The authors would like to thank Prof. Sze-Bi Hsu and Ms. Zhenzhen for useful discussions and help in the theoretical analysis and numerical simulation. Y. T. Y. would like to acknowledge funding support from the Ministry of Science and Technology under grant numbers MOST 103-2220-E-007-026 and MOST 104-2220-E-007-011, and from the National Tsing Hua University under grant numbers 103N2042E1, 104N2042E1, and 105N518CE1.

Morbidostat Cihaz 1. Montaj ve Ön test <ol><li> Morbidostat Meclisi <ol><li> 18 G şırınga iğne ile kültür flakon kapağı 3 delikler. ~ Uzunluğunda 7 cm polietilen boru üç parça kesin. kap polietilen boru bu üç parça yerleştirin. </li><li> polidimetilsiloksan (PDMS) karışım için döküm olarak hizmet kapağın kenarını sarmak için bant kullanın. bir kürdan ile elle karıştırma ile bir bileşenin 5 g ve 150 ml&#39;lik plastik bir kap içinde PDMS B bileşeninin 0.5 g karıştırın. 10 ml şırınga içine karışımı yerleştirin. <ol><li> şırınga ile kap PDMS karışımı dökün. 70 ° C&#39;de bir fırında 8 saat PDMS tedavi etmek için, tüm kapak fırında. </li></ol></li><li> Bir havya ile karbon direnci ile 24 ayar tel ve LED katot LED anot lehimleyin. 24 G teli ile bir 680 Ω karbon direnç lehim. Elektrik bandı kullanarak tel bağlantısı izole. </li><li> Yani24 G tel ve 100 kÊ karbon direnci ile photodetector verici ile photodetector kollektör lder. Elektrik bandı kullanarak tel bağlantısı izole. </li><li> kültür flakon tutucu ışık yayan diyot yerleştirin. Ek Şekil 2&#39;de devre şeması takip ederek, LED IR (örneğin, bir cep telefonu kamera) tespit edebilen bir dijital fotoğraf makinesi kullanılarak çalıştığından emin olun 5 V güç kaynağı ile diyot ve güç onu yayan ışık bağlayın. </li><li> Kültür şişe tutucu fotodetektör yerleştirin. Ek Şekil 2&#39;de devre şeması takip ederek, elektronik kontrol yönüyle voltajı ölçmek için foto detektör dirençlerin her iki tarafına kabloyu 5 V güç kaynağı ile fotodetektör ve güç bağlayın. </li><li> Manyetik karıştırıcı birim olarak görev soğutma fanı, şaftı üzerinde bir mıknatıs Tutkal. alignm Notkültür flakon fan ve kültür şişe ve mıknatıs arasındaki boşluk milin ent manyetik karıştırma ünitesinin düzgün fonksiyonu için çok önemlidir. </li><li> Mikro-pompalar, orta şişe ve atık şişe silikon tüp karşılık gelen parça içine kültür flakonun polietilen boru her parça bağlayın. 1 saat pompa açın ve toplam hacim pompa hızını belirlemek için kültür şişesine orta şişeden pompalanan ölçün. Tipik pompalama oranı seyreltme oranı D = 0.33 sa -1 kültür flakon hacmini çalışan bir 12 ml karşılık ~ 4 ml / saat, olması gerektiğini unutmayın. </li><li> Bir orta ölçekli (34 cm x 34 cm x 43.5 cm) çalkalama inkübatör bütün aksamını yerleştirin. </li></ol></li><li> Morbidostat ön test <ol><li> 5 V serin fan set güç kaynağı voltajı manyetik karıştırma çubuğu test etmek onun motoru başlatmak için. karıştırma işlemi görsel olarak kontrol edilebilir unutmayın. sürücü gerilimisoğutma fanı motoru tam darbe genişlik modülasyonu (PWM) tarafından kontrol edilir s. </li><li> Yabani tip E. bir dizi hazırlanması 600 optik yoğunlukları ile coli örnekleri genellikle 0.07 den kalibrasyonu 0.3 arasında değişen nm. Bir testi E. yerleştirin Kültür şişede coli numune ve fotodetektör voltajı kaydedin. <ol><li> Yeri ~ 100 plaka okuyucu aynı numunenin ul ve optik yoğunluk kaydedin. kalibrasyon eğrisini çizmek için optik yoğunluk verilerinin karşı fotodetektör voltajını kullanın. tipik optik yoğunluk bir birim değişikliği burada kullanılan önyargı düzeni ile fotodetektör olarak ~ 7.6 V değişiklik karşılık unutmayın. </li></ol></li></ol></li></ol> 2. Morbidostat Koşu <ol><li> Günlük Deneme Başlamadan Önce Hazırlık <ol><li> girişleri bölümünde olduğu gibi cihaz oluşturmak için iç çapı 1/32 inç ve dış çapı 3/32 inç üç ultra-kimyasala dayanıklı Tygon boru donanımları ile kültür flakon hazırlayın1.1 ve Ek Şekil 1&#39;de. </li><li> M9 minimal ortam (% 0.2 glukoz) ve trimetoprim (TMP) ilaç içeren bir ortam hazırlar. 121 ° C&#39;de bir otoklav içinde orta, orta şişe, ilaç orta şişe, atık şişe ve kültür flakon sterilize edin. Not: TMP, daha sonra Tablo 1 &#39;de konsantrasyonları ve ortam içeren TMP ilaç otoklava değildir elde etmek için kullanılan bir hazır bir çözümdür. </li></ol></li><li> Morbidostat Koşu <ol><li> Deneyin ilk gününde, donmuş vahşi tip 1 ml E. çözülme Oda sıcaklığında ve transfer ihtiva eden kültür şişesine hücreler 120 ul, 5 dakika boyunca coli MG1655 hücreler, M9 büyüme ortamı 12 ml. İlk günden sonra, dondurulmuş E. 1 ml çözülme coli 5 dakika ve transfer içeren yeni bir kültür şişesine hücrelerin 120 ul için önceki gün hücreleri ~ M9 büyüme ortamı 12 ml. </li><li> çalkalayıcı inkübatör açın ve tempe ayarlamak<html> Resim çalkalanarak 30 ° C&#39;ye kadar süreyle. </li><li> mikro-pompa, manyetik bir karıştırma birimi, ve optik yoğunluk ölçümü açarak morbidostat işlemi başlatır. NOT: Çalışma sırasında, bir geri besleme eşik algoritması ilaç enjeksiyonu kontrol etmek için kullanılır. ölçülen optik yoğunluk önceden belirlenmiş bir eşiği aştığında, ilaç enjeksiyon pompası açık olacak ve orta pompa kapalı olacaktır. Aksi takdirde, ilaç enjeksiyon pompası devre dışı kalır ve orta pompa açıktır. </li><li> mikrobiyal büyüme olmadığından emin olmak için zaman zaman gerilim izleyin. Not: Çünkü donma ve çözülme döngüsü, E. coli hücreleri, her gün büyüme sırasında yaklaşık 4 saatlik bir gecikme sergiler. </li><li> ~ 23 saat sonra, onun besleme gerilimini kapatarak mikro pompayı durdurun ve kültür şişesini çıkarmak. Kültür şişeye% 15 gliserol ekleyin ve depolama için -80 ° C&#39;de örnek dondurma. </li><li> Tekrarlayın 2.2.5 2.2.1 adımları. </li></ol></li></ol>le &quot;&gt; 3. Antibiyotik Duyarlılık Ölçümü 96 Kuyu Formatında NOT: antibiyotik direnci seviyesini belirlemek için 96 kuyu biçiminde bir plaka okuyucu büyüme hızı ölçümü yapın. <ol><li> 5 dakika boyunca oda sıcaklığında, her gün, dondurulmuş numune çözülme ve • 15 mi M9 ortam ihtiva eden kültür şişesine hücre 15 ul transfer. Onları ~ 0.1 ulaştığı 600 nm&#39;de optik yoğunluk kadar büyümeye izin verin. 1 ml&#39;lik şişeler içine 15 ml ayırın ve Tablo 1 &#39;de gösterildiği gibi, istenen ilaç konsantrasyonları elde etmek için bu adımda TMP ilaç ekleyin. </li><li> Plaka okuyucu içinde her kuyuya adım 3.1 ve yerden numune 200 ul almak ve onları 12 saat 5 için büyümeye olanak sağlar. Dalga boyu 600 nm olduğunda optik yoğunluk ölçümü sırasında otomatik olarak kaydedilir. NOT: Her bir veri noktası için, üçlü ölçümler kaydedilir ve veri tutarlılığı sağlamak için ortalaması alınır. zamana karşı optik yoğunluk veri olabilir be büyüme oranı elde etmek için kullanılır. </li><li> IC 50 elde etmek için ilaç konsantrasyonuna karşı büyüme oranı verilerini çizilir. IC50 büyüme maksimal büyüme oranı 5 yüzde elli olan ilaç konsantrasyonu olarak tanımlanır unutmayın. </li></ol> Mikroakışkan Cihazlar 4. Tek Hücre Morfolojisi ve Antibiyotik Duyarlılık Ölçme <ol><li> Başka yerde 15 açıklandığı gibi PDMS katmanlı yumuşak litografi yoluyla mikroakışkan cihazların imalatı gerçekleştirin. <ol><li> Kontrol ve akış tabakaları için fotorezist kalıp yapmak fotolitografi kullanın. Kontrol katmanı için, bir çıplak silikon bir kalıp üretmek için negatif ışığa (~ 15 mikron yükseklik) ve pozitif ışığa (~ 8 mm yükseklik) kullandığını unutmayın. </li><li> sırasıyla, kontrol tabakası ve akış tabakası, 1: 1 ve 20: 5 çapraz bağlantı oranları PDMS karışımları hazırlayın. kabarcıkları uzaklaştırmak için vakum altında bir desikatör içinde karışımlarını koyun1 saat için. </li><li> (TMSC) buhar trimetilklorosilan silikon gofret kontrol katmanı fotorezist kalıpları Açığa. PDMS karışımı döküm ~ 6 mm kalınlığındaki kontrol katman olun (çapraz bağlama oranı 5: 1) denetim katmanı fotorezist kalıp üzerine silikon gofret. Fırında, 1 saat boyunca 80 ° C&#39;de 40 dakika boyunca kontrol katmanı fırında. </li><li> (: 1, sıkma devir 60 saniye boyunca 3.000 rpm çapraz bağlama oranı 20 ile) bir akış tabakası fotorezist kalıpta bir PDMS karışımı kaplama Spin akış katman olun. Fırında, 1 saat boyunca 80 ° C&#39;de 30 dakika boyunca akış tabakası fırında. </li><li> İstenilen yonga boyutu kontrol tabakası (genellikle 3 cm x 2 cm) kesilir ve elle kontrol tabakası kalkmasına bir jilet kullanın. Akış tabakasının üstüne denetim katmanı yerleştirin ve bir stereomikroskop altında bunları hizalayın. Fırın gece boyunca 80 ° C &#39;de hizalanmış montaj Cure. Daha sonra, bakiye TMCS çözmek için 5 saat için plastik bir kap içinde deiyonize su, 250 ml montaj emmek. </li><li> Daha sonra, 20 G iğne ile giriş delikler ve (PDMS çapraz Oranı 5 bağlama: sıkma devir 2.000 rpm sn 30, 1) boş bir PDMS tabaka ile kaplı bir cam slayt için tüm elastomer bağ 40 sn için hava plazma muamelesi ile 1.2 Torr hava basıncı. </li><li> PDMS gelen sitotoksik etkilerini azaltmak için 80 ° C&#39;de 36 saat boyunca yoğun pişirme yürütmek. Bu pişirme adımı bakteriyel hücrelere toksisite en aza indirmek için kritik olduğunu not edin. </li></ol></li><li> Chip Büyüme Deney üzerinde <ol><li> mikroakışkan cihazın içine yerleştirmeden önce, 1 saat süre ile, 1 saat, M9 ortam için deiyonize su ile yıkayın. </li><li> 5 dakika boyunca oda sıcaklığında, her gün, dondurulmuş numune çözülme ve taze M9 ortam ile yeni bir test tüpü inoküle. gece boyunca 37 ° C&#39;de çalkalamalı bir inkübatör içinde örnek yerleştirin. </li><li> M9 orta mikrobiyal örnek 10 kat sulandırmak ve 5 psi mikrobiyal örnek kabı baskı ile mikroakışkan cihazın içine yükleyin. Daha sonra, TMP ilaç yükü5 psi ilaç ortamı kap baskı çip halinde araç. 15 dakika mikroakışkan yonga üzerinde iki oda arasında Mikromekanik valfi harekete geçirerek mikrop ve ilaç arasındaki karıştırma yürütün. </li><li> ters mikroskop üzerine monte mikroskop inkübatör mikroakışkan çip yerleştirin. CCD kamera ile 8 saat boyunca saat ters mikroskop üzerine monte edilmiş bir büyüme odasında hücre görüntü elde. </li><li> Hücre görüntü verileri 18 bir eşik algoritma ile hücre sayıları hesaplamak için özel program komut dosyasını kullanın. hücre sayısı verileri genellikle üzerinde üç mikroakışkan odaları ortalama unutmayın. </li></ol></li></ol>

