The authors thank Davy Opdenacker for technical assistance and photography. We greatly thank Dr. Annick Bleys for helpful suggestions to improve the manuscript. This work was financed by the Interuniversity Attraction Poles Programme IUAP P7/29 'MARS' from the Belgian Federal Science Policy Office, by the FWO grant G027313N and by the Agency for Innovation by Science and Technology, IWT (IR).

1. Arabidopsis IRIs Protocol Nota: O texto refere-se a experiências &quot;pequenas&quot; ou &quot;grandes&quot; escala. Experimentos de pequena escala, como a análise de linha de marcação e coloração histológica 6, 14, exigem apenas algumas amostras. Experiências em larga escala, tais como em tempo real quantitativa qRT-PCR, as micro-matrizes de 9-11 ou de sequenciação de ARN, requerem uma maior quantidade de amostras. Como tal, uma quantidade de ~ 1000 mudas por amostra foi utilizada por Vanneste et al 11. Executar experiência microarray após dissecção segmento de raiz. DIA 1 <ol><li> A esterilização de sementes de Arabidopsis Nota: Selecione um dos seguintes procedimentos de esterilização de sementes. Qualquer um deles é adequado para as próximas etapas do protocolo. Esterilização de gás (1.1.2) apresenta duas principais vantagens sobre a esterilização líquida (1.1.1): leva menos tempo ao manusear uma grande entorpecidoer de sementes, uma vez que não tem de ocorrer pipetagem para as amostras individuais; e as sementes esterilizadas podem ser armazenados por um período mais longo. No entanto, isso exige um exsicador e tratamento cuidadoso. <ol><li> Esterilização líquido <ol><li> Despeje o número desejado de sementes em tubos de micro-centrífuga. Utilizar-se a 20 mg (~ 800 sementes) em um tubo de 1,5 ml ou de 40 mg (~ 1600 sementes) em tubos de 2 ml de micro-centrífuga. </li><li> Adicionar 1 ml de etanol a 70%. Inverter ou agitar suavemente por 2 min. </li><li> Substituir o etanol a 70% com 1 ml de solução de esterilização durante 15 min. (Preparar uma solução de solução de esterilização: 3,85 ml de hipoclorito de sódio (NaOCl) de ações (12%) (ATENÇÃO: Use exaustor), 5 ul Tween 20, até 10 ml com água Inverta os tubos várias vezes para se certificar de que todas as sementes vir. em contacto com a solução. </li><li> Em uma câmara de fluxo laminar de ar, substituir a solução de esterilização com 1 ml de água destilada estéril e lavar as sementes 5 vezes durante 5 min por repetidasly substituindo com 1 ml de água estéril destilada fresca. </li></ol></li><li> Esterilização por gás <ol><li> Verter o número desejado de sementes num tubo de micro-centrifugadora de 2 ml. Use tubos individuais quando se trabalha com várias linhas independentes, e organizá-los em uma caixa aberta tubos micro-centrífuga de plástico ou titular. Se o número de sementes em um tubo superior a 500 (12,5 mg), subdividir as sementes do número apropriado de tubos para assegurar a esterilização bem sucedida. Certifique-se as tampas de tubos vizinhos não cobrem uns aos outros. Encaixar a tampa da caixa na parte inferior, uma vez que necessita de estar no exsicador, bem como para esterilização. </li><li> Coloque a caixa na tigela de um secador, juntamente com um copo de vidro (ATENÇÃO: Use exaustor). </li><li> Encha o copo com 100 ml de 12% NaOCl (ATENÇÃO: Use extractor de fumo). Colocar a tampa no exsicador, mas deixar uma pequena abertura, onde o copo é colocado. </li><li> Adicionar 3 ml de ácido clorídrico a 37% (fumegante) (CAUÇÃO: Use exaustor) para o copo através da pequena abertura e rapidamente fechar o exsicador. A vontade bolha solução por algum tempo devido à formação Cl 2 -gas. Deixar o sistema fechado O / N (ou, pelo menos, 8 horas). </li><li> Remover a tampa do exsicador. Retire a caixa e cobri-lo com a tampa para evitar a contaminação durante o transporte. </li><li> Coloque a caixa em um armário de fluxo de ar laminar, retire a tampa e deixar as sementes para cerca de 1 hora à temperatura ambiente para permitir a libertação de gás. Nota: As sementes podem ser armazenadas com segurança a seco em tubos de micro-centrifugação de fechadas durante até 2 semanas a 4 ° C. </li></ol></li></ol></li><li> A indução de raízes laterais em Arabidopsis <ol><li> Lateral Root Inibição (Tratamento NPA) <ol><li> Prepare meio de crescimento para o crescimento in vitro. O meio contém metade da força Murashige e Skoog mistura de sal de 15, 0,1 g / l de mio-inositol, 10 g / L de sacarose, e é tamponado com 0,5g / L de 2- (N-morfolino) etanossulfónico (MES). </li><li> Ajustar o pH para 5,7 com 1 M de KOH. Adiciona-se 8 g / L de agar de tecido da planta e do meio de autoclave durante 20 min a 121 ° C. </li><li> Prepare uma solução estoque 25 mM de NPA em dimetilsulfóxido (DMSO) (ATENÇÃO: Usar luvas). Em uma câmara de fluxo laminar de ar, arrefecer o meio autoclavado para baixo para cerca de 65 ° C (que é a temperatura à qual a garrafa pode ser realizada à mão), e adicionar solução de estoque 25 NPA mM para obter uma concentração final de 10 uM NPA. </li><li> Homogeneizar em cima disso agitando a garrafa por 10 s. Pour 50 ml de meio por prato de petri quadrado (12 cm x 12 cm). Nota: Em caso de experimento em grande escala, aplique uma malha de nylon (20 mm) para garantir a fácil transferência. Prepara-se uma malha (9 cm x 9 cm) por tratamento em autoclave (Figura 1A). Quando autoclavado, aplicar a malha para o meio de crescimento estéril utilizando pinças (Figura 1B). Empurre a malha para o meio de crescimento usando um sterilized drigalsky para se certificar de que está em bom contato com o meio de crescimento (Figura 1B) (ATENÇÃO: O trabalho em condições estéreis). </li><li> Semear as sementes nos NPA-placas. Nota: No caso de um experimento em grande escala está prevista, semear 2 linhas densas e bem-alinhados de 50 sementes para facilitar a recolha de amostras (ver 1.2.2.3). <ol><li> Em caso de esterilização líquido, semear as sementes no NPA placas usando uma pipeta de 200 mL. Cortar 3 - 4 mm da extremidade das pontas conta-gotas em condições estéreis (ou antes da esterilização das pontas), a fim de ser capaz de pipetar com as sementes. Pipeta cima e para baixo algumas vezes para voltar a suspender as sementes, em seguida, pipete água cerca de 150 mL estéril com 10 - 20 sementes e esperar até que o sedimento sementes na parte inferior da ponta. (ATENÇÃO: O trabalho em condições estéreis) Nota: Quando tocar o agar ou a malha suavemente com a ponta, uma gota de água com uma semente vai ser libertado a partir dele (Figura 1C). </li> &lt;li&gt; Em caso de esterilização por gás, semear as sementes usando autoclavado toothpicks.Pinch o palito no agar antes de tomar as sementes para garantir uma superfície pegajosa. Escolher-se a sementes, um a um utilizando o palito e distribuir as sementes nas placas (Figura 1D). Como alternativa, adicione a água estéril para as sementes e semear como descrito em 1.2.1.5.1 (ATENÇÃO: O trabalho em condições estéreis). </li></ol></li><li> Selar as placas com fita adesiva respirável e armazená-los placas a 4 ° C no escuro durante pelo menos 2 dias e máximo de uma semana. Isso é necessário para estratificação e garante sincronizados e germinação mais eficiente. Nota: Como alternativa, as sementes podem ser estratificada antes da semeadura, imersa em água destilada em micro-centrífuga de tubos, o que requer menos espaço frigorífico. Neste caso, os tubos para armazenar pelo menos uma semana a 4 ° C, e mover as placas para a câmara de crescimento imediatamente após a sementeira (ver 1.2.1.7). DIA 3 </li&gt; <li> Mover as placas para a câmara de crescimento (luz contínua (110 μE m -2 s -1), 21 ° C) durante 5 dias (2 dias de germinação e 3 dias de crescimento) numa posição quase vertical (80 a 90 °) para assegurar o crescimento das raízes, e não na forma. DIA 8 </li></ol></li><li> Lateral Root indução (tratamento NAA) <ol><li> Prepara-se o mesmo meio de crescimento como descrito em 1.2.1.1 1.2.1.2 e. Prepare uma solução