The authors thank Davy Opdenacker for technical assistance and photography. We greatly thank Dr. Annick Bleys for helpful suggestions to improve the manuscript. This work was financed by the Interuniversity Attraction Poles Programme IUAP P7/29 'MARS' from the Belgian Federal Science Policy Office, by the FWO grant G027313N and by the Agency for Innovation by Science and Technology, IWT (IR).

1. Arabidopsis Protocolo LRIS Nota: El texto se refiere a &quot;pequeños&quot; o &quot;grandes&quot; experimentos a escala. Experimentos a pequeña escala, tales como el análisis de línea de marcador y la tinción histológica 6, 14, requieren sólo unas pocas muestras. Experimentos a gran escala, tales como cuantitativa en tiempo real QRT-PCR, micro-arrays 9-11 o de secuenciación de RNA, requieren una mayor cantidad de muestras. Como tal, una cantidad de ~ 1000 plántulas por muestra fue utilizado por Vanneste et al. 11 para realizar microarray experimento después de la disección segmento de raíz. DÍA 1 <ol><li> Esterilización de semillas de Arabidopsis Nota: Seleccione uno de los siguientes procedimientos para la esterilización de semillas. Cualquiera de ellos es adecuado para los siguientes pasos del protocolo. Esterilización de gas (1.1.2) presenta dos ventajas principales sobre la esterilización de líquidos (1.1.1): se tarda menos tiempo en el manejo de una gran entumecidaer de semillas, ya que ninguna de pipeteo tiene que ocurrir para las muestras individuales; y las semillas esterilizadas se pueden almacenar durante un período más largo. Sin embargo, requiere un desecador y un manejo cuidadoso. <ol><li> La esterilización de líquidos <ol><li> Vierta la cantidad deseada de semillas en tubos de microcentrífuga. Utilice un máximo de 20 mg (~ 800 semillas) en un tubo de 1,5 ml o 40 mg (~ 1600 semillas) en unos 2 ml tubos de microcentrífuga. </li><li> Añadir 1 ml de etanol al 70%. Invertir o agite suavemente durante 2 min. </li><li> Sustituir el 70% de etanol con 1 ml de solución de esterilización para 15 min. (Preparar la solución de esterilización fresca: 3,85 ml de hipoclorito de sodio (NaOCl) stock (12%) (PRECAUCIÓN: El uso de humos campana), 5 l de Tween 20, hasta 10 ml con agua invertir los tubos varias veces para asegurarse de que todas las semillas vienen. en contacto con la solución. </li><li> En una cabina de flujo de aire laminar, sustituir la solución de esterilización con 1 ml de agua destilada estéril y enjuagar las semillas 5 veces durante 5 min por repetidaLy sustituir con 1 ml de agua destilada estéril fresco. </li></ol></li><li> Esterilización Gas <ol><li> Verter el número deseado de semillas en un tubo de microcentrífuga de 2 ml. Utilice tubos individuales cuando se trabaja con varias líneas independientes, y organizar los abrieron en una caja o soporte de plástico tubos de microcentrífuga. Si el número de semillas en un tubo excede 500 (12,5 mg), subdividir las semillas en el número apropiado de tubos para asegurar la esterilización exitosa. Asegúrese de que las tapas de los tubos vecinos no cubren unos a otros. Encajar la tapa de la caja en la parte inferior, ya que tiene que estar en el desecador, así como para la esterilización. </li><li> Coloque la caja en el plato de un desecador, junto con un vaso de vidrio (PRECAUCIÓN: El uso de humos campana). </li><li> Llenar el vaso de precipitados con 100 ml de 12% NaOCl (PRECAUCIÓN: Use campana extractora de gases). Ponga la tapa en el desecador, pero deja una pequeña abertura donde se coloca el vaso de precipitados. </li><li> Añadir 3 ml de ácido clorhídrico al 37% (furioso) (CAUCIÓN: Uso humos campana) al vaso de precipitados a través de la pequeña abertura y cierre rápidamente el desecador. La burbuja voluntad solución para algún tiempo debido a la formación de Cl 2 -gas. Deja el sistema cerrado O / N (o por lo menos 8 horas). </li><li> Retire la tapa del desecador. Saque la caja y cubrirlo con la tapa para evitar la contaminación durante el transporte. </li><li> Ponga la caja en una cabina de flujo laminar de aire, quitar la tapa y dejar las semillas durante aproximadamente 1 hora a RT para permitir la liberación de gas. Nota: Las semillas se pueden almacenar de forma segura en seco en tubos de microcentrífuga cerradas hasta por 2 semanas a 4 ° C. </li></ol></li></ol></li><li> La inducción de raíz lateral en Arabidopsis <ol><li> Lateral Raíz Inhibición (NPA Personal) <ol><li> Preparar medio de crecimiento para el crecimiento in vitro. El medio contiene medio de Murashige y Skoog de ​​fuerza mezcla de sal 15, 0,1 g / L de mio-inositol, 10 g / L de sacarosa, y se tampona con 0,5g / L 2- (N-morfolino) etanosulfónico (MES). </li><li> Ajustar el pH a 5,7 con 1 M de KOH. Añadir 8 g / L de agar tejido de la planta y el medio en autoclave durante 20 min a 121 ° C. </li><li> Preparar una solución madre 25 mM de NPA en dimetilsulfóxido (DMSO) (PRECAUCIÓN: Use guantes). En una cabina de flujo de aire laminar, enfriar el medio en autoclave hasta aproximadamente 65 ° C (que es la temperatura a la que la botella se hace con la mano), y añadir 25 solución madre mM NPA para obtener una concentración final de 10 mM NPA. </li><li> Homogeneizar la adición agitando suavemente la botella durante 10 segundos. Verter 50 ml de medio por placa de Petri cuadrada (12 cm x 12 cm). Nota: En caso de experimento a gran escala, aplicar una malla de nylon (20 micras) para garantizar la transferencia fácil. Preparar una malla (9 cm x 9 cm) por tratamiento en autoclave (Figura 1A). Cuando autoclave, aplicar la malla al medio de crecimiento con unas pinzas estériles (Figura 1B). Empuje suavemente la malla para el medio de cultivo utilizando un sterilized drigalsky para asegurarse de que está en buen contacto con el medio de crecimiento (Figura 1B) (PRECAUCIÓN: El trabajo en condiciones estériles). </li><li> Siembre las semillas en los NPA placas. Nota: En caso de que se planea un experimento a gran escala, siembran 2 filas densas y bien alineados de 50 semillas para facilitar la toma de muestras (véase 1.2.2.3). <ol><li> En el caso de la esterilización líquido, sembrar las semillas en NPA placas utilizando una pipeta de 200 l. Corte 3 - 4 mm del final de las puntas de pipeteado en condiciones estériles (o antes de la esterilización de las puntas) con el fin de ser capaz de pipetear las semillas. Pipetear hacia arriba y abajo un par de veces para volver a suspender las semillas, a continuación pipetear agua aproximadamente 150 l estéril con 10 - 20 semillas y esperar hasta que el sedimento semillas en la parte inferior de la punta. (PRECAUCIÓN: El trabajo en condiciones estériles) Nota: Al tocar el agar o la malla suavemente con la punta, una gota de agua con una semilla se dará a conocer de ella (Figura 1C). </li> &lt;li&gt; En el caso de la esterilización por gas, sembrar las semillas usando autoclave toothpicks.Pinch el palillo de dientes en el agar antes de tomar las semillas para asegurar una superficie pegajosa. Recoge la semillas una por una con el palillo de dientes y distribuir las semillas en las placas (Figura 1D). Alternativamente, añadir agua estéril para las semillas y sembrar como se describe en 1.2.1.5.1 (PRECAUCIÓN: El trabajo en condiciones estériles). </li></ol></li><li> Sellar las placas con cinta adhesiva transpirable y almacenarlos placas a 4 ° C en la oscuridad durante al menos 2 días y un máximo de una semana. Esto es necesario para la estratificación y garantiza sincronizados y germinación más eficiente. Nota: Como alternativa, las semillas pueden ser estratificados antes de la siembra, se sumergieron en agua destilada en tubos micro-centrífuga, lo que requiere menos espacio en el refrigerador. En este caso, almacenar los tubos durante al menos una semana a 4 ° C, y se mueven las placas al gabinete crecimiento inmediatamente después de la siembra (véase 1.2.1.7). DÍA 3 </li&gt; <li> Mover las placas para el gabinete de crecimiento (luz continua (110 E · m -2 s -1), 21 ° C) durante 5 días (2 días de la germinación y 3 días de crecimiento) en una posición casi vertical (80 a 90 °) para garantizar el crecimiento de raíces en adelante, y no en el medio. DÍA 8 </li></ol></li><li> Lateral Raíz de inducción (NAA Personal) <ol><li> Preparar el mismo medio de crecimiento como se describe en 1.2.1.1 y 1.2.1.2. Preparar una solución de 50 mM balance de NAA en