기에서 동일한 샘플 ㎕의 광학 밀도를 기록한다. 검량선을 플롯 광학 밀도 데이터 대 전압 검출기를 사용한다. 일반적으로, 광학 밀도의 1 단위 변화가 여기에 사용되는 바이어스 방식과 광 검출기에서 ~ 7.6 V 변화에 대응합니다. </li></ol></li></ol></li></ol> 2. Morbidostat 실행 <ol><li> 데일리 실험을 시작하기 전에 준비 <ol><li> 입구 부에서와 같이 장치를 형성하기 위해 내경이 1/32 인치 외부 직경 3/32 인치 세 울트라 화학성 타이곤 호스와 배양 병을 준비1.1 및 보충 그림 1인치 </li><li> M9 최소 배지 (0.2 % 포도당) 및 트리 메소 프림 (TMP) 약물 함유 배지를 준비합니다. 121 ℃에서 오토 클레이브 배지, 배지 병, 약물 매체 병, 폐기물 용기 및 배양 병을 소독. 주 : TMP 나중에 표 1의 농도 및 배지를 함유하는 약물 TMP가 멸균되지을 달성하기 위해 사용되는 원액이다. </li></ol></li><li> Morbidostat 실행 <ol><li> 실험 첫날, 냉동 야생형 1 ml의 E. 해동 실온 전송 함유 배양 병에 120 μL 세포에서 5 분간 콜라이 MG1655 ~ M9 세포 성장 배지 12 mL로. 1 일 이후에, 냉동 E. 1 ㎖를 해동 대장균 5 분 및 전송이 포함 된 새로운 문화 유리 병에 세포 120 μL의 전날 셀 ~ M9 성장 배지 12 ml를. </li><li> 진탕 배양기를 켜고 템피을 설정<html> 전혀 흔들림 30 ° C에 rature. </li><li> 마이크로 펌프, 자기 교반 장치 및 광학 밀도 측정 켜서 morbidostat 동작을 시작한다. 주 : 동작 동안, 임계 값 피드백 알고리즘은 약물 주입을 제어하기 위해 사용된다. 측정 된 광학 밀도가 미리 설정된 임계 값을 초과 할 경우, 약물 주입 펌프를 턴온 될 것이고, 매체 펌프가 턴 오프된다. 그렇지 않으면, 약물 주입 펌프는 꺼진 상태로 유지하고, 매체 펌프가 켜져 있습니다. </li><li> 미생물 성장이 있는지 확인하기 위해 수시로 전압을 모니터한다. 참고 : 때문에 동결 및 해동주기, E.의 대장균 세포는 매일의 성장시 ~ 4 시간의 지연을 나타낸다. </li><li> ~ 23 시간 후, 그것의 공급 전압을 해제하여 마이크로 펌프를 중지하고 문화 유리 병을 꺼내. 문화 유리 병에 15 % 글리세롤을 추가하고 저장을 위해 -80 ° C에서 샘플을 동결. </li><li> 반복 2.2.5에 2.2.1 단계를 반복합니다. </li></ol></li></ol>제작 &quot;&gt; 3. 항생제 감수성 측정 96 음 형식으로 주 : 항생제 내성 수준을 결정하기 위해 96 웰 포맷 플레이트 리더에서 성장 속도 측정을 수행한다. <ol><li> 실온에서 5 분 동안 매일 샘플을 냉동 및 해동 ~ 15ml의 M9 배지를 함유하는 바이알에 배양 세포의 15 μl를 옮긴다. 그들을 ~ 0.1에 도달 내지 600 nm에서의 광학 밀도까지 성장 할 수 있습니다. 1 ㎖의 병에 15 mL로 분할하고, 표 1에 나타낸 바와 같이 원하는 약물 농도를 얻기 위해,이 단계에서 TMP 약물을 추가한다. </li><li> 플레이트 리더에서 잘 각으로 단계 3.1과 장소에서 샘플 200 μl를 가지고 그들을 12 시간 5 성장할 수 있습니다. 파장 600 nm에서의 광학 밀도를 측정하는 동안 자동으로 기록된다. 주 : 각 데이터 포인트에 대해, 삼중 측정 기록 된 데이터의 일관성을 보장하기 위해 평균화된다. 시간에 대한 광학 밀도의 데이터는 수 bE는 성장 속도를 얻기 위해 사용된다. </li><li> IC (50)를 획득하기 위해 상기 약물 농도 대 성장 속도 데이터를 플롯. IC (50) 성장 속도가 최대 성장 속도 (5)의 50 %가되는 약물 농도로서 정의된다합니다. </li></ol> 미세 유체 장치 4. 단일 세포 형태와 항생제 감수성 측정 <ol><li> 다른 곳에서 15 설명한 바와 같이 PDMS에서 다층 소프트 리소그래피를 통해 미세 유체 장치의 제조를 수행합니다. <ol><li> 제어 및 흐름 층의 포토 레지스트 몰드를 만들기 위해 포토 리소그래피를 사용합니다. 제어 층에 베어 실리콘 웨이퍼 상에 몰드를 생산하는 네가티브 포토 레지스트 (~ 15㎛의 높이) 및 포지티브 레지스트 (~ 8 ㎛의 높이)를 사용할 수 있습니다. </li><li> 각각의 제어 층과 유동 층, 1 : 1 내지 20 : 5의 비율 가교와 PDMS 혼합물을 준비한다. 모든 거품을 제거하기 위해 진공하에 데시 케이 터에 혼합물을 넣어1 시간 동안. </li><li> (TMCS) 증기 트리메틸 위해 실리콘 웨이퍼 상에 포토 레지스트 층 제어 금형 노출. PDMS의 혼합물을 캐스팅하여 ~ 6mm 두께의 제어 층을 (가교 비율 5 : 1) 제어 층의 포토 리지 스트 몰드에 실리콘 웨이퍼. 오븐에서 1 시간 동안 80 ° C에서 40 분 동안 제어 층을 굽는다. </li><li> (1, 회전 속도가 60 초 동안 3,000 RPM 가교 율 20)와 유동 층 포토 리지 스트 몰드에 PDMS 혼합물을 스핀 코팅에 의해 유동 층을 만든다. 오븐에서 1 시간 동안 80 ° C에서 30 분 동안 유동 층을 굽는다. </li><li> 원하는 칩 사이즈로 제어 층 (통상 3cm X 2cm)을 절단 수동 제어 층을 박리 면도날을 사용한다. 유동 층의 상부에 상기 제어 층을 올려 놓고 입체 현미경을 정렬. 오븐 하룻밤에 80 ° C에서 정렬 된 어셈블리를 치료. 그 후, 잔류 TMCS을 용해하는 5 시간 동안 플라스틱 용기에 탈 이온수 250 ㎖에 조립체를 침지. </li><li> 이어서, 20 G 바늘 유입 구멍을 펀치 (PDMS 간 비율이 5 링크 : 회전 속도 2000 rpm으로 30 초를 들면, 1) 빈 PDMS 층으로 코팅 된 유리 슬라이드를 엘라스토머 전체 접합 40 초에서 공기 플라즈마 처리하여 1.2 토르 공기압. </li><li> PDMS의 세포 독성 효과를 감소시키기 위해 80 ℃에서 36 시간 동안 광범위한 베이킹을 수행. 이러한 베이킹 단계는 상기 세균 세포에 독성을 최소화하는 것이 중요합니다. </li></ol></li><li> 칩 성장 실험에 <ol><li> 미세 유체 장치에 넣기 전에 1 시간 동안 1 시간과 M9 매체에 대한 탈 이온수로 세척합니다. </li><li> 실온에서 5 분 동안 매일 샘플을 동결 해동 신선한 M9 배지로 새로운 시험관에 접종. 하룻밤 37 ℃에서 진탕 배양기에서 샘플을 놓습니다. </li><li> M9 매체와 미생물 샘플 10 배 희석하고 5 psi에서 미생물 시료 용기를 압박하여 미세 유체 장치에로드합니다. 그런 다음 TMP 약물을로드5 psi에서 약물 매체 컨테이너를 압박하여 칩에 매체. 15 분 동안 마이크로 유체 칩에 두 개의 챔버 사이에 마이크로 기계식 밸브를 작동하여 미생물 및 약물의 혼합을 실행합니다. </li><li> 거꾸로 현미경에 장착 된 현미경 인큐베이터에있는 마이크로 유체 칩을 놓습니다. CCD 카메라와 8 시간마다 시간이 도립 현미경에 장착 된 성장 챔버 내의 셀 화상을 취득. </li><li> 셀의 영상 데이터 (18)상의 임계 알고리즘을 통하여 세포 수를 계산하기 위해 사용자 정의 프로그램 스크립트를 사용한다. 셀 번호 데이터는 일반적으로 위에 세 미세 유체 챔버 평균을합니다. </li></ol></li></ol>

