The authors thank Davy Opdenacker for technical assistance and photography. We greatly thank Dr. Annick Bleys for helpful suggestions to improve the manuscript. This work was financed by the Interuniversity Attraction Poles Programme IUAP P7/29 'MARS' from the Belgian Federal Science Policy Office, by the FWO grant G027313N and by the Agency for Innovation by Science and Technology, IWT (IR).

<ol>
	<li>Van Norman, J. M., Xuan, W., Beeckman, T., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=To+branch+or+not+to+branch:+the+role+of+pre-patterning+in+lateral+root+formation.">To branch or not to branch: the role of pre-patterning in lateral root formation.</a> Development. 140, 4301-4310 (2013).</li><li>Dolan, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+organisation+of+the+Arabidopsis+thaliana+root.">Cellular organisation of the Arabidopsis thaliana root.</a> Development. 119, 71-84 (1993).</li><li>Bell, J. K., McCully, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+histological+study+of+lateral+root+initiation+and+development+in+Zea+mays.">A histological study of lateral root initiation and development in Zea mays.</a> Protoplasma. 70, 179-205 (1970).</li><li>Benkova, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Local,+efflux-dependent+auxin+gradients+as+a+common+module+for+plant+organ+formation.">Local, efflux-dependent auxin gradients as a common module for plant organ formation.</a> Cell. 115, 591-602 (2003).</li><li>Beeckman, T., Burssens, S., Inz&#233;, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+peri-cell-cycle+in+Arabidopsis.">The peri-cell-cycle in Arabidopsis.</a> J. Exp. Bot. 52, 403-411 (2001).</li><li>Himanen, K., Boucheron, E., Vanneste, S., de Almeida Engler, J., Inz&#233;, D., Beeckman, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auxin-mediated+cell+cycle+activation+during+early+lateral+root+initiation.">Auxin-mediated cell cycle activation during early lateral root initiation.</a> Plant Cell. 14, 2339-2351 (2002).</li><li>Jansen, L., Parizot, B., Beeckman, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+system+for+lateral+roots+in+Arabidopsis+thaliana+and+maize.">Inducible system for lateral roots in Arabidopsis thaliana and maize.</a> Methods Mol Biol. 959, 149-158 (2013).</li><li>Casimiro, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auxin+transport+promotes+Arabidopsis+lateral+root+initiation.">Auxin transport promotes Arabidopsis lateral root initiation.</a> Plant Cell. 13, 843-852 (2001).</li><li>Himanen, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcript+profiling+of+early+lateral+root+initiation.">Transcript profiling of early lateral root initiation.</a> Proc. Natl. Acad. Sci. USA. 101, 5146-5151 (2004).</li><li>De Smet, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Receptor-like+kinase+ACR4+restricts+formative+cell+divisions+in+the+Arabidopsis+root.">Receptor-like kinase ACR4 restricts formative cell divisions in the Arabidopsis root.</a> Science. 322, 594-597 (2008).</li><li>Vanneste, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+cycle+progression+in+the+pericycle+is+not+sufficient+for+SOLITARY+ROOT/IAA14-mediated+lateral+root+initiation+in+Arabidopsis+thaliana.">Cell cycle progression in the pericycle is not sufficient for SOLITARY ROOT/IAA14-mediated lateral root initiation in Arabidopsis thaliana.</a> Plant Cell. 17, 3035-3050 (2005).</li><li>De Rybel, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+role+for+the+root+cap+in+root+branching+revealed+by+the+non-auxin+probe+naxillin.">A role for the root cap in root branching revealed by the non-auxin probe naxillin.</a> Nat. Chem. Biol. 8, 798-805 (2012).</li><li>Jansen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+transcriptomics+as+a+tool+for+the+identification+of+root+branching+genes+in+maize.">Comparative transcriptomics as a tool for the identification of root branching genes in maize.</a> Plant Biotechnol. J. 11, 1092-1102 (2013).</li><li>Parizot, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diarch+symmetry+of+the+vascular+bundle+in+Arabidopsis+root+encompasses+the+pericycle+and+is+reflected+in+distich+lateral+root+initiation.">Diarch symmetry of the vascular bundle in Arabidopsis root encompasses the pericycle and is reflected in distich lateral root initiation.</a> Plant Physiol. 146, 140-148 (2008).</li><li>Murashige, T., Skoog, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+revised+medium+for+rapid+growth+and+bio+assays+with+tobacco+tissue+cultures.">A revised medium for rapid growth and bio assays with tobacco tissue cultures.</a> Physiol. Plant. 15, 473-497 (1962).</li><li>Bellini, C., Pacurar, D. I., Perrone, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adventitious+roots+and+lateral+roots:+similarities+and+differences.">Adventitious roots and lateral roots: similarities and differences.</a> Annu Rev Plant Biol. 65, 639-666 (2014).</li><li>Grunewald, W., Parizot, B., Inz&#233;, D., Gheysen, G., Beeckman, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Developmental+biology+of+roots:+One+common+pathway+for+all+angiosperms?.">Developmental biology of roots: One common pathway for all angiosperms?.</a> Int. J. Plant Dev. Biol. 1, 212-225 (2007).</li><li>Parizot, B., Beeckman, T., Crespi, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomics+of+root+development.">Genomics of root development.</a> Root Genomics and Soil Interactions. , 3-28 (2012).</li><li>Bargmann, B. O., Birnbaum, K. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence+activated+cell+sorting+of+plant+protoplasts.">Fluorescence activated cell sorting of plant protoplasts.</a> Journal of visualized experiments : JoVE. , (2010).</li><li>Nakazono, M., Qiu, F., Borsuk, L. A., Schnable, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser-capture+microdissection,+a+tool+for+the+global+analysis+of+gene+expression+in+specific+plant+cell+types:+identification+of+genes+expressed+differentially+in+epidermal+cells+or+vascular+tissues+of+maize.">Laser-capture microdissection, a tool for the global analysis of gene expression in specific plant cell types: identification of genes expressed differentially in epidermal cells or vascular tissues of maize.</a> Plant Cell. 15, 583-596 (2003).</li><li>Ludwig, Y., Hochholdinger, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser+microdissection+of+plant+cells.">Laser microdissection of plant cells.</a> Methods Mol Biol. 1080, 249-258 (2014).</li><li>Beeckman, T., Engler, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+easy+technique+for+the+clearing+of+histochemically+stained+plant+tissue.">An easy technique for the clearing of histochemically stained plant tissue.</a> Plant Mol. Biol. Rep. 12, 37-42 (1994).</li><li>Ditengou, F. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanical+induction+of+lateral+root+initiation+in+Arabidopsis+thaliana.">Mechanical induction of lateral root initiation in Arabidopsis thaliana.</a> Proc. Natl. Acad. Sci. USA. 105, 18818-18823 (2008).</li><li>Lucas, M., Godin, C., Jay-Allemand, C., Laplaze, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auxin+fluxes+in+the+root+apex+co-regulate+gravitropism+and+lateral+root+initiation.">Auxin fluxes in the root apex co-regulate gravitropism and lateral root initiation.</a> J. Exp. Bot. 59, 55-66 (2008).</li><li>Wang, S., Taketa, S., Ichii, M., Xu, L., Xia, K., Zhou, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lateral+root+formation+in+rice+(Oryza+Sativa.+L.):+differential+effects+of+indole-3-acetic+acid+and+indole-3-butyric+acid.">Lateral root formation in rice (Oryza Sativa. L.): differential effects of indole-3-acetic acid and indole-3-butyric acid.</a> Plant Growth Regul. 41, 41-47 (2003).</li><li>Martinez-de la Cruz, E., Garcia-Ramirez, E., Vazquez-Ramos, J. M., Reyes de la Cruz, H., Lopez-Bucio, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auxins+differentially+regulate+root+system+architecture+and+cell+cycle+protein+levels+in+maize+seedlings.">Auxins differentially regulate root system architecture and cell cycle protein levels in maize seedlings.</a> J Plant Physiol. 176, 147-156 (2015).</li><li>Beyer, E. M., Morgan, P. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+ethylene+on+uptake,+distribution,+and+metabolism+of+indoleacetic+acid-1-14C+and+-2-14C+and+naphthaleneacetic+acid-1-14C.">Effect of ethylene on uptake, distribution, and metabolism of indoleacetic acid-1-14C and -2-14C and naphthaleneacetic acid-1-14C.</a> Plant Physiol. 46, 157-162 (1970).</li><li>Delbarre, A., Muller, P., Imhoff, V., Guern, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+mechanisms+controlling+uptake+and+accumulation+of+2,4-dichlorophenoxy+acetic+acid,+naphthalene-1-acetic+acid,+and+indole-3-acetic+acid+in+suspension-cultured+tobacco+cells.">Comparison of mechanisms controlling uptake and accumulation of 2,4-dichlorophenoxy acetic acid, naphthalene-1-acetic acid, and indole-3-acetic acid in suspension-cultured tobacco cells.</a> Planta. 198, 532-541 (1996).</li><li>Bailey-Serres, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microgenomics:+genome-scale,+cell-specific+monitoring+of+multiple+gene+regulation+tiers.">Microgenomics: genome-scale, cell-specific monitoring of multiple gene regulation tiers.</a> Annu Rev Plant Biol. 64, 293-325 (2013).</li><li>Perez-Torres, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phosphate+availability+alters+lateral+root+development+in+Arabidopsis+by+modulating+auxin+sensitivity+via+a+mechanism+involving+the+TIR1+auxin+receptor.">Phosphate availability alters lateral root development in Arabidopsis by modulating auxin sensitivity via a mechanism involving the TIR1 auxin receptor.</a> Plant Cell. 20, 3258-3272 (2008).</li></ol>

