The authors would like to acknowledge Hans de Graaf and Tomas Veenendaal for their technical assistance in culturing the ECs.

Ethik-Erklärung: Die Blutgefäße in dieser Studie verwendet wurden, als überschüssige Material geerntet wurden aus frischen Hunde-Kadaver (n = 4) von gesunden Hunden für andere, unabhängige Forschung (Universität 3R Politik) euthanasiert. Aberrant Blutgefäße (intra- und extrahepatischen portosystemischen Shunts, n = je 1) vorgestellt wurden für Haustiere der Universität Utrecht an der Universitätsklinik von Hunden post-mortem nach informierte Zustimmung der Eigentümer geerntet. 1. Isolierung und Kultur von primären Canine Endothelial Cells <ol><li> Precoat-6-well - Platten mit 2 ml / Vertiefung 0,5% w / v Gelatine und mit einer angefeuchteten Atmosphäre von 5% CO 2 bei 37 ° C für 2 h in einem Brutschrank belassen. Entfernen Lösung überschüssige Gelatine vor der primären Zellen Aussaat. </li><li> Aseptisch entfernen Sie das Blutgefäß (e) von Interesse (zB Aorta, Hohlvene, Vena porta) von einem frischen Eckzahn kadaver (Abbildung 1A). Aufrechterhaltung der Anatomie des Gefäßsystemsindem gerade Zange an beiden Enden des Schiffes von Interesse. Unnötige Manipulation des Gewebes mit einer Pinzette Schädigung der Endothelzellen zu verhindern. <ol><li> Schneiden Sie das geklemmt Gefäß an beiden Enden mit chirurgischen Scheren und vom kadaver entfernen. Transport in Hanks Balanced Salt Solution (HBSS) auf Eis. HINWEIS: Eine Schiffslänge von ca. 5 cm Für dieses Verfahren wird bevorzugt, aber diejenigen, die 1 cm messen auch genügend Zellen zur Kultur bieten. </li></ol></li><li> Übertragen Sie das Blutgefäß in eine Petrischale gefüllt mit eiskaltem HBSS. Mit chirurgische Scheren, entfernen Sie alle anhaftendem Gewebe und Fett von der Außenseite des Gefäßes, halten das Gefäß selbst intakt (1B). Stellen Sie sicher, dass das Schiff jederzeit deutlich sichtbar ist beim Schneiden: beiseite ziehen das umgebende Gewebe mit einer Klammer oder einer Zange für optimale Sicht. <ol><li> Schließen Sie alle Zweige des Schiffes mit Ligatur (zB Polyglactin 3-0) und sie anschließend zu entfernenmit chirurgischen Schere oder einem Skalpell. </li></ol></li><li> Ein Gefäßende mit einem gekrümmten Halsted Moskito Zange, klemmen die Spitze der Zange an dem anderen Ende des Behälters sorgfältig eingeben und dann zurückziehen, langsam das Gefäß Invertieren bis er vollständig von innen nach außen (1C-G) ist. Die Außenseite besteht nun aus der endothelialen Zellschicht. Wenn sich eine Schwierigkeit beim Umdrehen des Behälters angetroffen wird, wieder in HBSS versenken Reibung zu reduzieren. </li><li> Platzieren Sie Tabaksbeutelnähte an beiden Enden des Schiffes es vollständig zu schließen und die Exposition von Nicht-endothelialen Gefäßgewebe zu dem Aufschlussverfahren (Abbildung 1H) zu verhindern. Verwenden Sie die Ligatur Enden des invertierten Gefäß zu manipulieren. </li><li> Wenn die Verdauung und Kultur später durchgeführt wird, das invertierte Kryokonservierung Gefäß vor dem Verdau Protokoll (Schritt 1.7). <ol><li> Legen Sie das invertierte Schiff in einem Kryoröhrchen und füllen mit Zellkultur Einfriermedium. Einfrieren bis -80 ° C, um ein Einfrieren Co mitntainer. Bei -80 ° C, wenn Schiffe sind innerhalb einer Woche verwendet werden. Für die langfristige Lagerung Ort Kryovials bei -180 ° C. Wenn die EG-Isolierung durchgeführt wird, tauen die Kryovials schnell in einem Wasserbad (37 ° C) und sofort in eiskaltem HBSS platzieren. Gehen Sie wie in 1.7 angegeben. Hinweis: Beachten Sie, dass die Gesamtausbeute von ECs nach der Isolierung geringer sein wird durch den Verlust der Lebensfähigkeit während des Gefrierprozesses. </li></ol></li><li> Übertragen Sie