DMSO (PRECAUCIÓN: Use guantes). Enfriar el medio en autoclave a 65 ° C y añadir una solución NAA al medio para obtener una concentración final de 10 mM NAA (PRECAUCIÓN: El trabajo en condiciones estériles). <ol><li> Homogeneizar la adición agitando suavemente la botella durante 10 segundos. Verter 50 ml de medio por placa de Petri cuadrada (12 cm x 12 cm). </li></ol></li><li> La transferencia de los plantones de las placas que contienen medio de cultivo suplementado con 10 mM NPA a los supcomplementado con 10 mM NAA. <ol><li> Enganche los brazos de pinzas curvas debajo de los cotiledones de la plántula y retire suavemente de la placa. Sólo transferir plantas de semillero de la cual las raíces han crecido totalmente en contacto con el medio NPA-crecimiento y, preferiblemente, hacia abajo. </li><li> Rozar la raíz sobre la superficie del medio de crecimiento que contiene NAA-over una pequeña distancia. Asegúrese de que las raíces de las plantas están en buen contacto con el medio de crecimiento. Si es necesario, pulse la raíz suavemente a la superficie de medio de crecimiento con las pinzas. Nota: En caso de un experimento a gran escala, eliminar todas las plántulas que no están en contacto con la malla y la transferencia mediante el levantamiento de la malla en las dos esquinas superiores con unas pinzas. Asegúrese de que la malla está en buen contacto con el medio que contiene NAA-con una lectura rápida de la malla sobre la superficie del agar sobre una pequeña distancia (Figura 1E). </li></ol></li><li> Sellar las nuevas placas con cinta transpirable y colocarlos en el gabinete de crecimiento (conluz continua (110 E · m -2 s -1), 21 ° C) en posición vertical durante el tiempo deseado después de la inducción hasta el muestreo. Nota: En caso de un experimento a gran escala, el uso de un bisturí para cortar los segmentos de raíz todos a la vez directamente sobre la malla y probar ellos raspando suavemente la superficie de la malla. </li></ol></li></ol></li></ol> 2. LRIS Protocolo Maíz <ol><li> Estratificación de maíz Núcleos <ol><li> Incubar los granos de maíz a 4 ° C en la oscuridad durante al menos 1 semana. Nota: Este protocolo se ha desarrollado utilizando la línea consanguínea B73 maíz. </li></ol></li><li> Esterilización de maíz Núcleos DÍA 1 Nota: Aunque las plántulas de maíz no tienen que ser cultivadas en condiciones estériles, se recomienda para esterilizar los granos de maíz y trabajar con material estéril para evitar el crecimiento de hongos en el rollo de papelsistema. <ol><li> Ponga el número necesario de granos de maíz en un vaso de precipitados de vidrio esterilizado. </li><li> Añadir 100 ml de solución de esterilización (6% NaOCl en agua) (PRECAUCIÓN: El uso campana de humos). </li><li> Añadir una barra de agitación magnética y colocar el vaso de precipitados sobre un agitador magnético a baja velocidad de agitación (aproximadamente 250 rpm) a temperatura ambiente durante 5 min. </li><li> Enjuague cinco veces durante 5 min mediante la sustitución de la solución con 100 ml de agua estéril fresco. </li></ol></li><li> Siembra de maíz Núcleos <ol><li> Póngase los guantes para reducir el riesgo de contaminación, y tomar un rollo de toallas de papel. </li><li> Arranque dos tramos de papel de toalla de mano con una longitud total de dos hojas (aproximadamente 92 cm x 24 cm) y colocarlos en la parte superior de uno al otro en una superficie limpia (Figura 2). </li><li> Doblar las hojas dobles en toda la longitud (aproximadamente 92 cm x 12 cm) (Figura 2A). </li><li> Use pinzas para distribuir 10 núcleos en aproximadamente 2 cm de la parte superior sobre tque toda la longitud del papel, mientras se mantiene un espacio intermedio de 8 cm entre cada núcleo y 8 cm libre en ambos extremos (Figura 2B). Asegúrese de que la radícula del kernel esté hacia abajo y hacia el papel (Figura 2B). </li><li> Rodar suavemente el papel en toda la longitud, manteniendo las semillas en su lugar (Figura 2B). Para facilitar la rodadura, es opcional para pulverizar primero el papel con agua estéril. </li><li> Coloque los rollos de papel en tubos de vidrio esterilizados de unos 6 cm de diámetro y 14 cm de altura (por ejemplo, 250 ml tubos de centrífuga) y colocarlos en una rejilla (Figura 2C). </li></ol></li><li> La inducción de raíz lateral de maíz <ol><li> Preparar una solución de 50 mM NPA acciones (disuelto en DMSO) (PRECAUCIÓN: Use guantes). </li><li> Para cada tubo, hacer una solución NPA 50 M mediante la adición de 125 l de la solución madre mM NPA 50 a 125 ml de agua estéril en un vaso de vidrio esterilizado. </li><li> Mezclar bien yverter 125 ml de la solución 50 mM NPA sobre el rollo de papel en el tubo. El rollo de papel absorberá la solución y llegar a ser completamente empapado. Nota: Cuando se utiliza rollos de papel y tubos con otras dimensiones, ajustar el volumen en consecuencia. El líquido debe llegar hasta la mitad del tubo para asegurar una buena absorción. </li><li> Coloque el sistema de rollo de papel en un armario de crecimiento durante tres días (27 ° C, luz continua, humedad relativa del 70%). Asegúrese de que los rollos de papel quedan empapados añadiendo extra de solución 50 mM NPA, ya que la solución se evapora con el tiempo (Figura 2D). DÍA 4 </li><li> Preparar una solución de 50 mM NAA acciones (disuelto en DMSO) (PRECAUCIÓN: Use guantes). </li><li> Para cada tubo, preparar una solución de NAA 50 M mediante la adición de 125 l de las acciones mM NAA 50 a 125 ml de agua estéril en un vaso de vidrio esterilizado. </li><li> Apriete suavemente la mayor parte de la solución NPA restante de los rollos de papel y coloque elm en agua estéril durante 5 min para lavar a cabo (PRECAUCIÓN: Use guantes). Apriete suavemente la mayor parte del agua de los rollos de papel. Repita este paso de lavado tres veces. </li><li> Mezcle bien y vierta la solución NAA 50 M en los rollos de papel en los tubos. Asegúrese de que estén completamente empapados. </li><li> Coloque el sistema de rollo de papel en el gabinete de crecimiento (27 ° C, luz continua, 70% de humedad relativa) durante la duración deseada después de la inducción. </li></ol></li><li> La inducción de raíz lateral de raíces adventicias de la Corona de maíz Nota: El LRIS como se describe anteriormente induce raíces laterales en la raíz primaria. Sin embargo, en maíz y otros monocotiledóneas, la raíz primaria y las raíces seminales embrionarias, junto con sus raíces laterales, son principalmente importante durante el desarrollo de las plántulas. En una etapa posterior en el crecimiento de la planta, las raíces adventicias post-embrionarias surgen en el vástago y también desarrollan raíces laterales para formar un nuevo sistema de raíces 16. El LRIS también puede ser usod para inducir raíces laterales en estas raíces adventicias corona post-embrionarias siguiendo algunos ajustes menores a la LRIS en la raíz primaria embrionaria. <ol><li> Para hacer que los rollos de papel, crear un sándwich de papeles con respectivamente dos capas de papel toalla de mano en el lado exterior, y dos capas de papel dentro de la germinación. Coloca los granos esterilizados (vea los pasos 02.01 a 02.02) en entre las dos hojas de papel de germinación. Papel de germinación, en comparación con el papel toalla de mano, será menos propenso a ser penetrado por los pelos radiculares y raíces laterales, lo que hará la apertura de la rollos de papel más fácil después. Por otro lado, las dos capas externas de papel toalla de mano se facilitar la absorción del líquido. </li><li> Inserte los rodillos en 700 ml tubos de vidrio y verter agua estéril sin NPA sobre ellos. Asegúrese de que estén completamente empapados. </li><li> Germinar los granos esterilizados en el gabinete de crecimiento (véase el paso 2.4.9). </li><li> Crezca las plantas de semillero hasta las raíces adventicias de la coronacomenzar a surgir (6 días para B73). Asegúrese de que los rollos de papel se mantienen húmeda en todo momento mediante la adición de agua estéril cuando sea necesario. </li><li> Transferencia a una solución de 25 mM NPA durante 4 días (consulte los pasos 2.4.1 a 2.4.4), seguido de una inducción similar de la iniciación de la raíz lateral mediante la sustitución de la solución NPA con una solución NAA 50 mM después de una etapa de lavado (véase el paso 2.4 0.5 a 2.4.9). </li></ol></li></ol>