יש המחברים אין לחשוף.

בפרוטוקול ארבידופסיס LRIS, חשוב להעביר רק את השתילים שצמחו כולו במגע עם מדיום גידול רשות הטבע והגנים המכיל. הדבר מבטיח כי ייזום שורש לרוחב חסום על אורך השורש כל. כדי למנוע פציעת שתילי במהלך העברה, זרועות המלקחיים המעוקלים יכולות להיות מכור תחת הפסיגים של השתיל. עם ההעברה, לוודא כי שורשי השתיל נמצאים בקשר עם מספיק הבינוני אגר המכיל NAA. זו יכולה להיות מושגת על ידי רפרוף השורש על פני אגר על פני מרחק קטן. זה יבטיח אינדוקציה מסונכרנת יעילה של ייזום שורש לרוחב על סך אורך השורש. ניתן לגדל השורשים חשופים לאור ללא משפיע לרעה על צמיחתם ואינדוקציה שורש לרוחב. בפרוטוקול LRIS התירס, חשוב שradicle של הקרנל פונה כלפי מטה וכלפי הנייר כדי להבטיח את השורש יגדל דownwards ולצרף לנייר בצד הנכון 16. אחרי שלושה ימים של טיפול רשות הטבע והגנים, השתילים צריכים יצאו מהליבה עם לירות קטן, שורש יסודי ושורשי זרע 16. השורש העיקרי צריך להיות באורך של כ 2 סנטימטר לפני שתמשיך לאינדוקציה של ייזום שורש לרוחב. פרוטוקול זה פותח באמצעות הקו טהור תירס B73, אבל במקרה של קו תירס עם שיעור צמיחה שונה, להתאים את זמן הדגירה בהתאם. ודא שגלילי הנייר יישארו ספוגים באופן קבוע על ידי הוספת 50 מיקרומטר פתרון רט&quot;ג כאשר הנוזל מתאדה לאורך זמן, אחרת טיפול רשות הטבע והגנים יכולים להיות פיתוח רוחב מוקדם לא יעיל ולא רצוי שורש יכול להתרחש. המערכת עצמה מונעת חשיפה של השורשים לאור, אבל אור הוא לא נושא מרכזי ולא משפיע על צמיחת שורש ואינדוקציה שורש לרוחב. דרכים אלטרנטיביות לזירוז מבוקר של שורשים לרוחב הן השימוש בMEChanical כיפוף 23 או 24 gravistimulation. היתרון העיקרי של מערכות אלה הוא שיש להם השראה &quot;טבעית&quot; יותר בהשוואה לטיפולי הורמונים בLRIS, אבל החסרון הוא שהם מוגבלים בכמות החומר שניתן לקצור בנקודת זמן נתונה, כי הם רק להניב אירוע חניכת שורש לרוחב אחד בעיקול לשתיל בהשוואה לגיוס מלא של pericycle בLRIS. LRIS משמש בארבידופסיס ותירס יכול לשמש במגוון רחב של צמחים, למרות תנאים נוחים צריכים להיות מותאמים. כדי להתקין LRIS, שני צעדים רצופים חשובים צריכים להיות מושגת: (1) חסימת תחבורת אוקסין ו( 2) ההצטברות של אוקסין לגרום לייזום שורש לרוחב. המערכת גדלה צריכה לאפשר לספיגה יעילה ואחידה של התרכובות וצריכה לאפשר התפתחות טובה של השתילים. מערכות אלטרנטיביות למדיום מוצק (ארבידופסיס) וגלילי נייר (תירס), כגון תרבות נוזלית, הידרופוניקה, או aeroponics, יכול לשמש למינים אחרים. השלב הראשון בLRIS, כלומר, החסימה של תחבורת אוקסין, יכול להיות מושגת על ידי הוספת מעכב תחבורת אוקסין. למרות שרשות הטבע והגנים מובילים לבלוק יעיל חניכה שורש לרוחב בארבידופסיס ותירס, עשויות תרכובות חלופיות כגון חומצת 2,3,5-triiodobenzoic (TIBA) או חומצת chlorophenoxyisobutyric p- (PCIB) לעבוד טוב יותר במינים אחרים. אופטימיזציה דומה ניתן לעשות עבור השלב השני של LRIS, כלומר, טיפול אוקסין. אוקסין NAA הסינתטי נראה המתאים ביותר לLRIS. מבשר אוקסין indol-3-butyric החומצה (רשות השידור) עשוי להיות חלופה טובה כפי שהוא גם חזק גורם שורשים לרוחב ויש לו פעילות ביולוגית גבוהה בצמחים שונים 25, 26. מצד השני, חומצת אינדול-3-אצטית אוקסין הטבעי (רשות העתיקות) היא פחות יציבה ויותר בקלות חילוף חומרים 27, הרציונליזציה ההשפעה החלשה שלה בdevel השורשopment בלמשל תירס או אורז 25, 26. חומצת 2,4-dichlorophenoxyacetic אוקסין הסינתטי (2,4D) מצטברת מאוד בתאי pericycle, באופן חלקי משום שהוא לא ייצא מהתאים 28, פוגע בייזום שורש לרוחב נכון וגרימה מלאכותית מבנים התמזגו. כמו כן תרכובות אחרות באינטראקציה עם מסלולי אוקסין, כגון naxillin 12, הוכחו לגרום לייזום שורש לרוחב בארבידופסיס וניתן לבדוק במינים אחרים. במקרים מסוימים, נביטה היא לא יעילה בנוכחות של רשות הטבע והגנים ואחד יכול לבחור ראשון לנבוט זרעים בהעדר רשות הטבע והגנים, להעביר לאחר מכן את השתילים למערכת רט&quot;ג המכילה. זה גורם סיכון אפשרי שיש primordia שורש לרוחב המוקדם יזם לפני גיוס שורש לרוחב עם טיפול NAA ו, ומכאן, חשוב לדגום את האזור של השורש שמוארך במהלך טיפול רשות הטבע והגנים בלבד. בעקבות אסטרטגיה כללית זו, sho אחדuld תוכל לייעל LRIS לכל צמח כמעט (זרע) וככזה יש לי מערכת קלה ללמוד פיתוח שורש לרוחב למפעל של עניין. אפיון נוסף של עיתוי ייזום שורש לרוחב יכול להתרחש באמצעות קווי סמן, כפי שהודגם לארבידופסיס. אם קווי סמן קשה להשיג, אפשר לעשות מחקר היסטולוגית מפורט, אבל זה גוזל זמן וחלוקות התא הראשונים הן לא קלה לזיהוי. לחלופין, ניתוח ביטוי של סמני חלוקת תא יכול לשמש כדי לציין את העיתוי של חלוקות התא הראשונות. LRIS יכול לשמש למטרות שונות, כגון ניתוח transcriptome 9-13 כמתואר בקצרה בתוצאות, כמו גם תצפיות היסטולוגית ברמת מקרוסקופית והמיקרוסקופית בייזום שורש רוחב 14. סוגים שונים של דגימה, החל מאיבר לתא בקנה מידה 29, עשויים לאפשר התרת היבטים שונים של מאוחר יותרייזום שורש אל. בנוסף, LRIS ניתן להשתמש כדי לפקח על ההשפעה של תרכובות שונות בייזום לרוחב שורש 12, 30. לבסוף, על ידי שימוש בקווי כתב, יכול לשמש גם LRIS לאפיין בקלות את ביטוי הגנים ו / או לוקליזציה חלבון במהלך רוחב פיתוח שורש.