<ol>
	<li>Levy, S. B., Marshall, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibiotic+resistance+worldwide:+causes,+challenges,+and+responses.">Antibiotic resistance worldwide: causes, challenges, and responses.</a> Nat. Med. 10, s122-s129 (2004).</li><li>Wang, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracking+the+in+vivo+evolution+of+multidrug+resistance+in+Staphylococus+aureus+by+whole+genome+sequencing.">Tracking the in vivo evolution of multidrug resistance in Staphylococus aureus by whole genome sequencing.</a> Pro. Natl. Acad. Sci. 104, 9451 (2007).</li><li>Dragosits, M., Mattanovich, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adaptive+laboratory+evolution+-+principles+and+applications+for+biotechnology.">Adaptive laboratory evolution - principles and applications for biotechnology.</a> Microbial Cell Factory. 12, 64 (2013).</li><li>Zhang, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acceleration+of+emergence+of+bacterial+antibiotic+resistance+in+connected+microenvironment.">Acceleration of emergence of bacterial antibiotic resistance in connected microenvironment.</a> Science. 333, 1764-1767 (2011).</li><li>Toprak, E., Veres, A., Michel, J. B., Chait, R., Hartl, D. L., Kishony, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+paths+to+antibiotic+resistance+under+dynamically+sustained+drug+selection.">Evolutionary paths to antibiotic resistance under dynamically sustained drug selection.</a> Nature Genetics. 44, 101-106 (2012).</li><li>Toprak, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Building+a+morbidostast:+an+automated+continuous+culture+device+for+studying+bacterial+drug+resistance+under+dynamically+sustained+drug+inhibition.">Building a morbidostast: an automated continuous culture device for studying bacterial drug resistance under dynamically sustained drug inhibition.</a> Nature Protocol. 8, 555-567 (2013).</li><li>Rosenthal, A. Z., Elowitz, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Following+evolution+of+bacterial+antibiotic+resistance+in+real+time.">Following evolution of bacterial antibiotic resistance in real time.</a> Nature Genetics. 44, 11-13 (2012).</li><li>Young, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+antibacterial+resistance+selection+and+quantitation.">In vitro antibacterial resistance selection and quantitation.</a> Curr Protoc Pharmacol. , (2006).</li><li>Novick, A., Szilard, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experiments+with+the+Chemostat+on+spontaneous+mutations+of+bacteria.">Experiments with the Chemostat on spontaneous mutations of bacteria.</a> Proc. Natl. Acad. Sci. U.S.A. 36, 708-719 (1950).</li><li>Balagadde, F. K., You, L., Hansen, C. L., Arnold, F. H., Quake, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+monitoring+of+bacteria+undergoing+programmed+population+control+in+a+microchemostat.">Long-term monitoring of bacteria undergoing programmed population control in a microchemostat.</a> Science. 309, 137-140 (2005).</li><li>Groisman, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microfluidic+chemostat+for+experiments+with+bacterial+and+yeast+cells.">A microfluidic chemostat for experiments with bacterial and yeast cells.</a> Nat. Methods. 2, 685-689 (2005).</li><li>Miller, A. W., Befort, C., Kerr, E. O., Dunham, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+Use+of+Multiplexed+Chemostat+Arrays.">Design and Use of Multiplexed Chemostat Arrays.</a> J. Vis. Exp. (72), e50262 (2013).</li><li>Takahashi, C. N., Miller, A. W., Ekness, F., Dunham, M. J., Klavins, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+low+cost,+customizable+turbidostat+for+use+in+synthetic+circuit+characterization.">A low cost, customizable turbidostat for use in synthetic circuit characterization.</a> ACS Synthetic Biology. , (2015).</li><li>Mohan, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+multiplexed+microfluidic+platform+for+rapid+antibiotic+susceptibility+testing.">A multiplexed microfluidic platform for rapid antibiotic susceptibility testing.</a> Biosens Bioelectrons. 49, 118-125 (2013).</li><li>Unger, M. A., Chou, H. P., Thorsen, T., Scherer, A., Quake, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monolithic+microfabricated+valves+and+pumps+by+multilayer+soft+lithography.">Monolithic microfabricated valves and pumps by multilayer soft lithography.</a> Science. 288, 113-116 (2000).</li><li>Kellogg, R. A., Gomez-Sjoberg, R., Leyrat, A. A., Tay, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Nat. Protocols. 9, 1713 (2014).</li><li>Gu, G. Y., Lee, Y. W., Chiang, C. C., Yang, Y. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nanoliter+microfluidic+serial+dilution+bioreactor.">A nanoliter microfluidic serial dilution bioreactor.</a> Biomicrofluidics. 9, 044126 (2015).</li><li>Gonzalez, R. C., Woods, R. E., Eddins, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Digital image using Matlab processing. , (2004).</li><li>Heikkila, E., Sundstrom, L., Huovinen, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trimethoprim+resistance+in+Escherichia+coli+isolates+from+a+geriatric+unit.">Trimethoprim resistance in Escherichia coli isolates from a geriatric unit.</a> Antimicrob. Agents Chemother. 34, 2013-2015 (1990).</li><li>Flensburg, J., Skold, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massive+overproduction+of+dihydrofolate+reductase+in+bacteria+as+a+response+to+the+use+of+trimethoprim.">Massive overproduction of dihydrofolate reductase in bacteria as a response to the use of trimethoprim.</a> Eur. J. Biochem. 162, 473-476 (1987).</li><li>Ohmae, E., Sasaki, Y., Gekko, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+five-tryptophan+mutations+on+structure,+stability+and+function+of+Escherichia+coli+dihydrofolate+reductase.">Effects of five-tryptophan mutations on structure, stability and function of Escherichia coli dihydrofolate reductase.</a> J. Biochem. 130, 439-447 (2001).</li><li>Smith, D. R., Calvo, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleotide+sequence+of+dihydrofolate+reductase+genes+from+trimethoprim-resistant+mutants+of+Escherichia+coli.+Evidence+that+dihydrofolate+reductase+interacts+with+another+essential+gene+product.">Nucleotide sequence of dihydrofolate reductase genes from trimethoprim-resistant mutants of Escherichia coli. Evidence that dihydrofolate reductase interacts with another essential gene product.</a> Mol. Gen. Genet. 187, 72-78 (1982).</li><li>Okumus, B., Yildiz, S., Toprak, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluidic+and+microfluidic+tools+for+quantitative+systems+biology.">Fluidic and microfluidic tools for quantitative systems biology.</a> Curr Opin Biotech. 25, 30-38 (2014).</li><li>Cho, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+antimicrobial+susceptibility+test+based+on+single-cell+morphological+analysis.">A rapid antimicrobial susceptibility test based on single-cell morphological analysis.</a> Sci. Transl. Med. 17, 267 (2014).</li><li>Hsu, S. B., Waltman, P. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+a+model+of+two+competitors+in+a+chemostat+with+an+external+inhibitor.">Analysis of a model of two competitors in a chemostat with an external inhibitor.</a> SIAM J. Applied Math. , 528-540 (1992).</li><li>Fu, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maximizing+biomass+productivity+and+cell+density+of+Chlorella+vulgaris+by+using+light-emitting+diode-based+photobioreactor.">Maximizing biomass productivity and cell density of Chlorella vulgaris by using light-emitting diode-based photobioreactor.</a> J. Biotech. 161, 242-249 (2012).</li><li>Peabody, V. G. L., Winkler, J., Kao, K. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tools+for+developing+tolerance+to+toxic+chemicals+in+microbial+systems+and+perspectives+on+moving+the+field+forward+and+into+the+industrial+setting.">Tools for developing tolerance to toxic chemicals in microbial systems and perspectives on moving the field forward and into the industrial setting.</a> Curr Opin in Chem Eng. 6, 9-17 (2014).</li></ol>