<ol>
	<li>Van Norman, J. M., Xuan, W., Beeckman, T., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=To+branch+or+not+to+branch:+the+role+of+pre-patterning+in+lateral+root+formation.">To branch or not to branch: the role of pre-patterning in lateral root formation.</a> Development. 140, 4301-4310 (2013).</li><li>Dolan, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+organisation+of+the+Arabidopsis+thaliana+root.">Cellular organisation of the Arabidopsis thaliana root.</a> Development. 119, 71-84 (1993).</li><li>Bell, J. K., McCully, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+histological+study+of+lateral+root+initiation+and+development+in+Zea+mays.">A histological study of lateral root initiation and development in Zea mays.</a> Protoplasma. 70, 179-205 (1970).</li><li>Benkova, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Local,+efflux-dependent+auxin+gradients+as+a+common+module+for+plant+organ+formation.">Local, efflux-dependent auxin gradients as a common module for plant organ formation.</a> Cell. 115, 591-602 (2003).</li><li>Beeckman, T., Burssens, S., Inz&#233;, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+peri-cell-cycle+in+Arabidopsis.">The peri-cell-cycle in Arabidopsis.</a> J. Exp. Bot. 52, 403-411 (2001).</li><li>Himanen, K., Boucheron, E., Vanneste, S., de Almeida Engler, J., Inz&#233;, D., Beeckman, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auxin-mediated+cell+cycle+activation+during+early+lateral+root+initiation.">Auxin-mediated cell cycle activation during early lateral root initiation.</a> Plant Cell. 14, 2339-2351 (2002).</li><li>Jansen, L., Parizot, B., Beeckman, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+system+for+lateral+roots+in+Arabidopsis+thaliana+and+maize.">Inducible system for lateral roots in Arabidopsis thaliana and maize.</a> Methods Mol Biol. 959, 149-158 (2013).</li><li>Casimiro, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auxin+transport+promotes+Arabidopsis+lateral+root+initiation.">Auxin transport promotes Arabidopsis lateral root initiation.</a> Plant Cell. 13, 843-852 (2001).</li><li>Himanen, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcript+profiling+of+early+lateral+root+initiation.">Transcript profiling of early lateral root initiation.</a> Proc. Natl. Acad. Sci. USA. 101, 5146-5151 (2004).</li><li>De Smet, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Receptor-like+kinase+ACR4+restricts+formative+cell+divisions+in+the+Arabidopsis+root.">Receptor-like kinase ACR4 restricts formative cell divisions in the Arabidopsis root.</a> Science. 322, 594-597 (2008).</li><li>Vanneste, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+cycle+progression+in+the+pericycle+is+not+sufficient+for+SOLITARY+ROOT/IAA14-mediated+lateral+root+initiation+in+Arabidopsis+thaliana.">Cell cycle progression in the pericycle is not sufficient for SOLITARY ROOT/IAA14-mediated lateral root initiation in Arabidopsis thaliana.</a> Plant Cell. 17, 3035-3050 (2005).</li><li>De Rybel, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+role+for+the+root+cap+in+root+branching+revealed+by+the+non-auxin+probe+naxillin.">A role for the root cap in root branching revealed by the non-auxin probe naxillin.</a> Nat. Chem. Biol. 8, 798-805 (2012).</li><li>Jansen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+transcriptomics+as+a+tool+for+the+identification+of+root+branching+genes+in+maize.">Comparative transcriptomics as a tool for the identification of root branching genes in maize.</a> Plant Biotechnol. J. 11, 1092-1102 (2013).</li><li>Parizot, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diarch+symmetry+of+the+vascular+bundle+in+Arabidopsis+root+encompasses+the+pericycle+and+is+reflected+in+distich+lateral+root+initiation.">Diarch symmetry of the vascular bundle in Arabidopsis root encompasses the pericycle and is reflected in distich lateral root initiation.</a> Plant Physiol. 146, 140-148 (2008).</li><li>Murashige, T., Skoog, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+revised+medium+for+rapid+growth+and+bio+assays+with+tobacco+tissue+cultures.">A revised medium for rapid growth and bio assays with tobacco tissue cultures.</a> Physiol. Plant. 15, 473-497 (1962).</li><li>Bellini, C., Pacurar, D. I., Perrone, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adventitious+roots+and+lateral+roots:+similarities+and+differences.">Adventitious roots and lateral roots: similarities and differences.</a> Annu Rev Plant Biol. 65, 639-666 (2014).</li><li>Grunewald, W., Parizot, B., Inz&#233;, D., Gheysen, G., Beeckman, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Developmental+biology+of+roots:+One+common+pathway+for+all+angiosperms?.">Developmental biology of roots: One common pathway for all angiosperms?.</a> Int. J. Plant Dev. Biol. 1, 212-225 (2007).</li><li>Parizot, B., Beeckman, T., Crespi, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomics+of+root+development.">Genomics of root development.</a> Root Genomics and Soil Interactions. , 3-28 (2012).</li><li>Bargmann, B. O., Birnbaum, K. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence+activated+cell+sorting+of+plant+protoplasts.">Fluorescence activated cell sorting of plant protoplasts.</a> Journal of visualized experiments : JoVE. , (2010).</li><li>Nakazono, M., Qiu, F., Borsuk, L. A., Schnable, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser-capture+microdissection,+a+tool+for+the+global+analysis+of+gene+expression+in+specific+plant+cell+types:+identification+of+genes+expressed+differentially+in+epidermal+cells+or+vascular+tissues+of+maize.">Laser-capture microdissection, a tool for the global analysis of gene expression in specific plant cell types: identification of genes expressed differentially in epidermal cells or vascular tissues of maize.</a> Plant Cell. 15, 583-596 (2003).</li><li>Ludwig, Y., Hochholdinger, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser+microdissection+of+plant+cells.">Laser microdissection of plant cells.</a> Methods Mol Biol. 1080, 249-258 (2014).</li><li>Beeckman, T., Engler, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+easy+technique+for+the+clearing+of+histochemically+stained+plant+tissue.">An easy technique for the clearing of histochemically stained plant tissue.</a> Plant Mol. Biol. Rep. 12, 37-42 (1994).</li><li>Ditengou, F. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanical+induction+of+lateral+root+initiation+in+Arabidopsis+thaliana.">Mechanical induction of lateral root initiation in Arabidopsis thaliana.</a> Proc. Natl. Acad. Sci. USA. 105, 18818-18823 (2008).</li><li>Lucas, M., Godin, C., Jay-Allemand, C., Laplaze, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auxin+fluxes+in+the+root+apex+co-regulate+gravitropism+and+lateral+root+initiation.">Auxin fluxes in the root apex co-regulate gravitropism and lateral root initiation.</a> J. Exp. Bot. 59, 55-66 (2008).</li><li>Wang, S., Taketa, S., Ichii, M., Xu, L., Xia, K., Zhou, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lateral+root+formation+in+rice+(Oryza+Sativa.+L.):+differential+effects+of+indole-3-acetic+acid+and+indole-3-butyric+acid.">Lateral root formation in rice (Oryza Sativa. L.): differential effects of indole-3-acetic acid and indole-3-butyric acid.</a> Plant Growth Regul. 41, 41-47 (2003).</li><li>Martinez-de la Cruz, E., Garcia-Ramirez, E., Vazquez-Ramos, J. M., Reyes de la Cruz, H., Lopez-Bucio, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auxins+differentially+regulate+root+system+architecture+and+cell+cycle+protein+levels+in+maize+seedlings.">Auxins differentially regulate root system architecture and cell cycle protein levels in maize seedlings.</a> J Plant Physiol. 176, 147-156 (2015).</li><li>Beyer, E. M., Morgan, P. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+ethylene+on+uptake,+distribution,+and+metabolism+of+indoleacetic+acid-1-14C+and+-2-14C+and+naphthaleneacetic+acid-1-14C.">Effect of ethylene on uptake, distribution, and metabolism of indoleacetic acid-1-14C and -2-14C and naphthaleneacetic acid-1-14C.</a> Plant Physiol. 46, 157-162 (1970).</li><li>Delbarre, A., Muller, P., Imhoff, V., Guern, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+mechanisms+controlling+uptake+and+accumulation+of+2,4-dichlorophenoxy+acetic+acid,+naphthalene-1-acetic+acid,+and+indole-3-acetic+acid+in+suspension-cultured+tobacco+cells.">Comparison of mechanisms controlling uptake and accumulation of 2,4-dichlorophenoxy acetic acid, naphthalene-1-acetic acid, and indole-3-acetic acid in suspension-cultured tobacco cells.</a> Planta. 198, 532-541 (1996).</li><li>Bailey-Serres, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microgenomics:+genome-scale,+cell-specific+monitoring+of+multiple+gene+regulation+tiers.">Microgenomics: genome-scale, cell-specific monitoring of multiple gene regulation tiers.</a> Annu Rev Plant Biol. 64, 293-325 (2013).</li><li>Perez-Torres, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phosphate+availability+alters+lateral+root+development+in+Arabidopsis+by+modulating+auxin+sensitivity+via+a+mechanism+involving+the+TIR1+auxin+receptor.">Phosphate availability alters lateral root development in Arabidopsis by modulating auxin sensitivity via a mechanism involving the TIR1 auxin receptor.</a> Plant Cell. 20, 3258-3272 (2008).</li></ol>