estoque de 50 mM NAA em DMSO (CUIDADO: Use luvas). Arrefece-se o meio autoclavado para baixo a 65 ° C e adicionar solução de NAA para a forma a obter uma concentração final de 10 uM de NAA (CUIDADO: O trabalho em condições estéreis). <ol><li> Homogeneizar em cima disso agitando a garrafa por 10 s. Pour 50 ml de meio por prato de petri quadrado (12 cm x 12 cm). </li></ol></li><li> Transferir as mudas das placas contendo o meio de crescimento suplementado com 10 ^ M para os ANP suptadas com 10 mM NAA. <ol><li> Gancho nos braços de uma pinça curvas sob os cotilédones de plântulas e gentilmente removê-lo da placa. Transferir apenas mudas de que as raízes têm crescido inteiramente em contacto com o meio de crescimento NPA-e, de preferência baixo. </li><li> Skim a raiz sobre a superfície do meio de crescimento contendo NAA sobre uma pequena distância. Certifique-se que as raízes das plantas estão em bom contato com o meio de crescimento. Se necessário, pressione a raiz suavemente para a superfície de meio de crescimento com a pinça. Nota: Em caso de uma experiência em larga escala, remover todas as plântulas que não estão em contacto com a malha e de transferência, levantando a malha nos dois cantos superiores com uma pinça. Certifique-se a malha está em bom contato com o meio contendo NAA por desnatação a malha sobre a superfície de ágar sobre uma pequena distância (Figura 1E). </li></ol></li><li> Selar as novas placas com fita respirável e colocá-los no armário de crescimento (conluz contínuo (110 μE m -2 s -1), 21 ° C) numa posição vertical durante o tempo desejado após a indução até à colheita. Nota: Em caso de uma experiência em larga escala, usa um bisturi para cortar os segmentos de raiz de uma só vez directamente sobre a malha e prove-las por raspagem suave da superfície da malha. </li></ol></li></ol></li></ol> 2. IRIs Milho Protocol <ol><li> Estratificação de milho Grãos <ol><li> Incubar os grãos de milho a 4 ° C no escuro durante pelo menos 1 semana. Nota: Este protocolo foi desenvolvido usando as linhas puras de milho B73. </li></ol></li><li> Esterilização de milho Grãos DIA 1 Nota: Embora plântulas de milho não tem que ser cultivadas em condições estéreis, é recomendado para esterilizar os grãos de milho e trabalhar com material estéril para evitar o crescimento de fungos no rolo de papelsistema. <ol><li> Coloque o número necessário de grãos de milho em um copo de vidro esterilizado. </li><li> Adicione 100 ml de solução de esterilização (6% NaOCl em água) (ATENÇÃO: Use exaustor). </li><li> Adicionar uma barra de agitação magnética e colocar o copo num agitador magnético de agitação a baixa velocidade (aproximadamente 250 rpm) a temperatura ambiente durante 5 min. </li><li> Lavar cinco vezes durante 5 min, substituindo a solução com 100 ml de água estéril fresco. </li></ol></li><li> Semeadura do milho Sementes <ol><li> Calçar luvas para reduzir o risco de contaminação e tomar um rolo de toalhas de papel. </li><li> Rasgue dois trechos de papel toalha de mão com um comprimento total de duas folhas (aproximadamente 92 centímetros x 24 cm) e coloque-os em cima uns dos outros em uma superfície limpa (Figura 2A). </li><li> Dobrar as folhas dobrar ao longo do comprimento (cerca de 92 cm x 12 cm) (Figura 2A). </li><li> Use uma pinça para distribuir 10 núcleos em aproximadamente 2 cm da parte superior sobre tele todo o comprimento do papel, enquanto mantendo um espaço intermédio de 8 cm entre cada núcleo e 8 cm livre em ambas as extremidades (Figura 2B). Certifique-se a radícula do kernel está voltada para baixo e para o papel (Figura 2B). </li><li> Rolo delicadamente o papel ao longo do comprimento, mantendo as sementes no lugar (Figura 2B). Para facilitar o rolamento, é opcional a primeira pulverizar o papel com água estéril. </li><li> Coloque os rolos de papel em tubos de vidro esterilizados de cerca de 6 cm de diâmetro e 14 cm de altura (por exemplo, 250 ml tubos de centrífuga) e colocá-los em um rack (Figura 2C). </li></ol></li><li> A indução de raízes laterais em Maize <ol><li> Prepare uma solução a 50 mM estoque NPA (dissolvido em DMSO) (ATENÇÃO: Usar luvas). </li><li> Para cada tubo, fazer uma solução 50 fiM NPA adicionando 125 ul da solução de estoque 50 mM de ANP a 125 ml de água estéril num recipiente de vidro esterilizado. </li><li> Misture bem eColoque 125 ml de uma solução a 50 uM ANP sobre o rolo de papel no tubo. O rolo de papel irá absorver a solução e tornar-se completamente encharcado. Nota: Ao usar rolos de papel e tubos com outras dimensões, ajustar o volume em conformidade. O líquido deve chegar na metade do tubo para garantir a absorção suficiente. </li><li> Coloque o sistema de rolo de papel em uma câmara de crescimento durante três dias (27 ° C, luz contínua, 70% de humidade relativa). Certifique-se de que os rolos de papel permanecer embebido através da adição de solução adicional NPA 50 uM, uma vez que a solução evapora-se ao longo do tempo (Figura 2D). DIA 4 </li><li> Prepare uma solução a 50 mM NAA estoque (dissolvido em DMSO) (ATENÇÃO: Usar luvas). </li><li> Para cada tubo, preparar uma solução de NAA 50 uM por adição de 125 ul de estoque a 50 mM a NAA 125 ml de água estéril num recipiente de vidro esterilizado. </li><li> Aperte delicadamente a maior parte do NPA solução remanescente dos rolos de papel e colocar om em água estéril durante 5 min para lavá-lo para fora (CUIDADO: Use luvas). Espremer suavemente a maior parte da água a partir dos rolos de papel. Repita este passo de lavagem três vezes. </li><li> Misture bem e despeje a solução NAA 50 mM ao longo dos rolos de papel nos tubos. Certifique-se de que eles estão completamente encharcado. </li><li> Colocar o sistema de rolo de papel na câmara de crescimento (27 ° C, a luz contínua, 70% de humidade relativa) durante a duração desejada após a indução. </li></ol></li><li> A indução de raízes laterais em raízes adventícias coroa de milho Nota: O IRIs como descrito acima induz raízes laterais na raiz principal. No entanto, em milho e outras monocotiledôneas, a raiz primária e as raízes seminais embrionárias, juntamente com as suas raízes laterais, são principalmente importante durante o desenvolvimento de mudas. Numa fase posterior no crescimento das plantas, as raízes adventícias pós-embrionárias surgir na haste e também desenvolver raízes laterais para formar um novo sistema radicular 16. O IRIs também pode ser usadod para induzir raízes laterais sobre essas raízes adventícias coroa pós-embrionárias, seguindo alguns pequenos ajustes para a IRIs na raiz primária embrionário. <ol><li> Para fazer com que os rolos de papel, criar um sanduíche de papéis com, respectivamente, duas camadas de papel toalha de mão sobre o lado exterior, e duas camadas de papel de germinação dentro. Coloque os grãos esterilizados (ver passos 2.1 e 2.2), entre as duas folhas de papel de germinação. Papel de germinação, em comparação com papel toalha de mão, será menos propenso a ser penetrado por pêlos radiculares e das raízes laterais, o que fará a abertura da rolos de papel mais fácil depois. Por outro lado, as duas camadas exteriores de papel toalha de mão irá facilitar a absorção do líquido. </li><li> Insira os rolos em 700 ml tubos de vidro e despeje água estéril sem NPA sobre eles. Certifique-se de que eles estão completamente encharcado. </li><li> Germinar as sementes esterilizadas no gabinete do crescimento (ver passo 2.4.9). </li><li> Crescer as mudas até as raízes adventícias coroacomeçam a surgir (6 dias para o B73). Certifique-se os rolos de papel são mantidos úmido em todos os momentos por adição de água estéril, quando necessário. </li><li> Transferir para uma solução a 25 uM NPA durante 4 dias (ver passos 2.4.1 a 2.4.4), seguido por uma indução semelhante de iniciação de raízes laterais, substituindo a solução com uma solução NPA NAA 50 uM após uma etapa de lavagem (ver passo 2.4 0,5 a 2.4.9). </li></ol></li></ol>