מערכת השורשים היא קריטית לצמיחת צמח, שכן הוא מבטיח מעגן וספיגה של מים וחומרים מזינים מהאדמה. בגלל ההתרחבות של מערכת שורשים בעיקר מסתמכת על הייצור של שורשים לרוחב, הייזום והקמה שלהם נחקרו בהרחבה. שורשים לרוחב הם יזמו בתת-קבוצה מסוימת של תאי pericycle, הנקראים תאי מייסד 1. ברוב dicots, כגון thaliana ארבידופסיס, תאים אלה נמצאים בקטבי protoxylem 2, ואילו בmonocots, כגון תירס, שהם נמצאים בקטבי השיפה 3. תאי מייסד מסומנים על ידי תגובת אוקסין עלה 4, ואחריו ביטוי של גני מחזור התא ספציפיים (למשל, cyclin B1; 1 / CYCB1; 1), לאחר שהם עוברים סיבוב ראשון של חטיבות anticlinal סימטריות 5. לאחר סדרה של חטיבות anticlinal וpericlinal מתואמות, primordium שורש לרוחב נוצר שסופו של דבר יתגלה כשורש לרוחב utonomous. המיקום והעיתוי של תחילת שורש לרוחב עם זאת לא צפויים, שכן אירועים אלה הם לא בשפע ולא מסונכרנים. זה מונע את השימוש של גישות מולקולריות כגון transcriptomics ללמוד את התהליך הזה. כדי להתמודד עם זה, מערכת לרוחב שורש עין מתנהל (LRIS) פותחה 6, 7. במערכת זו, מטופלים שתילים ראשון עם N חומצת -1-naphthylphthalamic (רט&quot;ג), אשר מעכב תחבורת אוקסין וצבירה, וכתוצאה מכך חסימת ייזום שורש לרוחב 8. על ידי המשך העברת השתיל למדיום המכיל את חומצת אוקסין הסינתטי 1-נפתלין אצטית (NAA), כל שכבת pericycle מגיבה לרמות הגבוהות אוקסין כך מסיבית חטיבות התרמה לרוחב שורש ייזום תא 6. ככזה, מערכת זו מובילה לחניכות שורשים לרוחב מהירות, סינכרוני ונרחבים, המאפשרת איסוף קל של דגימות שורש מועשרים לשלב ספציפי של מנוחפיתוח שורש RAL. בהמשך לכך, ניתן להשתמש בדוגמאות אלה כדי לקבוע פרופילי ביטוי הגנום במהלך היווצרות שורש לרוחב. LRIS הניב ידע משמעותי כבר על התחלה לרוחב שורש בארבידופסיס ותירס 9-13, אבל הצורך ליישם במערכת זו כדי מיני צמחים אחרים הופך ברור יותר ככל שיותר הגנומים רצף ויש עניין גובר להעברת ידע לחשוב חסכוניים מִין. הנה, הפרוטוקולים מפורטים של ארבידופסיס וLRISs התירס מקבלים. בשלב הבא, דוגמא של השימוש במערכת מסופקת, על ידי הממחיש כיצד ניתן להשתמש בנתוני transcriptomics צברו מLRIS התירס לזהות homologs הפונקציונלי שיש להם תפקיד שימור בייזום שורש לרוחב על פני מיני צמחים שונים. לבסוף, הנחיות כדי לייעל את LRIS למיני צמחים אחרים מוצעים.