Los autores no tienen nada que revelar.

En el protocolo de Arabidopsis LRIS, es importante sólo para transferir las plántulas que han crecido totalmente en contacto con el medio de crecimiento que contiene NPA. Esto asegura que la iniciación de la raíz lateral está bloqueado en toda la longitud de la raíz. A fin de evitar herir las plántulas durante la transferencia, los brazos de las pinzas curvas pueden ser conectados en virtud de los cotiledones de la plántula. Tras la transferencia, asegúrese de que las raíces de las plántulas están en suficiente contacto con el medio de agar que contiene NAA. Esto se puede lograr con una lectura rápida de la raíz sobre la superficie del agar durante una pequeña distancia. Esto asegurará una inducción eficiente sincronizada de la iniciación de las raíces laterales en toda la longitud de la raíz. Las raíces pueden ser cultivadas expuestas a la luz, sin afectar negativamente a su crecimiento y la inducción de raíces laterales. En el protocolo LRIS maíz, es importante que la radícula del kernel se enfrenta hacia abajo y hacia el papel para garantizar la raíz crecerá downwards y adjuntar a la ponencia en el lado correcto 16. Después de tres días de tratamiento NPA, las plántulas deben haber surgido del núcleo con un pequeño brote, una raíz principal y raíces seminales 16. La raíz primaria debe ser de aproximadamente 2 cm de largo antes de proceder a la inducción de la iniciación de las raíces lateral. Este protocolo ha sido desarrollado utilizando la línea consanguínea B73 maíz, pero en caso de una línea de maíz con una tasa de crecimiento diferente, ajustar el tiempo de incubación en consecuencia. Asegúrese de que los rollos de papel quedan empapados añadiendo regularmente 50 mM solución NPA cuando el líquido se evapora con el tiempo, de lo contrario el tratamiento NPA podría ser temprano desarrollo de las raíces laterales ineficiente y no deseados podría ocurrir. El propio sistema evita la exposición de las raíces a la luz, pero la luz no es un problema importante y no afecta el crecimiento de la raíz y la inducción de raíces laterales. Formas alternativas para la inducción controlada de raíces laterales son el uso de mechanical flexión 23 o 24 gravistimulation. La principal ventaja de estos sistemas es que tienen una inducción más &quot;natural&quot; en comparación con los tratamientos hormonales en el LRIS, pero la desventaja es que están limitados en la cantidad de material que puede ser cosechada en un momento dado, ya que sólo producir un evento de iniciación de las raíces laterales en la curva por plántula en comparación con una inducción completa del periciclo en el LRIS. El LRIS utilizado en Arabidopsis y maíz se puede utilizar en una variedad de plantas, aunque las condiciones favorables necesitan ser optimizado. Para instalar una LRIS, dos importantes pasos sucesivos tienen que lograr: (1) el bloqueo de transporte de auxina y (2) la acumulación de auxina para inducir la iniciación de las raíces laterales. El sistema de cultivo debe permitir la captación eficiente y uniforme de los compuestos y debe permitir un buen desarrollo de las plántulas. Sistemas alternativos a medio sólido (Arabidopsis) y rollos de papel (maíz), tales como cultivo líquido, cultivo hidropónico, o aeroponics, podría ser utilizado para otras especies. La primera etapa en el LRIS, es decir, el bloqueo de la transporte de auxina, se puede lograr mediante la adición de un inhibidor de transporte de auxina. Aunque NPA conduce a un bloqueo eficaz de la iniciación de las raíces laterales en Arabidopsis y maíz, compuestos alternativos, tales como el ácido 2,3,5-triyodobenzoico (TIBA) o ácido clorofenoxiisobutírico p- (PCIB) podrían funcionar mejor en otras especies. Una optimización similar puede hacerse para el segundo paso del LRIS, es decir, el tratamiento de auxina. La auxina sintética NAA parece ser el más adecuado para un LRIS. El precursor de auxina indol-3-butírico (IBA) podría ser una buena alternativa ya que también induce fuertemente raíces laterales y tiene una alta bioactividad en diferentes plantas 25, Por otra parte, el ácido indol-3-acético auxina natural de 26. (IAA) es menos estable y más fácilmente metabolizado 27, racionalizando su efecto más débil sobre devel raízrrollo en, por ejemplo, el maíz o el arroz 25, 26. La auxina sintética del ácido 2,4-diclorofenoxiacético (2,4-D) se acumula en las células altamente pericycle, en parte porque no se exporta desde las celdas 28, impidiendo la iniciación de raíces laterales adecuado y la inducción artificial estructuras fusionadas. También otros compuestos que interactúan con las vías de auxina, tales como naxillin 12, se han mostrado para inducir la iniciación de raíces laterales en Arabidopsis y se pueden probar en otras especies. En algunos casos, la germinación es ineficiente en presencia de NPA y uno podría elegir para germinar las semillas primero en ausencia de NPA, para transferir posteriormente las plántulas al sistema NPA-que contiene. Esto induce un posible riesgo de tener primeros primordios radiculares laterales iniciadas antes de la inducción de raíces laterales con el tratamiento NAA y, por lo tanto, es importante única muestra la región de la raíz que alarga durante el tratamiento NPA. Siguiendo esta estrategia general, se shoULD poder optimizar un LRIS para prácticamente cualquier (semillas) de la planta y, como tal, tiene un sistema fácil para estudiar el desarrollo de las raíces laterales de la planta de interés. Además de la caracterización de la temporización de la iniciación de las raíces lateral puede ocurrir a través de líneas de marcador, como se ejemplifica para Arabidopsis. Si las líneas de marcador son difíciles de obtener, un estudio histológico detallado podría hacerse, pero esto consume mucho tiempo y las primeras divisiones celulares no son fácilmente reconocibles. Alternativamente, el análisis de expresión de marcadores de la división celular se puede utilizar para indicar el tiempo de las primeras divisiones celulares. El LRIS se puede utilizar para diferentes propósitos, tales como el análisis del transcriptoma 9-13 como se ha descrito brevemente en los resultados, así como las observaciones histológicas a nivel macroscópica y microscópica durante la iniciación de raíces laterales 14. Los diferentes tipos de muestreo, que van de órgano a escala celular 29, podría permitir desentrañar los diferentes aspectos de la tardeiniciación de las raíces al. Además, el LRIS puede ser usado para monitorear el efecto de diferentes compuestos sobre la iniciación de raíces laterales 12, 30. Por último, mediante el uso de líneas de reportero, un LRIS también se puede utilizar para caracterizar fácilmente la expresión de genes y / o localización de la proteína durante lateral desarrollo de las raíces.

El sistema radicular es crucial para el crecimiento de las plantas, ya que asegura el anclaje y la absorción de agua y nutrientes del suelo. Debido a la expansión de un sistema de raíces se basa principalmente en la producción de raíces laterales, su iniciación y la formación se han estudiado ampliamente. Raíces laterales se inician en un subconjunto específico de células pericycle, llamadas células fundadoras 1. En la mayoría de las dicotiledóneas, tales como Arabidopsis thaliana, estas células se encuentran en los polos protoxilema 2, mientras que en las monocotiledóneas, tales como maíz, que se encuentran en los polos del floema 3. Células fundadoras están marcados por un aumento de la respuesta auxina 4, seguido por la expresión de genes específicos del ciclo celular (por ejemplo, ciclina B1; 1 / CYCB1; 1), después de lo cual se someten a una primera ronda de divisiones anticlinales asimétricos 5. Después de una serie de divisiones anticlinales y periclinales coordinadas, se forma un primordio raíces laterales que finalmente emerger como un araíces laterales utonomous. La ubicación y el momento de la iniciación de las raíces laterales, sin embargo no son predecibles, ya que estos eventos no son ni abundantes ni sincronizada. Esto impide el uso de enfoques moleculares tales como la transcriptómica para estudiar este proceso. Para hacer frente a esto, un sistema lateral inducible Root (LRIS) se ha desarrollado 6, 7. En este sistema, las plántulas se tratan primero con N -1-naftilftalámico (NPA), que inhibe el transporte de auxina y la acumulación, en consecuencia, el bloqueo de la iniciación de las raíces laterales 8. Por posteriormente transferir la plántula al medio que contiene la auxina sintética ácido acético 1-naftaleno (NAA), toda la capa periciclo responde a los niveles de auxina elevadas de ese modo masivamente raíz iniciar divisiones celulares laterales inductores 6. Como tal, este sistema conduce a las raíces rápidos, síncronos y extensas iniciaciones laterales, permitiendo una fácil colección de muestras de raíces enriquecidos para una etapa específica en los últimos tiemposdesarrollo de las raíces ral. Posteriormente, estas muestras se pueden utilizar para determinar los perfiles de expresión de todo el genoma durante la formación de raíces laterales. El LRIS ha dado conocimiento ya significativa sobre la iniciación lateral raíces en Arabidopsis y maíz 9-13, pero la necesidad de aplicar este sistema a otras especies de plantas se hace más evidente a medida que más genomas se secuencian y hay un interés creciente para transferir conocimientos a económica importante especies. Aquí, se dan los protocolos detallados de la Arabidopsis y LRISs maíz. A continuación, se proporciona un ejemplo de la utilización del sistema, ilustrando cómo se pueden usar los datos obtenidos de la transcriptómica LRIS maíz para identificar homólogos funcionales que tienen una función conservada durante la iniciación de raíces laterales a través de diferentes especies de plantas. Por último, las directrices para optimizar la LRIS para se proponen otras especies de plantas.