<ol>
	<li>Van Norman, J. M., Xuan, W., Beeckman, T., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=To+branch+or+not+to+branch:+the+role+of+pre-patterning+in+lateral+root+formation.">To branch or not to branch: the role of pre-patterning in lateral root formation.</a> Development. 140, 4301-4310 (2013).</li><li>Dolan, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+organisation+of+the+Arabidopsis+thaliana+root.">Cellular organisation of the Arabidopsis thaliana root.</a> Development. 119, 71-84 (1993).</li><li>Bell, J. K., McCully, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+histological+study+of+lateral+root+initiation+and+development+in+Zea+mays.">A histological study of lateral root initiation and development in Zea mays.</a> Protoplasma. 70, 179-205 (1970).</li><li>Benkova, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Local,+efflux-dependent+auxin+gradients+as+a+common+module+for+plant+organ+formation.">Local, efflux-dependent auxin gradients as a common module for plant organ formation.</a> Cell. 115, 591-602 (2003).</li><li>Beeckman, T., Burssens, S., Inz&#233;, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+peri-cell-cycle+in+Arabidopsis.">The peri-cell-cycle in Arabidopsis.</a> J. Exp. Bot. 52, 403-411 (2001).</li><li>Himanen, K., Boucheron, E., Vanneste, S., de Almeida Engler, J., Inz&#233;, D., Beeckman, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auxin-mediated+cell+cycle+activation+during+early+lateral+root+initiation.">Auxin-mediated cell cycle activation during early lateral root initiation.</a> Plant Cell. 14, 2339-2351 (2002).</li><li>Jansen, L., Parizot, B., Beeckman, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+system+for+lateral+roots+in+Arabidopsis+thaliana+and+maize.">Inducible system for lateral roots in Arabidopsis thaliana and maize.</a> Methods Mol Biol. 959, 149-158 (2013).</li><li>Casimiro, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auxin+transport+promotes+Arabidopsis+lateral+root+initiation.">Auxin transport promotes Arabidopsis lateral root initiation.</a> Plant Cell. 13, 843-852 (2001).</li><li>Himanen, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcript+profiling+of+early+lateral+root+initiation.">Transcript profiling of early lateral root initiation.</a> Proc. Natl. Acad. Sci. USA. 101, 5146-5151 (2004).</li><li>De Smet, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Receptor-like+kinase+ACR4+restricts+formative+cell+divisions+in+the+Arabidopsis+root.">Receptor-like kinase ACR4 restricts formative cell divisions in the Arabidopsis root.</a> Science. 322, 594-597 (2008).</li><li>Vanneste, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+cycle+progression+in+the+pericycle+is+not+sufficient+for+SOLITARY+ROOT/IAA14-mediated+lateral+root+initiation+in+Arabidopsis+thaliana.">Cell cycle progression in the pericycle is not sufficient for SOLITARY ROOT/IAA14-mediated lateral root initiation in Arabidopsis thaliana.</a> Plant Cell. 17, 3035-3050 (2005).</li><li>De Rybel, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+role+for+the+root+cap+in+root+branching+revealed+by+the+non-auxin+probe+naxillin.">A role for the root cap in root branching revealed by the non-auxin probe naxillin.</a> Nat. Chem. Biol. 8, 798-805 (2012).</li><li>Jansen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+transcriptomics+as+a+tool+for+the+identification+of+root+branching+genes+in+maize.">Comparative transcriptomics as a tool for the identification of root branching genes in maize.</a> Plant Biotechnol. J. 11, 1092-1102 (2013).</li><li>Parizot, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diarch+symmetry+of+the+vascular+bundle+in+Arabidopsis+root+encompasses+the+pericycle+and+is+reflected+in+distich+lateral+root+initiation.">Diarch symmetry of the vascular bundle in Arabidopsis root encompasses the pericycle and is reflected in distich lateral root initiation.</a> Plant Physiol. 146, 140-148 (2008).</li><li>Murashige, T., Skoog, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+revised+medium+for+rapid+growth+and+bio+assays+with+tobacco+tissue+cultures.">A revised medium for rapid growth and bio assays with tobacco tissue cultures.</a> Physiol. Plant. 15, 473-497 (1962).</li><li>Bellini, C., Pacurar, D. I., Perrone, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adventitious+roots+and+lateral+roots:+similarities+and+differences.">Adventitious roots and lateral roots: similarities and differences.</a> Annu Rev Plant Biol. 65, 639-666 (2014).</li><li>Grunewald, W., Parizot, B., Inz&#233;, D., Gheysen, G., Beeckman, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Developmental+biology+of+roots:+One+common+pathway+for+all+angiosperms?.">Developmental biology of roots: One common pathway for all angiosperms?.</a> Int. J. Plant Dev. Biol. 1, 212-225 (2007).</li><li>Parizot, B., Beeckman, T., Crespi, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomics+of+root+development.">Genomics of root development.</a> Root Genomics and Soil Interactions. , 3-28 (2012).</li><li>Bargmann, B. O., Birnbaum, K. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence+activated+cell+sorting+of+plant+protoplasts.">Fluorescence activated cell sorting of plant protoplasts.</a> Journal of visualized experiments : JoVE. , (2010).</li><li>Nakazono, M., Qiu, F., Borsuk, L. A., Schnable, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser-capture+microdissection,+a+tool+for+the+global+analysis+of+gene+expression+in+specific+plant+cell+types:+identification+of+genes+expressed+differentially+in+epidermal+cells+or+vascular+tissues+of+maize.">Laser-capture microdissection, a tool for the global analysis of gene expression in specific plant cell types: identification of genes expressed differentially in epidermal cells or vascular tissues of maize.</a> Plant Cell. 15, 583-596 (2003).</li><li>Ludwig, Y., Hochholdinger, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser+microdissection+of+plant+cells.">Laser microdissection of plant cells.</a> Methods Mol Biol. 1080, 249-258 (2014).</li><li>Beeckman, T., Engler, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+easy+technique+for+the+clearing+of+histochemically+stained+plant+tissue.">An easy technique for the clearing of histochemically stained plant tissue.</a> Plant Mol. Biol. Rep. 12, 37-42 (1994).</li><li>Ditengou, F. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanical+induction+of+lateral+root+initiation+in+Arabidopsis+thaliana.">Mechanical induction of lateral root initiation in Arabidopsis thaliana.</a> Proc. Natl. Acad. Sci. USA. 105, 18818-18823 (2008).</li><li>Lucas, M., Godin, C., Jay-Allemand, C., Laplaze, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auxin+fluxes+in+the+root+apex+co-regulate+gravitropism+and+lateral+root+initiation.">Auxin fluxes in the root apex co-regulate gravitropism and lateral root initiation.</a> J. Exp. Bot. 59, 55-66 (2008).</li><li>Wang, S., Taketa, S., Ichii, M., Xu, L., Xia, K., Zhou, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lateral+root+formation+in+rice+(Oryza+Sativa.+L.):+differential+effects+of+indole-3-acetic+acid+and+indole-3-butyric+acid.">Lateral root formation in rice (Oryza Sativa. L.): differential effects of indole-3-acetic acid and indole-3-butyric acid.</a> Plant Growth Regul. 41, 41-47 (2003).</li><li>Martinez-de la Cruz, E., Garcia-Ramirez, E., Vazquez-Ramos, J. M., Reyes de la Cruz, H., Lopez-Bucio, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auxins+differentially+regulate+root+system+architecture+and+cell+cycle+protein+levels+in+maize+seedlings.">Auxins differentially regulate root system architecture and cell cycle protein levels in maize seedlings.</a> J Plant Physiol. 176, 147-156 (2015).</li><li>Beyer, E. M., Morgan, P. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+ethylene+on+uptake,+distribution,+and+metabolism+of+indoleacetic+acid-1-14C+and+-2-14C+and+naphthaleneacetic+acid-1-14C.">Effect of ethylene on uptake, distribution, and metabolism of indoleacetic acid-1-14C and -2-14C and naphthaleneacetic acid-1-14C.</a> Plant Physiol. 46, 157-162 (1970).</li><li>Delbarre, A., Muller, P., Imhoff, V., Guern, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+mechanisms+controlling+uptake+and+accumulation+of+2,4-dichlorophenoxy+acetic+acid,+naphthalene-1-acetic+acid,+and+indole-3-acetic+acid+in+suspension-cultured+tobacco+cells.">Comparison of mechanisms controlling uptake and accumulation of 2,4-dichlorophenoxy acetic acid, naphthalene-1-acetic acid, and indole-3-acetic acid in suspension-cultured tobacco cells.</a> Planta. 198, 532-541 (1996).</li><li>Bailey-Serres, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microgenomics:+genome-scale,+cell-specific+monitoring+of+multiple+gene+regulation+tiers.">Microgenomics: genome-scale, cell-specific monitoring of multiple gene regulation tiers.</a> Annu Rev Plant Biol. 64, 293-325 (2013).</li><li>Perez-Torres, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phosphate+availability+alters+lateral+root+development+in+Arabidopsis+by+modulating+auxin+sensitivity+via+a+mechanism+involving+the+TIR1+auxin+receptor.">Phosphate availability alters lateral root development in Arabidopsis by modulating auxin sensitivity via a mechanism involving the TIR1 auxin receptor.</a> Plant Cell. 20, 3258-3272 (2008).</li></ol>