<ol>
	<li>Levy, S. B., Marshall, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibiotic+resistance+worldwide:+causes,+challenges,+and+responses.">Antibiotic resistance worldwide: causes, challenges, and responses.</a> Nat. Med. 10, s122-s129 (2004).</li><li>Wang, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracking+the+in+vivo+evolution+of+multidrug+resistance+in+Staphylococus+aureus+by+whole+genome+sequencing.">Tracking the in vivo evolution of multidrug resistance in Staphylococus aureus by whole genome sequencing.</a> Pro. Natl. Acad. Sci. 104, 9451 (2007).</li><li>Dragosits, M., Mattanovich, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adaptive+laboratory+evolution+-+principles+and+applications+for+biotechnology.">Adaptive laboratory evolution - principles and applications for biotechnology.</a> Microbial Cell Factory. 12, 64 (2013).</li><li>Zhang, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acceleration+of+emergence+of+bacterial+antibiotic+resistance+in+connected+microenvironment.">Acceleration of emergence of bacterial antibiotic resistance in connected microenvironment.</a> Science. 333, 1764-1767 (2011).</li><li>Toprak, E., Veres, A., Michel, J. B., Chait, R., Hartl, D. L., Kishony, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+paths+to+antibiotic+resistance+under+dynamically+sustained+drug+selection.">Evolutionary paths to antibiotic resistance under dynamically sustained drug selection.</a> Nature Genetics. 44, 101-106 (2012).</li><li>Toprak, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Building+a+morbidostast:+an+automated+continuous+culture+device+for+studying+bacterial+drug+resistance+under+dynamically+sustained+drug+inhibition.">Building a morbidostast: an automated continuous culture device for studying bacterial drug resistance under dynamically sustained drug inhibition.</a> Nature Protocol. 8, 555-567 (2013).</li><li>Rosenthal, A. Z., Elowitz, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Following+evolution+of+bacterial+antibiotic+resistance+in+real+time.">Following evolution of bacterial antibiotic resistance in real time.</a> Nature Genetics. 44, 11-13 (2012).</li><li>Young, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+antibacterial+resistance+selection+and+quantitation.">In vitro antibacterial resistance selection and quantitation.</a> Curr Protoc Pharmacol. , (2006).</li><li>Novick, A., Szilard, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experiments+with+the+Chemostat+on+spontaneous+mutations+of+bacteria.">Experiments with the Chemostat on spontaneous mutations of bacteria.</a> Proc. Natl. Acad. Sci. U.S.A. 36, 708-719 (1950).</li><li>Balagadde, F. K., You, L., Hansen, C. L., Arnold, F. H., Quake, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+monitoring+of+bacteria+undergoing+programmed+population+control+in+a+microchemostat.">Long-term monitoring of bacteria undergoing programmed population control in a microchemostat.</a> Science. 309, 137-140 (2005).</li><li>Groisman, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microfluidic+chemostat+for+experiments+with+bacterial+and+yeast+cells.">A microfluidic chemostat for experiments with bacterial and yeast cells.</a> Nat. Methods. 2, 685-689 (2005).</li><li>Miller, A. W., Befort, C., Kerr, E. O., Dunham, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+Use+of+Multiplexed+Chemostat+Arrays.">Design and Use of Multiplexed Chemostat Arrays.</a> J. Vis. Exp. (72), e50262 (2013).</li><li>Takahashi, C. N., Miller, A. W., Ekness, F., Dunham, M. J., Klavins, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+low+cost,+customizable+turbidostat+for+use+in+synthetic+circuit+characterization.">A low cost, customizable turbidostat for use in synthetic circuit characterization.</a> ACS Synthetic Biology. , (2015).</li><li>Mohan, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+multiplexed+microfluidic+platform+for+rapid+antibiotic+susceptibility+testing.">A multiplexed microfluidic platform for rapid antibiotic susceptibility testing.</a> Biosens Bioelectrons. 49, 118-125 (2013).</li><li>Unger, M. A., Chou, H. P., Thorsen, T., Scherer, A., Quake, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monolithic+microfabricated+valves+and+pumps+by+multilayer+soft+lithography.">Monolithic microfabricated valves and pumps by multilayer soft lithography.</a> Science. 288, 113-116 (2000).</li><li>Kellogg, R. A., Gomez-Sjoberg, R., Leyrat, A. A., Tay, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Nat. Protocols. 9, 1713 (2014).</li><li>Gu, G. Y., Lee, Y. W., Chiang, C. C., Yang, Y. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nanoliter+microfluidic+serial+dilution+bioreactor.">A nanoliter microfluidic serial dilution bioreactor.</a> Biomicrofluidics. 9, 044126 (2015).</li><li>Gonzalez, R. C., Woods, R. E., Eddins, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Digital image using Matlab processing. , (2004).</li><li>Heikkila, E., Sundstrom, L., Huovinen, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trimethoprim+resistance+in+Escherichia+coli+isolates+from+a+geriatric+unit.">Trimethoprim resistance in Escherichia coli isolates from a geriatric unit.</a> Antimicrob. Agents Chemother. 34, 2013-2015 (1990).</li><li>Flensburg, J., Skold, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massive+overproduction+of+dihydrofolate+reductase+in+bacteria+as+a+response+to+the+use+of+trimethoprim.">Massive overproduction of dihydrofolate reductase in bacteria as a response to the use of trimethoprim.</a> Eur. J. Biochem. 162, 473-476 (1987).</li><li>Ohmae, E., Sasaki, Y., Gekko, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+five-tryptophan+mutations+on+structure,+stability+and+function+of+Escherichia+coli+dihydrofolate+reductase.">Effects of five-tryptophan mutations on structure, stability and function of Escherichia coli dihydrofolate reductase.</a> J. Biochem. 130, 439-447 (2001).</li><li>Smith, D. R., Calvo, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleotide+sequence+of+dihydrofolate+reductase+genes+from+trimethoprim-resistant+mutants+of+Escherichia+coli.+Evidence+that+dihydrofolate+reductase+interacts+with+another+essential+gene+product.">Nucleotide sequence of dihydrofolate reductase genes from trimethoprim-resistant mutants of Escherichia coli. Evidence that dihydrofolate reductase interacts with another essential gene product.</a> Mol. Gen. Genet. 187, 72-78 (1982).</li><li>Okumus, B., Yildiz, S., Toprak, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluidic+and+microfluidic+tools+for+quantitative+systems+biology.">Fluidic and microfluidic tools for quantitative systems biology.</a> Curr Opin Biotech. 25, 30-38 (2014).</li><li>Cho, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+antimicrobial+susceptibility+test+based+on+single-cell+morphological+analysis.">A rapid antimicrobial susceptibility test based on single-cell morphological analysis.</a> Sci. Transl. Med. 17, 267 (2014).</li><li>Hsu, S. B., Waltman, P. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+a+model+of+two+competitors+in+a+chemostat+with+an+external+inhibitor.">Analysis of a model of two competitors in a chemostat with an external inhibitor.</a> SIAM J. Applied Math. , 528-540 (1992).</li><li>Fu, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maximizing+biomass+productivity+and+cell+density+of+Chlorella+vulgaris+by+using+light-emitting+diode-based+photobioreactor.">Maximizing biomass productivity and cell density of Chlorella vulgaris by using light-emitting diode-based photobioreactor.</a> J. Biotech. 161, 242-249 (2012).</li><li>Peabody, V. G. L., Winkler, J., Kao, K. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tools+for+developing+tolerance+to+toxic+chemicals+in+microbial+systems+and+perspectives+on+moving+the+field+forward+and+into+the+industrial+setting.">Tools for developing tolerance to toxic chemicals in microbial systems and perspectives on moving the field forward and into the industrial setting.</a> Curr Opin in Chem Eng. 6, 9-17 (2014).</li></ol>

