The authors would like to thank Prof. Sze-Bi Hsu and Ms. Zhenzhen for useful discussions and help in the theoretical analysis and numerical simulation. Y. T. Y. would like to acknowledge funding support from the Ministry of Science and Technology under grant numbers MOST 103-2220-E-007-026 and MOST 104-2220-E-007-011, and from the National Tsing Hua University under grant numbers 103N2042E1, 104N2042E1, and 105N518CE1.

1. Montagem e pré-teste do dispositivo Morbidostat <ol><li> Assembleia da Morbidostat <ol><li> Soco 3 furos na tampa do frasco de cultura com uma agulha de seringa 18 G. Corte três peças de tubagem de polietileno ~ 7 cm de comprimento. Inserir essas três pedaços de tubos de polietileno na tampa. </li><li> Use fita para envolver a borda da tampa para servir como o elenco para a mistura de polidimetilsiloxano (PDMS). Dissolvem-se 5 g de componente A e 0,5 g de componente B de o PDMS em um recipiente de plástico de 150 ml por agitação manualmente com um palito. Carregar a mistura em uma seringa de 10 ml. <ol><li> Despeje a mistura de PDMS na tampa com a seringa. Asse toda a tampa para curar o PDMS durante 8 horas na estufa a 70 ° C. </li></ol></li><li> Soldar o ânodo LED com o fio de calibre 24 e catodo LED com o resistor de carbono com um ferro de solda. Solde um resistor de 680 Ω de carbono com um fio de 24 g. Isolar a ligação do fio usando fita isolante. </li><li> assimlder no colector do fotodetector com o G fio 24 e o emissor da célula fotoeléctrica com uma resistência de 100 kQ carbono. Isolar a ligação do fio usando fita isolante. </li><li> Coloque o diodo emissor de luz no suporte de cultura do frasco. Seguindo o esquema de circuitos na Suplementar Figura 2, conecte o diodo emissor de luz e ligá-lo com uma fonte de alimentação de 5 V. Verifique se o LED funciona usando uma câmera digital que pode detectar IR (por exemplo, uma câmera de telefone celular). </li><li> Colocar o fotodetector no suporte do frasco de cultura. Seguindo o esquema de circuitos na Suplementar Figura 2, conecte o fotodetector e ligá-lo com uma fonte de alimentação de 5 V. Ligue o fio de ambos os lados das resistências de fotodetectores para medir a tensão através da placa de controle eletrônico. </li><li> Cole um íman sobre o veio da ventoinha de arrefecimento, o qual serve como unidade de agitador magnético. Note-se que o alignmENT do eixo do ventilador para o frasco de cultura, e o espaçamento entre o frasco de cultura e o íman é muito crítica para a função adequada da unidade de agitação magnética. </li><li> Ligue cada pedaço de tubo de polietileno do frasco de cultura para a parte correspondente de tubo de silicone para os micro-bombas, garrafas médias e frasco de resíduos. Ligar a bomba durante 1 hora e medir o volume total a ser bombeado a partir da garrafa de forma para o frasco de cultura para determinar a taxa de bombagem. Note-se que a taxa de bombeamento típico deve ser ~ 4 ml / h, o que corresponde à taxa de diluição de D = 0,33 h -1 para a 12 ml de volume do frasco de cultura de trabalho. </li><li> Coloque todo o conjunto em uma incubadora shaker médio porte (34 cm x 34 cm x 43,5 cm). </li></ol></li><li> O pré-teste do Morbidostat <ol><li> Set tensão de alimentação do ventilador de fresco a 5 V para iniciar o seu motor para testar a barra de agitação magnética. Note-se que a ação de agitação pode ser inspeccionados visualmente. A tensão que conduzirs o motor do ventilador de arrefecimento é precisamente controlado por modulação de largura de pulso (PWM). </li><li> Preparar uma série de tipo selvagem E. Amostras de E. coli com as densidades ópticas a 600 nm, tipicamente variando 0,07-0,3 para a calibração. Coloque um teste E. amostra coli no frasco de cultura e registar a tensão fotodetector. <ol><li> Ponto ~ 100 uL da mesma amostra no leitor de placas e gravar a densidade óptica. Use a tensão fotodetector em função dos dados de densidade óptica para traçar a curva de calibração. Note-se que tipicamente, uma unidade de variação na densidade óptica corresponde a 7,6 V ~ mudança no fotodetector com o esquema de polarização utilizado aqui. </li></ol></li></ol></li></ol> 2. A execução do Morbidostat <ol><li> Preparação Antes de começar a experiência diária <ol><li> Prepara-se o frasco de cultura com três ultra-resistentes a substâncias químicas tubos Tygon com diâmetro interior de 1/32 polegadas e diâmetro externo de 3/32 de polegada para entradas para formar o dispositivo como na secção1.1 e na Figura Suplementar 1. </li><li> Preparar o meio M9 mínimo (0,2% de glicose) e trimetoprim (TMP) de drogas contendo meio. Esteriliza-se o meio, o meio de garrafa, a garrafa forma de droga, o frasco de resíduos, e o frasco de cultura num autoclave a 121 ° C. NOTA: O TMP é uma solução de reserva que é utilizado para alcançar as concentrações mais tarde no Quadro 1 e a droga TMP contendo meio não é autoclavado. </li></ol></li><li> Executando o Morbidostat <ol><li> No primeiro dia do experimento, descongelar 1 ml de tipo selvagem congelado E. coli MG1655 durante 5 min à temperatura ambiente e a transferência de 120 ul das células para o frasco de cultura contendo ~ 12 mL de meio de crescimento M9. Após o primeiro dia, descongelar 1 ml de E. congelado coli células a partir do dia anterior durante 5 min e transferência de 120 uL de células para um novo frasco de cultura contendo ~ 12 mL de meio de crescimento M9. </li><li> Ligue a incubadora shaker e definir a tempe<html> ratura de 30 ° C sem agitação. </li><li> Inicie a operação morbidostat girando sobre o micro-bomba, a unidade de agitação magnética, e a medição da densidade óptica. Nota: Durante a operação, um algoritmo de limiar de realimentação é utilizado para controlar a injecção de drogas. Quando a densidade óptica medida exceder um limite pré-definido, a bomba de injecção de drogas seria ligado e a bomba médio seria desligado. Caso contrário, a bomba de injecção de drogas permanece desligado ea bomba médio está ligado. </li><li> Monitorar a tensão ao longo do tempo para assegurar que não é o crescimento microbiano. Nota: Devido à congelação e descongelação ciclo, E. coli células apresentam um atraso de ~ 4 horas durante o crescimento de cada dia. </li><li> Depois de ~ 23 h, parar a micro-bomba desligando a tensão de alimentação e retire o frasco de cultura. Adiciona-se 15% de glicerol no frasco de cultura e congelar a amostra a -80 ° C durante o armazenamento. </li><li> Repita os passos 2.2.1 a 2.2.5. </li></ol></li></ol>le &quot;&gt; 3. Antibiótico Susceptibilidade Medição em 96 Bem Format NOTA: Executar a medição da taxa de crescimento em um leitor de placas com um formato de 96 poços para determinar o nível de resistência a antibióticos. <ol><li> Descongelar a amostra congelada diária à temperatura ambiente durante 5 min e transferir 15 ul da célula para o frasco de cultura contendo ~ 15 mL de meio M9. Permitir-lhes crescer até a densidade óptica a 600 nm atingir ~ 0,1. Dividir as 15 ml em frascos de 1 ml e adicionar o fármaco TMP nesta etapa para se obter as concentrações de droga desejadas, como mostrado na Tabela 1. </li><li> Tome 200 ul da amostra a partir do passo 3.1 e local para cada poço na placa de leitor e permitir-lhes crescer durante 12 horas 5. A densidade óptica no comprimento de onda de 600 nm é registado automaticamente durante a medição. NOTA: Para cada ponto de dados, as medições triplicadas são registrados e em média para garantir a consistência dos dados. Os dados sobre a densidade óptica em função do tempo pode be utilizado para obter a taxa de crescimento. </li><li> Plotar os dados da taxa de crescimento em comparação com a concentração da droga para obter IC50. Note-se que IC50 é definido como a concentração de fármaco à qual a taxa de crescimento é de cinquenta por cento da taxa de crescimento máxima 5. </li></ol> 4. única célula Morfologia e Antibiótico Susceptibilidade Medição em microcanais <ol><li> Realizar a fabricação dos dispositivos microfluídicos via litografia macia multicamadas de PDMS conforme já descrito 15. <ol><li> Use fotolitografia para fazer o molde fotorresistente para os níveis de controlo e de fluxo. Note-se que para a camada de controlo, utilizar fotorresistente negativa (~ 15? M de altura) e fotorresistente positivo (~ 8 uM altura) para produzir um molde sobre uma bolacha de silício nu. </li><li> Preparar misturas de PDMS com rácios de reticulação de 5: 1 e 20: 1 para a camada de controlo e camada de fluxo, respectivamente. Coloque as misturas em um exsicador sob vácuo para remover quaisquer bolhas, Durante 1 h. </li><li> Exponha o controlo moldes camada fotossensível em bolacha de silício para trimetilclorosilano vapor (TMCS). Adicione a camada de espessura ~ 6 milímetros de controlo, lançando-se a mistura de PDMS (com razão de reticulação 5: 1) sobre a bolacha de silício sobre o molde de controle camada foto-resistente. Cozer a camada de controlo durante 40 minutos a 80 ° C durante 1 hora no forno. </li><li> Adicione a camada de fluxo de rotação por revestimento de uma mistura de PDMS (com reticulação proporção de 20: 1, velocidade de rotação 3000 rpm durante 60 seg) em um molde fotorresistente camada de escoamento. Cozer a camada de fluxo durante 30 min a 80 ° C durante 1 hora no forno. </li><li> Use uma lâmina de barbear para cortar a camada de controle para o tamanho do chip desejado (tipicamente 3 cm x 2 cm) e manualmente retire a camada de controle. Coloque a camada de controlo no topo da camada de escoamento e alinhá-los sob um estereomicroscópio. Curar a montagem alinhada a 80 ° C na noite forno. Em seguida, mergulhe o conjunto em 250 ml de água deionizada em um recipiente de plástico durante 5 horas para dissolver o TMCS residual. </li><li> Subsequentemente, perfurar os orifícios de entrada com 20 g de agulhas e ligar todo o elastómero a uma lâmina de vidro revestida com uma camada de PDMS em branco (PDMS reticulação proporção de 5: 1, velocidade de rotação 2000 rpm durante 30 seg) por tratamento com plasma de ar de 40 seg a 1,2 Torr de pressão de ar. </li><li> Realizar ampla cozimento durante 36 h a 80 ° C para reduzir os efeitos citotóxicos de PDMS. Note-se que esta fase de cozedura é crítica para minimizar a toxicidade para as células bacterianas. </li></ol></li><li> No Experimento Crescimento Chip <ol><li> Antes de carregar no dispositivo de microfluidos, lavá-la com água desionizada durante 1 hora e meio M9 durante 1 h. </li><li> Descongelar a amostra congelada diária à temperatura ambiente durante 5 min e inocular um novo tubo de ensaio com meio fresco M9. Colocar a amostra num incubador com agitação a 37 ° C durante a noite. </li><li> Diluir o microbiana amostra de 10 vezes com meio M9 e carregá-lo para dentro do dispositivo microfluídico pressionando o recipiente da amostra microbiana a 5 psi. Em seguida, carregar a droga TMPmédio no chip pressionando o recipiente do meio de droga em 5 psi. Executar a mistura entre o micróbio e fármaco por actuação da válvula de micromecânica entre as duas câmaras no chip de microfluidos durante 15 min. </li><li> Colocar o chip de microfluidos na incubadora microscópio montado no microscópio invertido. Adquirem a imagem de células na câmara de crescimento a cada HR durante 8 horas com a câmara CCD montada sobre o microscópio invertido. </li><li> Use o script programa personalizado para calcular o número de células por meio de um algoritmo de limite sobre os dados de imagem de células 18. Note-se que os dados do número de células são calculados normalmente mais de três câmaras microfluídicos. </li></ol></li></ol>