<table border="0" cellpadding="0" cellspacing="0" width="1258">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">ARABIDOPSIS LRIS</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td style="width:551px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Seeds</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Arabidopsis seeds</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td>Col-0 ecotype</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Gas sterilization of seeds</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">micro-centrifuge tubes 1.5 ml</td>
			<td style="width:228px;">SIGMA-ALDRICH</td>
			<td style="width:119px;">0030 125.215</td>
			<td>Eppendorf microtubes 3810X, PCR clean</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">micro-centrifuge tubes 2 ml</td>
			<td style="width:228px;">SIGMA-ALDRICH</td>
			<td style="width:119px;">0030 120.094</td>
			<td>Eppendorf Safe-Lock microcentrifuge tubes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">hydrochloric acid</td>
			<td style="width:228px;">Merck KGaA</td>
			<td style="width:119px;">1,003,171,000</td>
			<td>37% (fuming) for analysis EMSURE ACS,ISO,Reag. Ph Eu</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">glass desiccator</td>
			<td style="width:228px;">SIGMA-ALDRICH</td>
			<td style="width:119px;"></td>
			<td>Pyrex</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:361px;">glass beaker</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">plastic micro-centrifuge tubes box or holder</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Bleach sterilization of seeds</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">ethanol</td>
			<td style="width:228px;">Chem-Lab nv</td>
			<td style="width:119px;">CL00.0505.1000</td>
			<td>Ethanol, abs. 100% a.r. dilute to 70%</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">sodium hypochlorite (NaOCl)</td>
			<td style="width:228px;">Carl Roth</td>
			<td style="width:119px;">9062.3</td>
			<td>12%</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Tween 20</td>
			<td style="width:228px;">SIGMA-ALDRICH</td>
			<td style="width:119px;">P1379</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">sterile water</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Growth medium</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Murashige and Skoog salt mixture</td>
			<td style="width:228px;">DUCHEFA Biochemie B.V.</td>
			<td style="width:119px;">M0221-0050</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">myo-inositol</td>
			<td style="width:228px;">SIGMA-ALDRICH</td>
			<td style="width:119px;">I5125-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">2-(N-morpholino)ethanesulfonic acid (MES)</td>
			<td style="width:228px;">DUCHEFA Biochemie B.V.</td>
			<td style="width:119px;">M1503.0100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">sucrose</td>
			<td style="width:228px;">VWR, Internation LLC</td>
			<td style="width:119px;">27483.294</td>
			<td>D(+)-Sucrose Ph. Eur.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">KOH</td>
			<td style="width:228px;">Merck KGaA</td>
			<td style="width:119px;">1050211000</td>
			<td>pellets for analysis (max. 0.002% Na) EMSURE ACS,ISO,Reag. Ph Eur</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Plant Tissue Culture Agar</td>
			<td style="width:228px;">LabM Limited</td>
			<td style="width:119px;">MC029</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Lateral root induction chemicals</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">N-1-naphthylphthalamic acid (NPA)</td>
			<td style="width:228px;">DUCHEFA Biochemie B.V.</td>
			<td style="width:119px;">No. N0926.0250</td>
			<td>10 &#181;M (Arabidopsis)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">1-naphthalene acetic acid (NAA)</td>
			<td style="width:228px;">DUCHEFA Biochemie B.V.</td>
			<td style="width:119px;">No. N0903.0050</td>
			<td>10 &#181;M (Arabidopsis)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">dimethylsulfoxide (DMSO)</td>
			<td style="width:228px;">SIGMA-ALDRICH</td>
			<td style="width:119px;">494429-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Making a mesh for transfer</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">nylon mesh</td>
			<td style="width:228px;">Prosep byba</td>
			<td style="width:119px;"></td>
			<td>Synthetic nylon mesh 20 &#181;m</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Sowing and seedling handling</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">square petri dish plates</td>
			<td style="width:228px;">GOSSELIN</td>
			<td style="width:119px;">BP124-05</td>
			<td>12 x 12 cm</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">50 ml DURAN tubes</td>
			<td style="width:228px;">SIGMA-ALDRICH</td>
			<td style="width:119px;">CLS430304</td>
			<td>Corning&#160;50 mL centrifuge tubes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">drigalski</td>
			<td style="width:228px;">Carl Roth</td>
			<td style="width:119px;">K732.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">pipette</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">cut pipette tips</td>
			<td style="width:228px;">Daslab</td>
			<td style="width:119px;">162001X</td>
			<td>Universal 200, cut off 5 mm of tip before autoclaving</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">breathable tape&#160;</td>
			<td style="width:228px;">3M Deutschland GmbH</td>
			<td style="width:119px;">cat. no. 1530-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">tweezers</td>
			<td style="width:228px;">Fiers nv/sa</td>
			<td style="width:119px;">K342.1; K344.1</td>
			<td>Dumont tweezers type a nr 5; Dumont tweezers type e nr 7</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Growth conditions</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">growth room</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td>21 &#176;C, continuous light</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Materials</td>
			<td style="width:228px;">Company</td>
			<td style="width:119px;">Catalog</td>
			<td>Comments</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">MAIZE LRIS</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Seeds</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Maize kernels</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td>B-73</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Bleach sterilization of kernels</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:361px;">glass beaker</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">magnetic stirrer&#160;</td>
			<td style="width:228px;">Fiers nv/sa</td>
			<td style="width:119px;">C267.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">sodium hypochlorite (NaOCl)</td>
			<td style="width:228px;">Carl Roth</td>
			<td style="width:119px;">9062.3</td>
			<td>12%</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">sterile water</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Lateral root induction chemicals</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">N-1-naphthylphthalamic acid (NPA)</td>
			<td style="width:228px;">DUCHEFA Biochemie B.V.</td>
			<td style="width:119px;">No. N0926.0250</td>
			<td>50 &#181;M (maize primary root), 25 &#181;M (maize adventitious root)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">1-naphthalene acetic acid (NAA)</td>
			<td style="width:228px;">DUCHEFA Biochemie B.V.</td>
			<td style="width:119px;">No. N0903.0050</td>
			<td>50 &#181;M (maize)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">dimethylsulfoxide (DMSO)</td>
			<td style="width:228px;">SIGMA-ALDRICH</td>
			<td style="width:119px;">494429-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Sowing and seedling handling</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">paper hand towels</td>
			<td style="width:228px;">Kimberly-Clark Professional*</td>
			<td style="width:119px;">6681</td>
			<td>SCOTT Hand Towels - Roll / White; sheet size (24 x 46 cm)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">seed germination paper</td>
			<td style="width:228px;">Anchor Paper Company</td>
			<td style="width:119px;"></td>
			<td>10 X 15 38# seed germination paper</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">tweezers</td>
			<td style="width:228px;">Fiers nv/sa</td>
			<td style="width:119px;">K342.1; K344.1</td>
			<td>Dumont tweezers type a nr 5; Dumont tweezers type e nr 7</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">250 ml (centrifuge) tubes</td>
			<td style="width:228px;">SCHOTT DURAN</td>
			<td style="width:119px;">2160136</td>
			<td>approx. 5.6 cm diameter and 14.7 cm height&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">700 ml tubes</td>
			<td style="width:228px;">DURAN GROUP</td>
			<td style="width:119px;">213994609</td>
			<td>cylinders, round foot tube, D 60&#160; x 250</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">rack</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td>for maize tubes, home made</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">sterile water</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Growth conditions</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">growth cabinet</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td>27 &#176;C, continuous light, 70% relative humidity</td>
		</tr>
	</tbody>
</table>

lateral root inducible system in arabidopsis and maize

Lateral root development contributes significantly to the root system, and hence is crucial for plant growth. The study of lateral root initiation is however tedious, because it occurs only in a few cells inside the root and in an unpredictable manner. To circumvent this problem, a Lateral Root Inducible System (LRIS) has been developed. By treating seedlings consecutively with an auxin transport inhibitor and a synthetic auxin, highly controlled lateral root initiation occurs synchronously in the primary root, allowing abundant sampling of a desired developmental stage. The LRIS has first been developed for Arabidopsis thaliana, but can be applied to other plants as well. Accordingly, it has been adapted for use in maize (Zea mays). A detailed overview of the different steps of the LRIS in both plants is given. The combination of this system with comparative transcriptomics made it possible to identify functional homologs of Arabidopsis lateral root initiation genes in other species as illustrated here for the CYCLIN B1;1 (CYCB1;1) cell cycle gene in maize. Finally, the principles that need to be taken into account when an LRIS is developed for other plant species are discussed.