The authors have nothing to disclose.

저가의 구성 요소에서 낮은 풋 프린트 morbidostat 장치가 설명된다. 장치 등록 약제 내성 수준의 증가는 이전보고 5의 것과 일치한다. 약물 내성의 진화 연구를 위해 설계된 장치는 다른 많은 실험에 잠재적으로 적용 할 수있다. 첫째, 약물 - 유도 된 돌연변이의 광범위한 데이터베이스 임상 적 항생제의 큰 세트에 설정 될 수있다. 예를 들어 다제 내성의 진화 경로 단순히 실험에 사용 된 약물의 수를 증가시킴으로써 조사 될 수있다. 여기에보고 모듈의 주요 장점은 다양한 실험 조건 하에서 대규모 병렬 실험 있도록 유연한 구성 가능성이다. 개념은 마이크로 유체 측정에서 설명되었다하더라도, 조사 파워는 유체 기술은 마이크로 유체 (23)를 결합함으로써 개선 될 수있다. 당 비용측정 (규모의 경제)이 극적으로 감소 시약 소비 감소 노동에 의해 감소된다. 여기서, 하나의 세포 형태 데이터는 미세 유체 플랫폼으로부터 추출 될 수있다. 최근에, 단셀의 미세 형태 테스트가 성공적 미생물학 임상 실험실에서 구현되었으며, 표준 직렬 국물 희석 시험 (24)에 상대적으로 행한다. 미세 유체 장치의 가용성 증가, 결합 기술은 대규모 높은 처리량 실험실 진화 실험을 가능하게한다. 몇 가지 단계는 morbidostat을 실행하는 것이 중요하다. 자기 교반 장치는 자석과 냉각 팬으로 형성되어 있기 때문에, 우선, 그 배양 병에 대한 팬의 축 정렬하기 위해 매우 중요하다. 또한, 배양 바이알과 자석 사이의 간격은 안정된 동작을 보장하는 것이 매우 중요하다. 둘째, 매일의 실험의 시작 부분에서 새로운 문화 바이알로 전환하는 것도 중요하다생물막 형성을 피할 수 있습니다. 그렇지 않으면, 생물막 형성은 2 ~ 3 일 이내에 발생할 수 있습니다. 셋째, 때문에 E. 대장균 시료 일관성을 보장하기 위해 매일의 실험 기간 동안 고정 된 샘플 매일 해동, 상기 미생물로부터 총 세탁을 방지하기 위해 적어도 4 시간의 지연 시간을 설정하는 것이 중요하다. 또한, 하나는 E.을 동결하지 않도록 선택할 수 있습니다 직접 대장균 샘플과 새로운 문화를 시작하는 새로운 문화의 병을 접종 샘플을 사용합니다. 실제적인 세팅에서, 현재의 시스템 설계는 잠재적 용도를 확장하는 여러 한계를 극복해야한다. 전체 시스템의 부피가 현재 하루 소비 매체에 의해 제한된다 (chemostatic 동작 동안, 하나의 배양 바이알은 0.33 시간 -1의 전형적인 희석율에서 하루 중 약 0.5 L를 소비한다). 작업 부피를 줄이기 위해 더욱 최적화 plumbi와 약물 억제 인구 역학 조심 시뮬레이션에 의해 달성 될 수있다NG 25 매개 변수. 마지막 morbidostat 세균 배양 실험 광범위한 분야에 쉽게 적용된다. 예를 들면, 발광 다이오드를 부착함으로써, 시스템은 박테리아 또는 미세 조류 (26)의 진화 모니터링을 가능하게하는 광 생물 반응기로서 재구성 될 수있다. 모듈은 무선 배터리 팩 장치를 조작하여 흡착제로 기밀 용기에서 혐기성 및 호기성 배양을 확장 할 수있다. 다른 예로서, 독소의 농도는 서서히 목표 화학적 27 내성 균주 엔지니어 증가 될 수있다.

최초의 항생제 페니실린의 도입 이후, 미생물의 항생제 내성은 세계적인 건강 문제 (1)로 발전하고있다. 항생제 내성의 획득은 생체 내 향적 연구 할 수 있지만, 이러한 실험의 조건들은 전체에 걸쳐 방출이 제어되지 않는다. 이와 달리, 적응 실험실 진화 항생제 약물 (3)로부터 환경 스트레스 또는 선택 압력 하에서 미생물 종의 분자 적 진화를 공개 할 수있다. 최근 항생제 내성 많은 잘 제어 진화 실험은 항생제 내성 출현을 해명 하였다. 예를 들어, 오스틴의 그룹은 적절하게 설계 미세 유체 복실 환경 4의 급속한 출현을 보여 주었다. 최근에 개발 된 약물 morbidostat 선택 압력 하에서 5,6- 체계적 돌연변이를 유도한다. morbidostat, 미생물 SELEC연속적으로 거의 일정한 집단을 유지하기 위해 항생 물질의 농도를 조절 능 장치는 미생물 7,8에서 사용한 변동 테스트에서 큰 전진한다. 변동 시험에서, 항생제 약물을 고농도로 주입하고, 살아남은 돌연변이 스크리닝하고 계산한다. 대신, morbidostat에서 미생물 끊임없이 도전하고 여러 돌연변이를 획득한다. morbidostat는 chemostat, 미생물 인구 9 희석 동안 지속적으로 영양분을 공급하여 일정한 인구를 유지하고 1950 년 노빅과 Szliard에 의해 발명 문화 장치와 유사하게 작동합니다. 도입 이후, chemostat는 고급 및 개선되었습니다. 현재 마이크로 유체 chemostats은 나노 리터 및 단일 셀 용량에 도달했습니다. 그러나, 이러한 장치는 많은 돌연변이 이벤트 10, 11와 큰 세포 인구를 필요로 적응 진화 실험에 적합하다. 최근, 미니~ 10 ml로 작업 볼륨이 chemostats는 리터 규모의 생물 반응기 및 마이크로 유체 chemostat (12, 13) 사이의 간극을 채우기 위해 개발되었다. 여기에서 우리는 항생제 약물 내성 연구에 대한 설계 및 저가의 사용, 자동 morbidostat을 제시한다. 제안 된 모듈은 최소한의 하드웨어 요구 사항을 가진 미생물 실험실에서 진탕 배양기에서 사용될 수있다. 오픈 소스 펌웨어는 쉽게 대사 공학 3과 적응 진화의 특정 애플리케이션에 맞게 조정된다. 마지막으로, morbidostat 항생제 감수성 검사 (14)에 대한 멀티 플렉스 미세 유체 플랫폼에 통합되어 있습니다.