das Gefäß in ein 50 - ml - Röhrchen und spülen Sie es zweimal in HBSS Erythrozyten (oder Rest Einfriermedium bei Auftauen) (1I) zu entfernen. </li><li> Digest das Gefäß in einer 50-ml-Röhrchen mit einer Lösung von 30 ml Kollagenase Typ II (0,15 U / ml) und Dispase (0,15 U / ml) in Canine Endothelial Cells Growth Medium (CECGM) für 1 h bei 37 ° C mit intermittierender sanften Agitation. </li><li> Entfernen des Behälters aus dem Rohr und zentrifugieren die Zellsuspension für 5 min bei 250 x g. </li><li> Zellpellet in CECGM einnd Samen 2 ml Zellsuspension pro Well (1 - 3 Brunnen je nach Gefäßgröße). Kultur der Zellen bei 37 ° C in einer befeuchteten Atmosphäre mit 5% CO 2 in Luft und das Kulturmedium zweimal pro Woche ändern. </li><li> Passage der Zellen, wenn eine Konfluenz von 70-80% erreicht ist. <ol><li> Waschen Sie die Zellen mit vorgewärmtem HBSS tot oder nicht-anhaftenden Zellen zu entfernen. In 200 ul rekombinanter Zell-Dissoziation Enzym (1x) in jede Vertiefung und legen zurück in den Inkubator für 5 Minuten oder bis alle Zellen abgelöst werden. </li><li> Übertragen Sie die Zellen in ein 15-ml-Tube und stoppen Trypsinierung durch Zugabe von 10 ml Kulturmedien (CEGM) mit 10% fötalem Kälberserum (FCS). Zentrifuge für 5 Minuten bei 250 x g. Weiter wird die Kultur im Gelatine vorbeschichtet Platte oder Kolben. </li></ol></li></ol> 2. Charakterisierung <ol><li> Kultur Canine Aortic Endothelial Cells (CnAOECs) und die Morphologie der primären und kommerziellen Zelllinien zweimal wöchentlich mit einem Mikroskop vergleichen. HINWEIS: Ter wächst typisches Muster von ECs in Patches lassen sich am besten beobachtet werden, wenn eine Konfluenz von&gt; 70% erreicht ist. <ol><li> Kultur CnAOECs in CECGM auf einem 0,5% w / v Gelatine vorbeschichtet T75-Kolben. Passage-Zellen einmal in der Woche, wenn die Konfluenz 70 - 80%. <ol><li> Für Passagierung, waschen Sie die Zellen einmal mit vorgewärmter HBSS und 1 ml rekombinanten Zell-Dissoziation Enzym (1x). Der Kolben wird wieder in den Inkubator für 5 Minuten oder bis alle Zellen abgelöst werden. Inactivate Trypsin von 10 ml Kulturmedium Zugabe (CEGM) mit 10% FCS. Zentrifugieren Sie die Zellsuspension für 5 Minuten bei 250 · g, den Überstand verwerfen und Resuspendieren der Zellen in 1 ml Kulturmedium. </li><li> Nehmen Sie ein 10-ul-Aliquot der Zellsuspension und verdünnt 1: 1 mit 0,4% Trypanblau. Zählen Sie die Zellen eines automatisierten Zellzähler verwenden, und die Platte aus 4,0 x 10 5 lebensfähigen Zellen in einem neuen T75 - Flasche. 10 ml vorgewärmtes CECGM in den Kolben und die Kultur bei 37 ° C in einer befeuchteten Atmosphäre mit 5% CO 2. </li></ol></li></ol></li><li> Isolieren von RNA aus Durchgang 1 der kultivierten CaPECs und CnAOECs. <ol><li> Sammeln Sie mindestens 1 x 10 3 Zellen als Pellet, fügen Sie 20 ul der Probenvorbereitung Reagenz (SPR) und Inkubation für 1 min die Zellen zu lysieren. Nach der Inkubation sorgfältig sammeln Zelllysat Gesamt-RNA und lagern bei -70 ° C enthält. </li></ol></li><li> Konvertieren von mRNA in cDNA eine cDNA - Synthese - Kit (zB iScript) nach den Anweisungen des Herstellers. Shop cDNA bei 4 ° C bis zu einer Woche oder bei -20 ° C für langfristige, bis bereit, die qPCR auszuführen. </li><li> Messen Sie die Genexpression der endothelialen Marker CD31 Endothel-Zell-Ursprung zu bestätigen. Führen Versuchsaufbau und die Quantifizierung mit Hilfe der MIQE précis Richtlinien 10. Zur Normalisierung, messen die Expression von Referenzgenen GAPDH, RPS19 und B2MG 11. <ol><li> Bereiten Sie eine 10-fache Verdünnung der erhaltenen cDNA in nukleasefreiem Wasser. </li><li> Bereiteneine 4-fache Verdünnung von gepoolten cDNA-Proben für die Standard-Linie und nukleasefreiem