יישום של LRIS לבצע transcriptomics השוואתי של תהליך רוט ייזום הרוחב אחד יישומים של LRIS הוא ההשוואה וההתאמה של פרופילי ביטוי גנים במהלך היווצרות שורש לרוחב במינים שונים. transcriptomics השוואתי גישות ליצור את האפשרות להצביע גני orthologous המעורבים בתהליך פיתוח השורש לרוחב במינים שונים. חניכה לרוחב שורש, אשר מורכבת מההיווצרות של איבר חדש מקבוצת משנה של תאים כלולים בציר שורש כבר נוצר, היא המנגנון העיקרי המשותפים למכוסי זרע לשלוט ארכיטקטורת השורש שלהם. כתוצאה מכך, סביר מאוד שהוא התפתח ממסלולים קיימים כיום באב קדמון משותף ושימור לאורך אבולוציה. ואכן, רגולטורים פוטנציאליים משותפים של ייזום שורש לרוחב נמצאו במינים שונים &lt;sup&gt; 17, 18. דגימת חומר באמצעות LRIS בארבידופסיס ותירס, וtranscriptome ניתוח LRIS כבר נקבע בשני מינים שונים:. ארבידופסיס ותירס 10, 13 בשני המינים, הוחלט לדגום את הצמחים רק לפני טיפול NAA, וזמן קצר לאחר גיוס, בתחילת, או בתגובה לאוקסין, כ גם בתחילת, או בחטיבות הראשונות בpericycle. יתר על כן, הקרינה הופעל תא מיון 19 (FACS) שימשה בארבידופסיס או מיקרוסקופית לייזר לכידת 20, 21 (LCM) בתירס כדי לבחור עבור תאי pericycle. בארבידופסיס, נקודות הזמן של 2 ו -6 שעות לאחר האינדוקציה נבחרו מבוססות על אפיון תעתיק של pDR5 :: תגובת אוקסין גאס וpCYCB1; 1 :: קווי סמן מחזור תא גאס 9 (איור 3). בתירס, בפעם מצביעה 2, 3 ו -4 שעות לאחר אינדוקציה, נבחרו לאחר אפיון מיקרוסקופי של פעילות חלוקת תא והניתוח של ביטוי גנים כמה סמן מחזור התא באמצעות בזמן אמת תגובת השרשרת של פולימראז השעתוק לאחור כמותית (qRT-PCR) 13 . RNA הופק מהתאים המבודדים והכלאה על פלטפורמות microarray כמתואר 10, 13 בעבר. מציאת ortholog של ארבידופסיס CYCB1; 1 (AtCYCB1; 1) בתירס בארבידופסיס, קו הסמן pCYCB1; 1 :: גאס כבר בשימוש נרחב כדי לעקוב אחר החטיבות הראשונות של pericycle במהלך חניכת שורש לרוחב. סמן כזה יהיה מאודשימושי בתירס. כמה homologs של AtCYCB1; 1 נמצא בתירס (www.maizesequence.org, כל פפטידים, BLASTP, הגדרות ברירת מחדל). שישה מהם היו נוכחים בmicroarray בוצע לאחר LRIS בתירס והראו העשרה משמעותית. הלהיט תפציץ הטוב ביותר, GRMZM2G310115, הראה רמות גבוהות מאוד שעתוק לאחר LRIS, דומות למה שנצפה בארבידופסיס לAtCYCB1; 1 (איור 4). יישום של LRIS לבדוק ביטוי אישי ג&#39;ין כדי לאמת GRMZM2G310115 כortholog מועמד טוב של AtCYCB1; 1 בייזום שורש לרוחב תירס, בזמן אמת qRT-PCR על דגימות שנלקחו בנקודות זמן שונות בוצע במהלך LRIS 13. טופלו צמחים כפי שתואר בפרוטוקול הנ&quot;ל ונקטפו בנקודות זמן שונות: לפני Nטיפול AA (רט&quot;ג), ואחרי 2, 3 ו -4 שעות של טיפול NAA. כמו כן, חומר של צמחים גדלו רק במים שנקטפו להשוות ביטוי גנים בין LRIS ותנאים ניטראליים. מייד לאחר קציר, מגזרי שורש מתאים לאזור המורכב בין 5 מ&quot;מ ו -15 מ&quot;מ מעל קצה השורש נותחו תחת משקפת. באמצעות פינצטה, הקליפה הופרדה מהאסטלה (המכיל את pericycle), וRNA הופק משני הרקמות. השלב אחרון זה בוצע במקום LCM, כי זה מהיר יותר וזול יותר בהרבה לאימות. פריימרים qRT-PCR באמצעות קדימה בהתאמה הבאה ולהפוך, AGCAGGACGCAGTTGGAGAG וGAGCCGAGAGCACAGAAGAAAG, GRMZM2G310115 קבלו תוקף להיות על LRIS-מוסדר, ולהיות ספציפי לרקמות אסטלה (איור 5). בנוסף, ניסוי זה מראה כי ללא אינדוקציה סינכרוני, האירועים הבדידים חניכה שורש לרוחב קורים בשורש גדל במים אינם יכולים לאתר,<html> ולהמחיש את הצורך של LRIS לחשוף ביטוי גני ההפרש הקשורים לתהליך של חניכת שורש לרוחב. <img alt="איור 1" src="/files/ftp_upload/53481/53481fig1.jpg" /> איור 1. מערכת רוחב שורש עין מתנהל לארבידופסיס () הכנת רשת הניילון (20 מיקרומטר):. לחתוך את רשת הניילון (9 סנטימטר על ידי 9 סנטימטרים), לעטוף אותו בנייר אלומיניום ולשים אותו בכוס זכוכית למעוקר. (ב) החל את רשת הניילון על צלחת רשות הטבע והגנים המכילים (10 מיקרומטר) באמצעות פינצטה. לאחר מכן להשתמש drigalski סטרילי כדי למנוע בועות אוויר. (ג) לזרוע זרעים ברשת הניילון באמצעות pipet. (ד) לזרוע זרעים ברשת הניילון באמצעות קיסם. (ה) מעבירים את רשת הניילון לצלחת המכיל NAA (10 מיקרומטר) באמצעות פינצטה.81 53481fig1large.jpg &quot;target =&quot; / _ blank &quot;&gt; לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו. <img alt="איור 2" src="/files/ftp_upload/53481/53481fig2.jpg" /> איור 2. מערכת עין מתנהל שורש לרוחב לתירס. &#160; (א) הכנת גלילי נייר: מקום שתי שכבות של נייר (92 סנטימטרים X 24 סנטימטר, אורך של שני גיליונות) על גבי זה ולקפל אותם להכפיל על פני האורך (92 סנטימטרים X 12 סנטימטרים). (ב) שים 10 גרעיני תירס מעוקרים עם radicle פונה כלפי מטה על הנייר ב 2 סנטימטר מהחלק העליון עם interspacing של 8 סנטימטר. ואז לגלגל את הנייר, תוך שמירה על גרעיני התירס במקום. (ג) מניחים את גלילי נייר בצינורות (למשל, 250 מיליליטר צינורות צנטריפוגה) ולשים אותם במעמד. (ד) לגדול שתילי התירס במשך שלושה ימים בפתרון רט&quot;ג 50 מיקרומטר (ב 27 מעלות צלזיוס, אור רציף, humi היחסיdity 70%). (ה) משמאל: שתיל ממש לפני ההעברה לNAA; התיכון: חלקים רוחביים microtome רק לפני ההעברה לNAA ו- 2 ימים לאחר ההעברה לNAA; מימין:. שתיל עם שורשים לרוחב יצאו גלויים 5 ימים לאחר ההעברה לNAA <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53481/53481fig2large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 3" src="/files/ftp_upload/53481/53481fig3.jpg" /> איור 3. רוחב שורש ייזום מגורה עם כמובן NAA טיפול. (AF) זמן ממושך מראה את תגובת אוקסין במהלך טיפול NAA באמצעות שורת סמן pDR5 :: גאס. תגובת אוקסין, שהוא אחד מהאירועים הראשונים מפעילות ייזום שורש לרוחב, מתחילה 2 שעות לאחר תחילת טיפול NAA. בפנל העליון, סקירה של כל השתיל ניתן; הצג הפנל התחתוןזה תגובת אוקסין בקצה השורש. כמובן (GM) זמן של טיפול NAA באמצעות pCYCB1; קו סמן גאס 1 ::. אות גאס מייצגת את הביטוי של CYCB1; גן 1, המציין את חלוקות התא הראשונות שמובילות להיווצרות שורש לרוחב להתחיל 6 שעות לאחר תחילת טיפול NAA. בפנל העליון, סקירה של כל השתיל ניתן; הפנל התחתון מציג CYCB1;. ביטוי 1 בקצה השורש (מכתים גאס לפי Beeckman ואנגלר, 1994 22) <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53481/53481fig3large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 4" src="/files/ftp_upload/53481/53481fig4.jpg" /> פרופיל ביטוי של גני איור 4. CYCB1 בארבידופסיס והתירס בLRIS. </sטרונג&gt; &#160; () ערכי ביטוי Microarray של AtCYCB1; 1 בLRIS כפי שתואר על ידי דה et al Smet. 2,008 ערכי 10 microarray (ב &#39;) ביטוי של orthologs פוטנציאל של AtCYCB1; 1 בLRIS כפי שתואר על ידי אל יאנסן ואח. 2,013 ציון 13 BLASTP הוא הציון מתקבל כאשר פיצוץ רצף החלבון של AtCYCB1; 1 על הגנום התירס. ברים שגיאה להביע סטיית תקן ו** מייצג -value עמ ≤0.01. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53481/53481fig4large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 5" src="/files/ftp_upload/53481/53481fig5.jpg" /> איור 5. ביטוי של GRMZM2G310115 באסטלה וCortex של שורשי תירס במהלך LRIS. הביטוי של &lt;em&gt; GRMZM2G310115 במהלך LRIS בתירס הוערך על ידי בזמן אמת כמותי qRT-PCR על דגימות אסטלה וקליפה גזור. דגימה משלימה בוצעה על צמחים גדלים במים. ערכים היו מנורמלים לביטוי במצבה במים. ברים שגיאה להביע סטיית תקן ו** מייצג -value עמ ≤0.01 (פריימרים וגני התייחסות לפי Jansen et al. 2,013 13). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53481/53481fig5large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a>