<table border="0" cellpadding="0" cellspacing="0" width="797">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Environmental Shaker Incubator</td>
			<td style="width:135px;">BioSan</td>
			<td style="width:163px;">ES-20</td>
			<td style="width:227px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Arduino Leonardo board</td>
			<td style="width:135px;">Arduino</td>
			<td style="width:163px;">Leonardo</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">680 Ohm Carbon Resistor</td>
			<td style="width:135px;">Digikey</td>
			<td style="width:163px;"></td>
			<td>Bias resistor for LED</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">100k Ohm Carbon resistor</td>
			<td style="width:135px;">Digikey</td>
			<td style="width:163px;"></td>
			<td>Bias resistor for phototransistor</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">940 nm light emitting diode</td>
			<td style="width:135px;">Bright LED Electronic</td>
			<td style="width:163px;">BIR-BM13E4G-2</td>
			<td>Optical density measurement</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">940 nm phototransistor</td>
			<td style="width:135px;">Kodenshi&#160;</td>
			<td style="width:163px;">ST-2L2B</td>
			<td>Optical density measurement</td>
		</tr>
		<tr height="57">
			<td height="57" style="height:57px;">Darlington pair IC Toshiba</td>
			<td style="width:135px;">Mouser</td>
			<td style="width:163px;">ULN2803APG</td>
			<td style="width:227px;">&#160;this IC drives micropumps and magnetic stirring unit</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:275px;">5V DC brushless fan&#160;</td>
			<td style="width:135px;">ADDA</td>
			<td style="width:163px;">AD0405LX-G70</td>
			<td style="width:227px;">spec: 5V supply voltage and 80mA available www.jameco.com</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Piezoelectric micropump</td>
			<td style="width:135px;">CurieJet</td>
			<td style="width:163px;">PS15I-FT-5L</td>
			<td>Pressure &#62;3kPa&#160; Flow rate &#62;5 ml/min</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Tygon 3350 Tuning</td>
			<td style="width:135px;">Saint Gobain</td>
			<td style="width:163px;">ABW00001</td>
			<td>ID: 1/32&#34; OD: 3/32&#34; L:50&#39;&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Magnetic Stir bar</td>
			<td style="width:135px;">COWIE</td>
			<td style="width:163px;"></td>
			<td>tapered shape dim: 10 mm x 4mm</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Glass scintillation 20ml vial</td>
			<td style="width:135px;">DGS</td>
			<td style="width:163px;"></td>
			<td>Pyrex glass 28mm(dia.)x 61 mm(h)</td>
		</tr>
		<tr height="48">
			<td height="48" style="height:48px;width:275px;">Culture vial holder</td>
			<td style="width:135px;"></td>
			<td style="width:163px;"></td>
			<td>Custom made from Polyformaldehyde&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Silicone&#160;</td>
			<td style="width:135px;">Dow Corning</td>
			<td style="width:163px;">Sylgald 184</td>
			<td>used to seal the glass vial</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Medium bottle</td>
			<td style="width:135px;">VWR</td>
			<td style="width:163px;">66022-065</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Difco M9 minimal salt 5x</td>
			<td style="width:135px;">BD</td>
			<td style="width:163px;"></td>
			<td>Medium</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Cadamino Acid</td>
			<td style="width:135px;">BD</td>
			<td style="width:163px;"></td>
			<td>Medium</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">glucose</td>
			<td style="width:135px;">Sigma</td>
			<td style="width:163px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Agar Bateriological</td>
			<td style="width:135px;">Oxoid</td>
			<td style="width:163px;"></td>
			<td>for agar plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Luria Bertani medium</td>
			<td style="width:135px;"></td>
			<td style="width:163px;"></td>
			<td></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:275px;">Inverted microscope</td>
			<td style="width:135px;">Leica Microsystems</td>
			<td style="width:163px;">Leica DMI-LED</td>
			<td style="width:227px;">used for microfluidic measurement Use X40 objective NA=0.55</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Microscope Incubator</td>
			<td style="width:135px;">Live Cell Instrument</td>
			<td style="width:163px;">CU-109</td>
			<td>used for microfluidic measurement</td>
		</tr>
		<tr height="49">
			<td height="49" style="height:49px;width:275px;">Solenoidal valves</td>
			<td style="width:135px;">Pneumadyne</td>
			<td style="width:163px;">S10MM-31-12-3</td>
			<td>Normally open 1.3 Watt 12 Vdc</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">USB interface card</td>
			<td style="width:135px;">Hobby Engineering</td>
			<td>USBIO24-R Digital I/O Module&#160;</td>
			<td>for microfluidics measurement</td>
		</tr>
		<tr height="45">
			<td height="45" style="height:45px;width:275px;">Air compressor</td>
			<td style="width:135px;">Rocker Scientific</td>
			<td style="width:163px;">ROCKER 440</td>
			<td style="width:227px;">Pressure source for microfluidcs Max. Pressure 80 Psi</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Male luer-lock fittings to 1/8&#34; barb</td>
			<td>ValuePlastics.com</td>
			<td style="width:163px;">MTLL230-1</td>
			<td>used for microfluidic control</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1/8&#34; barb to 10-32 threaded port</td>
			<td>ValuePlastics.com</td>
			<td style="width:163px;">B-1</td>
			<td>used for microfluidic control</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Female luer-lock fittings to 10-32 threaded port</td>
			<td>ValuePlastics.com</td>
			<td style="width:163px;">KFTL-1</td>
			<td>used for microfluidic control</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NPN darlington transistor 500mA, 40V (2N6427)</td>
			<td>DigiKey.com</td>
			<td>2N6427GOS-ND</td>
			<td>used for microfluidic control</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">10kOhm, carbon film resistor, 0.25W</td>
			<td>DigiKey.com</td>
			<td>P10KBACT-ND</td>
			<td>used for microfluidic control</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tantalum capacitor, 10uF, 25V, 10%</td>
			<td>DigiKey.com</td>
			<td>478-1841-ND</td>
			<td>used for microfluidic control</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Andor CCD camera</td>
			<td style="width:135px;">Andor</td>
			<td style="width:163px;">Zyla 4.2 Plus SCMOS</td>
			<td>used for microfluidic on chip imaging</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">ELISA plate reader</td>
			<td style="width:135px;"></td>
			<td style="width:163px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">two component Silicone&#160;</td>
			<td style="width:135px;">Momentive</td>
			<td style="width:163px;">RTV 615</td>
			<td>used for microfluidic chip fabrication</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">SU-8 photoresist</td>
			<td style="width:135px;">Micrchem</td>
			<td style="width:163px;">SU8 2015</td>
			<td>used for microfluidic chip fabrication</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">AZ4620 photoresist</td>
			<td style="width:135px;">Clariant</td>
			<td style="width:163px;">AZ 4620</td>
			<td>used for microfluidic chip fabrication</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Plasma cleaner</td>
			<td style="width:135px;">Harrick Plasma</td>
			<td style="width:163px;">PDC 32G</td>
			<td>used for microfluidic chip fabrication</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">20 Gauge Syringe Needle</td>
			<td style="width:135px;">BD</td>
			<td style="width:163px;"></td>
			<td>used for microfluidic chip fabrication</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Labcycler</td>
			<td style="width:135px;">Sensoquest</td>
			<td style="width:163px;">Labcycler</td>
			<td>PCR&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">DNA polymerase</td>
			<td style="width:135px;">Toyobo</td>
			<td style="width:163px;">KDO Plus</td>
			<td>PCR amplification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Trimethoprim</td>
			<td style="width:135px;">Sigma</td>
			<td style="width:163px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Plate reader</td>
			<td style="width:135px;">Biotek</td>
			<td style="width:163px;">Synergy H1 hybrid&#160;</td>
			<td>antibiotic resistane measurement</td>
		</tr>
	</tbody>
</table>

design and use of a low cost, automated morbidostat for adaptive evolution of bacteria under antibiotic drug selection