Wasser als Nicht-Template-Steuerung verwenden. Verdünnen Sie die Proben fünfmal einen 50-fachen Gesamtverdünnung für qPCR Reaktionen zu erreichen. Pipette 10 ul - Reaktionen in doppelter Ausfertigung in einer 384-Well - Format unter Verwendung von 4 &amp; mgr; l cDNA und 6 &amp; mgr; l des Fluorophors mit 20 pmol reverser gemischt und Vorwärts - Primer (Tabelle 1). </li><li> Stellen Sie das Programm auf 95 ° C für 5 min für Taq-Polymerase-Aktivierung, gefolgt von 39 Zyklen von 10 sec bei 95 ° C für die Denaturierung und 30 sec bei Tm zum Glühen und Dehnung. Die Tm für jeden Primersatz ist in Tabelle 1 gezeigt. </li><li> Perform Kurve Schmelzen analysiert jede Lauf folgende nur ein Produkt, um sicherzustellen, wird verstärkt. Normalisieren der Expressionsniveaus der Proben die durchschnittliche relative Menge der Referenzgene verwenden, und berechnen die ACt wenn Reaktionswirkungsgrad zwischen 95% und 105% liegt. </li></ol></li><li> Beurteilen Sie EC-Funktionalität mit einem angiogenesis Test. <ol><li> Zugabe von 10 &amp; mgr; l der extrazellulären Matrix zu jeder Vertiefung einer vorgekühlten Angiogenese Dia- und verteilt mit einer Pipettenspitze die Oberfläche der Vertiefung zu bedecken. Halten Sie die extrazelluläre Matrix auf Eis und vermeiden, dass die Einführung von Luftblasen in das Gel. In einem Inkubator bei 37 ° C mit 5% CO 2 für 30 min erstarren das Gel durch den Schieber in eine Petrischale mit Wasser getränkten Papiertüchern platzieren. </li><li> In 1,0 x 10 4 primäre ECs in 50 ul Endothelial Growth Medium pro Vertiefung. Inkubieren der Objektträger 6 Stunden bei 37 ° C mit 5% CO 2. </li><li> Nach 6 Stunden Fotos mit einer 20-facher Vergrößerung nehmen, um sicherzustellen, das Ganze gut in das Bild aufzunehmen. </li></ol></li></ol>

<ol>
	<li>Haidara, M. A., Assiri, A. S., Yassin, H. Z., Ammar, H. I., Obradovic, M. M., Isenovic, E. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heart+Failure+Models:+Traditional+and+Novel+Therapy.">Heart Failure Models: Traditional and Novel Therapy.</a> Curr. Vasc. Pharmacol. 13 (5), 658-669 (2015).</li><li>van Steenbeek, F. G., van den Bossche, L., Leegwater, P. A., Rothuizen, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inherited+liver+shunts+in+dogs+elucidate+pathways+regulating+embryonic+development+and+clinical+disorders+of+the+portal+vein.">Inherited liver shunts in dogs elucidate pathways regulating embryonic development and clinical disorders of the portal vein.</a> Mamm. Genome. 23 (1-2), 76-84 (2012).</li><li>Murai, A., Asa, S. A., Kodama, A., Hirata, A., Yanai, T., Sakai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Constitutive+phosphorylation+of+the+mTORC2/Akt/4E-BP1+pathway+in+newly+derived+canine+hemangiosarcoma+cell+lines.">Constitutive phosphorylation of the mTORC2/Akt/4E-BP1 pathway in newly derived canine hemangiosarcoma cell lines.</a> BMC Vet. Res. 8 (1), 128 (2012).</li><li>Boilson, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+circulating+progenitor+cells+in+left+ventricular+dysfunction.">Regulation of circulating progenitor cells in left ventricular dysfunction.</a> Circ. Heart Fail. 3 (5), 635-642 (2010).</li><li>Gonzalez-Miguel, J., Morchon, R., Siles-Lucas, M., Simon, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fibrinolysis+and+proliferative+endarteritis:+two+related+processes+in+chronic+infections?+The+model+of+the+blood-borne+pathogen+Dirofilaria+immitis.">Fibrinolysis and proliferative endarteritis: two related processes in chronic infections? The model of the blood-borne pathogen Dirofilaria immitis.</a> PLoS One. 10 (4), e0124445 (2015).</li><li>Sacks, T., Moldow, C. F., Craddock, P. R., Bowers, T. K., Jacob, H. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oxygen+radicals+mediate+endothelial+cell+damage+by+complement-stimulated+granulocytes.+An+in+vitro+model+of+immune+vascular+damage.">Oxygen radicals mediate endothelial cell damage by complement-stimulated granulocytes. An in vitro model of immune vascular damage.</a> J. Clin. Invest. 61 (5), 1161-1167 (1978).</li><li>Aranguren, X. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unraveling+a+novel+transcription+factor+code+determining+the+human+arterial-specific+endothelial+cell+signature.">Unraveling a novel transcription factor code determining the human arterial-specific endothelial cell signature.</a> Blood. 122 (24), 3982-3992 (2013).</li><li>van Balkom, B. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endothelial+cells+require+miR-214+to+secrete+exosomes+that+suppress+senescence+and+induce+angiogenesis+in+human+and+mouse+endothelial+cells.">Endothelial cells require miR-214 to secrete exosomes that suppress senescence and induce angiogenesis in human and mouse endothelial cells.</a> Blood. 121 (19), 3997-4006 (2013).</li><li>Crampton, S. P., Davis, J., Hughes, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+human+umbilical+vein+endothelial+cells+(HUVEC).">Isolation of human umbilical vein endothelial cells (HUVEC).</a> J. Vis. Exp. (3), e183 (2007).</li><li>Bustin, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MIQE+precis:+Practical+implementation+of+minimum+standard+guidelines+for+fluorescence-based+quantitative+real-time+PCR+experiments.">MIQE precis: Practical implementation of minimum standard guidelines for fluorescence-based quantitative real-time PCR experiments.</a> BMC Mol. Biol. 11, 74 (2010).</li><li>Brinkhof, B., Spee, B., Rothuizen, J., Penning, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+evaluation+of+canine+reference+genes+for+accurate+quantification+of+gene+expression.">Development and evaluation of canine reference genes for accurate quantification of gene expression.</a> Anal. Biochem. 356 (1), 36-43 (2006).</li><li>Heishima, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA-214+and+MicroRNA-126+Are+Potential+Biomarkers+for+Malignant+Endothelial+Proliferative+Diseases.">MicroRNA-214 and MicroRNA-126 Are Potential Biomarkers for Malignant Endothelial Proliferative Diseases.</a> Int. J. Mol. Sci. 16 (10), 25377-25391 (2015).</li><li>Liu, M. M., Flanagan, T. C., Lu, C. C., French, A. T., Argyle, D. J., Corcoran, B. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Culture+and+characterisation+of+canine+mitral+valve+interstitial+and+endothelial+cells.">Culture and characterisation of canine mitral valve interstitial and endothelial cells.</a> Vet. J. 204 (1), 32-39 (2015).</li><li>van den Bossche, L., van Steenbeek, F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Canine+congenital+portosystemic+shunts:+disconnections+dissected.">Canine congenital portosystemic shunts: disconnections dissected.</a> The Veterinary Journal. 211, 14-20 (2015).</li><li>Sobczynska-Rak, A., Polkowska, I., Silmanowicz, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elevated+Vascular+Endothelial+Growth+Factor+(VEGF)+levels+in+the+blood+serum+of+dogs+with+malignant+neoplasms+of+the+oral+cavity.">Elevated Vascular Endothelial Growth Factor (VEGF) levels in the blood serum of dogs with malignant neoplasms of the oral cavity.</a> Acta Vet. Hung. 62 (3), 362-371 (2014).</li><li>Zhang, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+and+in+vivo+study+of+hydralazine,+a+potential+anti-angiogenic+agent.">In vitro and in vivo study of hydralazine, a potential anti-angiogenic agent.</a> Eur. J. Pharmacol. 779, 138-146 (2016).</li></ol>

The authors have no competing financial interests.