Watch this Scientific Journal Video about Lateral Root Inducible System in Arabidopsis and Maize at JoVE.com

מערכת השראת שורש לרוחב בארבידופסיס ובתירס | ביולוגיה | וִידֵאוֹ

Lateral Root Inducible System in Arabidopsis and Maize

מערכת עין מתנהל שורש לרוחב ב<em&gt; ארבידופסיס</em&gt; ותירס

The Lateral Root Inducible System (LRIS) allows for synchronous induction of lateral roots and is presented for Arabidopsis thaliana and maize.

Lateral root development contributes significantly to the root system, and hence is crucial for plant growth. The study of lateral root initiation is ...

lateral-root-inducible-system-in-arabidopsis-and-maize

Nanyang Technological University

Research

Education

JoVE Journal

JoVE Core

Biology

Lateral Root Inducible System in Arabidopsis and Maize

Plant Biology

Plant Structure, Growth, and Nutrition

SCIENTISTS IN ACTION

13.6K Views.  Ghent. The Lateral Root Inducible System (LRIS) allows for synchronous induction of lateral roots and is presented for Arabidopsis thaliana and maize.

Video: Lateral Root Inducible System in Arabidopsis and Maize

Preparation and Maintenance of Dorsal Root Ganglia Neurons in Compartmented Cultures

Neurons extend axonal processes that are far removed from the cell body to innervate target tissues, where target-derived growth factors are required for neuronal survival and function. Neurotrophins are specifically required to maintain the survival and differentiation of innervating sensory neurons but the question of how these target-derived neurotrophins communicate to the cell body of innervating neurons has been an area of active research for over 30 years. The most commonly accepted model of how neurotrophin signals reach the cell body proposes that signaling endosomes carry this signal retrogradely along the axon. In order to study retrograde transport, a culture system was originally devised by Robert Campenot, in which cell bodies are isolated from their axons. The technique of preparing these compartmented chambers for culturing sensory neurons recapitulates the selective stimulation of neuron terminals that occurs in vivo following release of target-derived neurotrophins. Retrograde signaling events that require long-range microtubule dependent retrograde transport have important implications for the treatment of neurodegenerative disorders.

Here we describe the technique of preparing and maintaining compartmented chambers for culturing sensory neurons of the dorsal root ganglia.

הכנה ותחזוקה של הגב הגרעינים נוירונים רוט בתרבויות מחולקים

Neurons extend axonal processes that are far removed from the cell body to innervate target tissues, where target-derived growth factors are required for ...

Do-It-Yourself Device for Recovery of Cryopreserved Samples Accidentally Dropped into Cryogenic Storage Tanks

Liquid nitrogen is colorless, odorless, extremely cold (-196 &deg;C) liquid kept under pressure. It is commonly used as a cryogenic fluid for long term storage of biological materials such as blood, cells and tissues 1,2. The cryogenic nature of liquid nitrogen, while ideal for sample preservation, can cause rapid freezing of live tissues on contact - known as 'cryogenic burn'2, which may lead to severe frostbite in persons closely involved in storage and retrieval of samples from Dewars. Additionally, as liquid nitrogen evaporates it reduces the oxygen concentration in the air and might cause asphyxia, especially in confined spaces2.
In laboratories, biological samples are often stored in cryovials or cryoboxes stacked in stainless steel racks within the Dewar tanks1. These storage racks are provided with a long shaft to prevent boxes from slipping out from the racks and into the bottom of Dewars during routine handling. All too often, however, boxes or vials with precious samples slip out and sink to the bottom of liquid nitrogen filled tank. In such cases, samples could be tediously retrieved after transferring the liquid nitrogen into a spare container or discarding it. The boxes and vials can then be relatively safely recovered from emptied Dewar. However, the cryogenic nature of liquid nitrogen and its expansion rate makes sunken sample retrieval hazardous. It is commonly recommended by Safety Offices that sample retrieval be never carried out by a single person. Another alternative is to use commercially available cool grabbers or tongs to pull out the vials3. However, limited visibility within the dark liquid filled Dewars poses a major limitation in their use.
In this article, we describe the construction of a Cryotolerant DIY retrieval device, which makes sample retrieval from Dewar containing cryogenic fluids both safe and easy.

Here we present a low cost, durable cryotolerant device for sample retrieval from Dewar tanks filled with liquid nitrogen. The ease of construction and modular design of the device makes the process of sample retrieval from cryogenic tanks safe and easy.