Os autores não têm nada a revelar.

No protocolo de Arabidopsis IRIs, é importante apenas para transferir as plântulas que cresceram inteiramente em contacto com o meio de crescimento contendo NPA. Isto assegura que a iniciação de raízes laterais é bloqueado ao longo de todo o comprimento da raiz. A fim de evitar ferir as plântulas durante a transferência, os braços das pinças curvas pode ser ligado sob os cotilédones de plântulas a. Após a transferência, certifique-se de que as raízes de mudas estão em contacto suficiente com o meio agar contendo NAA. Isto pode ser conseguido por desnatação à raiz sobre a superfície de agar sobre uma pequena distância. Isso irá garantir uma indução sincronizado eficiente da iniciação de raízes laterais ao longo do comprimento total de raízes. As raízes podem ser cultivadas expostas à luz, sem afectar negativamente o seu crescimento e indução de raízes laterais. No protocolo IRIs milho, é importante que a radícula do núcleo está voltado para baixo e para o papel de assegurar a raiz cresce downwards e anexar ao papel no lado correto 16. Depois de três dias de tratamento NPA, as mudas devem ter surgido a partir do kernel com um pequeno rebento, uma raiz primária e raízes seminais 16. A raiz principal deve ser, aproximadamente, 2 cm de comprimento, antes de prosseguir para a indução de iniciação de raízes laterais. Este protocolo foi desenvolvido utilizando a linha pura B73 do milho, mas, em caso de uma linha de milho com uma taxa de crescimento diferente, ajustar o tempo de incubação em conformidade. Certifique-se de que os rolos de papel embebido permanecer regularmente adicionando 50 ï¿½ solução NPA quando o líquido evapora ao longo do tempo, caso contrário tratamento NPA poderia ser o desenvolvimento de raízes laterais cedo ineficiente e indesejada poderia ocorrer. O próprio sistema evita a exposição das raízes à luz, mas a luz não é uma questão importante e não afeta o crescimento da raiz e indução de raízes laterais. Formas alternativas para a indução controlada de raízes laterais são o uso de MEChanical dobra 23 ou 24 gravistimulation. A principal vantagem destes sistemas é que eles têm uma indução mais &quot;natural&quot; em comparação com os tratamentos hormonais no IRIs, mas a desvantagem é que elas são limitadas na quantidade de material que pode ser colhida num dado ponto de tempo porque apenas produzir um evento de iniciação de raízes laterais na curva por muda em relação a uma indução completa do periciclo no IRIs. O IRIs utilizado em Arabidopsis e de milho podem ser utilizados numa variedade de plantas, embora as condições favoráveis ​​precisa ser optimizada. Para instalar um IRIs, duas etapas sucessivas importantes têm de ser alcançados: (1) o bloqueio de transporte de auxina e (2) acumulação de auxina para induzir a iniciação de raízes laterais. O sistema deve permitir crescente para a absorção eficiente e uniforme dos compostos e deveria permitir o desenvolvimento das mudas. Sistemas alternativos para meio sólido (Arabidopsis) e rolos de papel (milho), tais como cultura líquida, hidroponia, ou aeroponics, poderia ser utilizado para outras espécies. A primeira etapa na IRIs, ou seja, o bloqueio do transporte de auxina, pode ser alcançado pela adição de um inibidor do transporte de auxina. Embora NPA leva a um bloco eficiente de iniciação de raízes laterais em Arabidopsis e milho, compostos alternativos, tais como o ácido 2,3,5-triiodobenzóico (TIBA) ou ácido chlorophenoxyisobutyric p- (pCIB) pode funcionar melhor em outras espécies. Uma optimização similar pode ser feito para a segunda etapa do IRIs, ou seja, o tratamento de auxina. A auxina sintética NAA parece ser o mais adequado para um IRIs. O precursor de auxina indol-3-butírico (IBA) pode ser uma boa alternativa, uma vez que também induz fortemente raízes laterais e tem uma alta bioactividade em diferentes plantas 25, por outro lado, o ácido indole-3-acético auxina naturais 26. (IAA) é menos estável e mais facilmente metabolizados 27, racionalizando seu efeito mais fraco em devel raizvolvimento em, por exemplo, de milho ou arroz 25, 26. A auxina sintética ácido 2,4-diclorofenoxiacético (2,4-D) se acumula nas células altamente periciclo, parcialmente porque não é exportado a partir das células 28, prejudicando a iniciação apropriada de raízes laterais e induzindo artificial estruturas fundidas. Também outros compostos que interagem com as vias de auxina, tais como naxillin 12, têm sido mostrados para induzir a iniciação de raízes laterais em Arabidopsis e pode ser testado em outras espécies. Em alguns casos, a germinação é ineficiente na presença de ANP e pode-se escolher primeiro a germinar as sementes na ausência de ANP, subsequentemente para transferir as plântulas para o sistema de ANP que contém. Isto induz um possível risco de ter início raiz primordial laterais iniciadas antes da indução de raízes laterais com tratamento NAA e, portanto, é importante apenas para provar a região da raiz alongada que durante o tratamento NPA. Seguindo esta estratégia geral, um should ser capaz de otimizar um IRIs para praticamente qualquer (semente) da planta e, como tal, tem um sistema fácil para estudar o desenvolvimento de raízes laterais para a planta de interesse. A caracterização adicional do momento do início de raízes laterais podem ocorrer através de linhas de marcação, tal como exemplificado para Arabidopsis. Se as linhas marcadoras são difíceis de obter, um estudo histológico detalhada pode ser feito, mas isso é moroso e as primeiras divisões celulares não são facilmente reconhecíveis. Alternativamente, a análise de marcadores de divisão celular de expressão pode ser utilizado para indicar o momento das primeiras divisões celulares. O IRIs pode ser usado para diferentes fins, tais como análise de transcriptoma 13/09 como brevemente descrito nos resultados, bem como observações histológicas, a nível macroscópico e microscópico durante o início de raízes laterais 14. Diferentes tipos de amostragem, que vão desde a escala órgão célula 29, poderá permitir desvendar os diferentes aspectos da tardeiniciação raiz al. Além disso, o IRIs pode ser utilizado para monitorizar o efeito de diferentes compostos sobre a iniciação de raízes laterais 12, 30. Finalmente, usando linhas repórter, um IRIs pode também ser usado para caracterizar facilmente a expressão do gene e / ou a localização da proteína durante laterais desenvolvimento radicular.

O sistema radicular é crucial para o crescimento da planta, uma vez que garante ancoragem e absorção de água e nutrientes do solo. Uma vez que a expansão de um sistema radicular baseia-se principalmente na produção de raízes laterais, a iniciação e formação têm sido amplamente estudados. Raízes laterais são iniciados em um subconjunto específico de células periciclo, chamados de células fundadoras 1. Na maior parte das dicotiledóneas, tais como Arabidopsis thaliana, estas células estão localizados nos pólos protoxilema 2, ao passo que em monocotiledóneas, como o milho, que são encontrados nos pólos 3 do floema. Fundador células são marcadas por um aumento da resposta auxina 4, seguido pela expressão de genes do ciclo celular específicas (por exemplo, a ciclina B1; 1 / CYCB1; 1), após o que eles passam por uma primeira rodada de divisões anticlinais assimétricas 5. Após uma série de divisões e anticlinal periclinal coordenados, um primórdio raiz lateral é formado, que finalmente irá emergir como um umraízes laterais utonomous. O local e hora do início de raízes laterais não são, porém previsível, uma vez que estes eventos não são nem abundante nem sincronizados. Esta situação impede o uso de abordagens moleculares, como transcriptomics para estudar este processo. Para combater isso, um lateral Sistema Inducible Root (IRIs) foi desenvolvido 6, 7. Neste sistema, as mudas são tratados primeiro com N -1-naphthylphthalamic (NPA), que inibe o transporte de auxina e acumulação, consequentemente bloqueando iniciação de raízes laterais 8. Por posteriormente a repicagem em meio contendo auxina sintética ácido acético 1-naftaleno (NAA), toda a camada periciclo responde aos níveis elevados de auxina assim maciçamente raiz iniciar divisões celulares laterais indutores 6. Como tal, este sistema leva a rápidas, síncronas e extensas iniciações raízes laterais, permitindo fácil recolha de amostras de raízes enriquecido para um determinado estádio da tardedesenvolvimento radicular ral. Posteriormente, estas amostras podem ser utilizadas para determinar os perfis de expressão de todo o genoma durante a formação de raízes laterais. O IRIs rendeu conhecimento já significativo sobre a iniciação de lateral de raiz em Arabidopsis e milho 13/09, mas a necessidade de aplicar este sistema para outras espécies de plantas torna-se mais evidente à medida que mais genomas são sequenciados e há um crescente interesse de transferir conhecimento para importante econômica espécies. Aqui, os protocolos detalhados de Arabidopsis e de milho são dadas LRISs. Em seguida, um exemplo do uso do sistema é fornecida, pelo que ilustra como os dados obtidos com o transcriptômica IRIs milho pode ser utilizado para identificar homólogos funcionais que têm uma função conservada durante a iniciação de raízes laterais em diferentes espécies de plantas. Finalmente, as orientações para optimizar a IRIs são propostos para outras espécies de plantas.