In Studien über Hunde-ECs Fokussierung der CnAOEC primäre Linie , die die endotheliale Abstammungslinien des Hundes 3, 12, Modell 13. In Studien am Menschen wird die HUVEC Kultur immer noch der Goldstandard. Offensichtlich aus Nabelschnur abgeleitet Fokussierung nur auf ECs ist eine feste Beschränkung in der kardiovaskulären Forschung. Endothelial-Zellen haben einen spezifischen Genexpressionsmuster arteriovenöse Spezifikation zu bestimmen. Um diese Unterschiede in der postnatalen Schiffe zu berücksichtigen, stellen wir diese Methode neuartige Isolierung auf der Basis der spezifischen anatomischen Lage der Endothelzellen. Die Verfahren, die üblicherweise für die primäre EC-Isolierung verwendet werden Spülen der Behälter mit einer Enzymlösung oder Zerkleinern des Schiffes vor der Verdauung, zwei Methoden, die sowohl das Risiko einer Kontamination mit nicht-ECs haben. Wir haben ein Verfahren zur Isolierung von Canine Primäre Endothelzellen (CaPECs) mit einer geringeren Wahrscheinlichkeit einer Kontamination, die auch auf kleinen Gefäßen verwendet werden kann. Diese Isolation methode von Endothelzellen auf die Invertierung des Schiffes zugrunde, die Zelltypen Verdauung aller anderen Behälter vermeidet. Es ist wichtig , die Behälter aseptisch zu entfernen, wie in Figur 1A dargestellt ist , Bakterien- oder Pilzkontamination der endothelialen Kulturen zu verhindern. Im Falle von Bakterienwachstum ein zusätzliches antimikrobielles Mittel (zB Gentamycin) dem Kulturmedium zugegeben werden. Im Falle der Behandlung von Pilzinfektion ist häufig nicht erfolgreich in unserer Erfahrung. Damit die Inversion erfolgreich zu sein, ist es wichtig, einen Behälter zu erhalten, die etwa 5 cm lang ist. Ein zweiter wichtiger Schritt Invertierung des Blutgefäßes zu erleichtern, ist die Entfernung von anhaftendem Gewebe und Fett mit chirurgischen Schere. das Gefäß invertierende wird sorgfältig durchgeführt, indem die Zange am gegenüberliegenden Ende Spann- und langsam das Gefäß umgekehrt wird. Wenn die Tabaksbeutel platzieren Nähte stellen Sie sicher, die endotheliale Schicht so wenig wie möglich zu berühren. Damage des Endothels kann in schlechten Ausbeute von lebenden Endothelzellen und den Zugang der Verdauung Medien zu darunter liegenden Gewebes zur Folge haben. Dies kann auch passieren, wenn der Behälter nicht vollständig geschlossen ist. Der Behälter kann leicht durch es Kommissionierung am Ende einer Ligatur up gehandhabt werden. In bestimmten Fällen kann eine Modifikation der Technik angewendet werden. In Blutgefäßen mit einem kleinen Durchmesser ist es manchmal unmöglich, eine Mosquito Zange einzulegen, um das Schiff zu invertieren. Eine Lösung ist Nähte an einem Ende des Behälters zu legen und deren Ligaturen durch das Blutgefäß schieben die Zange verwendet wird. Am anderen Ende können sie dann mit einem Moskito Zange und zog gesichert werden, wodurch das Gefäß umgekehrt wird. Manchmal wird der Behälter reißen als Folge der zusätzlichen Nähte, so Diese Modifikation ist nicht der bevorzugte Ansatz. Ein weiteres Problem, das auftreten kann, ist, wenn viele Erythrozyten in den Kulturplatten beim Aussäen der primären Zellen vorhanden sind. Dies kann das Ergebnis vonunzureichendes Waschen des Blutgefäßes vor der Verdauung. Wenn dies auftritt, am Tag 2 mit warmem HBSS Waschen der Vertiefungen ist oft ausreichend, um den Großteil der Erythrozyten zu entfernen. In jedem Fall bleiben die Erythrozyten nicht in der Kultur und zeichnen sich bei Passagierung der CaPECs verloren. Die isolierten CaPECs ausgedrückt CD31, was darauf hinweist, dass die Population von Zellen, die aus dem Blutgefäß ist in der Tat endothelialen Ursprungs verdaut wurde. Wie kürzlich veröffentlicht, wird diese Markierung auch in Endothelzellen aus der canine Mitralklappe 14 ausgedrückt. Die Bildung von Kolonien in Kultur zeigt die Kulturen entweder aus einzelnen Zellen oder von kleinen Zellhaufen zu starten. Das schnelle Wachstum auf die endotheliale spezifischen Medien ist auch ein Hinweis auf korrekte Zelltyp. Die primären Zellen können für acht Passagen kultiviert werden, wonach die Kulturen Ausdehnung einzustellen. Dies ist ein Hinweis auf die Seneszenz und macht es weniger wahrscheinlich, dass Stammzellen / Vorläuferzellen mit diesem proto kultiviertcol. In einem Angiogenese-Assay, CaPECs von Aorta, Hohlvene und Pfortader zeigte innerhalb von 6 Stunden Verzweigung. Diese endotheliale Funktionalität bietet solide Beweise für ihre Herkunft. Je nach Verfügbarkeit wurde nur Hunde Material untersucht, aber die Isolationsmethode hat mögliche Anwendungen für die Isolierung von primären humanen Endothelzellen oder Endothelzellen aus anderen Organismen. Die Technik ist auch möglich, sehr kleine Gefäße (1 cm Länge), aber nachgeben weniger isolierten Zellen. Aus diesem Grund von kleinen Gefäßen erhalten CaPECs wird eine zusätzliche Passage erfordern, bevor sie über eine ausreichende Zahl für Experimente erreicht haben. Die Fähigkeit, die Isolationsmethode auf kleinen Schiffen durchzuführen ist ein großer Vorteil für Studien in Gefäßerkrankungen. ECs konnte von erkrankten oder anomalen Gefäße wie portosystemischen Shunts isoliert werden. Das sind Schiffe , die die Pfortader verbindet und den systemischen Kreislauf , das Blut , die Leber zu umgehen verursacht 2 </sup&gt;. Der Shunt selbst kann als 1 cm klein sein. Vergleicht man die ECs aus einem Shunt Gefäß mit Zellen von einem gesunden Hohlvene und Pfortader Ursprung geben könnte neue Informationen relevant für die Shunt-Entwicklung, da die Pathogenese noch nicht vollständig verstanden ist. Außerdem könnten neue angiogenen Gene auf funktionaler Ebene untersucht werden durch genetische Modifikationen wie siRNA-vermittelten Gen-Silencing durchführt. Abschließend kann diese neuartige Isolationsmethode ein leistungsfähiges Modell sein Herz - Kreislauf- Erkrankungen zu untersuchen (kongenitale), Krankheitsmodelle und (Tumor) Angiogenese 15, 16.