The authors have nothing to disclose.

düşük maliyetli bileşenleri Düşük ayak izi morbidostat cihaz gösterilmiştir. Cihaz tarafından kayıtlı ilaç direnç seviyesi artar önceki raporlarda 5 ile tutarlıdır. ilaç direnci evrimsel çalışmalar için tasarlanan cihaz, diğer birçok deneylere potansiyel uygulanabilir. İlk olarak, ilaç kaynaklı mutasyon Ayrıntılı bir klinik açıdan önemli antibiyotik büyük bir set için kurulabilir. Örneğin, çoklu ilaç direncinin evrimsel yolun sadece deneyde kullanılan ilaç sayısını artırarak ele alınabilir. Burada bildirilen modülün ana avantajı, farklı deneysel koşullar altında büyük ölçekli, paralel deneyler sağlayan, esnek yapılandırılabilirlik olduğunu. Kavramı Mikroakiskan ölçümleri içinde ortaya konmuşsa da, araştırmacı güç akışkan tekniği 23, mikroflüidik birleştirilmesiyle geliştirilebilir. başına maliyetÖlçüm (ölçek ekonomisi) dramatik düşürdü reaktif tüketimi ve azaltılmış emek azalır. Burada, tek bir hücre morfolojisi verileri mikroakışkan platformu elde edilebilir. Son zamanlarda, tek hücre mikroakışkan morfoloji testi başarıyla klinik mikrobiyoloji laboratuvarlarında uygulamaya konmuştur ve standart suyu seri seyreltme testleri 24 nispeten gerçekleştirir. mikroakışkan cihazların artan durumu ile kombine teknolojiler büyük ölçekli, yüksek hacimli laboratuvar evrim deneyleri sağlayacaktır. Birkaç adım morbidostat çalıştırmak için kritik öneme sahiptir. Manyetik bir karıştırma birimi mıknatıs ve bir soğutma fanı oluşturulmaktadır için İlk olarak, kültür şişesine fan şaftı hizalamak için çok önemlidir. Ayrıca, kültür şişesine ve mıknatıs arasındaki mesafe bir kararlı çalışmasını sağlamak için çok önemlidir. İkincisi, her günün deney başında yeni bir kültür şişesine geçiş de önemlidirbiyofilm oluşumunu önlemek. Aksi takdirde, biyofilm oluşumu 2 ya da 3 gün içinde ortaya çıkabilir. Üçüncü olarak, çünkü, E. E. coli örnekleri tutarlılığını sağlamak için her gün deney sırasında donmuş bir örnekten günlük çözülmüş, mikropların dışarı toplam yıkama önlemek için en az 4 saatlik bir gecikme süresini ayarlamak için önemlidir. Alternatif olarak, bir E. dondurmak için seçebilirsiniz doğrudan E. coli örnekleri ve yeni bir kültür başlatmak için yeni bir kültür flakon aşılamak için örnek kullanın. pratik bir ortamda, mevcut sistem tasarımı potansiyel kullanımlarını genişletmek için çeşitli sınırlamalar aşmak gerekir. Tüm sistemin hacmi şu anda günde tüketilen orta ile sınırlıdır (chemostatic işlem sırasında, bir kültür flakon 0.33 saat -1 tipik seyreltme hızında günde ortamın yaklaşık 0,5 L tüketir). çalışma hacmini azaltmak için, daha fazla optimizasyon Plumbi ile ilaç inhibe nüfus dinamikleri dikkatli simülasyon ile elde edilebilirng 25 parametreleri. Son olarak, morbidostat bakteri kültürü deneyleri geniş için de uyarlanabilir. Örneğin, bir ışık yayan diyot takarak, sistem siyanobakteri ya da mikro alglerin 26 evrimsel izleme sağlayan bir foto-biyoreaktör olarak yeniden olabilir. Modül kablosuz bir pil paketi cihazı çalıştırarak adsorbentle gaz geçirmez bir kapta anaerobik ve mikroaerobik ekimi uzatılabilir. Başka bir örnek olarak, bir toksin konsantrasyonu giderek hedef kimyasal 27 dirençli suşlar mühendislikten geçirilmesi için arttırılabilir.