<table border="0" cellpadding="0" cellspacing="0" width="1258">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">ARABIDOPSIS LRIS</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td style="width:551px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Seeds</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Arabidopsis seeds</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td>Col-0 ecotype</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Gas sterilization of seeds</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">micro-centrifuge tubes 1.5 ml</td>
			<td style="width:228px;">SIGMA-ALDRICH</td>
			<td style="width:119px;">0030 125.215</td>
			<td>Eppendorf microtubes 3810X, PCR clean</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">micro-centrifuge tubes 2 ml</td>
			<td style="width:228px;">SIGMA-ALDRICH</td>
			<td style="width:119px;">0030 120.094</td>
			<td>Eppendorf Safe-Lock microcentrifuge tubes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">hydrochloric acid</td>
			<td style="width:228px;">Merck KGaA</td>
			<td style="width:119px;">1,003,171,000</td>
			<td>37% (fuming) for analysis EMSURE ACS,ISO,Reag. Ph Eu</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">glass desiccator</td>
			<td style="width:228px;">SIGMA-ALDRICH</td>
			<td style="width:119px;"></td>
			<td>Pyrex</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:361px;">glass beaker</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">plastic micro-centrifuge tubes box or holder</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Bleach sterilization of seeds</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">ethanol</td>
			<td style="width:228px;">Chem-Lab nv</td>
			<td style="width:119px;">CL00.0505.1000</td>
			<td>Ethanol, abs. 100% a.r. dilute to 70%</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">sodium hypochlorite (NaOCl)</td>
			<td style="width:228px;">Carl Roth</td>
			<td style="width:119px;">9062.3</td>
			<td>12%</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Tween 20</td>
			<td style="width:228px;">SIGMA-ALDRICH</td>
			<td style="width:119px;">P1379</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">sterile water</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Growth medium</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Murashige and Skoog salt mixture</td>
			<td style="width:228px;">DUCHEFA Biochemie B.V.</td>
			<td style="width:119px;">M0221-0050</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">myo-inositol</td>
			<td style="width:228px;">SIGMA-ALDRICH</td>
			<td style="width:119px;">I5125-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">2-(N-morpholino)ethanesulfonic acid (MES)</td>
			<td style="width:228px;">DUCHEFA Biochemie B.V.</td>
			<td style="width:119px;">M1503.0100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">sucrose</td>
			<td style="width:228px;">VWR, Internation LLC</td>
			<td style="width:119px;">27483.294</td>
			<td>D(+)-Sucrose Ph. Eur.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">KOH</td>
			<td style="width:228px;">Merck KGaA</td>
			<td style="width:119px;">1050211000</td>
			<td>pellets for analysis (max. 0.002% Na) EMSURE ACS,ISO,Reag. Ph Eur</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Plant Tissue Culture Agar</td>
			<td style="width:228px;">LabM Limited</td>
			<td style="width:119px;">MC029</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Lateral root induction chemicals</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">N-1-naphthylphthalamic acid (NPA)</td>
			<td style="width:228px;">DUCHEFA Biochemie B.V.</td>
			<td style="width:119px;">No. N0926.0250</td>
			<td>10 &#181;M (Arabidopsis)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">1-naphthalene acetic acid (NAA)</td>
			<td style="width:228px;">DUCHEFA Biochemie B.V.</td>
			<td style="width:119px;">No. N0903.0050</td>
			<td>10 &#181;M (Arabidopsis)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">dimethylsulfoxide (DMSO)</td>
			<td style="width:228px;">SIGMA-ALDRICH</td>
			<td style="width:119px;">494429-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Making a mesh for transfer</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">nylon mesh</td>
			<td style="width:228px;">Prosep byba</td>
			<td style="width:119px;"></td>
			<td>Synthetic nylon mesh 20 &#181;m</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Sowing and seedling handling</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">square petri dish plates</td>
			<td style="width:228px;">GOSSELIN</td>
			<td style="width:119px;">BP124-05</td>
			<td>12 x 12 cm</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">50 ml DURAN tubes</td>
			<td style="width:228px;">SIGMA-ALDRICH</td>
			<td style="width:119px;">CLS430304</td>
			<td>Corning&#160;50 mL centrifuge tubes</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">drigalski</td>
			<td style="width:228px;">Carl Roth</td>
			<td style="width:119px;">K732.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">pipette</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">cut pipette tips</td>
			<td style="width:228px;">Daslab</td>
			<td style="width:119px;">162001X</td>
			<td>Universal 200, cut off 5 mm of tip before autoclaving</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">breathable tape&#160;</td>
			<td style="width:228px;">3M Deutschland GmbH</td>
			<td style="width:119px;">cat. no. 1530-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">tweezers</td>
			<td style="width:228px;">Fiers nv/sa</td>
			<td style="width:119px;">K342.1; K344.1</td>
			<td>Dumont tweezers type a nr 5; Dumont tweezers type e nr 7</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Growth conditions</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">growth room</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td>21 &#176;C, continuous light</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Materials</td>
			<td style="width:228px;">Company</td>
			<td style="width:119px;">Catalog</td>
			<td>Comments</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">MAIZE LRIS</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Seeds</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Maize kernels</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td>B-73</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Bleach sterilization of kernels</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:361px;">glass beaker</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">magnetic stirrer&#160;</td>
			<td style="width:228px;">Fiers nv/sa</td>
			<td style="width:119px;">C267.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">sodium hypochlorite (NaOCl)</td>
			<td style="width:228px;">Carl Roth</td>
			<td style="width:119px;">9062.3</td>
			<td>12%</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">sterile water</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Lateral root induction chemicals</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">N-1-naphthylphthalamic acid (NPA)</td>
			<td style="width:228px;">DUCHEFA Biochemie B.V.</td>
			<td style="width:119px;">No. N0926.0250</td>
			<td>50 &#181;M (maize primary root), 25 &#181;M (maize adventitious root)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">1-naphthalene acetic acid (NAA)</td>
			<td style="width:228px;">DUCHEFA Biochemie B.V.</td>
			<td style="width:119px;">No. N0903.0050</td>
			<td>50 &#181;M (maize)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">dimethylsulfoxide (DMSO)</td>
			<td style="width:228px;">SIGMA-ALDRICH</td>
			<td style="width:119px;">494429-1L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Sowing and seedling handling</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">paper hand towels</td>
			<td style="width:228px;">Kimberly-Clark Professional*</td>
			<td style="width:119px;">6681</td>
			<td>SCOTT Hand Towels - Roll / White; sheet size (24 x 46 cm)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">seed germination paper</td>
			<td style="width:228px;">Anchor Paper Company</td>
			<td style="width:119px;"></td>
			<td>10 X 15 38# seed germination paper</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">tweezers</td>
			<td style="width:228px;">Fiers nv/sa</td>
			<td style="width:119px;">K342.1; K344.1</td>
			<td>Dumont tweezers type a nr 5; Dumont tweezers type e nr 7</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">250 ml (centrifuge) tubes</td>
			<td style="width:228px;">SCHOTT DURAN</td>
			<td style="width:119px;">2160136</td>
			<td>approx. 5.6 cm diameter and 14.7 cm height&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">700 ml tubes</td>
			<td style="width:228px;">DURAN GROUP</td>
			<td style="width:119px;">213994609</td>
			<td>cylinders, round foot tube, D 60&#160; x 250</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">rack</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td>for maize tubes, home made</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">sterile water</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:361px;">Growth conditions</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">growth cabinet</td>
			<td style="width:228px;"></td>
			<td style="width:119px;"></td>
			<td>27 &#176;C, continuous light, 70% relative humidity</td>
		</tr>
	</tbody>
</table>

lateral root inducible system in arabidopsis and maize

Lateral root development contributes significantly to the root system, and hence is crucial for plant growth. The study of lateral root initiation is however tedious, because it occurs only in a few cells inside the root and in an unpredictable manner. To circumvent this problem, a Lateral Root Inducible System (LRIS) has been developed. By treating seedlings consecutively with an auxin transport inhibitor and a synthetic auxin, highly controlled lateral root initiation occurs synchronously in the primary root, allowing abundant sampling of a desired developmental stage. The LRIS has first been developed for Arabidopsis thaliana, but can be applied to other plants as well. Accordingly, it has been adapted for use in maize (Zea mays). A detailed overview of the different steps of the LRIS in both plants is given. The combination of this system with comparative transcriptomics made it possible to identify functional homologs of Arabidopsis lateral root initiation genes in other species as illustrated here for the CYCLIN B1;1 (CYCB1;1) cell cycle gene in maize. Finally, the principles that need to be taken into account when an LRIS is developed for other plant species are discussed.