Hunde sind als Großtiermodell für kardiovaskuläre Erkrankungen Forschung und auch von angeborener (genetischen) Gefäßanomalien 1, 2 leiden können. Um diese Krankheiten kommerziellen Endothelzelllinien studieren häufig verwendet werden , um Endothelzellen (EC) Funktionalität beurteilen. Für Hunde gibt es eine kommerzielle Endothelzelllinie verfügbar (CnAOEC), von Eckzahn Aorta abgeleitet. Diese Zelllinie ist vor allem in Studien als Kontrolle normalen ECs 3-5 verwendet. In der menschlichen kardiovaskulären Forschung sind die am häufigsten verwendeten Endothelzelllinien menschlichen Nabelschnurvenen-Endothelzellen (HUVECs) und menschlichen Nabelschnurarterie Endothelial Cells (HUAECs) aus menschlicher Nabelschnur Vene und Arterie abgeleitet sind. HUVECs wurden als Goldstandard in der Gefäßforschung seit den 1980er Jahren 6 verwendet. Sie gelten als das klassische Modellsystem zum Studium der Endothelfunktion und Krankheit Anpassung sein. Endothelial-Zellen isoliert aus verschiedenen Blutgefäße variieren in appearance und Funktionalität durch genetische Hintergrund und der Exposition gegenüber der Mikroumgebung 7. Zusätzlich werden HUVECs und HUAECs aus Nabelschnur abgeleitet sind, eine Entwicklungsgefäßstruktur, die an die Bedingungen in Bezug erwachsenen Blutgefäße möglicherweise nicht vollständig mimic sie und die Reaktion auf Krankheit ausgesetzt sind. Daher ist unzureichend in HUVECs und HUAECs zu kardiovaskulären Erkrankungen im Allgemeinen gefunden Ergebnisse zu übersetzen. Wenn die Anpassung und das Verhalten von Erwachsenen ECs studieren, primären ECs aus dem Gefäß von Interesse sollte als direkter Ansatz verwendet werden. Zur Isolierung haben diese Zellen zeigen verschiedene Methoden berichtet. Eine weit beschriebene Verfahren, die auch für HUVECs verwendet wird, wird das Spülen des Behälters mit einem enzymatischen Verdauungslösung 8. Dies führt oft zu einer Kontamination mit nicht-ECs wie glatte Muskelzellen und Fibroblasten 9. Ein anderes häufig verwendetes Verfahren zur Isolierung ist die enzymatische Verdauung von gehackten Gefäßgewebe, gefolgt von Fluoreszenz-aktivierte Zelle (FACS) , basierend auf endothelialen Zellmarker Cluster of Differentiation (CD) 31 7, 8. FACS - Sortierung und anschließender Zellkultur Sortieranlage erfordert relativ große Mengen an Zellen und ist daher nicht geeignet für die Isolierung von Endothel von kleinen Blutgefäßen. Wir haben daher ein neues robustes Verfahren zu entwickeln, zur Isolierung eines reinen endothelialen Zellpopulation aus verschiedenen Hunde- Blutgefäße mit hoher Reinheit gerichtet. Um die Effizienz des neuen Isolationsmethode testen, haben wir isoliert und rein erhalten Canine Primary Endothelzell (CAPEC) Kulturen aus verschiedenen Hunde-Arterien und Venen, große und kleine. Dieses Verfahren ermöglicht auch die Kultur von Endothelzellen aus erkrankten Ursprung und / oder abweichende Gefäße wie angeborene intra- oder extrahepatischen portosystemischen Shunts, eine häufige Erkrankung bei Hunden 2. Das Verfahren erlaubt die Isolierung von zusätzlichen relevanten Zelltypen des gleichen Gefäß wie vaskulären glatten Muskelzellen, da die meisten des Schiffes int bleibtWährend des Verfahrens handeln.