우리는 항생제 내성의 진화 경로를 특성화 저렴한 비용으로, 구성 morbidostat에 대해 설명합니다. morbidostat 연속적 박테리아 증식을 모니터링하여 동적으로 약물 내성을 획득 진화 항상 세균 도전 약물 농도를 조절하는 세균 배양 장치이다. 이 장치는 ~ 10 ML의 작업 볼륨을 갖추고 있으며, 완전 자동화 및 광학 밀도 측정 및 매체 및 약물 전달 마이크로 펌프가 장착되어 있습니다. 플랫폼의 유효성을 확인하기 위해, 우리는 1655 대장균 MG에서 trimethoprim을 저항의 단계적 취득을 측정하고, 세포 형태 및 항생제 감수성을 조사 할 수있는 멀티 플렉스 미세 유체 플랫폼과 장치를 통합. 접근 방식은 항생제 약물 내성의 실험실 연구를 확장 업 및 대사 공학 및 기타 세균 배양 실험에서 변형 개선을 위해 진화를 적응 적하는 확장 가능한 것입니다 수 있습니다.

상술 morbidostat은도 1에 도식화한다. 실험 진화 항생제 감수성 시험 및 세포 형태 검사를 포함하는 일반적인 동작을 morbidostat, E.에서 검증 된 (TMP) trimethoprim을 노출 대장균 MG1655 문화, 일반적으로 사용되는 항생제 약물 5,6. TMP는 약물 내성이 매우 독특한 단계적 증가를 유도하고, 돌연변이 디 하이드로 리덕 타제 (DHFR) 유전자 클러스터를 해결한다. 따라서, TMP는 morbidostat 동작을 검증하기위한 매우 효과적인 표준 약물이다. 매일, 상기 미생물은 소정의 광학 밀도가 임계치를 초과하여 증가하고도 2a에 도시 된 바와 같이, 약물 주입을 유발하는 것으로 예상된다. 약물 주입 성장을 억제 할 것으로 예상 결과, 광학 밀도가 감소된다. 몇몇 시험 런은 최적의 약물 농도를 결정하기 위해 필요할 수있다. 엄지 손가락의 규칙으로, 우리는 increasE로 약물 매체의 농도, 약물 매체 성장을 억제하는 것이 실패 찾은 후 5 배. 실험 전체 과정 후, 매일 샘플을 냉동 및 해동 IC (50), 약제 내성 수준의 정량적 측정 값을 결정하기 위해 사용된다. 도 2b에 플롯은 항생제 약물 저항의 일시적인 증가를 보여줍니다. 약물 저항은 1,500 배 정도 증가에 ~ 1,000 μg의 / ㎖ 이상 ~ 12 실험실 진화 5 이전의 연구 결과와 일치 일, 임상 19을 분리합니다. 마지막 날 돌연변이의 DHFR의 점 돌연변이는 생거 시퀀싱에 의해 측정하고, 표 2에 열거되어있다. 하나의 돌연변이가 프로모터 영역에 위치한 프로모터 영역의 단일 점 돌연변이가 크게 DHFR의 발현 수준을 변경할 수 있음을 나타낸다 발견 효소 20. 위치 49910에서 또 다른 돌연변이 DHFR의 유전자 영역에 위치하고 행위에 가깝습니다DHFR의 필자 사이트 (21) 효소. 한천 플레이트를 포함하는 약물의 선택은 오직 하나의 돌연변이를 부여하는 경향으로 다수의 돌연변이와 약제 내성의 인수는 morbidostat의 유용성을 증명한다. 세포 형태를 더 민감 판독 같이, 항생제 감수성 단일 세포 형태 검사가 병렬로 수행되는, 다중 마이크로 유체 플랫폼 (14).도 3은 다중 마이크로 유체 칩의 디자인을 도시한다. 세균 세포의 현미경 사진 (그림 5) TMP의 하위 억제 농도에 따라 형태를 모두 야생형의 변화와 돌연변이 균주를 알 수있다. 돌연변이 균주는 유의 한 filamentation을 보여줍니다 동안 야생형 균주는 상당한 filamentation을 보여줍니다. 단일 세포 수준에서의 형태 변화는 항생제 내성의 신속한 진단에 사용될 수있다. (4)에 표시 치 도표TMP의 다양한 농도에서 페이지의 성장 곡선. 돌연변이 샘플 항생제 저항의 상당한 증가를 나타낸다. 도 4 온칩 성장 데이터는도 2b에 표시된 플레이트 판독기에서 IC 50 값과 일치한다. <img alt="그림 1" src="/files/ftp_upload/54426/54426fig1.jpg" /> 그림 1. morbidostat의 설계도 morbidostat은 미생물 집단의 광학 밀도를 측정하고, 따라서 약물의 농도를 조절하는 연속 배양 장치이다. 이 장치는 약물 주입 모드와 약물 희석 모드에서 실행됩니다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/54426fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/54426/54426fig2.jpg"/&gt; 도 2 : 성장 곡선 및 항생제 저항성 수준의 증가 피드백에서 (a) 대표 성장 곡선.. 미생물 성장은 그 주입 임계 값 알고리즘에 의해 트리거되는 항생제에 의해 억제된다. 양의 증가 속도가 미리 설정된 임계치 이상의 광학 농도 (OD TH = 0.086)를 제기 할 때, 약물 주입 모드로 전환 장치. 그렇지 않으면, 장치는 약 희석 모드에서 실행. 빨간색과 보라색 화살표는 각각 약물 주사 및 약물 희석 모드로 전환 나타냅니다. (b) 노출 trimethoprim을 12 일 동안 셀 저항 레벨. 이 IC (50)는 항생제 약물 내성의 별개의 단계적 증가를 보여줍니다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/54426fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img al<html> t = &quot;그림 3&quot;SRC = &quot;/ 파일 / ftp_upload / 54426 / 54426fig3.jpg&quot;/&gt; 그림 3 : 세포 형태 및 온 - 칩 항생제 감수성 조사를위한 미세 유체 장치 칩 레이아웃 (가) 현미경 사진.. 녹색 및 청색 구획 각각 성장 및 약물 배지 챔버, 그리고 적색 레이아웃 제어 계층을 나타낸다. 성장 챔버의 크기는 450 μm의 (난) 400 μm의 (w)는 8 μm의 (시간을) X X입니다. 성장 챔버 균로드와 약물 챔버는 TMP로 로딩된다. 스케일 바는 1cm입니다. (b) 동일한 칩의 뷰를 확대. 스케일 바 = 500 μm의. (다) 전 양원의보기를 확대하고 혼합 한 후. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/54426fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> &quot;SRC =&quot;/ 파일 / ftp_upload / 54426 / 54426fig4.jpg &quot;/&gt; 그림 4 : E.의 온 - 칩 성장 곡선 (a) 야생형 선조 균주 및 (일 12시) (b) 돌연변이 균주 : 대장균 TMP의 다양한 농도에 노출. 돌연변이 샘플은 항생제 약물 저항의 상당한 증가를 보여줍니다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/54426fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 5" src="/files/ftp_upload/54426/54426fig5.jpg" /> 그림 5 : 단일 세포 형태 학적 (A - D) TMP의 서브 억제 수준의 치료 후 셀의 밝은 필드 이미지. (d 돌연변이의 부재에서 야생형 세포의 상당한 filamentation (b)를 참고 </strong&gt;). 패널 (전자 - h를) (- D A)의 디지털화 된 이미지입니다. 모든 세균 이미지가 40X 배율 목적으로 CCD 카메라에 의해 촬영되었다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/54426fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> 보충 그림 1 :. 치수 및 문화 유리 병 홀더의 조립 <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/Supplemental_Figure_1.pdf" target="_blank">이 파일을 다운로드하려면 여기를 클릭하십시오.</a> 보충 그림 2 :. LED와 광 검출기의 회로도 <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/Supplementary_Figure_2.PNG" target="_blank">이 파일을 다운로드하려면 여기를 클릭하십시오.</a> 부가 코드 :. 미세 유체 칩에서 얻은 세포 이미지에서 세포 수를 계산하는 사용자 정의 스크립트 <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/renamed_40eb7.pdf" target="_blank">이 파일을 다운로드하려면 여기를 클릭하십시오.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td colspan="2"> 견본 </td><td colspan="11"> TMP 약물 (μg의 / ㎖) </td></tr><tr><td colspan="2"> 하루 1-3 </td><td> 0 </td><td> 0.06 </td><td> 0.12 </td><td> 0.25 </td><td> 0.5 </td><td> 1 </td><td> 이 </td><td> 4 </td><td> 8 </td><td> (16) </td><td> (32) </td></tr><tr><td colspan="2"> 4 일 </td><td> 0 </td><td> 1 </td><td> 이 </td><td> 삼 </td><td> (5) </td><td> (10) </td><td> (20) </td><td> (40) </td><td> (80) </td><td> (160) </td><td> (320) </td></tr><tr><td colspan="2"> 하루 5-7 </td><td> 0 </td><td> 이 </td><td> 4 </td><td> 8 </td> &lt;TD&gt; (15) </td><td> (30) </td><td> (60) </td><td> (120) </td><td> (240) </td><td> 480 </td><td> 960 </td></tr><tr><td colspan="2"> 하루 8 ~ 12 </td><td> 0 </td><td> 삼 </td><td> (7) </td><td> (15) </td><td> (30) </td><td> (60) </td><td> (125) </td><td> (250) </td><td> (500) </td><td> 1,000 </td><td> 2,000 </td></tr></tbody></table> 표 1. μg의 / ㎖ 단위로 측정 플레이트 판독기 약물 농도에 IC (50)를 결정하는 데 사용 약물 농도는 매일 냉동 샘플에 대해 표시된다. 세포가 높은 약품 내성을 같이 사용 된 약물 농도는 그에 따라 증가한다. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 아니 </td><td> 위치 </td><td> SNP </td><td> 노트 </td></tr><tr><td> 1 </td><td> 49894 </td><td> C-&gt; T </td><tD&gt; DHFR 유전자 </td></tr><tr><td> 이 </td><td> 49910 </td><td> T-&gt;를 </td><td> DHFR 유전자 </td></tr><tr><td> 삼 </td><td> 49795 </td><td> C-&gt; T </td><td> DHFR 프로모터 </td></tr></tbody></table> 표 2. 생거 시퀀싱에 의해 식별 DHFR 변이 대표적인 시퀀스 데이터는 마지막 날 돌연변이 (12 일)의 3 DHFR 점 돌연변이를 나타낸다. 프로모터 유전자 영역은 각각 하나와 2 개의 SNP를 포함한다. PCR을에 사용되는 순방향 및 역방향 프라이머 3&#39;TCTAGAGAGATCATTACCGA GGACCGCGAACATCTGTCAT5 &#39;와 3&#39;ACTAGT TTACCGCCGCTC CAGAATCTCAA AGCAATAGCTG5&#39;이었다.