Aplicación del LRIS a Realizar Transcriptómica comparativos del lateral Proceso Raíz Iniciación Una aplicación de la LRIS es la comparación y correlación de los perfiles de expresión génica durante la formación de raíces laterales en diferentes especies. Transcriptómica comparativos acerca a crear la posibilidad de identificar los genes ortólogos involucrados en el proceso de desarrollo de las raíces laterales en diferentes especies. Iniciación de las raíces laterales, que consiste en la formación de un nuevo órgano de un subconjunto de células contenidas en un eje de la raíz ya formado, es el principal mecanismo compartido por las angiospermas para controlar su arquitectura de las raíces. En consecuencia, es muy probable que evolucionó a partir de vías existentes presentes en un ancestro común y fue conservado durante la evolución. De hecho, los reguladores potenciales comunes de la iniciación de raíces laterales se han encontrado en diferentes especies &lt;sup&gt; 17, 18. Material de muestreo mediante el LRIS en Arabidopsis y maíz, y el análisis del transcriptoma El LRIS se ha establecido en dos especies diferentes:. Arabidopsis y maíz 10, 13 En ambas especies, se decidió probar las plantas justo antes del tratamiento NAA, y poco después de la inducción, en el inicio de, o durante la respuesta auxina, como así como en el inicio de, o durante las primeras divisiones en el periciclo. Además, clasificación de células activadas por fluorescencia 19 (FACS) se utilizó en Arabidopsis o microscopía láser de captura 20, 21 (LCM) en el maíz para seleccionar las células pericycle. En Arabidopsis, los puntos de tiempo de 2 y 6 horas después de la inducción fueron elegidos en base a la caracterización transcripcional del pDR5 :: respuesta auxina GUS y pCYCB1; 1 :: ciclo celular líneas de marcador GUS 9 (Figura 3). En el maíz, señala el tiempo 2, 3 y 4 h después de la inducción, fueron seleccionados después de la caracterización microscópica de la actividad de la división celular y el análisis de varios genes marcadores del ciclo celular de expresión usando inversa cuantitativa reacción en cadena de la polimerasa con transcripción en tiempo real (qRT-PCR) 13 . Se extrajo ARN de las células aisladas y se hibridó en las plataformas de microarrays como se describió previamente 10, 13. Encontrar el ortholog de ​​Arabidopsis CYCB1; 1 (AtCYCB1; 1) en maíz En Arabidopsis, la línea de marcador pCYCB1; 1 :: GUS ha sido ampliamente utilizado para rastrear las primeras divisiones de la periciclo durante la iniciación de la raíz lateral. Tal marcador sería muyútil en el maíz. Varios homólogos de AtCYCB1; 1 se encontraron en el maíz (www.maizesequence.org, todos los péptidos, BLASTP, ajustes por defecto). Seis de ellos estuvieron presentes en el microarray realizado después LRIS en el maíz y mostraron enriquecimiento significativo. La mejor BLAST afectados, GRMZM2G310115, mostró niveles muy altos de transcripción después LRIS, similar a lo observado en Arabidopsis para AtCYCB1; 1 (Figura 4). Aplicación del LRIS a Compruebe individual Expresión Génica Para validar GRMZM2G310115 como un buen candidato ortólogo de AtCYCB1; 1 en la iniciación de las raíces laterales de maíz, un tiempo real QRT-PCR en muestras tomadas en diferentes puntos de tiempo se llevó a cabo durante el curso de una LRIS 13. Las plantas se trataron como se describe en el protocolo mencionado anteriormente y se recogieron a diferentes puntos de tiempo: antes de NTratamiento AA (NPA), y después de 2, 3 y 4 h de tratamiento NAA. Además, el material de las plantas que crecen sólo en el agua se cosechó para comparar la expresión de genes entre LRIS y condiciones neutras. Inmediatamente después de la cosecha, los segmentos de raíz correspondiente a una región comprendida entre 5 mm y 15 mm por encima de la punta de la raíz fueron disecados bajo el binocular. El uso de pinzas, la corteza se separó de la estela (que contiene el periciclo), y el ARN se extrajo de ambos tejidos. Este último paso se realizó en lugar de LCM, porque es mucho más rápido y más barato para su validación. Usando el siguiente avance respectivo y atrás primers QRT-PCR, AGCAGGACGCAGTTGGAGAG y GAGCCGAGAGCACAGAAGAAAG, GRMZM2G310115 fue validado a ser hasta reguladas en LRIS, y ser específico para los tejidos estela (Figura 5). Además, este experimento muestra que sin inducción síncrono, los eventos discretos de la iniciación de raíces laterales que suceden en una raíz que crece en agua no son detectables,<html> e ilustrar la necesidad de la LRIS para revelar la expresión génica diferencial relacionada con el proceso de la iniciación de la raíz lateral. <img alt="Figura 1" src="/files/ftp_upload/53481/53481fig1.jpg" /> Figura 1. Lateral raíz sistema inducible de Arabidopsis (A) Preparación de la malla de nylon (20 m.): Cortar la malla de nylon (9 cm por 9 cm), envuélvalo en papel de aluminio y lo puso en un vaso de vidrio para autoclave. (B) Aplique la malla de nylon sobre una placa de NPA-que contiene (10 M) con unas pinzas. A continuación, utilice un Drigalski estéril con el fin de eliminar las burbujas de aire. (C) la siembra de semillas en la malla de nylon utilizando una pipeta. (D) la siembra de semillas en la malla de nylon utilizando un palillo de dientes. (E) Transferir el nylon con malla a una placa que contiene NAA-(10 M) con unas pinzas.81 / 53481fig1large.jpg &quot;target =&quot; _ blank &quot;&gt; Haga clic aquí para ver una versión más grande de esta figura. <img alt="Figura 2" src="/files/ftp_upload/53481/53481fig2.jpg" /> Figura 2. Lateral sistema inducible Raíz de maíz. &#160; (A) Preparación de los rollos de papel: lugar dos capas de papel (92 cm x 24 cm, longitud de dos hojas) en la parte superior de uno al otro y doblarlas duplican sobre la longitud (92 cm x 12 cm). (B) Ponga 10 granos de maíz esterilizados con la radícula hacia abajo en el papel a 2 cm de la parte superior con un espacio intermedio de 8 cm. Entonces enrollar el papel, manteniendo los granos de maíz en su lugar. (C) Coloque los rollos de papel en tubos (por ejemplo, 250 ml tubos de centrífuga) y los puso en un estante. (D) Crezca las plántulas de maíz durante tres días en una solución NPA 50 M (a 27 ° C, luz continua, Humi relativadity 70%). (E) Izquierda: plántulas justo antes de la transferencia a NAA; Secundaria: secciones transversales de micrótomo justo antes de la transferencia de NAA y 2 días después de la transferencia de NAA; Derecha:. Plántulas con raíces laterales surgido visibles 5 días después de la transferencia de NAA <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53481/53481fig2large.jpg" target="_blank">Haga clic aquí para ver una versión más grande de esta figura.</a> <img alt="figura 3" src="/files/ftp_upload/53481/53481fig3.jpg" /> Figura 3. Lateral Raíz Iniciación se estimula Tras prolongada supuesto NAA Tratamiento. (AF) Tiempo que muestra la respuesta auxina durante un tratamiento NAA utilizando la línea de marcador pDR5 :: GUS. La respuesta auxina, que es uno de los primeros eventos de activación la iniciación de raíces laterales, empieza 2 h después del inicio del tratamiento NAA. En el panel superior, se da una visión general de toda la planta de semillero; el show panel inferiors la respuesta auxina en la punta de la raíz. Curso (GM) Tiempo de un tratamiento NAA utilizando el pCYCB1; línea de marcador 1 :: GUS. La señal de GUS representa la expresión de la CYCB1; 1 gen, indicando que las divisiones celulares primeros conducen a la formación de raíces laterales comienzan 6 h ​​después del inicio del tratamiento NAA. En el panel superior, se da una visión general de toda la planta de semillero; el panel inferior muestra CYCB1;. 1 expresión en la punta de la raíz (tinción GUS según Beeckman y Engler, 1994 22) <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53481/53481fig3large.jpg" target="_blank">Haga clic aquí para ver una versión más grande de esta figura.</a> <img alt="Figura 4" src="/files/ftp_upload/53481/53481fig4.jpg" /> Figura 4. Expresión Perfil de Genes CYCB1 en Arabidopsis y maíz durante LRIS. </strong&gt; &#160; (A) los valores de expresión de microarrays de AtCYCB1; 1 durante LRIS como se describe por De Smet et al. 2008 valores de expresión 10 (B) Microarray de potenciales ortólogos de AtCYCB1; 1 durante LRIS según lo descrito por Jansen et al. 2.013 puntaje 13 BLASTP es la puntuación obtenida en la voladura de la secuencia de la proteína de AtCYCB1; 1 en el genoma del maíz. Las barras de error expresan desviación estándar y ** es sinónimo de un valor de p ≤0.01. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53481/53481fig4large.jpg" target="_blank">Por favor haga clic aquí para ver una versión más grande de esta figura.</a> <img alt="Figura 5" src="/files/ftp_upload/53481/53481fig5.jpg" /> Figura 5. Expresión de GRMZM2G310115 en la estela y la corteza de las raíces del maíz durante LRIS. La expresión de &lt;em&gt; GRMZM2G310115 durante LRIS en el maíz fue evaluada por cuantitativa en tiempo real QRT-PCR en muestras de estela y la corteza disecados. Una muestra adicional se realizó en plantas cultivadas en agua. Los valores se normalizaron para la expresión en la estela en el agua. Las barras de error expresan desviación estándar y ** es sinónimo de un valor de p ≤0.01 (cebadores y los genes de referencia según Jansen et al. 2013 13). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53481/53481fig5large.jpg" target="_blank">Por favor, haga clic aquí para ver una versión más grande de esta figura.</a>

Watch this Scientific Journal Video about Lateral Root Inducible System in Arabidopsis and Maize at JoVE.com

Sistema Inducible de Raíz Lateral en Arabidopsis y Maíz | Biología | Video

Lateral Root Inducible System in Arabidopsis and Maize

Lateral sistema inducible Raíz en<em&gt; Arabidopsis</em&gt; Y maíz

The Lateral Root Inducible System (LRIS) allows for synchronous induction of lateral roots and is presented for Arabidopsis thaliana and maize.