<ol>
	<li>Levy, S. B., Marshall, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibiotic+resistance+worldwide:+causes,+challenges,+and+responses.">Antibiotic resistance worldwide: causes, challenges, and responses.</a> Nat. Med. 10, s122-s129 (2004).</li><li>Wang, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracking+the+in+vivo+evolution+of+multidrug+resistance+in+Staphylococus+aureus+by+whole+genome+sequencing.">Tracking the in vivo evolution of multidrug resistance in Staphylococus aureus by whole genome sequencing.</a> Pro. Natl. Acad. Sci. 104, 9451 (2007).</li><li>Dragosits, M., Mattanovich, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adaptive+laboratory+evolution+-+principles+and+applications+for+biotechnology.">Adaptive laboratory evolution - principles and applications for biotechnology.</a> Microbial Cell Factory. 12, 64 (2013).</li><li>Zhang, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acceleration+of+emergence+of+bacterial+antibiotic+resistance+in+connected+microenvironment.">Acceleration of emergence of bacterial antibiotic resistance in connected microenvironment.</a> Science. 333, 1764-1767 (2011).</li><li>Toprak, E., Veres, A., Michel, J. B., Chait, R., Hartl, D. L., Kishony, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+paths+to+antibiotic+resistance+under+dynamically+sustained+drug+selection.">Evolutionary paths to antibiotic resistance under dynamically sustained drug selection.</a> Nature Genetics. 44, 101-106 (2012).</li><li>Toprak, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Building+a+morbidostast:+an+automated+continuous+culture+device+for+studying+bacterial+drug+resistance+under+dynamically+sustained+drug+inhibition.">Building a morbidostast: an automated continuous culture device for studying bacterial drug resistance under dynamically sustained drug inhibition.</a> Nature Protocol. 8, 555-567 (2013).</li><li>Rosenthal, A. Z., Elowitz, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Following+evolution+of+bacterial+antibiotic+resistance+in+real+time.">Following evolution of bacterial antibiotic resistance in real time.</a> Nature Genetics. 44, 11-13 (2012).</li><li>Young, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+antibacterial+resistance+selection+and+quantitation.">In vitro antibacterial resistance selection and quantitation.</a> Curr Protoc Pharmacol. , (2006).</li><li>Novick, A., Szilard, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experiments+with+the+Chemostat+on+spontaneous+mutations+of+bacteria.">Experiments with the Chemostat on spontaneous mutations of bacteria.</a> Proc. Natl. Acad. Sci. U.S.A. 36, 708-719 (1950).</li><li>Balagadde, F. K., You, L., Hansen, C. L., Arnold, F. H., Quake, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+monitoring+of+bacteria+undergoing+programmed+population+control+in+a+microchemostat.">Long-term monitoring of bacteria undergoing programmed population control in a microchemostat.</a> Science. 309, 137-140 (2005).</li><li>Groisman, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microfluidic+chemostat+for+experiments+with+bacterial+and+yeast+cells.">A microfluidic chemostat for experiments with bacterial and yeast cells.</a> Nat. Methods. 2, 685-689 (2005).</li><li>Miller, A. W., Befort, C., Kerr, E. O., Dunham, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+Use+of+Multiplexed+Chemostat+Arrays.">Design and Use of Multiplexed Chemostat Arrays.</a> J. Vis. Exp. (72), e50262 (2013).</li><li>Takahashi, C. N., Miller, A. W., Ekness, F., Dunham, M. J., Klavins, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+low+cost,+customizable+turbidostat+for+use+in+synthetic+circuit+characterization.">A low cost, customizable turbidostat for use in synthetic circuit characterization.</a> ACS Synthetic Biology. , (2015).</li><li>Mohan, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+multiplexed+microfluidic+platform+for+rapid+antibiotic+susceptibility+testing.">A multiplexed microfluidic platform for rapid antibiotic susceptibility testing.</a> Biosens Bioelectrons. 49, 118-125 (2013).</li><li>Unger, M. A., Chou, H. P., Thorsen, T., Scherer, A., Quake, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monolithic+microfabricated+valves+and+pumps+by+multilayer+soft+lithography.">Monolithic microfabricated valves and pumps by multilayer soft lithography.</a> Science. 288, 113-116 (2000).</li><li>Kellogg, R. A., Gomez-Sjoberg, R., Leyrat, A. A., Tay, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Nat. Protocols. 9, 1713 (2014).</li><li>Gu, G. Y., Lee, Y. W., Chiang, C. C., Yang, Y. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nanoliter+microfluidic+serial+dilution+bioreactor.">A nanoliter microfluidic serial dilution bioreactor.</a> Biomicrofluidics. 9, 044126 (2015).</li><li>Gonzalez, R. C., Woods, R. E., Eddins, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Digital image using Matlab processing. , (2004).</li><li>Heikkila, E., Sundstrom, L., Huovinen, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trimethoprim+resistance+in+Escherichia+coli+isolates+from+a+geriatric+unit.">Trimethoprim resistance in Escherichia coli isolates from a geriatric unit.</a> Antimicrob. Agents Chemother. 34, 2013-2015 (1990).</li><li>Flensburg, J., Skold, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massive+overproduction+of+dihydrofolate+reductase+in+bacteria+as+a+response+to+the+use+of+trimethoprim.">Massive overproduction of dihydrofolate reductase in bacteria as a response to the use of trimethoprim.</a> Eur. J. Biochem. 162, 473-476 (1987).</li><li>Ohmae, E., Sasaki, Y., Gekko, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+five-tryptophan+mutations+on+structure,+stability+and+function+of+Escherichia+coli+dihydrofolate+reductase.">Effects of five-tryptophan mutations on structure, stability and function of Escherichia coli dihydrofolate reductase.</a> J. Biochem. 130, 439-447 (2001).</li><li>Smith, D. R., Calvo, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleotide+sequence+of+dihydrofolate+reductase+genes+from+trimethoprim-resistant+mutants+of+Escherichia+coli.+Evidence+that+dihydrofolate+reductase+interacts+with+another+essential+gene+product.">Nucleotide sequence of dihydrofolate reductase genes from trimethoprim-resistant mutants of Escherichia coli. Evidence that dihydrofolate reductase interacts with another essential gene product.</a> Mol. Gen. Genet. 187, 72-78 (1982).</li><li>Okumus, B., Yildiz, S., Toprak, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluidic+and+microfluidic+tools+for+quantitative+systems+biology.">Fluidic and microfluidic tools for quantitative systems biology.</a> Curr Opin Biotech. 25, 30-38 (2014).</li><li>Cho, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+antimicrobial+susceptibility+test+based+on+single-cell+morphological+analysis.">A rapid antimicrobial susceptibility test based on single-cell morphological analysis.</a> Sci. Transl. Med. 17, 267 (2014).</li><li>Hsu, S. B., Waltman, P. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+a+model+of+two+competitors+in+a+chemostat+with+an+external+inhibitor.">Analysis of a model of two competitors in a chemostat with an external inhibitor.</a> SIAM J. Applied Math. , 528-540 (1992).</li><li>Fu, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maximizing+biomass+productivity+and+cell+density+of+Chlorella+vulgaris+by+using+light-emitting+diode-based+photobioreactor.">Maximizing biomass productivity and cell density of Chlorella vulgaris by using light-emitting diode-based photobioreactor.</a> J. Biotech. 161, 242-249 (2012).</li><li>Peabody, V. G. L., Winkler, J., Kao, K. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tools+for+developing+tolerance+to+toxic+chemicals+in+microbial+systems+and+perspectives+on+moving+the+field+forward+and+into+the+industrial+setting.">Tools for developing tolerance to toxic chemicals in microbial systems and perspectives on moving the field forward and into the industrial setting.</a> Curr Opin in Chem Eng. 6, 9-17 (2014).</li></ol>