<table border="0" cellpadding="0" cellspacing="0" width="1258">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">ARABIDOPSIS LRIS</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td style="width:551px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Seeds</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Arabidopsis seeds</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td>Col-0 ecotype</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Gas sterilization of seeds</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">micro-centrifuge tubes 1.5 ml</td>
			<td style="width:228px;">SIGMA-ALDRICH</td>
			<td style="width:119px;">0030 125.215</td>
			<td>Eppendorf microtubes 3810X, PCR clean</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">micro-centrifuge tubes 2 ml</td>
			<td style="width:228px;">SIGMA-ALDRICH</td>
			<td style="width:119px;">0030 120.094</td>
			<td>Eppendorf Safe-Lock microcentrifuge tubes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">hydrochloric acid</td>
			<td style="width:228px;">Merck KGaA</td>
			<td style="width:119px;">1,003,171,000</td>
			<td>37% (fuming) for analysis EMSURE ACS,ISO,Reag. Ph Eu</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">glass desiccator</td>
			<td style="width:228px;">SIGMA-ALDRICH</td>
			<td style="width:119px;"></td>
			<td>Pyrex</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:361px;">glass beaker</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">plastic micro-centrifuge tubes box or holder</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Bleach sterilization of seeds</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">ethanol</td>
			<td style="width:228px;">Chem-Lab nv</td>
			<td style="width:119px;">CL00.0505.1000</td>
			<td>Ethanol, abs. 100% a.r. dilute to 70%</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">sodium hypochlorite (NaOCl)</td>
			<td style="width:228px;">Carl Roth</td>
			<td style="width:119px;">9062.3</td>
			<td>12%</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Tween 20</td>
			<td style="width:228px;">SIGMA-ALDRICH</td>
			<td style="width:119px;">P1379</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">sterile water</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Growth medium</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Murashige and Skoog salt mixture</td>
			<td style="width:228px;">DUCHEFA Biochemie B.V.</td>
			<td style="width:119px;">M0221-0050</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">myo-inositol</td>
			<td style="width:228px;">SIGMA-ALDRICH</td>
			<td style="width:119px;">I5125-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">2-(N-morpholino)ethanesulfonic acid (MES)</td>
			<td style="width:228px;">DUCHEFA Biochemie B.V.</td>
			<td style="width:119px;">M1503.0100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">sucrose</td>
			<td style="width:228px;">VWR, Internation LLC</td>
			<td style="width:119px;">27483.294</td>
			<td>D(+)-Sucrose Ph. Eur.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">KOH</td>
			<td style="width:228px;">Merck KGaA</td>
			<td style="width:119px;">1050211000</td>
			<td>pellets for analysis (max. 0.002% Na) EMSURE ACS,ISO,Reag. Ph Eur</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Plant Tissue Culture Agar</td>
			<td style="width:228px;">LabM Limited</td>
			<td style="width:119px;">MC029</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Lateral root induction chemicals</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">N-1-naphthylphthalamic acid (NPA)</td>
			<td style="width:228px;">DUCHEFA Biochemie B.V.</td>
			<td style="width:119px;">No. N0926.0250</td>
			<td>10 &#181;M (Arabidopsis)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">1-naphthalene acetic acid (NAA)</td>
			<td style="width:228px;">DUCHEFA Biochemie B.V.</td>
			<td style="width:119px;">No. N0903.0050</td>
			<td>10 &#181;M (Arabidopsis)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">dimethylsulfoxide (DMSO)</td>
			<td style="width:228px;">SIGMA-ALDRICH</td>
			<td style="width:119px;">494429-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Making a mesh for transfer</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">nylon mesh</td>
			<td style="width:228px;">Prosep byba</td>
			<td style="width:119px;"></td>
			<td>Synthetic nylon mesh 20 &#181;m</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Sowing and seedling handling</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">square petri dish plates</td>
			<td style="width:228px;">GOSSELIN</td>
			<td style="width:119px;">BP124-05</td>
			<td>12 x 12 cm</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">50 ml DURAN tubes</td>
			<td style="width:228px;">SIGMA-ALDRICH</td>
			<td style="width:119px;">CLS430304</td>
			<td>Corning&#160;50 mL centrifuge tubes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">drigalski</td>
			<td style="width:228px;">Carl Roth</td>
			<td style="width:119px;">K732.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">pipette</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">cut pipette tips</td>
			<td style="width:228px;">Daslab</td>
			<td style="width:119px;">162001X</td>
			<td>Universal 200, cut off 5 mm of tip before autoclaving</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">breathable tape&#160;</td>
			<td style="width:228px;">3M Deutschland GmbH</td>
			<td style="width:119px;">cat. no. 1530-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">tweezers</td>
			<td style="width:228px;">Fiers nv/sa</td>
			<td style="width:119px;">K342.1; K344.1</td>
			<td>Dumont tweezers type a nr 5; Dumont tweezers type e nr 7</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Growth conditions</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">growth room</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td>21 &#176;C, continuous light</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Materials</td>
			<td style="width:228px;">Company</td>
			<td style="width:119px;">Catalog</td>
			<td>Comments</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">MAIZE LRIS</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Seeds</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Maize kernels</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td>B-73</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Bleach sterilization of kernels</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:361px;">glass beaker</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">magnetic stirrer&#160;</td>
			<td style="width:228px;">Fiers nv/sa</td>
			<td style="width:119px;">C267.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">sodium hypochlorite (NaOCl)</td>
			<td style="width:228px;">Carl Roth</td>
			<td style="width:119px;">9062.3</td>
			<td>12%</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">sterile water</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Lateral root induction chemicals</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">N-1-naphthylphthalamic acid (NPA)</td>
			<td style="width:228px;">DUCHEFA Biochemie B.V.</td>
			<td style="width:119px;">No. N0926.0250</td>
			<td>50 &#181;M (maize primary root), 25 &#181;M (maize adventitious root)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">1-naphthalene acetic acid (NAA)</td>
			<td style="width:228px;">DUCHEFA Biochemie B.V.</td>
			<td style="width:119px;">No. N0903.0050</td>
			<td>50 &#181;M (maize)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">dimethylsulfoxide (DMSO)</td>
			<td style="width:228px;">SIGMA-ALDRICH</td>
			<td style="width:119px;">494429-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Sowing and seedling handling</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">paper hand towels</td>
			<td style="width:228px;">Kimberly-Clark Professional*</td>
			<td style="width:119px;">6681</td>
			<td>SCOTT Hand Towels - Roll / White; sheet size (24 x 46 cm)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">seed germination paper</td>
			<td style="width:228px;">Anchor Paper Company</td>
			<td style="width:119px;"></td>
			<td>10 X 15 38# seed germination paper</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">tweezers</td>
			<td style="width:228px;">Fiers nv/sa</td>
			<td style="width:119px;">K342.1; K344.1</td>
			<td>Dumont tweezers type a nr 5; Dumont tweezers type e nr 7</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">250 ml (centrifuge) tubes</td>
			<td style="width:228px;">SCHOTT DURAN</td>
			<td style="width:119px;">2160136</td>
			<td>approx. 5.6 cm diameter and 14.7 cm height&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">700 ml tubes</td>
			<td style="width:228px;">DURAN GROUP</td>
			<td style="width:119px;">213994609</td>
			<td>cylinders, round foot tube, D 60&#160; x 250</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">rack</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td>for maize tubes, home made</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">sterile water</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Growth conditions</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">growth cabinet</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td>27 &#176;C, continuous light, 70% relative humidity</td>
		</tr>
	</tbody>
</table>

lateral root inducible system in arabidopsis and maize

Lateral root development contributes significantly to the root system, and hence is crucial for plant growth. The study of lateral root initiation is however tedious, because it occurs only in a few cells inside the root and in an unpredictable manner. To circumvent this problem, a Lateral Root Inducible System (LRIS) has been developed. By treating seedlings consecutively with an auxin transport inhibitor and a synthetic auxin, highly controlled lateral root initiation occurs synchronously in the primary root, allowing abundant sampling of a desired developmental stage. The LRIS has first been developed for Arabidopsis thaliana, but can be applied to other plants as well. Accordingly, it has been adapted for use in maize (Zea mays). A detailed overview of the different steps of the LRIS in both plants is given. The combination of this system with comparative transcriptomics made it possible to identify functional homologs of Arabidopsis lateral root initiation genes in other species as illustrated here for the CYCLIN B1;1 (CYCB1;1) cell cycle gene in maize. Finally, the principles that need to be taken into account when an LRIS is developed for other plant species are discussed.