עשה זאת בעצמך התקן להבראת דוגמאות Cryopreserved בטעות ירד לתוך טנקים אחסון קריוגני

Liquid nitrogen is colorless, odorless, extremely cold (-196 &deg;C) liquid kept under pressure. It is commonly used as a cryogenic fluid for long term ...

Using Flatbed Scanners to Collect High-resolution Time-lapsed Images of the Arabidopsis Root Gravitropic Response

Research efforts in biology increasingly require use of methodologies that enable high-volume collection of high-resolution data. A challenge laboratories can face is the development and attainment of these methods. Observation of phenotypes in a process of interest is a typical objective of research labs studying gene function and this is often achieved through image capture. A particular process that is amenable to observation using imaging approaches is the corrective growth of a seedling root that has been displaced from alignment with the gravity vector. Imaging platforms used to measure the root gravitropic response can be expensive, relatively low in throughput, and/or labor intensive. These issues have been addressed by developing a high-throughput image capture method using inexpensive, yet high-resolution, flatbed scanners. Using this method, images can be captured every few minutes at 4,800 dpi. The current setup enables collection of 216 individual responses per day. The image data collected is of ample quality for image analysis applications.

This protocol describes a process for rapid collection of images of Arabidopsis seedlings responding to a gravity stimulus using commercially-available flatbed scanners. The method allows for inexpensive, high-volume capture of high-resolution images amenable for downstream analysis algorithms.

שימוש במשטח סורקים לאיסוף תמונות-פקע זמן ברזולוציה גבוהה של ארבידופסיס רוט Gravitropic התגובה

Research efforts in biology increasingly require use of methodologies that enable high-volume collection of high-resolution data. A challenge laboratories ...

An Assay for Lateral Line Regeneration in Adult Zebrafish

Due to the clinical importance of hearing and balance disorders in man, model organisms such as the zebrafish have been used to study lateral line development and regeneration. The zebrafish is particularly attractive for such studies because of its rapid development time and its high regenerative capacity. To date, zebrafish studies of lateral line regeneration have mainly utilized fish of the embryonic and larval stages because of the lower number of neuromasts at these stages. This has made quantitative analysis of lateral line regeneration/and or development easier in the earlier developmental stages. Because many zebrafish models of neurological and non-neurological diseases are studied in the adult fish and not in the embryo/larvae, we focused on developing a quantitative lateral line regenerative assay in adult zebrafish so that an assay was available that could be applied to current adult zebrafish disease models. Building on previous studies by Van Trump et al.17&#160;that described procedures for ablation of hair cells in adult Mexican blind cave fish and zebrafish (Danio rerio), our assay was designed to allow quantitative comparison between control and experimental groups. This was accomplished by developing a regenerative neuromast standard curve based on the percent of neuromast reappearance over a 24 hr time period following gentamicin-induced necrosis of hair cells in a defined region of the lateral line. The assay was also designed to allow extension of the analysis to the individual hair cell level when a higher level of resolution is required.

Because many zebrafish models of neurological and non-neurological diseases are studied in the adult fish rather than the embryo/larvae, we developed a quantitative lateral line regenerative assay that can be applied to adult zebrafish disease models. The assay involved resolution at the 1) neuromast and 2) individual hair cell levels.

Assay עבור התחדשות קו לרוחב בדג הזברה למבוגר

Due to the clinical importance of hearing and balance disorders in man, model organisms such as the zebrafish have been used to study lateral line ...

Measuring Spatial and Temporal Ca2+ Signals in Arabidopsis Plants

Developmental and environmental cues induce Ca2+ fluctuations in plant cells. Stimulus-specific spatial-temporal Ca2+ patterns are sensed by cellular Ca2+ binding proteins that initiate Ca2+ signaling cascades. However, we still know little about how stimulus specific Ca2+ signals are generated. The specificity of a Ca2+ signal may be attributed to the sophisticated regulation of the activities of Ca2+ channels and/or transporters in response to a given stimulus. To identify these cellular components and understand their functions, it is crucial to use systems that allow a sensitive and robust recording of Ca2+ signals at both the tissue and cellular levels. Genetically encoded Ca2+ indicators that are targeted to different cellular compartments have provided a platform for live cell confocal imaging of cellular Ca2+ signals. Here we describe instructions for the use of two Ca2+ detection systems: aequorin based FAS (film adhesive seedlings) luminescence Ca2+ imaging and case12 based live cell confocal fluorescence Ca2+ imaging. Luminescence imaging using the FAS system provides a simple, robust and sensitive detection of spatial and temporal Ca2+ signals at the tissue level, while live cell confocal imaging using Case12 provides simultaneous detection of cytosolic and nuclear Ca2+ signals at a high resolution.

Measuring Spatial and Temporal Ca2+ Signals in Arabidopsis Plants

Ca2+ signaling regulates diverse biological processes in plants. Here we present approaches for monitoring abiotic stress induced spatial and temporal Ca2+ signals in Arabidopsis cells and tissues using the genetically encoded Ca2+ indicators Aequorin or Case12.

מדידת מרחב ובזמן Ca<sup&gt; 2 +</sup&gt; אותות בצמחים ארבידופסיס

Developmental and environmental cues induce Ca2+ fluctuations in plant cells. Stimulus-specific spatial-temporal Ca2+ patterns are sensed by cellular Ca2+ ...

High Resolution Quantification of Crystalline Cellulose Accumulation in Arabidopsis Roots to Monitor Tissue-specific Cell Wall Modifications

Plant cells are surrounded by a cell wall, the composition of which determines their final size and shape. The cell wall is composed of a complex matrix containing polysaccharides that include cellulose microfibrils that form both crystalline structures and cellulose chains of amorphous organization. The orientation of the cellulose fibers and their concentrations dictate the mechanical properties of the cell. Several methods are used to determine the levels of crystalline cellulose, each bringing both advantages and limitations. Some can distinguish the proportion of crystalline regions within the total cellulose. However, they are limited to whole-organ analyses that are deficient in spatiotemporal information. Others relying on live imaging, are limited by the use of imprecise dyes. Here, we report a sensitive polarized light-based system for specific quantification of relative light retardance, representing crystalline cellulose accumulation in cross sections of Arabidopsis thaliana roots. In this method, the cellular resolution and anatomical data are maintained, enabling direct comparisons between the different tissues composing the growing root. This approach opens a new analytical dimension, shedding light on the link between cell wall composition, cellular behavior and whole-organ growth.

High Resolution Quantification of Crystalline Cellulose Accumulation in Arabidopsis Roots to Monitor Tissue-specific Cell Wall Modifications

Crystalline cellulose is an important constituent of the plant cell wall. However, its quantification at a cellular resolution is technically challenging. Here, we report the use of polarized light technology and root cross sections to obtain information of cell wall composition at a spatiotemporal resolution.

כימות רזולוציה גבוהות של הצטברות צלולוזת גבישים ב<em&gt; ארבידופסיס</em&gt; שורשי לפקח סלולארי רקמות ספציפיות קיר שינויים

Plant cells are surrounded by a cell wall, the composition of which determines their final size and shape. The cell wall is composed of a complex matrix ...