The authors have nothing to disclose.

Um dispositivo morbidostat baixa pegada de componentes de baixo custo é demonstrada. Os aumentos no nível de resistência a drogas registadas pelo dispositivo são consistentes com os dos relatórios anteriores 5. Concebido para estudos evolutivos de resistência a drogas, o dispositivo é potencialmente aplicável a muitas outras experiências. Primeiro, um banco de dados abrangente de mutações induzidas pela droga pode ser estabelecido para um grande conjunto de antibióticos clinicamente relevantes. Por exemplo, a via evolutiva de resistência a múltiplas drogas podem ser estudados por simples aumento do número de fármacos utilizados na experiência. A principal vantagem do módulo aqui relatado é a sua capacidade de configuração flexível, permitindo em larga escala, as experiências paralelas, sob diferentes condições experimentais. Embora o conceito foi demonstrado nas medições microfluidics, o poder de investigação pode ser melhorado através da combinação de microfluidos com a tecnologia de fluidos 23. O custo pormedição (economia de escala) é drasticamente reduzido pelo consumo de reagente reduzido e trabalho reduzida. Aqui, os dados de morfologia de célula única pode ser extraído a partir da plataforma de microfluidos. Recentemente, testes de morfologia microfluídico de células individuais foi implementado com sucesso em laboratórios de microbiologia clínica, e realiza comparável ao caldo padrão testes de diluição de série 24. Com a crescente disponibilidade de dispositivos microfluídicos, tecnologias combinadas permitirá em grande escala, de alto rendimento experimentos de evolução laboratório. Vários passos são fundamentais para executar o morbidostat. Em primeiro lugar, porque a unidade de agitação magnética é formado a partir de imans e um ventilador de arrefecimento, é crucial para alinhar o eixo do ventilador para o frasco de cultura. Além disso, a distância entre o frasco de cultura e o íman é muito crítica para assegurar um funcionamento estável. Em segundo lugar, a mudança para um novo frasco de cultura no início da experiência de cada dia é também importanteevitar a formação de biofilme. Caso contrário, a formação de biofilmes pode ocorrer dentro de 2 ou 3 dias. Em terceiro lugar, porque E. amostras de E. coli são descongelados diária a partir de uma amostra congelada durante a experiência de cada dia para garantir a consistência, é importante para definir um período de atraso de pelo menos 4 horas para evitar uma lavagem total de fora dos micróbios. Alternativamente, pode-se optar por não congelar E. Amostras de E. coli e directamente usar a amostra para inocular um novo frasco de cultura para iniciar uma nova cultura. Em um cenário prático, o design atual sistema deve superar várias limitações para estender seus potenciais usos. O volume de todo o sistema está actualmente limitada pelo meio consumido por dia (durante a operação chemostatic, um frasco de cultura consome, aproximadamente, 0,5 L de meio por dia, à taxa de diluição típico de 0,33 h -1). Para reduzir o volume de trabalho, otimização possa ser alcançado por meio de simulação atento sobre a dinâmica populacional de drogas inibido com plumbing parâmetros 25. Finalmente, o morbidostat é facilmente adaptável a uma vasta gama de experiências de cultura de bactérias. Por exemplo, por ligação de um diodo emissor de luz, o sistema poderia ser reconfigurado como um foto-biorreactor, permitindo o acompanhamento da evolução de cianobactérias ou microalgas 26. O módulo pode ser estendida para o cultivo anaeróbico e microaeróbia num recipiente estanque ao gás, com adsorventes por o dispositivo sem fios que opera em um conjunto de baterias. Como outro exemplo, a concentração de uma toxina pode ser gradualmente aumentado para engenharia estirpes que são resistentes ao produto alvo 27.