Lateral root development contributes significantly to the root system, and hence is crucial for plant growth. The study of lateral root initiation is ...

lateral-root-inducible-system-in-arabidopsis-and-maize

Nanyang Technological University

Research

Education

JoVE Journal

JoVE Core

Biology

Lateral Root Inducible System in Arabidopsis and Maize

Plant Biology

Plant Structure, Growth, and Nutrition

SCIENTISTS IN ACTION

13.7K vistas.  Ghent. The Lateral Root Inducible System (LRIS) allows for synchronous induction of lateral roots and is presented for Arabidopsis thaliana and maize.

Video: Lateral Root Inducible System in Arabidopsis and Maize

Preparation and Maintenance of Dorsal Root Ganglia Neurons in Compartmented Cultures

Neurons extend axonal processes that are far removed from the cell body to innervate target tissues, where target-derived growth factors are required for neuronal survival and function. Neurotrophins are specifically required to maintain the survival and differentiation of innervating sensory neurons but the question of how these target-derived neurotrophins communicate to the cell body of innervating neurons has been an area of active research for over 30 years. The most commonly accepted model of how neurotrophin signals reach the cell body proposes that signaling endosomes carry this signal retrogradely along the axon. In order to study retrograde transport, a culture system was originally devised by Robert Campenot, in which cell bodies are isolated from their axons. The technique of preparing these compartmented chambers for culturing sensory neurons recapitulates the selective stimulation of neuron terminals that occurs in vivo following release of target-derived neurotrophins. Retrograde signaling events that require long-range microtubule dependent retrograde transport have important implications for the treatment of neurodegenerative disorders.

Here we describe the technique of preparing and maintaining compartmented chambers for culturing sensory neurons of the dorsal root ganglia.

Preparación y mantenimiento de las neuronas dorsales ganglios de raíz en las culturas con compartimientos

Neurons extend axonal processes that are far removed from the cell body to innervate target tissues, where target-derived growth factors are required for ...

Investigación

Biología

Do-It-Yourself Device for Recovery of Cryopreserved Samples Accidentally Dropped into Cryogenic Storage Tanks

Liquid nitrogen is colorless, odorless, extremely cold (-196 &deg;C) liquid kept under pressure. It is commonly used as a cryogenic fluid for long term storage of biological materials such as blood, cells and tissues 1,2. The cryogenic nature of liquid nitrogen, while ideal for sample preservation, can cause rapid freezing of live tissues on contact - known as 'cryogenic burn'2, which may lead to severe frostbite in persons closely involved in storage and retrieval of samples from Dewars. Additionally, as liquid nitrogen evaporates it reduces the oxygen concentration in the air and might cause asphyxia, especially in confined spaces2.
In laboratories, biological samples are often stored in cryovials or cryoboxes stacked in stainless steel racks within the Dewar tanks1. These storage racks are provided with a long shaft to prevent boxes from slipping out from the racks and into the bottom of Dewars during routine handling. All too often, however, boxes or vials with precious samples slip out and sink to the bottom of liquid nitrogen filled tank. In such cases, samples could be tediously retrieved after transferring the liquid nitrogen into a spare container or discarding it. The boxes and vials can then be relatively safely recovered from emptied Dewar. However, the cryogenic nature of liquid nitrogen and its expansion rate makes sunken sample retrieval hazardous. It is commonly recommended by Safety Offices that sample retrieval be never carried out by a single person. Another alternative is to use commercially available cool grabbers or tongs to pull out the vials3. However, limited visibility within the dark liquid filled Dewars poses a major limitation in their use.
In this article, we describe the construction of a Cryotolerant DIY retrieval device, which makes sample retrieval from Dewar containing cryogenic fluids both safe and easy.

Here we present a low cost, durable cryotolerant device for sample retrieval from Dewar tanks filled with liquid nitrogen. The ease of construction and modular design of the device makes the process of sample retrieval from cryogenic tanks safe and easy.

Do-It-Yourself de dispositivos para la recuperación de las muestras criopreservadas de caída accidental en los tanques de almacenamiento criogénicos

Liquid nitrogen is colorless, odorless, extremely cold (-196 &deg;C) liquid kept under pressure. It is commonly used as a cryogenic fluid for long term ...

Using Flatbed Scanners to Collect High-resolution Time-lapsed Images of the Arabidopsis Root Gravitropic Response

Research efforts in biology increasingly require use of methodologies that enable high-volume collection of high-resolution data. A challenge laboratories can face is the development and attainment of these methods. Observation of phenotypes in a process of interest is a typical objective of research labs studying gene function and this is often achieved through image capture. A particular process that is amenable to observation using imaging approaches is the corrective growth of a seedling root that has been displaced from alignment with the gravity vector. Imaging platforms used to measure the root gravitropic response can be expensive, relatively low in throughput, and/or labor intensive. These issues have been addressed by developing a high-throughput image capture method using inexpensive, yet high-resolution, flatbed scanners. Using this method, images can be captured every few minutes at 4,800 dpi. The current setup enables collection of 216 individual responses per day. The image data collected is of ample quality for image analysis applications.

This protocol describes a process for rapid collection of images of Arabidopsis seedlings responding to a gravity stimulus using commercially-available flatbed scanners. The method allows for inexpensive, high-volume capture of high-resolution images amenable for downstream analysis algorithms.

El uso de escáneres planos para recopilar de alta resolución de duración transcurrido Imágenes de la gravitrópica Respuesta Arabidopsis Root

Research efforts in biology increasingly require use of methodologies that enable high-volume collection of high-resolution data. A challenge laboratories ...

An Assay for Lateral Line Regeneration in Adult Zebrafish

Due to the clinical importance of hearing and balance disorders in man, model organisms such as the zebrafish have been used to study lateral line development and regeneration. The zebrafish is particularly attractive for such studies because of its rapid development time and its high regenerative capacity. To date, zebrafish studies of lateral line regeneration have mainly utilized fish of the embryonic and larval stages because of the lower number of neuromasts at these stages. This has made quantitative analysis of lateral line regeneration/and or development easier in the earlier developmental stages. Because many zebrafish models of neurological and non-neurological diseases are studied in the adult fish and not in the embryo/larvae, we focused on developing a quantitative lateral line regenerative assay in adult zebrafish so that an assay was available that could be applied to current adult zebrafish disease models. Building on previous studies by Van Trump et al.17&#160;that described procedures for ablation of hair cells in adult Mexican blind cave fish and zebrafish (Danio rerio), our assay was designed to allow quantitative comparison between control and experimental groups. This was accomplished by developing a regenerative neuromast standard curve based on the percent of neuromast reappearance over a 24 hr time period following gentamicin-induced necrosis of hair cells in a defined region of the lateral line. The assay was also designed to allow extension of the analysis to the individual hair cell level when a higher level of resolution is required.

Because many zebrafish models of neurological and non-neurological diseases are studied in the adult fish rather than the embryo/larvae, we developed a quantitative lateral line regenerative assay that can be applied to adult zebrafish disease models. The assay involved resolution at the 1) neuromast and 2) individual hair cell levels.

Un ensayo para la línea lateral de regeneración en adultos de pez cebra

Due to the clinical importance of hearing and balance disorders in man, model organisms such as the zebrafish have been used to study lateral line ...

Measuring Spatial and Temporal Ca2+ Signals in Arabidopsis Plants

Developmental and environmental cues induce Ca2+ fluctuations in plant cells. Stimulus-specific spatial-temporal Ca2+ patterns are sensed by cellular Ca2+ binding proteins that initiate Ca2+ signaling cascades. However, we still know little about how stimulus specific Ca2+ signals are generated. The specificity of a Ca2+ signal may be attributed to the sophisticated regulation of the activities of Ca2+ channels and/or transporters in response to a given stimulus. To identify these cellular components and understand their functions, it is crucial to use systems that allow a sensitive and robust recording of Ca2+ signals at both the tissue and cellular levels. Genetically encoded Ca2+ indicators that are targeted to different cellular compartments have provided a platform for live cell confocal imaging of cellular Ca2+ signals. Here we describe instructions for the use of two Ca2+ detection systems: aequorin based FAS (film adhesive seedlings) luminescence Ca2+ imaging and case12 based live cell confocal fluorescence Ca2+ imaging. Luminescence imaging using the FAS system provides a simple, robust and sensitive detection of spatial and temporal Ca2+ signals at the tissue level, while live cell confocal imaging using Case12 provides simultaneous detection of cytosolic and nuclear Ca2+ signals at a high resolution.

Measuring Spatial and Temporal Ca2+ Signals in Arabidopsis Plants

Ca2+ signaling regulates diverse biological processes in plants. Here we present approaches for monitoring abiotic stress induced spatial and temporal Ca2+ signals in Arabidopsis cells and tissues using the genetically encoded Ca2+ indicators Aequorin or Case12.

Medición Espacial y Temporal Ca<sup&gt; 2 +</sup&gt; Las señales en plantas de Arabidopsis

Developmental and environmental cues induce Ca2+ fluctuations in plant cells. Stimulus-specific spatial-temporal Ca2+ patterns are sensed by cellular Ca2+ ...