<table border="0" cellpadding="0" cellspacing="0" width="904">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Collagenase type II</td>
			<td style="width:164px;">Life Technologies</td>
			<td style="width:211px;">17101-015</td>
			<td style="width:201px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dispase</td>
			<td style="width:164px;">Life Technologies</td>
			<td style="width:211px;">17105-041</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">DMEM (1X) + GlutaMAX</td>
			<td style="width:164px;">Life Technologies</td>
			<td style="width:211px;">31966-021</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Hank&#39;s Balanced Salt Solution</td>
			<td style="width:164px;">Life Technologies</td>
			<td style="width:211px;">14025-050</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Canine Endothelial Cells Growth Medium&#160;</td>
			<td style="width:164px;">Cell Applications</td>
			<td style="width:211px;">Cn211-500</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">CnAOECs</td>
			<td style="width:164px;">Cell Applications</td>
			<td>Cn304-05</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Fetal Calf Serum (FCS)&#160;</td>
			<td style="width:164px;">GE Healthcare</td>
			<td style="width:211px;">16000-044</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TrypLE Express</td>
			<td style="width:164px;">Life Technologies</td>
			<td style="width:211px;">12604-013</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">SPR</td>
			<td style="width:164px;">Bio-Rad</td>
			<td>170-8898</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">iScript synthesis kit</td>
			<td style="width:164px;">Bio-Rad</td>
			<td style="width:211px;">170-8891</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">SYBR green super mix</td>
			<td style="width:164px;">Bio-Rad</td>
			<td style="width:211px;">170-8886</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Recovery Cell Freezing Medium</td>
			<td style="width:164px;">Gibco/Life Technologies</td>
			<td style="width:211px;">12648-010</td>
			<td>Keep on ice prior to use</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Freezing container, Nalgene Mr. Frosty</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:211px;">C1562</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Gelatin</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:211px;">G1890</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Surgical scissors (Mayo or Metzenbaum)</td>
			<td style="width:164px;">B. Braun Medical</td>
			<td style="width:211px;">BC555R</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Mosquito forceps&#160;</td>
			<td style="width:164px;">B. Braun Medical</td>
			<td style="width:211px;">FB440R</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Mosquito forceps curved</td>
			<td style="width:164px;">B. Braun Medical</td>
			<td style="width:211px;">FB441R</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">polyglactin 3-0</td>
			<td style="width:164px;">Ethicon</td>
			<td style="width:211px;">VCP311H</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Trypan blue</td>
			<td style="width:164px;">Bio-Rad</td>
			<td style="width:211px;">145-0013</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Automated counting chamber</td>
			<td style="width:164px;">Bio-Rad</td>
			<td style="width:211px;">145-0102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Counting Slides, Dual Chamber</td>
			<td style="width:164px;">Bio-Rad</td>
			<td style="width:211px;">145-0011</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Matrigel</td>
			<td style="width:164px;">BD Biosciences</td>
			<td style="width:211px;">BD356231</td>
			<td>Slowly thaw on ice</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">&#181;-Slide Angiogenesis</td>
			<td style="width:164px;">Ibidi</td>
			<td style="width:211px;">81501</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Endothelial Growth Medium</td>
			<td style="width:164px;">Lonza</td>
			<td style="width:211px;">CC-3156</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">EGM-2 SingleQuot Kit&#160;</td>
			<td style="width:164px;">Lonza</td>
			<td style="width:211px;">CC-4176</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation and culture of primary endothelial cells from canine arteries and veins

Cardiovascular disease is studied in both human and veterinary medicine. Endothelial cells have been used extensively as an in vitro model to study vasculogenesis, (tumor) angiogenesis, and atherosclerosis. The current standard for in vitro research on human endothelial cells (ECs) is the use of Human Umbilical Vein Endothelial Cells (HUVECs) and Human Umbilical Artery Endothelial Cells (HUAECs). For canine endothelial research, only one cell line (CnAOEC) is available, which is derived from canine aortic endothelium. Although currently not completely understood, there is a difference between ECs originating from either arteries or veins. For a more direct approach to in vitro functionality studies on ECs, we describe a new method for isolating Canine Primary Endothelial Cells (CaPECs) from a variety of vessels. This technique reduces the chance of contamination with fast-growing cells such as fibroblasts and smooth muscle cells, a problem that is common in standard isolation methods such as flushing the vessel with enzymatic solutions or mincing the vessel prior to digestion of the tissue containing all cells. The technique we describe was optimized for the canine model, but can easily be utilized in other species such as human.