Desde a introdução da primeira penicilina antibiótico, a resistência aos antibióticos microbiana tornou-se um problema de saúde global 1. Embora a aquisição de resistência a antibióticos pode ser retrospectivamente estudados in vivo, as condições destas experiências muitas vezes não são controlados ao longo de toda a evolução 2. Alternativamente, evolução adaptativa laboratório pode revelar a evolução molecular de uma determinada espécie microbiana sob stresses ambientais ou pressão de seleção de um medicamento antibiótico 3. Recentemente, muitas experiências evolutivas bem controlados de resistência aos medicamentos antibióticos elucidaram o surgimento de resistência aos medicamentos antibióticos. Por exemplo, o grupo de Austin demonstrado surgimento rápido num ambiente compartimentado microfluidos adequadamente manipulado 4. O morbidostat recentemente desenvolvido induz a mutações sistemáticas sob droga pressão de seleção 5,6. O morbidostat, uma selec microbianação dispositivo que ajusta continuamente a concentração de antibiótico para manter uma população praticamente constante, é um grande avanço a partir do teste de flutuação utilizado em microbiologia 7,8. No teste de flutuação, uma droga antibiótica é injectada a alta concentração, e os sobreviventes mutantes são rastreadas e contadas. Em vez disso, os micróbios em um morbidostat são constantemente desafiados e adquirir múltiplas mutações. O morbidostat opera de forma semelhante ao quimiostato, cultura de um dispositivo inventado por Novick e Szliard em 1950 que mantém uma população constante através do fornecimento de nutrientes continuamente enquanto que a diluição da população microbiana 9. Desde a sua introdução, o quemostato tem sido avançado e melhorado. quimiostatos microfluídicos em curso alcançaram capacidades nanolitros e de uma única célula. No entanto, estes dispositivos não são adequados para experiências evolução adaptativa, que necessitam de uma população de células grandes com muitos eventos de mutação 10,11. Recentemente, mini-quimiostatos com volumes de trabalho de ~ 10 ml também foram desenvolvidos para preencher a lacuna entre biorreatores em escala litro eo microfluídico quemostato 12,13. Aqui apresentamos a concepção e utilização de um baixo custo, morbidostat automatizado para um estudo de resistência aos medicamentos antibióticos. O módulo proposto pode ser empregue num incubador agitador de laboratório com microbiologia requisito mínimo de hardware. O firmware open-source também é facilmente adaptado para aplicações específicas de evolução adaptativa, tais como engenharia metabólica 3. Finalmente, o morbidostat é integrado em uma plataforma microfluídica multiplexado para testes de sensibilidade aos antibióticos 14.

<table border="0" cellpadding="0" cellspacing="0" width="797">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Environmental Shaker Incubator</td>
			<td style="width:135px;">BioSan</td>
			<td style="width:163px;">ES-20</td>
			<td style="width:227px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Arduino Leonardo board</td>
			<td style="width:135px;">Arduino</td>
			<td style="width:163px;">Leonardo</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">680 Ohm Carbon Resistor</td>
			<td style="width:135px;">Digikey</td>
			<td style="width:163px;"></td>
			<td>Bias resistor for LED</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">100k Ohm Carbon resistor</td>
			<td style="width:135px;">Digikey</td>
			<td style="width:163px;"></td>
			<td>Bias resistor for phototransistor</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">940 nm light emitting diode</td>
			<td style="width:135px;">Bright LED Electronic</td>
			<td style="width:163px;">BIR-BM13E4G-2</td>
			<td>Optical density measurement</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">940 nm phototransistor</td>
			<td style="width:135px;">Kodenshi&#160;</td>
			<td style="width:163px;">ST-2L2B</td>
			<td>Optical density measurement</td>
		</tr>
		<tr height="57">
			<td height="57" style="height:57px;">Darlington pair IC Toshiba</td>
			<td style="width:135px;">Mouser</td>
			<td style="width:163px;">ULN2803APG</td>
			<td style="width:227px;">&#160;this IC drives micropumps and magnetic stirring unit</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:275px;">5V DC brushless fan&#160;</td>
			<td style="width:135px;">ADDA</td>
			<td style="width:163px;">AD0405LX-G70</td>
			<td style="width:227px;">spec: 5V supply voltage and 80mA available www.jameco.com</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Piezoelectric micropump</td>
			<td style="width:135px;">CurieJet</td>
			<td style="width:163px;">PS15I-FT-5L</td>
			<td>Pressure &#62;3kPa&#160; Flow rate &#62;5 ml/min</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Tygon 3350 Tuning</td>
			<td style="width:135px;">Saint Gobain</td>
			<td style="width:163px;">ABW00001</td>
			<td>ID: 1/32&#34; OD: 3/32&#34; L:50&#39;&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Magnetic Stir bar</td>
			<td style="width:135px;">COWIE</td>
			<td style="width:163px;"></td>
			<td>tapered shape dim: 10 mm x 4mm</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Glass scintillation 20ml vial</td>
			<td style="width:135px;">DGS</td>
			<td style="width:163px;"></td>
			<td>Pyrex glass 28mm(dia.)x 61 mm(h)</td>
		</tr>
		<tr height="48">
			<td height="48" style="height:48px;width:275px;">Culture vial holder</td>
			<td style="width:135px;"></td>
			<td style="width:163px;"></td>
			<td>Custom made from Polyformaldehyde&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Silicone&#160;</td>
			<td style="width:135px;">Dow Corning</td>
			<td style="width:163px;">Sylgald 184</td>
			<td>used to seal the glass vial</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Medium bottle</td>
			<td style="width:135px;">VWR</td>
			<td style="width:163px;">66022-065</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Difco M9 minimal salt 5x</td>
			<td style="width:135px;">BD</td>
			<td style="width:163px;"></td>
			<td>Medium</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Cadamino Acid</td>
			<td style="width:135px;">BD</td>
			<td style="width:163px;"></td>
			<td>Medium</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">glucose</td>
			<td style="width:135px;">Sigma</td>
			<td style="width:163px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Agar Bateriological</td>
			<td style="width:135px;">Oxoid</td>
			<td style="width:163px;"></td>
			<td>for agar plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Luria Bertani medium</td>
			<td style="width:135px;"></td>
			<td style="width:163px;"></td>
			<td></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:275px;">Inverted microscope</td>
			<td style="width:135px;">Leica Microsystems</td>
			<td style="width:163px;">Leica DMI-LED</td>
			<td style="width:227px;">used for microfluidic measurement Use X40 objective NA=0.55</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Microscope Incubator</td>
			<td style="width:135px;">Live Cell Instrument</td>
			<td style="width:163px;">CU-109</td>
			<td>used for microfluidic measurement</td>
		</tr>
		<tr height="49">
			<td height="49" style="height:49px;width:275px;">Solenoidal valves</td>
			<td style="width:135px;">Pneumadyne</td>
			<td style="width:163px;">S10MM-31-12-3</td>
			<td>Normally open 1.3 Watt 12 Vdc</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">USB interface card</td>
			<td style="width:135px;">Hobby Engineering</td>
			<td>USBIO24-R Digital I/O Module&#160;</td>
			<td>for microfluidics measurement</td>
		</tr>
		<tr height="45">
			<td height="45" style="height:45px;width:275px;">Air compressor</td>
			<td style="width:135px;">Rocker Scientific</td>
			<td style="width:163px;">ROCKER 440</td>
			<td style="width:227px;">Pressure source for microfluidcs Max. Pressure 80 Psi</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Male luer-lock fittings to 1/8&#34; barb</td>
			<td>ValuePlastics.com</td>
			<td style="width:163px;">MTLL230-1</td>
			<td>used for microfluidic control</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1/8&#34; barb to 10-32 threaded port</td>
			<td>ValuePlastics.com</td>
			<td style="width:163px;">B-1</td>
			<td>used for microfluidic control</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Female luer-lock fittings to 10-32 threaded port</td>
			<td>ValuePlastics.com</td>
			<td style="width:163px;">KFTL-1</td>
			<td>used for microfluidic control</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NPN darlington transistor 500mA, 40V (2N6427)</td>
			<td>DigiKey.com</td>
			<td>2N6427GOS-ND</td>
			<td>used for microfluidic control</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">10kOhm, carbon film resistor, 0.25W</td>
			<td>DigiKey.com</td>
			<td>P10KBACT-ND</td>
			<td>used for microfluidic control</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tantalum capacitor, 10uF, 25V, 10%</td>
			<td>DigiKey.com</td>
			<td>478-1841-ND</td>
			<td>used for microfluidic control</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Andor CCD camera</td>
			<td style="width:135px;">Andor</td>
			<td style="width:163px;">Zyla 4.2 Plus SCMOS</td>
			<td>used for microfluidic on chip imaging</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">ELISA plate reader</td>
			<td style="width:135px;"></td>
			<td style="width:163px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">two component Silicone&#160;</td>
			<td style="width:135px;">Momentive</td>
			<td style="width:163px;">RTV 615</td>
			<td>used for microfluidic chip fabrication</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">SU-8 photoresist</td>
			<td style="width:135px;">Micrchem</td>
			<td style="width:163px;">SU8 2015</td>
			<td>used for microfluidic chip fabrication</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">AZ4620 photoresist</td>
			<td style="width:135px;">Clariant</td>
			<td style="width:163px;">AZ 4620</td>
			<td>used for microfluidic chip fabrication</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Plasma cleaner</td>
			<td style="width:135px;">Harrick Plasma</td>
			<td style="width:163px;">PDC 32G</td>
			<td>used for microfluidic chip fabrication</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">20 Gauge Syringe Needle</td>
			<td style="width:135px;">BD</td>
			<td style="width:163px;"></td>
			<td>used for microfluidic chip fabrication</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Labcycler</td>
			<td style="width:135px;">Sensoquest</td>
			<td style="width:163px;">Labcycler</td>
			<td>PCR&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">DNA polymerase</td>
			<td style="width:135px;">Toyobo</td>
			<td style="width:163px;">KDO Plus</td>
			<td>PCR amplification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Trimethoprim</td>
			<td style="width:135px;">Sigma</td>
			<td style="width:163px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Plate reader</td>
			<td style="width:135px;">Biotek</td>
			<td style="width:163px;">Synergy H1 hybrid&#160;</td>
			<td>antibiotic resistane measurement</td>
		</tr>
	</tbody>
</table>