Watch this Scientific Journal Video about Design and Use of a Low Cost, Automated Morbidostat for Adaptive Evolution of Bacteria Under Antibiotic Drug Selection at JoVE.com

Design and Use of a Low Cost, Automated Morbidostat for Adaptive Evolution of Bacteria Under Antibiotic Drug Selection

We describe a low cost, configurable morbidostat that enables the characterization of antibiotic drug resistance by dynamically adjusting the drug concentration. The device can be integrated with a multiplexed microfluidic platform. The approach can be scaled up for laboratory antibiotic drug resistance studies.

디자인과 낮은 비용의 사용, 자동 Morbidostat 박테리아의 적응 진화에 대한 항생제 약물 선택에서

We describe a low cost, configurable morbidostat for characterizing the evolutionary pathway of antibiotic resistance. The morbidostat is a bacterial ...

design-use-low-cost-automated-morbidostat-for-adaptive-evolution

Nanyang Technological University

Research

JoVE Journal

Genetics

9.6K 조회수.  National Tsing Hua University. We describe a low cost, configurable morbidostat that enables the characterization of antibiotic drug resistance by dynamically adjusting the drug concentration. The device can be integrated with a multiplexed microfluidic platform. The approach can be scaled up for laboratory antibiotic drug resistance studies.

비디오: Design and Use of a Low Cost, Automated Morbidostat for Adaptive Evolution of Bacteria Under Antibiotic Drug Selection

Procedure for Adaptive Laboratory Evolution of Microorganisms Using a Chemostat

Natural evolution involves genetic diversity such as environmental change and a selection between small populations. Adaptive laboratory evolution (ALE) refers to the experimental situation in which evolution is observed using living organisms under controlled conditions and stressors; organisms are thereby artificially forced to make evolutionary changes. Microorganisms are subject to a variety of stressors in the environment and are capable of regulating certain stress-inducible proteins to increase their chances of survival. Naturally occurring spontaneous mutations bring about changes in a microorganism's genome that affect its chances of survival. Long-term exposure to chemostat culture provokes an accumulation of spontaneous mutations and renders the most adaptable strain dominant. Compared to the colony transfer and serial transfer methods, chemostat culture entails the highest number of cell divisions and, therefore, the highest number of diverse populations. Although chemostat culture for ALE requires more complicated culture devices, it is less labor intensive once the operation begins. Comparative genomic and transcriptome analyses of the adapted strain provide evolutionary clues as to how the stressors contribute to mutations that overcome the stress. The goal of the current paper is to bring about accelerated evolution of microorganisms under controlled laboratory conditions.

Here, we present a protocol to obtain adaptive laboratory evolution of microorganisms under conditions using chemostat culture. Also, genomic analysis of the evolved strain is discussed.

Chemostat를 사용하여 미생물의 적응 연구소 발전을위한 절차

Natural evolution involves genetic diversity such as environmental change and a selection between small populations. Adaptive laboratory evolution (ALE) ...

연구

유전학

Testing the Role of Multicopy Plasmids in the Evolution of Antibiotic Resistance

Multicopy plasmids are extremely abundant in prokaryotes but their role in bacterial evolution remains poorly understood. We recently showed that the increase in gene copy number per cell provided by multicopy plasmids could accelerate the evolution of plasmid-encoded genes. In this work, we present an experimental system to test the ability of multicopy plasmids to promote gene evolution. Using simple molecular biology methods, we constructed a model system where an antibiotic resistance gene can be inserted into Escherichia coli MG1655, either in the chromosome or on a multicopy plasmid. We use an experimental evolution approach to propagate the different strains under increasing concentrations of antibiotics and we measure survival of bacterial populations over time. The choice of the antibiotic molecule and the resistance gene is so that the gene can only confer resistance through the acquisition of mutations. This &#34;evolutionary rescue&#34; approach provides a simple method to test the potential of multicopy plasmids to promote the acquisition of antibiotic resistance. In the next step of the experimental system, the molecular bases of antibiotic resistance are characterized. To identify mutations responsible for the acquisition of antibiotic resistance we use deep DNA sequencing of samples obtained from whole populations and clones. Finally, to confirm the role of the mutations in the gene under study, we reconstruct them in the parental background and test the resistance phenotype of the resulting strains.