İlk antibiyotik ilaç penisilin tanıtılmasından bu yana, mikrobiyal antibiyotik direnci küresel bir sağlık sorunu 1 dönüşmüştür. Antibiyotik direnci elde edilmesi geriye in vivo olarak incelenebilir karşın, bu deneylerin koşulları genellikle bütün evrim 2 boyunca kontrol edilmez. Alternatif olarak, adaptif laboratuvar evrim bir antibiyotik ilaç 3&#39;ten çevresel streslere veya seçim baskısı altında bir mikrobiyal türlerin moleküler evrim ortaya çıkarabilir. Son zamanlarda, antibiyotik ilaç direncinin çok iyi kontrol evrimsel deneyler antibiyotik ilaç direnci ortaya çıkmasını aydınlatmıştır. Örneğin, Austin&#39;in grup düzgün tasarlanmış mikroakışkan bölmeli bir ortamda 4 hızlı çıkmasını gösterdi. Son zamanlarda geliştirilen morbidostat ilaç seçim baskısı 5,6 altında sistematik mutasyonlar neden olur. morbidostat, mikrobiyal SendaiSürekli neredeyse sabit nüfusu korumak için antibiyotik konsantrasyonunu ayarlar yon cihazı, mikrobiyoloji 7,8 kullanılan dalgalanma testi önemli bir ilerlemedir. dalgalanma testinde, bir antibiyotik ilaç yüksek bir konsantrasyonda enjekte edilir ve kalan mutantlar elenir ve sayılır. Bunun yerine, bir morbidostat içinde mikropların sürekli meydan ve çoklu mutasyonları elde edilir. Morbidostat kemostat, mikrobiyal nüfusu 9 sulandırarak sırasında sürekli olarak besinleri sağlayarak sabit bir nüfus tutar 1950 yılında Novick&#39;le ve Szliard tarafından icat bir kültür cihazına benzer çalışır. piyasaya sunulmasından bu yana, kemostat gelişmiş ve geliştirilmiştir. Güncel mikroakışkan chemostats nanoliter ve tek hücreli kapasiteleri ulaşmıştır. Bununla birlikte, bu cihazlar, bir çok mutasyon olayları 10,11 ile büyük hücre popülasyonunu gerektiren adaptif evrimi deneyler için uygun değildir. Son zamanlarda, mini~ 10 ml çalışma hacmine sahip chemostats da litre ölçek Biyoreaktörlerde ve mikroakışkan kemostat 12,13 arasındaki boşluğu doldurmak için geliştirilmiştir. Burada bir antibiyotik ilaç direnci çalışma için tasarım ve düşük maliyet, otomatikleştirilmiş morbidostat sunuyoruz. Önerilen modül minimum donanım gereksinimi ile bir mikrobiyoloji laboratuvarında bir çalkalama inkübatör kullanılabilir. Açık kaynak yazılım aynı zamanda kolayca metabolik mühendislik 3 olarak adaptif evrim özel uygulamalar, için özel olarak tasarlanmıştır. Son olarak, morbidostat antibiyotik duyarlılık testi 14 için multiplekslenmiş mikroakışkan platforma entegre edilmiştir.

<table border="0" cellpadding="0" cellspacing="0" width="797">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Environmental Shaker Incubator</td>
			<td style="width:135px;">BioSan</td>
			<td style="width:163px;">ES-20</td>
			<td style="width:227px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Arduino Leonardo board</td>
			<td style="width:135px;">Arduino</td>
			<td style="width:163px;">Leonardo</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">680 Ohm Carbon Resistor</td>
			<td style="width:135px;">Digikey</td>
			<td style="width:163px;"></td>
			<td>Bias resistor for LED</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">100k Ohm Carbon resistor</td>
			<td style="width:135px;">Digikey</td>
			<td style="width:163px;"></td>
			<td>Bias resistor for phototransistor</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">940 nm light emitting diode</td>
			<td style="width:135px;">Bright LED Electronic</td>
			<td style="width:163px;">BIR-BM13E4G-2</td>
			<td>Optical density measurement</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">940 nm phototransistor</td>
			<td style="width:135px;">Kodenshi&#160;</td>
			<td style="width:163px;">ST-2L2B</td>
			<td>Optical density measurement</td>
		</tr>
		<tr height="57">
			<td height="57" style="height:57px;">Darlington pair IC Toshiba</td>
			<td style="width:135px;">Mouser</td>
			<td style="width:163px;">ULN2803APG</td>
			<td style="width:227px;">&#160;this IC drives micropumps and magnetic stirring unit</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:275px;">5V DC brushless fan&#160;</td>
			<td style="width:135px;">ADDA</td>
			<td style="width:163px;">AD0405LX-G70</td>
			<td style="width:227px;">spec: 5V supply voltage and 80mA available www.jameco.com</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Piezoelectric micropump</td>
			<td style="width:135px;">CurieJet</td>
			<td style="width:163px;">PS15I-FT-5L</td>
			<td>Pressure &#62;3kPa&#160; Flow rate &#62;5 ml/min</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Tygon 3350 Tuning</td>
			<td style="width:135px;">Saint Gobain</td>
			<td style="width:163px;">ABW00001</td>
			<td>ID: 1/32&#34; OD: 3/32&#34; L:50&#39;&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Magnetic Stir bar</td>
			<td style="width:135px;">COWIE</td>
			<td style="width:163px;"></td>
			<td>tapered shape dim: 10 mm x 4mm</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Glass scintillation 20ml vial</td>
			<td style="width:135px;">DGS</td>
			<td style="width:163px;"></td>
			<td>Pyrex glass 28mm(dia.)x 61 mm(h)</td>
		</tr>
		<tr height="48">
			<td height="48" style="height:48px;width:275px;">Culture vial holder</td>
			<td style="width:135px;"></td>
			<td style="width:163px;"></td>
			<td>Custom made from Polyformaldehyde&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Silicone&#160;</td>
			<td style="width:135px;">Dow Corning</td>
			<td style="width:163px;">Sylgald 184</td>
			<td>used to seal the glass vial</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Medium bottle</td>
			<td style="width:135px;">VWR</td>
			<td style="width:163px;">66022-065</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Difco M9 minimal salt 5x</td>
			<td style="width:135px;">BD</td>
			<td style="width:163px;"></td>
			<td>Medium</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Cadamino Acid</td>
			<td style="width:135px;">BD</td>
			<td style="width:163px;"></td>
			<td>Medium</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">glucose</td>
			<td style="width:135px;">Sigma</td>
			<td style="width:163px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Agar Bateriological</td>
			<td style="width:135px;">Oxoid</td>
			<td style="width:163px;"></td>
			<td>for agar plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Luria Bertani medium</td>
			<td style="width:135px;"></td>
			<td style="width:163px;"></td>
			<td></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:275px;">Inverted microscope</td>
			<td style="width:135px;">Leica Microsystems</td>
			<td style="width:163px;">Leica DMI-LED</td>
			<td style="width:227px;">used for microfluidic measurement Use X40 objective NA=0.55</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Microscope Incubator</td>
			<td style="width:135px;">Live Cell Instrument</td>
			<td style="width:163px;">CU-109</td>
			<td>used for microfluidic measurement</td>
		</tr>
		<tr height="49">
			<td height="49" style="height:49px;width:275px;">Solenoidal valves</td>
			<td style="width:135px;">Pneumadyne</td>
			<td style="width:163px;">S10MM-31-12-3</td>
			<td>Normally open 1.3 Watt 12 Vdc</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">USB interface card</td>
			<td style="width:135px;">Hobby Engineering</td>
			<td>USBIO24-R Digital I/O Module&#160;</td>
			<td>for microfluidics measurement</td>
		</tr>
		<tr height="45">
			<td height="45" style="height:45px;width:275px;">Air compressor</td>
			<td style="width:135px;">Rocker Scientific</td>
			<td style="width:163px;">ROCKER 440</td>
			<td style="width:227px;">Pressure source for microfluidcs Max. Pressure 80 Psi</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Male luer-lock fittings to 1/8&#34; barb</td>
			<td>ValuePlastics.com</td>
			<td style="width:163px;">MTLL230-1</td>
			<td>used for microfluidic control</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1/8&#34; barb to 10-32 threaded port</td>
			<td>ValuePlastics.com</td>
			<td style="width:163px;">B-1</td>
			<td>used for microfluidic control</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Female luer-lock fittings to 10-32 threaded port</td>
			<td>ValuePlastics.com</td>
			<td style="width:163px;">KFTL-1</td>
			<td>used for microfluidic control</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NPN darlington transistor 500mA, 40V (2N6427)</td>
			<td>DigiKey.com</td>
			<td>2N6427GOS-ND</td>
			<td>used for microfluidic control</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">10kOhm, carbon film resistor, 0.25W</td>
			<td>DigiKey.com</td>
			<td>P10KBACT-ND</td>
			<td>used for microfluidic control</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tantalum capacitor, 10uF, 25V, 10%</td>
			<td>DigiKey.com</td>
			<td>478-1841-ND</td>
			<td>used for microfluidic control</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Andor CCD camera</td>
			<td style="width:135px;">Andor</td>
			<td style="width:163px;">Zyla 4.2 Plus SCMOS</td>
			<td>used for microfluidic on chip imaging</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">ELISA plate reader</td>
			<td style="width:135px;"></td>
			<td style="width:163px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">two component Silicone&#160;</td>
			<td style="width:135px;">Momentive</td>
			<td style="width:163px;">RTV 615</td>
			<td>used for microfluidic chip fabrication</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">SU-8 photoresist</td>
			<td style="width:135px;">Micrchem</td>
			<td style="width:163px;">SU8 2015</td>
			<td>used for microfluidic chip fabrication</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">AZ4620 photoresist</td>
			<td style="width:135px;">Clariant</td>
			<td style="width:163px;">AZ 4620</td>
			<td>used for microfluidic chip fabrication</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Plasma cleaner</td>
			<td style="width:135px;">Harrick Plasma</td>
			<td style="width:163px;">PDC 32G</td>
			<td>used for microfluidic chip fabrication</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">20 Gauge Syringe Needle</td>
			<td style="width:135px;">BD</td>
			<td style="width:163px;"></td>
			<td>used for microfluidic chip fabrication</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Labcycler</td>
			<td style="width:135px;">Sensoquest</td>
			<td style="width:163px;">Labcycler</td>
			<td>PCR&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">DNA polymerase</td>
			<td style="width:135px;">Toyobo</td>
			<td style="width:163px;">KDO Plus</td>
			<td>PCR amplification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Trimethoprim</td>
			<td style="width:135px;">Sigma</td>
			<td style="width:163px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Plate reader</td>
			<td style="width:135px;">Biotek</td>
			<td style="width:163px;">Synergy H1 hybrid&#160;</td>
			<td>antibiotic resistane measurement</td>
		</tr>
	</tbody>
</table>