design and use of a low cost, automated morbidostat for adaptive evolution of bacteria under antibiotic drug selection

Descreve-se um baixo custo, morbidostat configurável para a caracterização da via evolutiva da resistência aos antibióticos. O morbidostat é um dispositivo de cultura bacteriana que monitora continuamente o crescimento bacteriano e ajusta dinamicamente a concentração da droga para desafiar constantemente as bactérias à medida que evoluem para adquirir resistência aos medicamentos. O dispositivo dispõe de um volume de trabalho de ~ 10 mL e é totalmente automatizado e equipado com medição de densidade óptica e micro-bombas para médio e entrega de droga. Para validar a plataforma, medimos a aquisição gradual de resistência trimetoprim em Escherichia coli MG 1655, e integrada com o dispositivo de microfluidos de uma plataforma multiplexado para investigar a morfologia das células e sensibilidade aos antibióticos. A abordagem pode ser up-dimensionado para estudos laboratoriais de resistência aos medicamentos antibióticos, e é extensível para adaptativa evolução de melhorias de tensão em engenharia metabólica e outros experimentos de cultura bacteriana.

O morbidostat acima descrito está esquematizado na Figura 1. As operações morbidostat comuns, incluindo a evolução experimental, teste de susceptibilidade aos antibióticos e a morfologia das células de controlo, foram validados em uma E. coli MG1655 cultura exposta ao trimetoprim (TMP), um fármaco antibiótico comumente utilizado 5,6. TMP induz aumentos graduais muito distintas em resistência aos medicamentos, e as mutações são agrupados em torno do gene dihidrofolato redutase (DHFR). Portanto, TMP é uma droga padrão altamente eficaz para validar a operação morbidostat. Cada dia, o micróbio é esperado para crescer acima do limiar de densidade óptica predefinido e desencadear a injecção de drogas, como mostrado na Figura 2a. A injecção de drogas é esperado para inibir o crescimento e como resultado, diminui a densidade óptica. Várias execuções de ensaios podem ser necessários para determinar a concentração de fármaco ideal. Como regra geral, nós Increase a concentração do fármaco por meio de 5 vezes após ter verificado que a forma de droga não consegue suprimir o crescimento. Depois de todo o curso do ensaio, as amostras congeladas diárias são descongeladas e utilizadas para determinar a IC50, uma medida quantitativa do nível de resistência a drogas. A trama na Figura 2b mostra o aumento temporal na resistência aos medicamentos antibióticos. A resistência aos medicamentos aumentou aproximadamente 1.500 vezes a ~ 1.000 ng / ml ao longo de ~ 12 dias, de acordo com descobertas anteriores na evolução laboratório 5 e isolados clínicos 19. As mutações pontuais de DHFR no último dia mutante foram medidos por Sanger de sequenciação e são listados na Tabela 2. Uma mutação é encontrado localizada na região do promotor e indica que a única mutação pontual na região promotora pode alterar significativamente o nível de DHFR expressão enzima 20. Outra mutação no local 49.910 está localizado na região do gene da DHFR e fica perto do atolocal ive da DHFR enzima 21. A aquisição de resistência aos medicamentos com múltiplas mutações prova a utilidade do morbidostat, como a seleção de drogas contendo placa de ágar tende a conferir apenas o única mutação. Como uma leitura mais sensível da morfologia celular, a morfologia de verificação de uma única célula com susceptibilidade aos antibióticos é realizado em paralelo uma plataforma de microfluidos multiplexado 14. A Figura 3 mostra o design do chip de microfluidos multiplexado. Micrografias das células bacterianas (Figura 5) revelam alterações na morfologia do tipo selvagem e estirpes mutantes sob concentrações sub-inibitória de TMP. estirpes do tipo selvagem mostrar filamentation significativa, enquanto a estirpe mutante não mostra filamentation significativo. Esta mudança de morfologia de cada nível de uma única célula pode ser utilizada no diagnóstico rápido da resistência aos antibióticos. A Figura 4 mostra a sobre-quiAs curvas de crescimento de P em várias concentrações de TMP. A amostra mutante mostra um aumento significativo na resistência ao antibiótico. O crescimento de dados on-chip na Figura 4 também é consistente com o valor de IC 50 a partir do leitor de placas apresentado na Figura 2b. <img alt="figura 1" src="/files/ftp_upload/54426/54426fig1.jpg" /> Figura 1:. Esquemática do morbidostat O morbidostat é um dispositivo de cultura contínua que mede a densidade óptica da população microbiana, e ajusta em conformidade a concentração do fármaco. O dispositivo funciona no modo modo de drogas por injeção de drogas e de diluição. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/54426fig1large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 2" src="/files/ftp_upload/54426/54426fig2.jpg"/&gt; Figura 2: Curva de crescimento e aumento do nível de resistência aos medicamentos antibióticos (a) curva de crescimento Representante sob feedback.. O crescimento microbiano é inibida pelo fármaco antibiótico, cuja injecção é accionado por um algoritmo de limiar. Quando a taxa de crescimento positiva levanta a densidade óptica acima do limiar pré-definido (OD TH = 0,086), o dispositivo muda para o modo de drogas por injeção. Caso contrário, o dispositivo é executado no modo de drogas de diluição. setas vermelhas e roxas indicam mudar para modos de injeção de drogas e de diluição da droga, respectivamente. (B) Resistência ao nível das células durante 12 dias de exposição a trimetoprim. O IC 50 mostra um aumento gradual distinta da resistência aos medicamentos antibióticos. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/54426fig2large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <img al<html> t = &quot;Figura 3&quot; src = &quot;/ files / ftp_upload / 54426 / 54426fig3.jpg&quot; /&gt; Figura 3: dispositivos microfluídicos para investigar a morfologia celular e on-chip de sensibilidade aos antibióticos (a) micrografia do layout de chip.. compartimentos verde e azul são as câmaras de crescimento e média de drogas, respectivamente, eo layout vermelho denota a camada de controle. As dimensões da câmara de crescimento são de 450 uM (L) x 400 ^ M (W) x 8 m (h). A câmara de crescimento é carregado com as bactérias, e a câmara de medicamento é carregada com TMP. barra de escala é de 1 cm. (B) vista ampliada do mesmo chip. Barra de escala = 500 pm. (C) Magnified vista de ambas as câmaras antes e após a mistura. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/54426fig3large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> &quot;Src =&quot; / files / ftp_upload / 54426 / 54426fig4.jpg &quot;/&gt; Curvas de crescimento on-chip de E.: Figura 4 coli expostas a várias concentrações de TMP: estirpe ancestral (a) de tipo selvagem e (b) estirpe mutante (no dia 12). A amostra mutante mostra um aumento significativo na resistência aos medicamentos antibióticos. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/54426fig4large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 5" src="/files/ftp_upload/54426/54426fig5.jpg" /> Figura 5: de uma única célula morfologias (a - d) imagens de campo claro da célula após o tratamento com níveis sub-inibitória de TMP. Note-se a filamentação significativa das células de tipo selvagem em (b), que está ausente nos mutantes (d </strong&gt;). Painéis (e - h) são imagens digitalizadas de (a - d). Todas as imagens bacterianas foram tiradas por uma câmera CCD com um objetivo de ampliação de 40X. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/54426fig5large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> Suplementar Figura 1:. As dimensões e a montagem do suporte de cultura frasco <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/Supplemental_Figure_1.pdf" target="_blank">Por favor clique aqui para baixar esse arquivo.</a> Suplementar Figura 2:. O diagrama de circuito para o LED e o fotodetector <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/Supplementary_Figure_2.PNG" target="_blank">Por favor clique aqui para baixar esse arquivo.</a> Código Suplementar:. roteiro personalizado para contar o número de células a partir das imagens de células obtidas a partir dos chips microfluídicos <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/renamed_40eb7.pdf" target="_blank">Por favor clique aqui para baixar esse arquivo.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td colspan="2"> Amostra </td><td colspan="11"> TMP Drogas (ug / ml) </td></tr><tr><td colspan="2"> dia 1-3 </td><td> 0 </td><td> 0,06 </td><td> 0,12 </td><td> 0,25 </td><td> 0,5 </td><td> 1 </td><td> 2 </td><td> 4 </td><td> 8 </td><td> 16 </td><td> 32 </td></tr><tr><td colspan="2"> dia 4 </td><td> 0 </td><td> 1 </td><td> 2 </td><td> 3 </td><td> 5 </td><td> 10 </td><td> 20 </td><td> 40 </td><td> 80 </td><td> 160 </td><td> 320 </td></tr><tr><td colspan="2"> dia 5-7 </td><td> 0 </td><td> 2 </td><td> 4 </td><td> 8 </td> &lt;td&gt; 15 </td><td> 30 </td><td> 60 </td><td> 120 </td><td> 240 </td><td> 480 </td><td> 960 </td></tr><tr><td colspan="2"> dia 12/08 </td><td> 0 </td><td> 3 </td><td> 7 </td><td> 15 </td><td> 30 </td><td> 60 </td><td> 125 </td><td> 250 </td><td> 500 </td><td> 1.000 </td><td> 2.000 </td></tr></tbody></table> Tabela 1:. Concentração de droga usada para determinar as IC50 em concentrações de droga placa leitor medida em unidades de ug / ml são apresentadas para a amostra congelada diária. À medida que as células se desenvolvem mais elevada resistência à droga, as concentrações de droga utilizadas são aumentados em conformidade. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Não </td><td> Localização </td><td> SNP </td><td> Nota </td></tr><tr><td> 1 </td><td> 49894 </td><td> C-&gt; T </td><td&gt; gene de DHFR </td></tr><tr><td> 2 </td><td> 49910 </td><td> T&gt; A </td><td> gene de DHFR </td></tr><tr><td> 3 </td><td> 49795 </td><td> C-&gt; T </td><td> promotor DHFR </td></tr></tbody></table> Tabela 2:. Mutação em DHFR identificado por sequenciação de Sanger Os dados da sequência representativos mostram as três mutações pontuais DHFR mutante no último dia (dia 12). As regiões do promotor e do gene conter um e 2 SNPs, respectivamente. Os iniciadores directo e inverso, utilizados na PCR foram 3&#39;TCTAGAGAGATCATTACCGA GGACCGCGAACATCTGTCAT5 &#39;e 3&#39;ACTAGT TTACCGCCGCTC CAGAATCTCAA AGCAATAGCTG5&#39;.

Watch this Scientific Journal Video about Design and Use of a Low Cost, Automated Morbidostat for Adaptive Evolution of Bacteria Under Antibiotic Drug Selection at JoVE.com

Design and Use of a Low Cost, Automated Morbidostat for Adaptive Evolution of Bacteria Under Antibiotic Drug Selection

We describe a low cost, configurable morbidostat that enables the characterization of antibiotic drug resistance by dynamically adjusting the drug concentration. The device can be integrated with a multiplexed microfluidic platform. The approach can be scaled up for laboratory antibiotic drug resistance studies.

Concepção e utilização de um baixo custo, Automated Morbidostat para Adaptive Evolução das bactérias sob Antibiótico Seleção de Drogas

We describe a low cost, configurable morbidostat for characterizing the evolutionary pathway of antibiotic resistance. The morbidostat is a bacterial ...

design-use-low-cost-automated-morbidostat-for-adaptive-evolution

Nanyang Technological University

Research

JoVE Journal

Genetics

9.6K visualizações.  National Tsing Hua University. We describe a low cost, configurable morbidostat that enables the characterization of antibiotic drug resistance by dynamically adjusting the drug concentration. The device can be integrated with a multiplexed microfluidic platform. The approach can be scaled up for laboratory antibiotic drug resistance studies.

Vídeo: Design and Use of a Low Cost, Automated Morbidostat for Adaptive Evolution of Bacteria Under Antibiotic Drug Selection

Procedure for Adaptive Laboratory Evolution of Microorganisms Using a Chemostat

Natural evolution involves genetic diversity such as environmental change and a selection between small populations. Adaptive laboratory evolution (ALE) refers to the experimental situation in which evolution is observed using living organisms under controlled conditions and stressors; organisms are thereby artificially forced to make evolutionary changes. Microorganisms are subject to a variety of stressors in the environment and are capable of regulating certain stress-inducible proteins to increase their chances of survival. Naturally occurring spontaneous mutations bring about changes in a microorganism's genome that affect its chances of survival. Long-term exposure to chemostat culture provokes an accumulation of spontaneous mutations and renders the most adaptable strain dominant. Compared to the colony transfer and serial transfer methods, chemostat culture entails the highest number of cell divisions and, therefore, the highest number of diverse populations. Although chemostat culture for ALE requires more complicated culture devices, it is less labor intensive once the operation begins. Comparative genomic and transcriptome analyses of the adapted strain provide evolutionary clues as to how the stressors contribute to mutations that overcome the stress. The goal of the current paper is to bring about accelerated evolution of microorganisms under controlled laboratory conditions.

Here, we present a protocol to obtain adaptive laboratory evolution of microorganisms under conditions using chemostat culture. Also, genomic analysis of the evolved strain is discussed.

Processo para o Adaptive Laboratório Evolução de microrganismos utilizando um quimiostato

Natural evolution involves genetic diversity such as environmental change and a selection between small populations. Adaptive laboratory evolution (ALE) ...