Aplicação do IRIs executar comparativos transcriptómica do lateral Processo Root Iniciação Uma aplicação da IRIs é a comparação e a correlação dos perfis de expressão de genes durante a formação de raízes laterais em espécies diferentes. Transcriptomics Comparativos aproxima criar a possibilidade de identificar genes ortólogos envolvidas no processo de desenvolvimento de raízes laterais em espécies diferentes. Iniciação de raízes laterais, que consiste na formação de um novo órgão de um subconjunto de células contidas em um eixo raiz já formada, é o mecanismo principal compartilhada por angiospermas para controlar a sua arquitectura raiz. Consequentemente, é muito provável que ele evoluiu de vias existentes presentes em um ancestral comum e foi conservado ao longo da evolução. Com efeito, os reguladores potenciais comuns de iniciação de raízes laterais foram encontradas em diferentes espécies &lt;sup&gt; 17, 18. A amostragem de materiais usando o IRIs em Arabidopsis e milho, e análise de transcriptoma O IRIs foi estabelecida em duas espécies diferentes:. Arabidopsis e de milho 10, 13 Em ambas as espécies, decidiu-se provar as plantas apenas antes do tratamento NAA, e logo após a indução, no início de ou durante a resposta de auxina, como bem como no aparecimento de, ou durante as primeiras divisões no periciclo. Além disso, a separação de células activadas por fluorescência 19 (SCAF) foi utilizada em Arabidopsis ou de captura laser Microscopia 20, 21 (LCM) no milho para seleccionar células periciclo. Na Arabidopsis, os pontos temporais de 2 e 6 horas após a indução foram escolhidos com base na caracterização da transcrição do pDR5 :: GUS e resposta auxina pCYCB1; 1 :: GUS linhas marcadoras 9 do ciclo celular (Figura 3). No milho, o tempo de pontos 2, 3 e 4 h após a indução, foram seleccionados após caracterização microscópica de actividade a divisão celular e a análise da expressão de vários genes marcadores do ciclo celular utilizando reversa em tempo real quantitativo reacção em cadeia da polimerase de transcrição (qRT-PCR) 13 . O ARN foi extraído a partir das células isoladas e hibridado em plataformas de microarray como anteriormente descrito 10, 13. Encontrar o Ortólogo de Arabidopsis CYCB1; 1 (AtCYCB1; 1) em milho Em Arabidopsis, a linha marcador pCYCB1; 1 :: GUS tem sido amplamente usado para rastrear as primeiras divisões do periciclo durante o início de raízes laterais. Tal marcador seria muitoútil no milho. Vários homólogos de AtCYCB1; 1 foram encontrados em milho (www.maizesequence.org, todos os peptídeos, BLASTP, as configurações padrão). Seis deles estavam presentes no microarray realizada após IRIs em milho e mostrou enriquecimento significativo. O melhor acerto do BLAST, GRMZM2G310115, mostraram níveis muito elevados de transcrição após IRIs, semelhante ao que foi observado em Arabidopsis para AtCYCB1; 1 (Figura 4). Aplicação do IRIs a verificação individual da Expressão Gênica Para validar GRMZM2G310115 como um bom candidato ortólogo de AtCYCB1; 1 na iniciação de raízes laterais milho, em tempo real qRT-PCR em amostras tomadas a diferentes pontos de tempo foi realizada durante o curso de um IRIs 13. As plantas foram tratadas como descrito no protocolo acima referido e colhidas em diferentes pontos de tempo: antes NTratamento AA (NPA), e depois de 2, 3 e 4 horas de tratamento NAA. Além disso, o material de plantas cultivadas apenas em água foi colhida para comparar a expressão de genes entre IRIs e condições neutras. Imediatamente após a colheita, segmentos de raiz correspondente a uma região compreendida entre 5 mm e 15 mm acima da ponta da raiz foram dissecadas sob a binocular. Usando pinças, o córtex foi separada da estela (que contém o periciclo), e extraiu-se o ARN a partir de ambos os tecidos. Este último passo foi realizado em vez de GCV, porque é muito mais rápido e mais barato para validação. Usando o seguinte respectivo direta e inversa iniciadores qRT-PCR, AGCAGGACGCAGTTGGAGAG e GAGCCGAGAGCACAGAAGAAAG, GRMZM2G310115 foi validado para ser regulado para cima em cima IRIs, e para ser específico para os tecidos estela (Figura 5). Além disso, esta experiência mostra que sem indução síncrona, os eventos discretos de iniciação de raízes laterais que acontecem em uma raiz que cresce na água não são detectáveis,<html> e ilustrar a necessidade da IRIs para revelar a expressão diferencial de genes relacionados com o processo de iniciação de raízes laterais. <img alt="figura 1" src="/files/ftp_upload/53481/53481fig1.jpg" /> Figura 1. Lateral raiz do sistema Inducible para Arabidopsis (A) Preparação da malha de nylon (20 mm):. Cortar a malha de nylon (9 cm por 9 cm), envolvê-la em papel de alumínio e colocá-lo em um copo de vidro para autoclavagem. (B) Aplique a malha de nylon em uma placa NPA contendo (10 mM), usando uma pinça. Em seguida, usar um Drigalski esterilizada de modo a eliminar bolhas de ar. (C) Sementes da sementeira na malha de nylon usando uma pipeta. (D) Sementes da sementeira na malha de nylon usando um palito. (E) Transferir a malha de nylon para uma placa contendo NAA (10 mM), usando uma pinça.81 / &quot;target =&quot; _ blank &quot;53481fig1large.jpg&gt; Por favor clique aqui para ver uma versão maior desta figura. <img alt="Figura 2" src="/files/ftp_upload/53481/53481fig2.jpg" /> Figura 2. Lateral raiz do sistema Inducible para o milho. &#160; (A) preparar os rolos de papel: coloque duas camadas de papel (92 cm x 24 cm, comprimento de duas folhas) em cima uns dos outros e dobrá-los ao longo do comprimento (92 cm x 12 cm). (B) Colocar 10 grãos de milho esterilizados com a radícula voltada para baixo no papel de 2 cm a partir do topo com um interspacing de 8 cm. Em seguida, enrole o papel, mantendo os grãos de milho no lugar. (C) Coloque os rolos de papel em tubos (por exemplo, 250 ml tubos de centrífuga) e colocá-los em um rack. (D) crescer as plântulas de milho para três dias em uma solução NPA 50 uM (a 27 ° C, a luz contínua, humi relativadity 70%). (E) Esquerda: mudas apenas antes da transferência para NAA; Médio: seções transversais micrótomo apenas antes da transferência para NAA e 2 dias após a transferência para NAA; À direita:. Plântulas com raízes laterais visíveis surgiram 5 dias após a transferência para NAA <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53481/53481fig2large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 3" src="/files/ftp_upload/53481/53481fig3.jpg" /> Figura 3. Lateral Root Iniciação é estimulada Após prolongada curso NAA tratamento. (AF) Tempo que mostra a resposta auxina, durante um tratamento NAA usando a linha marcador pDR5 :: GUS. A resposta de auxina, que é um dos primeiros eventos desencadeiam a iniciação de raízes laterais, começa 2 horas após o início do tratamento de NAA. No painel superior, uma visão geral de toda a plântula é dado; o painel inferior mostraé a resposta auxina na ponta da raiz. Claro (GM) Tempo de um tratamento NAA usando o pCYCB1; linha de marcação 1 :: GUS. O sinal representa a expressão de GUS do CYCB1; 1 gene, indicando que as primeiras divisões celulares que conduzem à formação de raízes laterais começar 6 horas após o início do tratamento de NAA. No painel superior, uma visão geral de toda a plântula é dado; o painel inferior mostra CYCB1;. 1 expressão na ponta da raiz (coloração GUS de acordo com Beeckman e Engler, 1994 22) <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53481/53481fig3large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 4" src="/files/ftp_upload/53481/53481fig4.jpg" /> Figura 4. Expressão de Genes Perfil CYCB1 em Arabidopsis e milho durante IRIs. </strong&gt; &#160; (A) os valores de expressão de Microarray AtCYCB1; 1 durante IRIs como descrito por De Smet et al. 2008 10 (B) Microarray valores de expressão de ortólogos potenciais de AtCYCB1; 1 durante IRIs tal como descrito por Jansen et ai. 2013 13 BLASTP pontuação é a pontuação obtida quando explodir a sequência da proteína de AtCYCB1; 1 no genoma do milho. As barras de erro expressar desvio padrão e ** representa um -valor p ≤0.01. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53481/53481fig4large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 5" src="/files/ftp_upload/53481/53481fig5.jpg" /> Figura 5. Expressão dos GRMZM2G310115 na Estela eo córtex de raízes de milho durante IRIs. A expressão de &lt;em&gt; GRMZM2G310115 durante IRIs no milho foram avaliadas por quantitativo em tempo real qRT-PCR em amostras de córtex estela e dissecados. Uma amostra adicional foi realizada em plantas cultivadas em água. Os valores foram normalizados para a expressão na estela em água. As barras de erro expressar desvio padrão e ** representa um -valor p ≤0.01 (primers e genes de referência de acordo com Jansen et al. 2013 13). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53481/53481fig5large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a>

Watch this Scientific Journal Video about Lateral Root Inducible System in Arabidopsis and Maize at JoVE.com

Sistema Indutível de Raiz Lateral em Arabidopsis e Milho | Biologia | Vídeo

Lateral Root Inducible System in Arabidopsis and Maize

Sistema induzível de raiz lateral em Arabidopsis e milho

The Lateral Root Inducible System (LRIS) allows for synchronous induction of lateral roots and is presented for Arabidopsis thaliana and maize.