design and use of a low cost, automated morbidostat for adaptive evolution of bacteria under antibiotic drug selection

Biz antibiyotik direnci evrimsel yolu tanımlamak için düşük maliyetli, yapılandırılabilir morbidostat açıklar. morbidostat sürekli bakteri gelişimini izler ve dinamik onlar ilaç direnci elde etmek için geliştikçe sürekli bakteri meydan okumak için ilaç konsantrasyonunu ayarlayan bakteriyel kültür cihazdır. Cihaz ~ 10 ml çalışma hacmi bulunmaktadır ve tam otomatik ve optik yoğunluk ölçümü ve orta ve ilaç dağıtımı için mikro pompalar ile donatılmıştır. Platformu doğrulamak için, biz 1655 Escherichia coli MG trimetoprim direncinin aşamalı satın ölçüldü ve hücre morfolojisi ve antibiyotik duyarlılıklarının araştırmak için multiplekslenmiş mikroakışkan platformu cihazı entegre edilmiştir. yaklaşım antibiyotik ilaç direncinin laboratuvar çalışmalarına ölçekli yukarı ve metabolik mühendislik ve diğer bakteri kültürü deneylerinde gerilme geliştirmeleri için evrimi adaptif uzatılabilir olabilir.

Yukarıda açıklanan morbidostat Şekil 1&#39;de şematize edilmiştir. Deneysel evrim, antibiyotik duyarlılık testi ve hücre morfolojisi kontrolü dahil olmak üzere ortak morbidostat işlemleri, bir E. valide edildi (TMP) trimetoprimin maruz coli MG1655 kültürü, yaygın olarak kullanılan bir antibiyotik ilaç 5,6. TMP ilaç direnci çok belirgin adım adım artar uyarır ve mutasyonlar dihidrofolat redüktaz (DHFR) geni etrafında kümelenir. Bu nedenle, TMP morbidostat işlemi doğrulamak için son derece etkili bir standart bir ilaçtır. Her gün, mikrop önceden ayarlanmış optik yoğunluk eşiğinin üzerinde büyür ve Şekil 2a&#39;da gösterildiği gibi, ilaç enjeksiyonu tetiklemek için beklenir. İlaç enjeksiyon büyümesini inhibe etmesi beklenmektedir ve bunun sonucunda, optik yoğunluk azalmasıdır. Birkaç deneme çalışması uygun ilaç konsantrasyonunu tespit etmek gerekli olabilir. Genel bir kural olarak, increase göre ilaç ortamının konsantrasyonu ilaç orta büyümesini bastırmak için başarısız olduğunu bulduktan sonra 5 kat. Tüm deney süresi ardından günlük olarak Donmuş numuneler eritildi ve IC50 ilaç direnç seviyesi bir nicel ölçü tespit etmek için kullanılır. Şekil 2b arsa antibiyotik ilaç direnci temporal artış göstermektedir. Ilaç direnci 1500 kat yaklaşık artmış ~ 1,000 mg / ml üzerinde ~ 12 laboratuvar evrim 5 önceki bulgularla uyumlu gün ve klinik 19 ayırır. Son günlük mutant DHFR nokta mutasyonları Sanger dizileme ile ölçüldü ve Tablo 2&#39;de sıralanmıştır. Bir mutasyon promotör bölgesinin üzerinde yer alan ve hızlandırıcı bölgede bir nokta mutasyonu, önemli ölçüde DHFR ekspresyonu düzeyini değiştirebilir gösterir bulunmuş enzim 20. Konuma 49910 Başka mutasyon DHFR gen bölgesinde bulunan ve hareket yakındırDHFR ive sitesi 21 enzim. agar plaka içeren uyuşturucu seçim sadece tek mutasyon görüşmek eğilimi gibi çoklu mutasyonları ile ilaç direnci elde edilmesi, morbidostat yararlılığını kanıtlıyor. Hücre morfolojisi, daha hassas bir okuma olarak, antibiyotik duyarlılık ile tek hücre morfolojisi giriş paralel içinde gerçekleştirilmektedir, birden fazla mesaj göndermiş mikroakışkan platformu 14. Şekil 3, birden fazla mesaj göndermiş mikroakışkan çip tasarımını göstermektedir. Bakteriyel hücrelerin Mikrograflan (Şekil 5) TMP inhibisyondan konsantrasyonlarında morfolojisi hem vahşi tip değişiklikler ve mutant suşları ortaya koymaktadır. mutant suş önemli Filamentasyon gösterirken Yabani tip suşları önemli Filamentasyon göstermektedir. Bir tek hücre düzeyinde Bu morfoloji değişikliği antibiyotik direnci hızlı tanı kullanılabilir. 4 görüntüler on-chi ŞekilTMP çeşitli konsantrasyonlarda s büyüme eğrileri. Mutant örnekleri antibiyotik ilaç direnci önemli bir artış göstermektedir. Şekil 4&#39;te çip üzerinde büyüme verileri aynı zamanda Şekil 2B&#39;de gösterilen plaka okuyucusundan IC50 değeri ile tutarlıdır. <img alt="Şekil 1" src="/files/ftp_upload/54426/54426fig1.jpg" /> Şekil 1:. Morbidostat şematik morbidostat mikrobik popülasyonun optik yoğunluğunu ölçer, ve buna bağlı olarak ilaç konsantrasyonunu ayarlar sürekli bir kültür cihazdır. Cihaz ilaç enjeksiyon modu ve ilaç seyreltme modunda çalışır. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/54426fig1large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="şekil 2" src="/files/ftp_upload/54426/54426fig2.jpg"/&gt; Şekil 2: Büyüme eğrisi ve antibiyotik ilaç direnç seviyesinin artması geribildirim altında (a) Temsilcisi büyüme eğrisi.. mikrobiyal büyüme olan enjeksiyon bir eşik algoritması tarafından tetiklenir antibiyotik ilaç tarafından inhibe edilir. Pozitif büyüme hızı önceden ayarlanmış eşiğin üstünde optik yoğunluk (OD TH = 0.086) ortaya çıkardığında, ilaç enjeksiyon moduna cihaz geçer. Aksi takdirde cihaz ilaç seyreltme modunda çalışır. Kırmızı ve mor oklar sırasıyla ilaç enjeksiyonu ve ilaç seyreltme modları içine geçiş göstermektedir. (B) trimetoprimin maruz kalma 12 gün boyunca hücrelerin Direnç seviyesi. IC 50 antibiyotik ilaç direnci ayrı bir kademeli artış göstermektedir. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/54426fig2large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img al<html> t = &quot;Şekil 3&quot; src = &quot;/ files / ftp_upload / 54426 / 54426fig3.jpg&quot; /&gt; Şekil 3: hücre morfolojisi ve on-chip antibiyotik duyarlılıklarının araştırılması için mikroakışkan cihazlar çip düzeni (a) Mikrografik.. Yeşil ve mavi bölmeleri sırasıyla büyüme ve ilaç ortamı odaları vardır ve kırmızı düzen kontrolü katmanı gösterir. Büyüme odasının boyutları 450 mikron (l) 400 mikron (w) 8 mikron (h) x x vardır. Büyüme odası bakteriler ile yüklenir, ve ilaç bölmesi TMP ile yüklenir. Ölçek çubuğu 1 cm dir. (B) Aynı çip görünümünü Büyütülmüş. Ölçek çubuğu = 500 mikron. (C) önce her iki odaların görünümü Büyütülmüş ve karıştırıldıktan sonra. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/54426fig3large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> &quot;Src =&quot; / files / ftp_upload / 54426 / 54426fig4.jpg &quot;/&gt; Şekil 4: E. yonga üstü büyüme eğrileri (a) vahşi-tür atalarının şekil değiştirme ve (12. günde), (b) mutant suş: E. coli TMP çeşitli konsantrasyonlarına maruz bırakılmıştır. Mutant örnek antibiyotik ilaç direnci önemli bir artış göstermektedir. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/54426fig4large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 5," src="/files/ftp_upload/54426/54426fig5.jpg" /> Şekil 5: Tek hücreli morfolojileri (a - d) TMP alt inhibitör seviyeleri ile tedaviden sonra hücrenin Aydınlık alan görüntüler. (D mutantlarda mevcut değildir yabani tip hücrelerin önemli ipliklerin (b) Not </strong&gt;). Paneller (e - h) (- d a) dijitalize görüntüler. Tüm bakteriyel görüntüler 40X büyütme amacı ile bir CCD kamera ile çekildi. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/54426fig5large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> Ek Şekil 1:. Boyutları ve kültür flakon tutucu montaj <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/Supplemental_Figure_1.pdf" target="_blank">bu dosyayı indirmek için buraya tıklayınız.</a> Ek Şekil 2:. LED ve photodetector için devre şeması <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/Supplementary_Figure_2.PNG" target="_blank">bu dosyayı indirmek için buraya tıklayınız.</a> Yardımcı Kod:. mikroakışkan cips elde hücre görüntüleri hücre sayısını saymak için Özel komut <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/renamed_40eb7.pdf" target="_blank">bu dosyayı indirmek için buraya tıklayınız.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td colspan="2"> Örnek </td><td colspan="11"> TMP ilaç (ug / ml) </td></tr><tr><td colspan="2"> gün 1-3 </td><td> 0 </td><td> 0.06 </td><td> 0.12 </td><td> 0.25 </td><td> 0.5 </td><td> 1 </td><td> 2 </td><td> 4 </td><td> 8 </td><td> 16 </td><td> 32 </td></tr><tr><td colspan="2"> 4. gün </td><td> 0 </td><td> 1 </td><td> 2 </td><td> 3 </td><td> 5 </td><td> 10 </td><td> 20 </td><td> 40 </td><td> 80 </td><td> 160 </td><td> 320 </td></tr><tr><td colspan="2"> gün 5-7 </td><td> 0 </td><td> 2 </td><td> 4 </td><td> 8 </td> &lt;td&gt; 15 </td><td> 30 </td><td> 60 </td><td> 120 </td><td> 240 </td><td> 480 </td><td> 960 </td></tr><tr><td colspan="2"> gün 8-12 </td><td> 0 </td><td> 3 </td><td> 7 </td><td> 15 </td><td> 30 </td><td> 60 </td><td> 125 </td><td> 250 </td><td> 500 </td><td> 1000 </td><td> 2.000 </td></tr></tbody></table> Tablo 1:. Ug / ml biriminde plaka okuyucu ölçümü ilaç konsantrasyonları IC50 belirlemek için kullanılan ilaç konsantrasyonu gün dondurulmuş numune için gösterildi. Hücreler daha yüksek ilaç direnci geliştirmek gibi, kullanılan ilaç konsantrasyonları buna göre artar. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Yok hayır </td><td> yer </td><td> SNP </td><td> Not </td></tr><tr><td> 1 </td><td> 49.894 </td><td> C-&gt; T </td><tD&gt; DHFR geni </td></tr><tr><td> 2 </td><td> 49.910 </td><td> T&gt; A </td><td> DHFR geni </td></tr><tr><td> 3 </td><td> 49.795 </td><td> C-&gt; T </td><td> DHFR yükseltici </td></tr></tbody></table> Tablo 2:. Sanger sıralama tarafından tespit DHFR Mutasyon temsilcisi dizi verileri son gün mutant (gün 12) üç DHFR nokta mutasyonları gösterir. promoteri ve gen bölgeleri, sırasıyla bir ve 2 SNP içerir. PCR için kullanılan ileri ve geri primerleri 3&#39;TCTAGAGAGATCATTACCGA GGACCGCGAACATCTGTCAT5 &quot;ve 3&#39;ACTAGT TTACCGCCGCTC CAGAATCTCAA AGCAATAGCTG5 &#39;idi.

Watch this Scientific Journal Video about Design and Use of a Low Cost, Automated Morbidostat for Adaptive Evolution of Bacteria Under Antibiotic Drug Selection at JoVE.com

Design and Use of a Low Cost, Automated Morbidostat for Adaptive Evolution of Bacteria Under Antibiotic Drug Selection

We describe a low cost, configurable morbidostat that enables the characterization of antibiotic drug resistance by dynamically adjusting the drug concentration. The device can be integrated with a multiplexed microfluidic platform. The approach can be scaled up for laboratory antibiotic drug resistance studies.

Tasarım ve Düşük Maliyetli kullanımı, Otomatik Morbidostat Bakterilerin Adaptif Evolution için antibiyotik ilaç Seçimi Altında

We describe a low cost, configurable morbidostat for characterizing the evolutionary pathway of antibiotic resistance. The morbidostat is a bacterial ...

design-use-low-cost-automated-morbidostat-for-adaptive-evolution

Nanyang Technological University

Research

JoVE Journal

Genetics

9.6K Görüntüleme.  National Tsing Hua University. We describe a low cost, configurable morbidostat that enables the characterization of antibiotic drug resistance by dynamically adjusting the drug concentration. The device can be integrated with a multiplexed microfluidic platform. The approach can be scaled up for laboratory antibiotic drug resistance studies.

Video: Design and Use of a Low Cost, Automated Morbidostat for Adaptive Evolution of Bacteria Under Antibiotic Drug Selection

Procedure for Adaptive Laboratory Evolution of Microorganisms Using a Chemostat

Natural evolution involves genetic diversity such as environmental change and a selection between small populations. Adaptive laboratory evolution (ALE) refers to the experimental situation in which evolution is observed using living organisms under controlled conditions and stressors; organisms are thereby artificially forced to make evolutionary changes. Microorganisms are subject to a variety of stressors in the environment and are capable of regulating certain stress-inducible proteins to increase their chances of survival. Naturally occurring spontaneous mutations bring about changes in a microorganism's genome that affect its chances of survival. Long-term exposure to chemostat culture provokes an accumulation of spontaneous mutations and renders the most adaptable strain dominant. Compared to the colony transfer and serial transfer methods, chemostat culture entails the highest number of cell divisions and, therefore, the highest number of diverse populations. Although chemostat culture for ALE requires more complicated culture devices, it is less labor intensive once the operation begins. Comparative genomic and transcriptome analyses of the adapted strain provide evolutionary clues as to how the stressors contribute to mutations that overcome the stress. The goal of the current paper is to bring about accelerated evolution of microorganisms under controlled laboratory conditions.