Here we present an experimental method to test the role of multicopy plasmids in the evolution of antibiotic resistance.

항생제 내성의 진화에서 다중 플라스 미드의 역할 테스트

Multicopy plasmids are extremely abundant in prokaryotes but their role in bacterial evolution remains poorly understood. We recently showed that the ...

Genome-wide Surveillance of Transcription Errors in Eukaryotic Organisms

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that control the fidelity of transcription. To fill this gap in scientific knowledge, we recently optimized the circle-sequencing assay to detect transcription errors throughout the transcriptome of Saccharomyces cerevisiae, Drosophila melanogaster, and Caenorhabditis elegans. This protocol will provide researchers with a powerful new tool to map the landscape of transcription errors in eukaryotic cells so that the mechanisms that control the fidelity of transcription can be elucidated in unprecedented detail.

This protocol provides researchers with a new tool to monitor the fidelity of transcription in multiple model organisms.

진 핵 생물의 전사 오류의 게놈 넓은 감시

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that ...

Producing Gene Deletions in Escherichia coli by P1 Transduction with Excisable Antibiotic Resistance Cassettes

A first approach to study the function of an unknown gene in bacteria is to create a knock-out of this gene. Here, we describe a robust and fast protocol for transferring gene deletion mutations from one Escherichia coli strain to another by using generalized transduction with the bacteriophage P1. This method requires that the mutation be selectable (e.g., based on gene disruptions using antibiotic cassette insertions). Such antibiotic cassettes can be mobilized from a donor strain and introduced into a recipient strain of interest to quickly and easily generate a gene deletion mutant. The antibiotic cassette can be designed to include flippase recognition sites that allow the excision of the cassette by a site-specific recombinase to produce a clean knock-out with only a ~100-base-pair-long scar sequence in the genome. We demonstrate the protocol by knocking out the tamA gene encoding an assembly factor involved in autotransporter biogenesis and test the effect of this knock-out on the biogenesis and function of two trimeric autotransporter adhesins. Though gene deletion by P1 transduction has its limitations, the ease and speed of its implementation make it an attractive alternative to other methods of gene deletion.

Producing Gene Deletions in Escherichia coli by P1 Transduction with Excisable Antibiotic Resistance Cassettes

Here we present a protocol for the use of pre-existing antibiotic resistance-cassette deletion constructs as a basis for making deletion mutants in other E. coli strains. Such deletion mutations can be mobilized and inserted into the corresponding locus of a recipient strain using P1 bacteriophage transduction.

Excisable 항 생 저항 카세트와 P1 변환 하 여 대장균 에서 생산 유전자 삭제

A first approach to study the function of an unknown gene in bacteria is to create a knock-out of this gene. Here, we describe a robust and fast protocol ...

qKAT: Quantitative Semi-automated Typing of Killer-cell Immunoglobulin-like Receptor Genes

Killer cell immunoglobulin-like receptors (KIRs) are a set of inhibitory and activating immune receptors, on natural killer (NK) and T cells, encoded by a polymorphic cluster of genes on chromosome 19. Their best-characterized ligands are the human leukocyte antigen (HLA) molecules that are encoded within the major histocompatibility complex (MHC) locus on chromosome 6. There is substantial evidence that they play a significant role in immunity, reproduction, and transplantation, making it crucial to have techniques that can accurately genotype them. However, high-sequence homology, as well as allelic and copy number variation, make it difficult to design methods that can accurately and efficiently genotype all KIR genes. Traditional methods are usually limited in the resolution of data obtained, throughput, cost-effectiveness, and the time taken for setting up and running the experiments. We describe a method called quantitative KIR semi-automated typing (qKAT), which is a high-throughput multiplex real-time polymerase chain reaction method that can determine the gene copy numbers for all genes in the KIR locus. qKAT is a simple high-throughput method that can provide high-resolution KIR copy number data, which can be further used to infer the variations in the structurally polymorphic haplotypes that encompass them. This copy number and haplotype data can be beneficial for studies on large-scale disease associations, population genetics, as well as investigations on expression and functional interactions between KIR and HLA.

Quantitative killer cell immunoglobulin-like receptor (KIR) semi-automated typing (qKAT) is a simple, high-throughput, and cost-effective method to copy number type KIR genes for their application in population and disease association studies.

qKAT: 킬러 세포 같은 면역 글로불린 수용 체 유전자의 양적 반자동 입력

Killer cell immunoglobulin-like receptors (KIRs) are a set of inhibitory and activating immune receptors, on natural killer (NK) and T cells, encoded by a ...

Genetic Engineering of Dictyostelium discoideum Cells Based on Selection and Growth on Bacteria

Dictyostelium discoideum is an intriguing model organism for the study of cell differentiation processes during development, cell signaling, and other important cellular biology questions. The technologies available to genetically manipulate Dictyostelium cells are well-developed. Transfections can be performed using different selectable markers and marker re-cycling, including homologous recombination and insertional mutagenesis. This is supported by a well-annotated genome. However, these approaches are optimized for axenic cell lines growing in liquid cultures and are difficult to apply to non-axenic wild-type cells, which feed only on bacteria. The mutations that are present in axenic strains disturb Ras signaling, causing excessive macropinocytosis required for feeding, and impair cell migration, which confounds the interpretation of signal transduction and chemotaxis experiments in those strains. Earlier attempts to genetically manipulate non-axenic cells have lacked efficiency and required complex experimental procedures. We have developed a simple transfection protocol that, for the first time, overcomes these limitations. Those series of large improvements to Dictyostelium molecular genetics allow wild-type cells to be manipulated as easily as standard laboratory strains. In addition to the advantages for studying uncorrupted signaling and motility processes, mutants that disrupt macropinocytosis-based growth can now be readily isolated. Furthermore, the entire transfection workflow is greatly accelerated, with recombinant cells that can be generated in days rather than weeks. Another advantage is that molecular genetics can further be performed with freshly isolated wild-type Dictyostelium samples from the environment. This can help to extend the scope of approaches used in these research areas.

Genetic Engineering of Dictyostelium discoideum Cells Based on Selection and Growth on Bacteria

Dictyostelium discoideum is a popular model organism to study complex cellular processes such as cell migration, endocytosis, and development. The utility of the organism is dependent on the feasibility of genetic manipulation. Here, we present methods to transfect Dictyostelium discoideum cells that overcome existing limitations of culturing cells in liquid media.

Dictyostelium discoideum 셀 선택에 따라 성장과 박테리아에서의 유전 공학

Dictyostelium discoideum is an intriguing model organism for the study of cell differentiation processes during development, cell signaling, and other ...