Genética

Testing the Role of Multicopy Plasmids in the Evolution of Antibiotic Resistance

Multicopy plasmids are extremely abundant in prokaryotes but their role in bacterial evolution remains poorly understood. We recently showed that the increase in gene copy number per cell provided by multicopy plasmids could accelerate the evolution of plasmid-encoded genes. In this work, we present an experimental system to test the ability of multicopy plasmids to promote gene evolution. Using simple molecular biology methods, we constructed a model system where an antibiotic resistance gene can be inserted into Escherichia coli MG1655, either in the chromosome or on a multicopy plasmid. We use an experimental evolution approach to propagate the different strains under increasing concentrations of antibiotics and we measure survival of bacterial populations over time. The choice of the antibiotic molecule and the resistance gene is so that the gene can only confer resistance through the acquisition of mutations. This &#34;evolutionary rescue&#34; approach provides a simple method to test the potential of multicopy plasmids to promote the acquisition of antibiotic resistance. In the next step of the experimental system, the molecular bases of antibiotic resistance are characterized. To identify mutations responsible for the acquisition of antibiotic resistance we use deep DNA sequencing of samples obtained from whole populations and clones. Finally, to confirm the role of the mutations in the gene under study, we reconstruct them in the parental background and test the resistance phenotype of the resulting strains.

Here we present an experimental method to test the role of multicopy plasmids in the evolution of antibiotic resistance.

Testando o papel de plasmídeos multicópia na evolução da resistência aos antibióticos

Multicopy plasmids are extremely abundant in prokaryotes but their role in bacterial evolution remains poorly understood. We recently showed that the ...

Genome-wide Surveillance of Transcription Errors in Eukaryotic Organisms

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that control the fidelity of transcription. To fill this gap in scientific knowledge, we recently optimized the circle-sequencing assay to detect transcription errors throughout the transcriptome of Saccharomyces cerevisiae, Drosophila melanogaster, and Caenorhabditis elegans. This protocol will provide researchers with a powerful new tool to map the landscape of transcription errors in eukaryotic cells so that the mechanisms that control the fidelity of transcription can be elucidated in unprecedented detail.

This protocol provides researchers with a new tool to monitor the fidelity of transcription in multiple model organisms.

Vigilância de todo o genoma de erros de transcrição em organismos eucarióticos

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that ...

Producing Gene Deletions in Escherichia coli by P1 Transduction with Excisable Antibiotic Resistance Cassettes

A first approach to study the function of an unknown gene in bacteria is to create a knock-out of this gene. Here, we describe a robust and fast protocol for transferring gene deletion mutations from one Escherichia coli strain to another by using generalized transduction with the bacteriophage P1. This method requires that the mutation be selectable (e.g., based on gene disruptions using antibiotic cassette insertions). Such antibiotic cassettes can be mobilized from a donor strain and introduced into a recipient strain of interest to quickly and easily generate a gene deletion mutant. The antibiotic cassette can be designed to include flippase recognition sites that allow the excision of the cassette by a site-specific recombinase to produce a clean knock-out with only a ~100-base-pair-long scar sequence in the genome. We demonstrate the protocol by knocking out the tamA gene encoding an assembly factor involved in autotransporter biogenesis and test the effect of this knock-out on the biogenesis and function of two trimeric autotransporter adhesins. Though gene deletion by P1 transduction has its limitations, the ease and speed of its implementation make it an attractive alternative to other methods of gene deletion.

Producing Gene Deletions in Escherichia coli by P1 Transduction with Excisable Antibiotic Resistance Cassettes

Here we present a protocol for the use of pre-existing antibiotic resistance-cassette deletion constructs as a basis for making deletion mutants in other E. coli strains. Such deletion mutations can be mobilized and inserted into the corresponding locus of a recipient strain using P1 bacteriophage transduction.

Produzindo a deleção do Gene na Escherichia coli por transdução P1 com fitas de resistência aos antibióticos sujeitos

A first approach to study the function of an unknown gene in bacteria is to create a knock-out of this gene. Here, we describe a robust and fast protocol ...

qKAT: Quantitative Semi-automated Typing of Killer-cell Immunoglobulin-like Receptor Genes

Killer cell immunoglobulin-like receptors (KIRs) are a set of inhibitory and activating immune receptors, on natural killer (NK) and T cells, encoded by a polymorphic cluster of genes on chromosome 19. Their best-characterized ligands are the human leukocyte antigen (HLA) molecules that are encoded within the major histocompatibility complex (MHC) locus on chromosome 6. There is substantial evidence that they play a significant role in immunity, reproduction, and transplantation, making it crucial to have techniques that can accurately genotype them. However, high-sequence homology, as well as allelic and copy number variation, make it difficult to design methods that can accurately and efficiently genotype all KIR genes. Traditional methods are usually limited in the resolution of data obtained, throughput, cost-effectiveness, and the time taken for setting up and running the experiments. We describe a method called quantitative KIR semi-automated typing (qKAT), which is a high-throughput multiplex real-time polymerase chain reaction method that can determine the gene copy numbers for all genes in the KIR locus. qKAT is a simple high-throughput method that can provide high-resolution KIR copy number data, which can be further used to infer the variations in the structurally polymorphic haplotypes that encompass them. This copy number and haplotype data can be beneficial for studies on large-scale disease associations, population genetics, as well as investigations on expression and functional interactions between KIR and HLA.

Quantitative killer cell immunoglobulin-like receptor (KIR) semi-automated typing (qKAT) is a simple, high-throughput, and cost-effective method to copy number type KIR genes for their application in population and disease association studies.

qKAT: quantitativa coeficiente digitação de assassino-célula Genes de receptores de imunoglobulina-como

Killer cell immunoglobulin-like receptors (KIRs) are a set of inhibitory and activating immune receptors, on natural killer (NK) and T cells, encoded by a ...

Genetic Engineering of Dictyostelium discoideum Cells Based on Selection and Growth on Bacteria

Dictyostelium discoideum is an intriguing model organism for the study of cell differentiation processes during development, cell signaling, and other important cellular biology questions. The technologies available to genetically manipulate Dictyostelium cells are well-developed. Transfections can be performed using different selectable markers and marker re-cycling, including homologous recombination and insertional mutagenesis. This is supported by a well-annotated genome. However, these approaches are optimized for axenic cell lines growing in liquid cultures and are difficult to apply to non-axenic wild-type cells, which feed only on bacteria. The mutations that are present in axenic strains disturb Ras signaling, causing excessive macropinocytosis required for feeding, and impair cell migration, which confounds the interpretation of signal transduction and chemotaxis experiments in those strains. Earlier attempts to genetically manipulate non-axenic cells have lacked efficiency and required complex experimental procedures. We have developed a simple transfection protocol that, for the first time, overcomes these limitations. Those series of large improvements to Dictyostelium molecular genetics allow wild-type cells to be manipulated as easily as standard laboratory strains. In addition to the advantages for studying uncorrupted signaling and motility processes, mutants that disrupt macropinocytosis-based growth can now be readily isolated. Furthermore, the entire transfection workflow is greatly accelerated, with recombinant cells that can be generated in days rather than weeks. Another advantage is that molecular genetics can further be performed with freshly isolated wild-type Dictyostelium samples from the environment. This can help to extend the scope of approaches used in these research areas.

Genetic Engineering of Dictyostelium discoideum Cells Based on Selection and Growth on Bacteria

Dictyostelium discoideum is a popular model organism to study complex cellular processes such as cell migration, endocytosis, and development. The utility of the organism is dependent on the feasibility of genetic manipulation. Here, we present methods to transfect Dictyostelium discoideum cells that overcome existing limitations of culturing cells in liquid media.

Engenharia genética de células de Dictyostelium discoideum com base na seleção e crescimento de bactérias

Dictyostelium discoideum is an intriguing model organism for the study of cell differentiation processes during development, cell signaling, and other ...