Lateral root development contributes significantly to the root system, and hence is crucial for plant growth. The study of lateral root initiation is ...

lateral-root-inducible-system-in-arabidopsis-and-maize

Nanyang Technological University

Research

Education

JoVE Journal

JoVE Core

Biology

Lateral Root Inducible System in Arabidopsis and Maize

Plant Biology

Plant Structure, Growth, and Nutrition

SCIENTISTS IN ACTION

13.7K visualizações.  Ghent. The Lateral Root Inducible System (LRIS) allows for synchronous induction of lateral roots and is presented for Arabidopsis thaliana and maize.

Vídeo: Lateral Root Inducible System in Arabidopsis and Maize

Preparation and Maintenance of Dorsal Root Ganglia Neurons in Compartmented Cultures

Neurons extend axonal processes that are far removed from the cell body to innervate target tissues, where target-derived growth factors are required for neuronal survival and function. Neurotrophins are specifically required to maintain the survival and differentiation of innervating sensory neurons but the question of how these target-derived neurotrophins communicate to the cell body of innervating neurons has been an area of active research for over 30 years. The most commonly accepted model of how neurotrophin signals reach the cell body proposes that signaling endosomes carry this signal retrogradely along the axon. In order to study retrograde transport, a culture system was originally devised by Robert Campenot, in which cell bodies are isolated from their axons. The technique of preparing these compartmented chambers for culturing sensory neurons recapitulates the selective stimulation of neuron terminals that occurs in vivo following release of target-derived neurotrophins. Retrograde signaling events that require long-range microtubule dependent retrograde transport have important implications for the treatment of neurodegenerative disorders.

Here we describe the technique of preparing and maintaining compartmented chambers for culturing sensory neurons of the dorsal root ganglia.

Preparação e manutenção dos neurônios da raiz dorsal Gânglios em culturas Compartmented

Neurons extend axonal processes that are far removed from the cell body to innervate target tissues, where target-derived growth factors are required for ...

Biologia

Do-It-Yourself Device for Recovery of Cryopreserved Samples Accidentally Dropped into Cryogenic Storage Tanks

Liquid nitrogen is colorless, odorless, extremely cold (-196 &deg;C) liquid kept under pressure. It is commonly used as a cryogenic fluid for long term storage of biological materials such as blood, cells and tissues 1,2. The cryogenic nature of liquid nitrogen, while ideal for sample preservation, can cause rapid freezing of live tissues on contact - known as 'cryogenic burn'2, which may lead to severe frostbite in persons closely involved in storage and retrieval of samples from Dewars. Additionally, as liquid nitrogen evaporates it reduces the oxygen concentration in the air and might cause asphyxia, especially in confined spaces2.
In laboratories, biological samples are often stored in cryovials or cryoboxes stacked in stainless steel racks within the Dewar tanks1. These storage racks are provided with a long shaft to prevent boxes from slipping out from the racks and into the bottom of Dewars during routine handling. All too often, however, boxes or vials with precious samples slip out and sink to the bottom of liquid nitrogen filled tank. In such cases, samples could be tediously retrieved after transferring the liquid nitrogen into a spare container or discarding it. The boxes and vials can then be relatively safely recovered from emptied Dewar. However, the cryogenic nature of liquid nitrogen and its expansion rate makes sunken sample retrieval hazardous. It is commonly recommended by Safety Offices that sample retrieval be never carried out by a single person. Another alternative is to use commercially available cool grabbers or tongs to pull out the vials3. However, limited visibility within the dark liquid filled Dewars poses a major limitation in their use.
In this article, we describe the construction of a Cryotolerant DIY retrieval device, which makes sample retrieval from Dewar containing cryogenic fluids both safe and easy.

Here we present a low cost, durable cryotolerant device for sample retrieval from Dewar tanks filled with liquid nitrogen. The ease of construction and modular design of the device makes the process of sample retrieval from cryogenic tanks safe and easy.

Do-It-Yourself Dispositivo de Recuperação de amostras criopreservadas cair acidentalmente em Tanques de armazenamento criogênico

Liquid nitrogen is colorless, odorless, extremely cold (-196 &deg;C) liquid kept under pressure. It is commonly used as a cryogenic fluid for long term ...

Using Flatbed Scanners to Collect High-resolution Time-lapsed Images of the Arabidopsis Root Gravitropic Response

Research efforts in biology increasingly require use of methodologies that enable high-volume collection of high-resolution data. A challenge laboratories can face is the development and attainment of these methods. Observation of phenotypes in a process of interest is a typical objective of research labs studying gene function and this is often achieved through image capture. A particular process that is amenable to observation using imaging approaches is the corrective growth of a seedling root that has been displaced from alignment with the gravity vector. Imaging platforms used to measure the root gravitropic response can be expensive, relatively low in throughput, and/or labor intensive. These issues have been addressed by developing a high-throughput image capture method using inexpensive, yet high-resolution, flatbed scanners. Using this method, images can be captured every few minutes at 4,800 dpi. The current setup enables collection of 216 individual responses per day. The image data collected is of ample quality for image analysis applications.

This protocol describes a process for rapid collection of images of Arabidopsis seedlings responding to a gravity stimulus using commercially-available flatbed scanners. The method allows for inexpensive, high-volume capture of high-resolution images amenable for downstream analysis algorithms.

Usando scanners de mesa para coletar imagens de alta resolução tempo decorrido da Arabidopsis Root gravitrópico Response

Research efforts in biology increasingly require use of methodologies that enable high-volume collection of high-resolution data. A challenge laboratories ...

An Assay for Lateral Line Regeneration in Adult Zebrafish

Due to the clinical importance of hearing and balance disorders in man, model organisms such as the zebrafish have been used to study lateral line development and regeneration. The zebrafish is particularly attractive for such studies because of its rapid development time and its high regenerative capacity. To date, zebrafish studies of lateral line regeneration have mainly utilized fish of the embryonic and larval stages because of the lower number of neuromasts at these stages. This has made quantitative analysis of lateral line regeneration/and or development easier in the earlier developmental stages. Because many zebrafish models of neurological and non-neurological diseases are studied in the adult fish and not in the embryo/larvae, we focused on developing a quantitative lateral line regenerative assay in adult zebrafish so that an assay was available that could be applied to current adult zebrafish disease models. Building on previous studies by Van Trump et al.17&#160;that described procedures for ablation of hair cells in adult Mexican blind cave fish and zebrafish (Danio rerio), our assay was designed to allow quantitative comparison between control and experimental groups. This was accomplished by developing a regenerative neuromast standard curve based on the percent of neuromast reappearance over a 24 hr time period following gentamicin-induced necrosis of hair cells in a defined region of the lateral line. The assay was also designed to allow extension of the analysis to the individual hair cell level when a higher level of resolution is required.

Because many zebrafish models of neurological and non-neurological diseases are studied in the adult fish rather than the embryo/larvae, we developed a quantitative lateral line regenerative assay that can be applied to adult zebrafish disease models. The assay involved resolution at the 1) neuromast and 2) individual hair cell levels.

Um ensaio para a lateral de Regeneração de Linha em Zebrafish Adulto

Due to the clinical importance of hearing and balance disorders in man, model organisms such as the zebrafish have been used to study lateral line ...

Measuring Spatial and Temporal Ca2+ Signals in Arabidopsis Plants

Developmental and environmental cues induce Ca2+ fluctuations in plant cells. Stimulus-specific spatial-temporal Ca2+ patterns are sensed by cellular Ca2+ binding proteins that initiate Ca2+ signaling cascades. However, we still know little about how stimulus specific Ca2+ signals are generated. The specificity of a Ca2+ signal may be attributed to the sophisticated regulation of the activities of Ca2+ channels and/or transporters in response to a given stimulus. To identify these cellular components and understand their functions, it is crucial to use systems that allow a sensitive and robust recording of Ca2+ signals at both the tissue and cellular levels. Genetically encoded Ca2+ indicators that are targeted to different cellular compartments have provided a platform for live cell confocal imaging of cellular Ca2+ signals. Here we describe instructions for the use of two Ca2+ detection systems: aequorin based FAS (film adhesive seedlings) luminescence Ca2+ imaging and case12 based live cell confocal fluorescence Ca2+ imaging. Luminescence imaging using the FAS system provides a simple, robust and sensitive detection of spatial and temporal Ca2+ signals at the tissue level, while live cell confocal imaging using Case12 provides simultaneous detection of cytosolic and nuclear Ca2+ signals at a high resolution.

Measuring Spatial and Temporal Ca2+ Signals in Arabidopsis Plants

Ca2+ signaling regulates diverse biological processes in plants. Here we present approaches for monitoring abiotic stress induced spatial and temporal Ca2+ signals in Arabidopsis cells and tissues using the genetically encoded Ca2+ indicators Aequorin or Case12.

Medindo espacial e temporal Ca<sup&gt; 2 +</sup&gt; Sinais em Arabidopsis Plantas

Developmental and environmental cues induce Ca2+ fluctuations in plant cells. Stimulus-specific spatial-temporal Ca2+ patterns are sensed by cellular Ca2+ ...