High Resolution Quantification of Crystalline Cellulose Accumulation in Arabidopsis Roots to Monitor Tissue-specific Cell Wall Modifications

Plant cells are surrounded by a cell wall, the composition of which determines their final size and shape. The cell wall is composed of a complex matrix containing polysaccharides that include cellulose microfibrils that form both crystalline structures and cellulose chains of amorphous organization. The orientation of the cellulose fibers and their concentrations dictate the mechanical properties of the cell. Several methods are used to determine the levels of crystalline cellulose, each bringing both advantages and limitations. Some can distinguish the proportion of crystalline regions within the total cellulose. However, they are limited to whole-organ analyses that are deficient in spatiotemporal information. Others relying on live imaging, are limited by the use of imprecise dyes. Here, we report a sensitive polarized light-based system for specific quantification of relative light retardance, representing crystalline cellulose accumulation in cross sections of Arabidopsis thaliana roots. In this method, the cellular resolution and anatomical data are maintained, enabling direct comparisons between the different tissues composing the growing root. This approach opens a new analytical dimension, shedding light on the link between cell wall composition, cellular behavior and whole-organ growth.

High Resolution Quantification of Crystalline Cellulose Accumulation in Arabidopsis Roots to Monitor Tissue-specific Cell Wall Modifications

Crystalline cellulose is an important constituent of the plant cell wall. However, its quantification at a cellular resolution is technically challenging. Here, we report the use of polarized light technology and root cross sections to obtain information of cell wall composition at a spatiotemporal resolution.

Alta resolución Cuantificación de celulosa cristalina acumulación en<em&gt; Arabidopsis</em&gt; Las raíces para monitorear la célula específica de tejido de pared Modificaciones

Plant cells are surrounded by a cell wall, the composition of which determines their final size and shape. The cell wall is composed of a complex matrix ...

Micron-scale Phenotyping Techniques of Maize Vascular Bundles Based on X-ray Microcomputed Tomography

It is necessary to accurately quantify the anatomical structures of maize materials based on high-throughput image analysis techniques. Here, we provide a 'sample preparation protocol' for maize materials (i.e., stem, leaf, and root) suitable for ordinary microcomputed tomography (micro-CT) scanning. Based on high-resolution CT images of maize stem, leaf, and root, we describe two protocols for the phenotypic analysis of vascular bundles: (1) based on the CT image of maize stem and leaf, we developed a specific image analysis pipeline to automatically extract 31 and 33 phenotypic traits of vascular bundles; (2) based on the CT image series of maize root, we set up an image processing scheme for the three-dimensional (3-D) segmentation of metaxylem vessels, and extracted two-dimensional (2-D) and 3-D phenotypic traits, such as volume, surface area of metaxylem vessels, etc. Compared with traditional manual measurement of vascular bundles of maize materials, the proposed protocols significantly improve the efficiency and accuracy of micron-scale phenotypic quantification.

We provide a novel method to improve the X-ray absorption contrast of maize tissue suitable for ordinary microcomputed tomography scanning. Based on CT images, we introduce a set of image-processing workflows for different maize materials to effectively extract microscopic phenotypes of vascular bundles of maize.

Técnicas de microescala Phenotyping de maíz haces vasculares basados en tomografía de rayos x Microcomputed

It is necessary to accurately quantify the anatomical structures of maize materials based on high-throughput image analysis techniques. Here, we provide a ...

Wide-Field, Real-Time Imaging of Local and Systemic Wound Signals in Arabidopsis

Plants respond to mechanical stresses such as wounding and herbivory by inducing defense responses both in the damaged and in the distal undamaged parts. Upon wounding of a leaf, an increase in cytosolic calcium ion concentration (Ca2+ signal) occurs at the wound site. This signal is rapidly transmitted to undamaged leaves, where defense responses are activated. Our recent research revealed that glutamate leaking from the wounded cells of the leaf into the apoplast around them serves as a wound signal. This glutamate activates glutamate receptor-like Ca2+ permeable channels, which then leads to long-distance Ca2+ signal propagation throughout the plant. The spatial and temporal characteristics of these events can be captured with real-time imaging of living plants expressing genetically encoded fluorescent biosensors. Here we introduce a plant-wide, real-time imaging method to monitor the dynamics of both the Ca2+ signals and changes in apoplastic glutamate that occur in response to wounding. This approach uses a wide-field fluorescence microscope and transgenic Arabidopsis plants expressing Green Fluorescent Protein (GFP)-based Ca2+ and glutamate biosensors. In addition, we present methodology to easily elicit wound-induced, glutamate-triggered rapid and long-distance Ca2+ signal propagation. This protocol can also be applied to studies on other plant stresses to help investigate how plant systemic signaling might be involved in their signaling and response networks.

Wide-Field, Real-Time Imaging of Local and Systemic Wound Signals in Arabidopsis

Extracellular glutamate-triggered systemic calcium signaling is critical for the induction of plant defense responses to mechanical wounding and herbivore attack in plants. This article describes a method to visualize the spatial and temporal dynamics of both these factors using Arabidopsis thaliana plants expressing calcium- and glutamate-sensitive fluorescent biosensors.

Wide-Field, Imágenes en tiempo real de señales de heridas locales y sistémicas en Arabidopsis

Plants respond to mechanical stresses such as wounding and herbivory by inducing defense responses both in the damaged and in the distal undamaged parts. ...

Divergence of Root Microbiota in Different Habitats based on Weighted Correlation Networks

The root microbiome plays an important role in plant growth and environmental adaptation. Network analysis is an important tool for studying communities, which can effectively explore the interaction relationship or co-occurrence model of different microbial species in different environments. The purpose of this manuscript is to provide details on how to use the weighted correlation network algorithm to analyze different co-occurrence networks that may occur in microbial communities due to different ecological environments. All analysis of the experiment is performed in the WGCNA package. WGCNA is an R package for weighted correlation network analysis. The experimental data used to demonstrate these methods were microbial community data from the NCBI (National Center for Biotechnology Information) database for three niches of the rice (Oryza sativa) root system. We used the weighted correlation network algorithm to construct co-abundance networks of microbial community in each of the three niches. Then, differential co-abundance networks among endosphere, rhizoplane and rhizosphere soil were identified. In addition, the core genera in network were obtained by the "WGCNA" package, which plays an important regulated role in network functions. These methods enable researchers to analyze the response of microbial network to environmental disturbance and verify different microbial ecological response theories. The results of these methods show that the significant differential microbial networks identified in the endosphere, rhizoplane and rhizosphere soil of rice.

Network analysis was applied to evaluate the association of various ecological microbial communities, such as soil, water and rhizosphere. Presented here is a protocol on how to use the WGCNA algorithm to analyze different co-occurrence networks that may occur in the microbial communities due to different ecological environments.

Divergencia de la microbiota radicular en diferentes hábitats basada en redes de correlación ponderadas

The root microbiome plays an important role in plant growth and environmental adaptation. Network analysis is an important tool for studying communities, ...

A Simple Protocol for Mapping the Plant Root System Architecture Traits

Comprehensive knowledge of plant root system architecture (RSA) development is critical for improving nutrient use efficiency and increasing crop cultivar tolerance to environmental challenges. An experimental protocol is presented for setting up the hydroponic system, plantlet growth, RSA spreading, and imaging. The approach used a magenta box-based hydroponic system containing polypropylene mesh supported by polycarbonate wedges. Experimental settings are exemplified by assessing the RSA of the plantlets under varying nutrient (phosphate [Pi]) supply. The system was established to examine the RSA of Arabidopsis, but it is readily adaptable to study other plants like Medicago sativa (Alfalfa). Arabidopsis thaliana (Col-0) plantlets are used in this investigation as an example to understand the plant RSA. Seeds are surface sterilized by treating ethanol and diluted commercial bleach, and kept at 4 &#176;C for stratification. The seeds are germinated and grown on a liquid half-MS medium on a polypropylene mesh supported by polycarbonate wedges. The plantlets are grown under standard growth conditions for the desired number days, gently picked out from the mesh, and submersed in water-containing agar plates. Each root system of the plantlets is spread gently on the water-filled plate with the help of a round art brush. These Petri plates are photographed or scanned at high resolution to document the RSA traits. The root traits, such as primary root, lateral roots, and branching zone, are measured using the freely available ImageJ software. This study provides techniques for measuring plant root characteristics in controlled environmental settings. We discuss how to (1) grow the plantlets, and collect and spread root samples, (2) obtain pictures of spread RSA samples, (3) capture the images, and (4) use image analysis software to quantify root attributes. The advantage of the present method is the versatile, easy, and efficient measurement of the RSA traits.

We use simple laboratory tools to examine the root system architecture (RSA) of Arabidopsis and Medicago. The plantlets are grown hydroponically over mesh and spread using an art brush to reveal the RSA. Images are taken using scanning or a high-resolution camera, then analyzed with ImageJ to map traits.

Un protocolo simple para mapear los rasgos de arquitectura del sistema radicular de la planta

Comprehensive knowledge of plant root system architecture (RSA) development is critical for improving nutrient use efficiency and increasing crop cultivar ...