Designing Automated, High-throughput, Continuous Cell Growth Experiments Using eVOLVER

Continuous culture methods enable cells to be grown under quantitatively controlled environmental conditions, and are thus broadly useful for measuring fitness phenotypes and improving our understanding of how genotypes are shaped by selection. Extensive recent efforts to develop and apply niche continuous culture devices have revealed the benefits of conducting new forms of cell culture control. This includes defining custom selection pressures and increasing throughput for studies ranging from long-term experimental evolution to genome-wide library selections and synthetic gene circuit characterization. The eVOLVER platform was recently developed to meet this growing demand: a continuous culture platform with a high degree of scalability, flexibility, and automation. eVOLVER provides a single standardizing platform that can be (re)-configured and scaled with minimal effort to perform many different types of high-throughput or multi-dimensional growth selection experiments. Here, a protocol is presented to provide users of the eVOLVER framework a description for configuring the system to conduct a custom, large-scale continuous growth experiment. Specifically, the protocol guides users on how to program the system to multiplex two selection pressures &#8212; temperature and osmolarity &#8212; across many eVOLVER vials in order to quantify fitness landscapes of Saccharomyces cerevisiae mutants at fine resolution. We show how the device can be configured both programmatically, through its open-source web-based software, and physically, by arranging fluidic and hardware layouts. The process of physically setting up the device, programming the culture routine, monitoring and interacting with the experiment in real-time over the internet, sampling vials for subsequent offline analysis, and post experiment data analysis are detailed. This should serve as a starting point for researchers across diverse disciplines to apply eVOLVER in the design of their own complex and high-throughput cell growth experiments to study and manipulate biological systems.

The eVOLVER framework enables high-throughput continuous microbial culture with high resolution and dynamic control over experimental parameters. This protocol demonstrates how to apply the system to conduct a complex fitness experiment, guiding users on programming automated control over many individual cultures, measuring, collecting, and interacting with experimental data in real-time.

Projetando experimentos de crescimento de células contínuas, de alta produtividade e automatizados usando o eVOLVER

Continuous culture methods enable cells to be grown under quantitatively controlled environmental conditions, and are thus broadly useful for measuring ...

Use of Frozen Tissue in the Comet Assay for the Evaluation of DNA Damage

The comet assay is gaining popularity as a means to assess DNA damage in cultured cells and tissues, particularly following exposure to chemicals or other environmental stressors. Use of the comet assay in regulatory testing for genotoxic potential in rodents has been driven by adoption of an Organisation for Economic Co-operation and Development (OECD) test guideline in 2014. Comet assay slides are typically prepared from fresh tissue at the time of necropsy; however, freezing tissue samples can avoid logistical challenges associated with simultaneous preparation of slides from multiple organs per animal and from many animals per study. Freezing also enables shipping samples from the exposure facility to a different laboratory for analysis, and storage of frozen tissue facilitates deferring a decision to generate DNA damage data for a given organ. The alkaline comet assay is useful for detecting exposure-related DNA double- and single-strand breaks, alkali-labile lesions, and strand breaks associated with incomplete DNA excision repair. However, DNA damage can also result from mechanical shearing or improper sample processing procedures, confounding the results of the assay. Reproducibility in collection and processing of tissue samples during necropsies may be difficult to control due to fluctuating laboratory personnel with varying levels of experience in harvesting tissues for the comet assay. Enhancing consistency through refresher training or deployment of mobile units staffed with experienced laboratory personnel is costly and may not always be feasible. To optimize consistent generation of high quality samples for comet assay analysis, a method for homogenizing flash frozen cubes of tissue using a customized tissue mincing device was evaluated. Samples prepared for the comet assay by this method compared favorably in quality to fresh and frozen tissue samples prepared by mincing during necropsy. Moreover, low baseline DNA damage was measured in cells from frozen cubes of tissue following prolonged storage.

This protocol describes several procedures for preparing high quality frozen tissue samples at the time of necropsy for use in the comet assay to assess DNA damage: 1) minced tissue, 2) scraped epithelial cells from the gastrointestinal tract, and 3) cubed tissue samples, requiring homogenization using a tissue mincing device.

Uso de tecido congelado no ensaio do cometa para avaliação de danos no DNA

The comet assay is gaining popularity as a means to assess DNA damage in cultured cells and tissues, particularly following exposure to chemicals or other ...

Use of Drosophila S2 Cells for Live Imaging of Cell Division

Drosophila S2 cells are an important tool in studying mitosis in tissue culture, providing molecular insights into this fundamental cellular process in a rapid and high-throughput manner. S2 cells have proven amenable to both fixed- and live-cell imaging applications. Notably, live-cell imaging can yield valuable information about how loss or knockdown of a gene can affect the kinetics and dynamics of key events during cell division, including mitotic spindle assembly, chromosome congression, and segregation, as well as overall cell cycle timing. Here we utilize S2 cells stably transfected with fluorescently tagged mCherry:&#945;-tubulin to mark the mitotic spindle and GFP:CENP-A (referred to as &#8216;CID&#8217; gene in Drosophila) to mark the centromere to analyze the effects of key mitotic genes on the timing of cell divisions, from prophase (specifically at Nuclear Envelope Breakdown; NEBD) to the onset of anaphase. This imaging protocol also allows for the visualization of the spindle microtubule and chromosome dynamics throughout mitosis. Herein, we aim to provide a simple yet comprehensive protocol that will allow readers to easily adapt S2 cells for live imaging experiments. Results obtained from such experiments should expand our understanding of genes involved in the cell division by defining their role in several simultaneous and dynamic events. Observations made in this cell culture system can be validated and further investigated in vivo using the impressive toolkit of genetic approaches in flies.

Use of Drosophila S2 Cells for Live Imaging of Cell Division

Cell divisions can be visualized in real time using fluorescently tagged proteins and time-lapse microscopy. Using the protocol presented here, users can analyze cell division timing dynamics, mitotic spindle assembly, and chromosome congression and segregation. Defects in these events following RNA interference (RNAi)-mediated gene knockdown can be assessed and quantified.

Uso de células de Drosophila S2 para imagens ao vivo da divisão celular

Drosophila S2 cells are an important tool in studying mitosis in tissue culture, providing molecular insights into this fundamental cellular process in a ...

A FACS-based Protocol to Isolate RNA from the Secondary Cells of Drosophila Male Accessory Glands

To understand the function of an organ, it is often useful to understand the role of its constituent cell populations. Unfortunately, the rarity of individual cell populations often makes it difficult to obtain enough material for molecular studies. For example, the accessory gland of the Drosophila male reproductive system contains two distinct secretory cell types. The main cells make up 96% of the secretory cells of the gland, while the secondary cells (SC) make up the remaining 4% of cells (about 80 cells per male). Although both cell types produce important components of the seminal fluid, only a few genes are known to be specific to the SCs. The rarity of SCs has, thus far, hindered transcriptomic analysis study of this important cell type. Here, a method is presented that allows for the purification of SCs for RNA extraction and sequencing. The protocol consists in first dissecting glands from flies expressing a SC-specific GFP reporter and then subjecting these glands to protease digestion and mechanical dissociation to obtain individual cells. Following these steps, individual, living, GFP-marked cells are sorted using a fluorescent activated cell sorter (FACS) for RNA purification. This procedure yields SC-specific RNAs from ~40 males per condition for downstream RT-qPCR and/or RNA sequencing in the course of one day. The rapidity and simplicity of the procedure allows for the transcriptomes of many different flies, from different genotypes or environmental conditions, to be determined in a short period of time.

A FACS-based Protocol to Isolate RNA from the Secondary Cells of Drosophila Male Accessory Glands

Here, we present a protocol to dissociate and sort a specific cell population from the Drosophila male accessory glands (secondary cells) for RNA sequencing and RT-qPCR. Cell isolation is accomplished through FACS purification of GFP-expressing secondary cells after a multistep-dissociation process requiring dissection, proteases digestion and mechanical dispersion.

Um protocolo baseado em FACS para isolar o RNA das células secundárias de glândulas acessórias masculinas de Drosophila

To understand the function of an organ, it is often useful to understand the role of its constituent cell populations. Unfortunately, the rarity of ...