High Resolution Quantification of Crystalline Cellulose Accumulation in Arabidopsis Roots to Monitor Tissue-specific Cell Wall Modifications

Plant cells are surrounded by a cell wall, the composition of which determines their final size and shape. The cell wall is composed of a complex matrix containing polysaccharides that include cellulose microfibrils that form both crystalline structures and cellulose chains of amorphous organization. The orientation of the cellulose fibers and their concentrations dictate the mechanical properties of the cell. Several methods are used to determine the levels of crystalline cellulose, each bringing both advantages and limitations. Some can distinguish the proportion of crystalline regions within the total cellulose. However, they are limited to whole-organ analyses that are deficient in spatiotemporal information. Others relying on live imaging, are limited by the use of imprecise dyes. Here, we report a sensitive polarized light-based system for specific quantification of relative light retardance, representing crystalline cellulose accumulation in cross sections of Arabidopsis thaliana roots. In this method, the cellular resolution and anatomical data are maintained, enabling direct comparisons between the different tissues composing the growing root. This approach opens a new analytical dimension, shedding light on the link between cell wall composition, cellular behavior and whole-organ growth.

High Resolution Quantification of Crystalline Cellulose Accumulation in Arabidopsis Roots to Monitor Tissue-specific Cell Wall Modifications

Crystalline cellulose is an important constituent of the plant cell wall. However, its quantification at a cellular resolution is technically challenging. Here, we report the use of polarized light technology and root cross sections to obtain information of cell wall composition at a spatiotemporal resolution.

Quantificação de alta resolução Celulose cristalina Acumulação em<em&gt; Arabidopsis</em&gt; Raízes para monitorar celular específico do tecido da parede Modificações

Plant cells are surrounded by a cell wall, the composition of which determines their final size and shape. The cell wall is composed of a complex matrix ...

Micron-scale Phenotyping Techniques of Maize Vascular Bundles Based on X-ray Microcomputed Tomography

It is necessary to accurately quantify the anatomical structures of maize materials based on high-throughput image analysis techniques. Here, we provide a 'sample preparation protocol' for maize materials (i.e., stem, leaf, and root) suitable for ordinary microcomputed tomography (micro-CT) scanning. Based on high-resolution CT images of maize stem, leaf, and root, we describe two protocols for the phenotypic analysis of vascular bundles: (1) based on the CT image of maize stem and leaf, we developed a specific image analysis pipeline to automatically extract 31 and 33 phenotypic traits of vascular bundles; (2) based on the CT image series of maize root, we set up an image processing scheme for the three-dimensional (3-D) segmentation of metaxylem vessels, and extracted two-dimensional (2-D) and 3-D phenotypic traits, such as volume, surface area of metaxylem vessels, etc. Compared with traditional manual measurement of vascular bundles of maize materials, the proposed protocols significantly improve the efficiency and accuracy of micron-scale phenotypic quantification.

We provide a novel method to improve the X-ray absorption contrast of maize tissue suitable for ordinary microcomputed tomography scanning. Based on CT images, we introduce a set of image-processing workflows for different maize materials to effectively extract microscopic phenotypes of vascular bundles of maize.

Técnicas de fenotipagem mícron-escala de milho feixes vasculares, com base na tomografia computadorizada de Microcomputed de raio-x

It is necessary to accurately quantify the anatomical structures of maize materials based on high-throughput image analysis techniques. Here, we provide a ...

Wide-Field, Real-Time Imaging of Local and Systemic Wound Signals in Arabidopsis

Plants respond to mechanical stresses such as wounding and herbivory by inducing defense responses both in the damaged and in the distal undamaged parts. Upon wounding of a leaf, an increase in cytosolic calcium ion concentration (Ca2+ signal) occurs at the wound site. This signal is rapidly transmitted to undamaged leaves, where defense responses are activated. Our recent research revealed that glutamate leaking from the wounded cells of the leaf into the apoplast around them serves as a wound signal. This glutamate activates glutamate receptor-like Ca2+ permeable channels, which then leads to long-distance Ca2+ signal propagation throughout the plant. The spatial and temporal characteristics of these events can be captured with real-time imaging of living plants expressing genetically encoded fluorescent biosensors. Here we introduce a plant-wide, real-time imaging method to monitor the dynamics of both the Ca2+ signals and changes in apoplastic glutamate that occur in response to wounding. This approach uses a wide-field fluorescence microscope and transgenic Arabidopsis plants expressing Green Fluorescent Protein (GFP)-based Ca2+ and glutamate biosensors. In addition, we present methodology to easily elicit wound-induced, glutamate-triggered rapid and long-distance Ca2+ signal propagation. This protocol can also be applied to studies on other plant stresses to help investigate how plant systemic signaling might be involved in their signaling and response networks.

Wide-Field, Real-Time Imaging of Local and Systemic Wound Signals in Arabidopsis

Extracellular glutamate-triggered systemic calcium signaling is critical for the induction of plant defense responses to mechanical wounding and herbivore attack in plants. This article describes a method to visualize the spatial and temporal dynamics of both these factors using Arabidopsis thaliana plants expressing calcium- and glutamate-sensitive fluorescent biosensors.

Imagens em campo amplo e em tempo real de sinais de feridas locais e sistêmicas em Arabidopsis

Plants respond to mechanical stresses such as wounding and herbivory by inducing defense responses both in the damaged and in the distal undamaged parts. ...

Divergence of Root Microbiota in Different Habitats based on Weighted Correlation Networks

The root microbiome plays an important role in plant growth and environmental adaptation. Network analysis is an important tool for studying communities, which can effectively explore the interaction relationship or co-occurrence model of different microbial species in different environments. The purpose of this manuscript is to provide details on how to use the weighted correlation network algorithm to analyze different co-occurrence networks that may occur in microbial communities due to different ecological environments. All analysis of the experiment is performed in the WGCNA package. WGCNA is an R package for weighted correlation network analysis. The experimental data used to demonstrate these methods were microbial community data from the NCBI (National Center for Biotechnology Information) database for three niches of the rice (Oryza sativa) root system. We used the weighted correlation network algorithm to construct co-abundance networks of microbial community in each of the three niches. Then, differential co-abundance networks among endosphere, rhizoplane and rhizosphere soil were identified. In addition, the core genera in network were obtained by the "WGCNA" package, which plays an important regulated role in network functions. These methods enable researchers to analyze the response of microbial network to environmental disturbance and verify different microbial ecological response theories. The results of these methods show that the significant differential microbial networks identified in the endosphere, rhizoplane and rhizosphere soil of rice.

Network analysis was applied to evaluate the association of various ecological microbial communities, such as soil, water and rhizosphere. Presented here is a protocol on how to use the WGCNA algorithm to analyze different co-occurrence networks that may occur in the microbial communities due to different ecological environments.

Divergência de Microbiota Raiz em Diferentes Habitats baseados em Redes de Correlação Ponderada

The root microbiome plays an important role in plant growth and environmental adaptation. Network analysis is an important tool for studying communities, ...

A Simple Protocol for Mapping the Plant Root System Architecture Traits

Comprehensive knowledge of plant root system architecture (RSA) development is critical for improving nutrient use efficiency and increasing crop cultivar tolerance to environmental challenges. An experimental protocol is presented for setting up the hydroponic system, plantlet growth, RSA spreading, and imaging. The approach used a magenta box-based hydroponic system containing polypropylene mesh supported by polycarbonate wedges. Experimental settings are exemplified by assessing the RSA of the plantlets under varying nutrient (phosphate [Pi]) supply. The system was established to examine the RSA of Arabidopsis, but it is readily adaptable to study other plants like Medicago sativa (Alfalfa). Arabidopsis thaliana (Col-0) plantlets are used in this investigation as an example to understand the plant RSA. Seeds are surface sterilized by treating ethanol and diluted commercial bleach, and kept at 4 &#176;C for stratification. The seeds are germinated and grown on a liquid half-MS medium on a polypropylene mesh supported by polycarbonate wedges. The plantlets are grown under standard growth conditions for the desired number days, gently picked out from the mesh, and submersed in water-containing agar plates. Each root system of the plantlets is spread gently on the water-filled plate with the help of a round art brush. These Petri plates are photographed or scanned at high resolution to document the RSA traits. The root traits, such as primary root, lateral roots, and branching zone, are measured using the freely available ImageJ software. This study provides techniques for measuring plant root characteristics in controlled environmental settings. We discuss how to (1) grow the plantlets, and collect and spread root samples, (2) obtain pictures of spread RSA samples, (3) capture the images, and (4) use image analysis software to quantify root attributes. The advantage of the present method is the versatile, easy, and efficient measurement of the RSA traits.

We use simple laboratory tools to examine the root system architecture (RSA) of Arabidopsis and Medicago. The plantlets are grown hydroponically over mesh and spread using an art brush to reveal the RSA. Images are taken using scanning or a high-resolution camera, then analyzed with ImageJ to map traits.

Um Protocolo Simples para Mapear as Características da Arquitetura do Sistema Radicular da Planta

Comprehensive knowledge of plant root system architecture (RSA) development is critical for improving nutrient use efficiency and increasing crop cultivar ...

Sistema induzível de raiz lateral em Arabidopsis e milho

Resumo

Explore mais vídeos

Capítulos neste vídeo