Here, we present a protocol to obtain adaptive laboratory evolution of microorganisms under conditions using chemostat culture. Also, genomic analysis of the evolved strain is discussed.

Bir Kemostat kullanarak Mikroorganizmaların Adaptif Laboratuvarı Evolution Prosedürü

Natural evolution involves genetic diversity such as environmental change and a selection between small populations. Adaptive laboratory evolution (ALE) ...

Genetik

Testing the Role of Multicopy Plasmids in the Evolution of Antibiotic Resistance

Multicopy plasmids are extremely abundant in prokaryotes but their role in bacterial evolution remains poorly understood. We recently showed that the increase in gene copy number per cell provided by multicopy plasmids could accelerate the evolution of plasmid-encoded genes. In this work, we present an experimental system to test the ability of multicopy plasmids to promote gene evolution. Using simple molecular biology methods, we constructed a model system where an antibiotic resistance gene can be inserted into Escherichia coli MG1655, either in the chromosome or on a multicopy plasmid. We use an experimental evolution approach to propagate the different strains under increasing concentrations of antibiotics and we measure survival of bacterial populations over time. The choice of the antibiotic molecule and the resistance gene is so that the gene can only confer resistance through the acquisition of mutations. This &#34;evolutionary rescue&#34; approach provides a simple method to test the potential of multicopy plasmids to promote the acquisition of antibiotic resistance. In the next step of the experimental system, the molecular bases of antibiotic resistance are characterized. To identify mutations responsible for the acquisition of antibiotic resistance we use deep DNA sequencing of samples obtained from whole populations and clones. Finally, to confirm the role of the mutations in the gene under study, we reconstruct them in the parental background and test the resistance phenotype of the resulting strains.

Here we present an experimental method to test the role of multicopy plasmids in the evolution of antibiotic resistance.

Multicopy plazmid rolü antibiyotik direnci gelişimi test

Multicopy plasmids are extremely abundant in prokaryotes but their role in bacterial evolution remains poorly understood. We recently showed that the ...

Genome-wide Surveillance of Transcription Errors in Eukaryotic Organisms

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that control the fidelity of transcription. To fill this gap in scientific knowledge, we recently optimized the circle-sequencing assay to detect transcription errors throughout the transcriptome of Saccharomyces cerevisiae, Drosophila melanogaster, and Caenorhabditis elegans. This protocol will provide researchers with a powerful new tool to map the landscape of transcription errors in eukaryotic cells so that the mechanisms that control the fidelity of transcription can be elucidated in unprecedented detail.

This protocol provides researchers with a new tool to monitor the fidelity of transcription in multiple model organisms.

Ökaryotlarda transkripsiyon hataları genom çapında gözetim

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that ...

Producing Gene Deletions in Escherichia coli by P1 Transduction with Excisable Antibiotic Resistance Cassettes

A first approach to study the function of an unknown gene in bacteria is to create a knock-out of this gene. Here, we describe a robust and fast protocol for transferring gene deletion mutations from one Escherichia coli strain to another by using generalized transduction with the bacteriophage P1. This method requires that the mutation be selectable (e.g., based on gene disruptions using antibiotic cassette insertions). Such antibiotic cassettes can be mobilized from a donor strain and introduced into a recipient strain of interest to quickly and easily generate a gene deletion mutant. The antibiotic cassette can be designed to include flippase recognition sites that allow the excision of the cassette by a site-specific recombinase to produce a clean knock-out with only a ~100-base-pair-long scar sequence in the genome. We demonstrate the protocol by knocking out the tamA gene encoding an assembly factor involved in autotransporter biogenesis and test the effect of this knock-out on the biogenesis and function of two trimeric autotransporter adhesins. Though gene deletion by P1 transduction has its limitations, the ease and speed of its implementation make it an attractive alternative to other methods of gene deletion.

Producing Gene Deletions in Escherichia coli by P1 Transduction with Excisable Antibiotic Resistance Cassettes

Here we present a protocol for the use of pre-existing antibiotic resistance-cassette deletion constructs as a basis for making deletion mutants in other E. coli strains. Such deletion mutations can be mobilized and inserted into the corresponding locus of a recipient strain using P1 bacteriophage transduction.

Escherichia coli Excisable antibiyotik direnci kasetleri ile P1 iletim tarafından üreten gen silme

A first approach to study the function of an unknown gene in bacteria is to create a knock-out of this gene. Here, we describe a robust and fast protocol ...

qKAT: Quantitative Semi-automated Typing of Killer-cell Immunoglobulin-like Receptor Genes

Killer cell immunoglobulin-like receptors (KIRs) are a set of inhibitory and activating immune receptors, on natural killer (NK) and T cells, encoded by a polymorphic cluster of genes on chromosome 19. Their best-characterized ligands are the human leukocyte antigen (HLA) molecules that are encoded within the major histocompatibility complex (MHC) locus on chromosome 6. There is substantial evidence that they play a significant role in immunity, reproduction, and transplantation, making it crucial to have techniques that can accurately genotype them. However, high-sequence homology, as well as allelic and copy number variation, make it difficult to design methods that can accurately and efficiently genotype all KIR genes. Traditional methods are usually limited in the resolution of data obtained, throughput, cost-effectiveness, and the time taken for setting up and running the experiments. We describe a method called quantitative KIR semi-automated typing (qKAT), which is a high-throughput multiplex real-time polymerase chain reaction method that can determine the gene copy numbers for all genes in the KIR locus. qKAT is a simple high-throughput method that can provide high-resolution KIR copy number data, which can be further used to infer the variations in the structurally polymorphic haplotypes that encompass them. This copy number and haplotype data can be beneficial for studies on large-scale disease associations, population genetics, as well as investigations on expression and functional interactions between KIR and HLA.

Quantitative killer cell immunoglobulin-like receptor (KIR) semi-automated typing (qKAT) is a simple, high-throughput, and cost-effective method to copy number type KIR genes for their application in population and disease association studies.

qKAT: nicel Semi-automated yazmaktan katil hücreli immünglobulin benzeri reseptör gen

Killer cell immunoglobulin-like receptors (KIRs) are a set of inhibitory and activating immune receptors, on natural killer (NK) and T cells, encoded by a ...

Genetic Engineering of Dictyostelium discoideum Cells Based on Selection and Growth on Bacteria

Dictyostelium discoideum is an intriguing model organism for the study of cell differentiation processes during development, cell signaling, and other important cellular biology questions. The technologies available to genetically manipulate Dictyostelium cells are well-developed. Transfections can be performed using different selectable markers and marker re-cycling, including homologous recombination and insertional mutagenesis. This is supported by a well-annotated genome. However, these approaches are optimized for axenic cell lines growing in liquid cultures and are difficult to apply to non-axenic wild-type cells, which feed only on bacteria. The mutations that are present in axenic strains disturb Ras signaling, causing excessive macropinocytosis required for feeding, and impair cell migration, which confounds the interpretation of signal transduction and chemotaxis experiments in those strains. Earlier attempts to genetically manipulate non-axenic cells have lacked efficiency and required complex experimental procedures. We have developed a simple transfection protocol that, for the first time, overcomes these limitations. Those series of large improvements to Dictyostelium molecular genetics allow wild-type cells to be manipulated as easily as standard laboratory strains. In addition to the advantages for studying uncorrupted signaling and motility processes, mutants that disrupt macropinocytosis-based growth can now be readily isolated. Furthermore, the entire transfection workflow is greatly accelerated, with recombinant cells that can be generated in days rather than weeks. Another advantage is that molecular genetics can further be performed with freshly isolated wild-type Dictyostelium samples from the environment. This can help to extend the scope of approaches used in these research areas.

Genetic Engineering of Dictyostelium discoideum Cells Based on Selection and Growth on Bacteria

Dictyostelium discoideum is a popular model organism to study complex cellular processes such as cell migration, endocytosis, and development. The utility of the organism is dependent on the feasibility of genetic manipulation. Here, we present methods to transfect Dictyostelium discoideum cells that overcome existing limitations of culturing cells in liquid media.

Genetik Mühendisliği hücreleri Dictyostelium discoideum alan seçimi ve bakteri büyüme

Dictyostelium discoideum is an intriguing model organism for the study of cell differentiation processes during development, cell signaling, and other ...