Micron-scale Phenotyping Techniques of Maize Vascular Bundles Based on X-ray Microcomputed Tomography

It is necessary to accurately quantify the anatomical structures of maize materials based on high-throughput image analysis techniques. Here, we provide a 'sample preparation protocol' for maize materials (i.e., stem, leaf, and root) suitable for ordinary microcomputed tomography (micro-CT) scanning. Based on high-resolution CT images of maize stem, leaf, and root, we describe two protocols for the phenotypic analysis of vascular bundles: (1) based on the CT image of maize stem and leaf, we developed a specific image analysis pipeline to automatically extract 31 and 33 phenotypic traits of vascular bundles; (2) based on the CT image series of maize root, we set up an image processing scheme for the three-dimensional (3-D) segmentation of metaxylem vessels, and extracted two-dimensional (2-D) and 3-D phenotypic traits, such as volume, surface area of metaxylem vessels, etc. Compared with traditional manual measurement of vascular bundles of maize materials, the proposed protocols significantly improve the efficiency and accuracy of micron-scale phenotypic quantification.

We provide a novel method to improve the X-ray absorption contrast of maize tissue suitable for ordinary microcomputed tomography scanning. Based on CT images, we introduce a set of image-processing workflows for different maize materials to effectively extract microscopic phenotypes of vascular bundles of maize.

טכניקות Phenotyping בקנה מידה מיקרון של חבילות וסקולריים תירס מבוסס על צילום רנטגן טומוגרפיה Microcomputed

It is necessary to accurately quantify the anatomical structures of maize materials based on high-throughput image analysis techniques. Here, we provide a ...

Wide-Field, Real-Time Imaging of Local and Systemic Wound Signals in Arabidopsis

Plants respond to mechanical stresses such as wounding and herbivory by inducing defense responses both in the damaged and in the distal undamaged parts. Upon wounding of a leaf, an increase in cytosolic calcium ion concentration (Ca2+ signal) occurs at the wound site. This signal is rapidly transmitted to undamaged leaves, where defense responses are activated. Our recent research revealed that glutamate leaking from the wounded cells of the leaf into the apoplast around them serves as a wound signal. This glutamate activates glutamate receptor-like Ca2+ permeable channels, which then leads to long-distance Ca2+ signal propagation throughout the plant. The spatial and temporal characteristics of these events can be captured with real-time imaging of living plants expressing genetically encoded fluorescent biosensors. Here we introduce a plant-wide, real-time imaging method to monitor the dynamics of both the Ca2+ signals and changes in apoplastic glutamate that occur in response to wounding. This approach uses a wide-field fluorescence microscope and transgenic Arabidopsis plants expressing Green Fluorescent Protein (GFP)-based Ca2+ and glutamate biosensors. In addition, we present methodology to easily elicit wound-induced, glutamate-triggered rapid and long-distance Ca2+ signal propagation. This protocol can also be applied to studies on other plant stresses to help investigate how plant systemic signaling might be involved in their signaling and response networks.

Wide-Field, Real-Time Imaging of Local and Systemic Wound Signals in Arabidopsis

Extracellular glutamate-triggered systemic calcium signaling is critical for the induction of plant defense responses to mechanical wounding and herbivore attack in plants. This article describes a method to visualize the spatial and temporal dynamics of both these factors using Arabidopsis thaliana plants expressing calcium- and glutamate-sensitive fluorescent biosensors.

שדה רחב, הדמיה בזמן אמת של אותות פצע מקומיים ומערכתיים ב Arabidopsis

Plants respond to mechanical stresses such as wounding and herbivory by inducing defense responses both in the damaged and in the distal undamaged parts. ...

Divergence of Root Microbiota in Different Habitats based on Weighted Correlation Networks

The root microbiome plays an important role in plant growth and environmental adaptation. Network analysis is an important tool for studying communities, which can effectively explore the interaction relationship or co-occurrence model of different microbial species in different environments. The purpose of this manuscript is to provide details on how to use the weighted correlation network algorithm to analyze different co-occurrence networks that may occur in microbial communities due to different ecological environments. All analysis of the experiment is performed in the WGCNA package. WGCNA is an R package for weighted correlation network analysis. The experimental data used to demonstrate these methods were microbial community data from the NCBI (National Center for Biotechnology Information) database for three niches of the rice (Oryza sativa) root system. We used the weighted correlation network algorithm to construct co-abundance networks of microbial community in each of the three niches. Then, differential co-abundance networks among endosphere, rhizoplane and rhizosphere soil were identified. In addition, the core genera in network were obtained by the "WGCNA" package, which plays an important regulated role in network functions. These methods enable researchers to analyze the response of microbial network to environmental disturbance and verify different microbial ecological response theories. The results of these methods show that the significant differential microbial networks identified in the endosphere, rhizoplane and rhizosphere soil of rice.

Network analysis was applied to evaluate the association of various ecological microbial communities, such as soil, water and rhizosphere. Presented here is a protocol on how to use the WGCNA algorithm to analyze different co-occurrence networks that may occur in the microbial communities due to different ecological environments.

סטייה של מיקרוביוטה שורש בבתי גידול שונים המבוססת על רשתות מתאם משוקללים

The root microbiome plays an important role in plant growth and environmental adaptation. Network analysis is an important tool for studying communities, ...

A Simple Protocol for Mapping the Plant Root System Architecture Traits

Comprehensive knowledge of plant root system architecture (RSA) development is critical for improving nutrient use efficiency and increasing crop cultivar tolerance to environmental challenges. An experimental protocol is presented for setting up the hydroponic system, plantlet growth, RSA spreading, and imaging. The approach used a magenta box-based hydroponic system containing polypropylene mesh supported by polycarbonate wedges. Experimental settings are exemplified by assessing the RSA of the plantlets under varying nutrient (phosphate [Pi]) supply. The system was established to examine the RSA of Arabidopsis, but it is readily adaptable to study other plants like Medicago sativa (Alfalfa). Arabidopsis thaliana (Col-0) plantlets are used in this investigation as an example to understand the plant RSA. Seeds are surface sterilized by treating ethanol and diluted commercial bleach, and kept at 4 &#176;C for stratification. The seeds are germinated and grown on a liquid half-MS medium on a polypropylene mesh supported by polycarbonate wedges. The plantlets are grown under standard growth conditions for the desired number days, gently picked out from the mesh, and submersed in water-containing agar plates. Each root system of the plantlets is spread gently on the water-filled plate with the help of a round art brush. These Petri plates are photographed or scanned at high resolution to document the RSA traits. The root traits, such as primary root, lateral roots, and branching zone, are measured using the freely available ImageJ software. This study provides techniques for measuring plant root characteristics in controlled environmental settings. We discuss how to (1) grow the plantlets, and collect and spread root samples, (2) obtain pictures of spread RSA samples, (3) capture the images, and (4) use image analysis software to quantify root attributes. The advantage of the present method is the versatile, easy, and efficient measurement of the RSA traits.

We use simple laboratory tools to examine the root system architecture (RSA) of Arabidopsis and Medicago. The plantlets are grown hydroponically over mesh and spread using an art brush to reveal the RSA. Images are taken using scanning or a high-resolution camera, then analyzed with ImageJ to map traits.

פרוטוקול פשוט למיפוי תכונות ארכיטקטורת מערכת שורש הצמח

Comprehensive knowledge of plant root system architecture (RSA) development is critical for improving nutrient use efficiency and increasing crop cultivar ...