Designing Automated, High-throughput, Continuous Cell Growth Experiments Using eVOLVER

Continuous culture methods enable cells to be grown under quantitatively controlled environmental conditions, and are thus broadly useful for measuring fitness phenotypes and improving our understanding of how genotypes are shaped by selection. Extensive recent efforts to develop and apply niche continuous culture devices have revealed the benefits of conducting new forms of cell culture control. This includes defining custom selection pressures and increasing throughput for studies ranging from long-term experimental evolution to genome-wide library selections and synthetic gene circuit characterization. The eVOLVER platform was recently developed to meet this growing demand: a continuous culture platform with a high degree of scalability, flexibility, and automation. eVOLVER provides a single standardizing platform that can be (re)-configured and scaled with minimal effort to perform many different types of high-throughput or multi-dimensional growth selection experiments. Here, a protocol is presented to provide users of the eVOLVER framework a description for configuring the system to conduct a custom, large-scale continuous growth experiment. Specifically, the protocol guides users on how to program the system to multiplex two selection pressures &#8212; temperature and osmolarity &#8212; across many eVOLVER vials in order to quantify fitness landscapes of Saccharomyces cerevisiae mutants at fine resolution. We show how the device can be configured both programmatically, through its open-source web-based software, and physically, by arranging fluidic and hardware layouts. The process of physically setting up the device, programming the culture routine, monitoring and interacting with the experiment in real-time over the internet, sampling vials for subsequent offline analysis, and post experiment data analysis are detailed. This should serve as a starting point for researchers across diverse disciplines to apply eVOLVER in the design of their own complex and high-throughput cell growth experiments to study and manipulate biological systems.

The eVOLVER framework enables high-throughput continuous microbial culture with high resolution and dynamic control over experimental parameters. This protocol demonstrates how to apply the system to conduct a complex fitness experiment, guiding users on programming automated control over many individual cultures, measuring, collecting, and interacting with experimental data in real-time.

에 버 버를 사용 하 여 자동화 된 고 처리량, 지속적인 세포 성장 실험 설계

Continuous culture methods enable cells to be grown under quantitatively controlled environmental conditions, and are thus broadly useful for measuring ...

Use of Frozen Tissue in the Comet Assay for the Evaluation of DNA Damage

The comet assay is gaining popularity as a means to assess DNA damage in cultured cells and tissues, particularly following exposure to chemicals or other environmental stressors. Use of the comet assay in regulatory testing for genotoxic potential in rodents has been driven by adoption of an Organisation for Economic Co-operation and Development (OECD) test guideline in 2014. Comet assay slides are typically prepared from fresh tissue at the time of necropsy; however, freezing tissue samples can avoid logistical challenges associated with simultaneous preparation of slides from multiple organs per animal and from many animals per study. Freezing also enables shipping samples from the exposure facility to a different laboratory for analysis, and storage of frozen tissue facilitates deferring a decision to generate DNA damage data for a given organ. The alkaline comet assay is useful for detecting exposure-related DNA double- and single-strand breaks, alkali-labile lesions, and strand breaks associated with incomplete DNA excision repair. However, DNA damage can also result from mechanical shearing or improper sample processing procedures, confounding the results of the assay. Reproducibility in collection and processing of tissue samples during necropsies may be difficult to control due to fluctuating laboratory personnel with varying levels of experience in harvesting tissues for the comet assay. Enhancing consistency through refresher training or deployment of mobile units staffed with experienced laboratory personnel is costly and may not always be feasible. To optimize consistent generation of high quality samples for comet assay analysis, a method for homogenizing flash frozen cubes of tissue using a customized tissue mincing device was evaluated. Samples prepared for the comet assay by this method compared favorably in quality to fresh and frozen tissue samples prepared by mincing during necropsy. Moreover, low baseline DNA damage was measured in cells from frozen cubes of tissue following prolonged storage.

This protocol describes several procedures for preparing high quality frozen tissue samples at the time of necropsy for use in the comet assay to assess DNA damage: 1) minced tissue, 2) scraped epithelial cells from the gastrointestinal tract, and 3) cubed tissue samples, requiring homogenization using a tissue mincing device.

DNA 손상의 평가를 위한 혜성 분석에서 냉동 조직의 사용

The comet assay is gaining popularity as a means to assess DNA damage in cultured cells and tissues, particularly following exposure to chemicals or other ...

Use of Drosophila S2 Cells for Live Imaging of Cell Division

Drosophila S2 cells are an important tool in studying mitosis in tissue culture, providing molecular insights into this fundamental cellular process in a rapid and high-throughput manner. S2 cells have proven amenable to both fixed- and live-cell imaging applications. Notably, live-cell imaging can yield valuable information about how loss or knockdown of a gene can affect the kinetics and dynamics of key events during cell division, including mitotic spindle assembly, chromosome congression, and segregation, as well as overall cell cycle timing. Here we utilize S2 cells stably transfected with fluorescently tagged mCherry:&#945;-tubulin to mark the mitotic spindle and GFP:CENP-A (referred to as &#8216;CID&#8217; gene in Drosophila) to mark the centromere to analyze the effects of key mitotic genes on the timing of cell divisions, from prophase (specifically at Nuclear Envelope Breakdown; NEBD) to the onset of anaphase. This imaging protocol also allows for the visualization of the spindle microtubule and chromosome dynamics throughout mitosis. Herein, we aim to provide a simple yet comprehensive protocol that will allow readers to easily adapt S2 cells for live imaging experiments. Results obtained from such experiments should expand our understanding of genes involved in the cell division by defining their role in several simultaneous and dynamic events. Observations made in this cell culture system can be validated and further investigated in vivo using the impressive toolkit of genetic approaches in flies.

Use of Drosophila S2 Cells for Live Imaging of Cell Division

Cell divisions can be visualized in real time using fluorescently tagged proteins and time-lapse microscopy. Using the protocol presented here, users can analyze cell division timing dynamics, mitotic spindle assembly, and chromosome congression and segregation. Defects in these events following RNA interference (RNAi)-mediated gene knockdown can be assessed and quantified.

Drosophila S2 cells are an important tool in studying mitosis in tissue culture, providing molecular insights into this fundamental cellular process in a ...

A FACS-based Protocol to Isolate RNA from the Secondary Cells of Drosophila Male Accessory Glands

To understand the function of an organ, it is often useful to understand the role of its constituent cell populations. Unfortunately, the rarity of individual cell populations often makes it difficult to obtain enough material for molecular studies. For example, the accessory gland of the Drosophila male reproductive system contains two distinct secretory cell types. The main cells make up 96% of the secretory cells of the gland, while the secondary cells (SC) make up the remaining 4% of cells (about 80 cells per male). Although both cell types produce important components of the seminal fluid, only a few genes are known to be specific to the SCs. The rarity of SCs has, thus far, hindered transcriptomic analysis study of this important cell type. Here, a method is presented that allows for the purification of SCs for RNA extraction and sequencing. The protocol consists in first dissecting glands from flies expressing a SC-specific GFP reporter and then subjecting these glands to protease digestion and mechanical dissociation to obtain individual cells. Following these steps, individual, living, GFP-marked cells are sorted using a fluorescent activated cell sorter (FACS) for RNA purification. This procedure yields SC-specific RNAs from ~40 males per condition for downstream RT-qPCR and/or RNA sequencing in the course of one day. The rapidity and simplicity of the procedure allows for the transcriptomes of many different flies, from different genotypes or environmental conditions, to be determined in a short period of time.

A FACS-based Protocol to Isolate RNA from the Secondary Cells of Drosophila Male Accessory Glands

Here, we present a protocol to dissociate and sort a specific cell population from the Drosophila male accessory glands (secondary cells) for RNA sequencing and RT-qPCR. Cell isolation is accomplished through FACS purification of GFP-expressing secondary cells after a multistep-dissociation process requiring dissection, proteases digestion and mechanical dispersion.

체미애 남성 액세서리 땀샘의 이차 세포에서 RNA를 분리하는 FACS 기반 프로토콜

To understand the function of an organ, it is often useful to understand the role of its constituent cell populations. Unfortunately, the rarity of ...