Designing Automated, High-throughput, Continuous Cell Growth Experiments Using eVOLVER

Continuous culture methods enable cells to be grown under quantitatively controlled environmental conditions, and are thus broadly useful for measuring fitness phenotypes and improving our understanding of how genotypes are shaped by selection. Extensive recent efforts to develop and apply niche continuous culture devices have revealed the benefits of conducting new forms of cell culture control. This includes defining custom selection pressures and increasing throughput for studies ranging from long-term experimental evolution to genome-wide library selections and synthetic gene circuit characterization. The eVOLVER platform was recently developed to meet this growing demand: a continuous culture platform with a high degree of scalability, flexibility, and automation. eVOLVER provides a single standardizing platform that can be (re)-configured and scaled with minimal effort to perform many different types of high-throughput or multi-dimensional growth selection experiments. Here, a protocol is presented to provide users of the eVOLVER framework a description for configuring the system to conduct a custom, large-scale continuous growth experiment. Specifically, the protocol guides users on how to program the system to multiplex two selection pressures &#8212; temperature and osmolarity &#8212; across many eVOLVER vials in order to quantify fitness landscapes of Saccharomyces cerevisiae mutants at fine resolution. We show how the device can be configured both programmatically, through its open-source web-based software, and physically, by arranging fluidic and hardware layouts. The process of physically setting up the device, programming the culture routine, monitoring and interacting with the experiment in real-time over the internet, sampling vials for subsequent offline analysis, and post experiment data analysis are detailed. This should serve as a starting point for researchers across diverse disciplines to apply eVOLVER in the design of their own complex and high-throughput cell growth experiments to study and manipulate biological systems.

The eVOLVER framework enables high-throughput continuous microbial culture with high resolution and dynamic control over experimental parameters. This protocol demonstrates how to apply the system to conduct a complex fitness experiment, guiding users on programming automated control over many individual cultures, measuring, collecting, and interacting with experimental data in real-time.

EVOLVER kullanarak otomatik, yüksek verimlilik, sürekli hücre büyüme denemeleri tasarlama

Continuous culture methods enable cells to be grown under quantitatively controlled environmental conditions, and are thus broadly useful for measuring ...

Use of Frozen Tissue in the Comet Assay for the Evaluation of DNA Damage

The comet assay is gaining popularity as a means to assess DNA damage in cultured cells and tissues, particularly following exposure to chemicals or other environmental stressors. Use of the comet assay in regulatory testing for genotoxic potential in rodents has been driven by adoption of an Organisation for Economic Co-operation and Development (OECD) test guideline in 2014. Comet assay slides are typically prepared from fresh tissue at the time of necropsy; however, freezing tissue samples can avoid logistical challenges associated with simultaneous preparation of slides from multiple organs per animal and from many animals per study. Freezing also enables shipping samples from the exposure facility to a different laboratory for analysis, and storage of frozen tissue facilitates deferring a decision to generate DNA damage data for a given organ. The alkaline comet assay is useful for detecting exposure-related DNA double- and single-strand breaks, alkali-labile lesions, and strand breaks associated with incomplete DNA excision repair. However, DNA damage can also result from mechanical shearing or improper sample processing procedures, confounding the results of the assay. Reproducibility in collection and processing of tissue samples during necropsies may be difficult to control due to fluctuating laboratory personnel with varying levels of experience in harvesting tissues for the comet assay. Enhancing consistency through refresher training or deployment of mobile units staffed with experienced laboratory personnel is costly and may not always be feasible. To optimize consistent generation of high quality samples for comet assay analysis, a method for homogenizing flash frozen cubes of tissue using a customized tissue mincing device was evaluated. Samples prepared for the comet assay by this method compared favorably in quality to fresh and frozen tissue samples prepared by mincing during necropsy. Moreover, low baseline DNA damage was measured in cells from frozen cubes of tissue following prolonged storage.

This protocol describes several procedures for preparing high quality frozen tissue samples at the time of necropsy for use in the comet assay to assess DNA damage: 1) minced tissue, 2) scraped epithelial cells from the gastrointestinal tract, and 3) cubed tissue samples, requiring homogenization using a tissue mincing device.

DNA Hasarının Değerlendirilmesinde Kuyruklu Yıldız Testinde Donmuş Dokunun Kullanımı

The comet assay is gaining popularity as a means to assess DNA damage in cultured cells and tissues, particularly following exposure to chemicals or other ...

Use of Drosophila S2 Cells for Live Imaging of Cell Division

Drosophila S2 cells are an important tool in studying mitosis in tissue culture, providing molecular insights into this fundamental cellular process in a rapid and high-throughput manner. S2 cells have proven amenable to both fixed- and live-cell imaging applications. Notably, live-cell imaging can yield valuable information about how loss or knockdown of a gene can affect the kinetics and dynamics of key events during cell division, including mitotic spindle assembly, chromosome congression, and segregation, as well as overall cell cycle timing. Here we utilize S2 cells stably transfected with fluorescently tagged mCherry:&#945;-tubulin to mark the mitotic spindle and GFP:CENP-A (referred to as &#8216;CID&#8217; gene in Drosophila) to mark the centromere to analyze the effects of key mitotic genes on the timing of cell divisions, from prophase (specifically at Nuclear Envelope Breakdown; NEBD) to the onset of anaphase. This imaging protocol also allows for the visualization of the spindle microtubule and chromosome dynamics throughout mitosis. Herein, we aim to provide a simple yet comprehensive protocol that will allow readers to easily adapt S2 cells for live imaging experiments. Results obtained from such experiments should expand our understanding of genes involved in the cell division by defining their role in several simultaneous and dynamic events. Observations made in this cell culture system can be validated and further investigated in vivo using the impressive toolkit of genetic approaches in flies.

Use of Drosophila S2 Cells for Live Imaging of Cell Division

Cell divisions can be visualized in real time using fluorescently tagged proteins and time-lapse microscopy. Using the protocol presented here, users can analyze cell division timing dynamics, mitotic spindle assembly, and chromosome congression and segregation. Defects in these events following RNA interference (RNAi)-mediated gene knockdown can be assessed and quantified.

Hücre Bölünmesi Canlı Görüntüleme için Drosophila S2 Hücrelerinin Kullanımı

Drosophila S2 cells are an important tool in studying mitosis in tissue culture, providing molecular insights into this fundamental cellular process in a ...

A FACS-based Protocol to Isolate RNA from the Secondary Cells of Drosophila Male Accessory Glands

To understand the function of an organ, it is often useful to understand the role of its constituent cell populations. Unfortunately, the rarity of individual cell populations often makes it difficult to obtain enough material for molecular studies. For example, the accessory gland of the Drosophila male reproductive system contains two distinct secretory cell types. The main cells make up 96% of the secretory cells of the gland, while the secondary cells (SC) make up the remaining 4% of cells (about 80 cells per male). Although both cell types produce important components of the seminal fluid, only a few genes are known to be specific to the SCs. The rarity of SCs has, thus far, hindered transcriptomic analysis study of this important cell type. Here, a method is presented that allows for the purification of SCs for RNA extraction and sequencing. The protocol consists in first dissecting glands from flies expressing a SC-specific GFP reporter and then subjecting these glands to protease digestion and mechanical dissociation to obtain individual cells. Following these steps, individual, living, GFP-marked cells are sorted using a fluorescent activated cell sorter (FACS) for RNA purification. This procedure yields SC-specific RNAs from ~40 males per condition for downstream RT-qPCR and/or RNA sequencing in the course of one day. The rapidity and simplicity of the procedure allows for the transcriptomes of many different flies, from different genotypes or environmental conditions, to be determined in a short period of time.

A FACS-based Protocol to Isolate RNA from the Secondary Cells of Drosophila Male Accessory Glands

Here, we present a protocol to dissociate and sort a specific cell population from the Drosophila male accessory glands (secondary cells) for RNA sequencing and RT-qPCR. Cell isolation is accomplished through FACS purification of GFP-expressing secondary cells after a multistep-dissociation process requiring dissection, proteases digestion and mechanical dispersion.

Drosophila Erkek Aksesuar Bezlerinin Sekonder Hücrelerinden RNA'yı Izole etmek için FACS tabanlı Protokol

To understand the function of an organ, it is often useful to understand the role of its constituent cell populations. Unfortunately, the rarity of ...