Verschiedene Blutgefäße wurden erfolgreich auf das beschriebene Isolierungsprotokoll (Figur 2) unterzogen. Es war möglich, zu sezieren und Aorta, Hohlvene, Vena porta invertieren und Koronararterie von gesunden Hunden (alle Gefäße von jedem Hund, n = 4). Mit dem gleichen Ansatz ECs wurden aus zwei angeborenen portosystemischen Shunts (extrahepatische und intrahepatische, n = je 1) isoliert. Obwohl Aorta leicht invertiert wurde, waren thorakalen Aorta Segmente eine größere Herausforderung als Bauchaorta. In thorakalen Segmente hat die Aorta viele Intercostalarterien davon abzweig, die einzeln ligiert werden müssen streng endothelial Einwirkung der Verdauungslösung zu gewährleisten. Die sezierten Segment der Vena cava caudalis enthalten Verzweigungspunkt der Nierenvenen, die vor der Inversion ligiert werden musste. Für das Portal den Beitrag Zweig der Vena gastroduodenalis Vene wurde vor dem Umdrehen des Blutgefäßes ligiert. Die coronary Arterie bei Hunden ist ein viel kleineres Blutgefäß (ca. 1 bis 2 mm Durchmesser in einem mittelgroßen Hund), von dem wir ein Segment des circumflexus ausgeschnitten. Weil es einen kleinen Durchmesser hat, erwies es einfacher sein, ein ziemlich kurzes Segment von 1 cm zu invertieren, da die Mosquito Zange nicht viel weiter eingesetzt werden konnte. Eines Tages nach der Isolierung haften Zellen sichtbar waren in der Kulturplatte. In Kultur hatte CaPECs eine polygonale Form und zeigte eine Tendenz in Patches zu wachsen , wie in Figur 3 gezeigt zahlreiche Kolonien von Endothelzellen 3 beobachtet werden konnte -. 6 Tage nach der Isolierung. Nach ungefähr 10 Tagen in Kultur wurde eine Konfluenz von 80% erreicht, und die Zellen übertroffen werden konnten. Im Durchschnitt konnten die primären endothelialen Kulturen für maximal 8 Passagen (einmal wöchentlich an einem Split-Rate von 1: 4) gehalten werden, an welcher Stelle sie aufgehört zu wachsen. Isolated Endothelzellen CD31 endotheliale Zellmarker exprimiert , wie durch qPCR (Figur 4) angedeutet ist . Die Expression in Endothelzellen aus der Aorta abgeleitet, Hohlvene und Pfortader von vier Hunden wurde mit einer Kontrollkultur von CnAOECs verglichen. Die kultivierten primären Zellen hatten eine vergleichbare CD31 Expression mit der Steuer ECs (Kruskall-Wallis, p = 0,856). CaPECs aus Aorta abgeleitet, Vena cava und vena porta zeigte auf der Angiogenese Folie , nach 6 Stunden Inkubation Verzweigungs wie in Figur 5 gezeigt. <img alt="Abbildung 1" src="/files/ftp_upload/54786/54786fig1.jpg" /> Abbildung 1: Zergliedern und Invertierung Blutgefäße für Endothelial Zellisolierung. A) Das Blutgefäß von Interesse ist aseptisch aus einem frischen Hunde-kadaver entfernt. B) anhaftendem Gewebe und / oder Fett , das Schiff umgebenden sollte remov seined sorgfältig mit chirurgische Scheren , ohne sich das Schiff zu beschädigen (Eckzahn Hohlvene, Abdominalsegment von 5 cm). C) mit einer Halsted Mosquito gebogenen Pinzette kann der Behälter ohne Perforieren der Endothel - Schicht eingegeben werden. DG) auf der anderen Seite der Zange Sichern Ende des Blutgefäßes und sanft zurückzuziehen, um dadurch vollständig das Blutgefäß zu invertieren. Die Endothelschicht ist nun auf der Außenseite des Behälters. H) Tabaksbeutelnähte an den Enden der nicht-endotheliale Oberfläche des umgekehrten Behälters. I) das Blutgefäß für das Waschen in ein 50 ml Röhrchen überführt wird Verschließen platziert und anschließende Verdauung. Maßstabsbalken zeigen 2 cm. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54786/54786fig1large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54786/54786fig1large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 2" src="/files/ftp_upload/54786/54786fig2.jpg" /> <strong&gt; Abbildung 2: Inverted Gefäße unterschiedlicher Herkunft. A) Eine invertierte Aorta - Segment (gesunden Hund). B) Eine invertierte Pfortader (gesunder Hund). C) Eine invertierte Hohlvene Segment (gesunder Hund). D) ein umgekehrtes Koronararterie Segment (gesunde Hund). E) ein umgekehrtes extrahepatic portosystemischen Shunts , abgeleitet von einem Cairn terrier (Alter: 6 Wochen alt). F) eine invertierte intrahepatischen portosystemischen Shunts , abgeleitet von einem irischen Wolfshund (Alter: 8 Wochen alt). Maßstabsbalken zeigen 2 cm. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54786/54786fig2large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54786/54786fig2large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 3" src="/files/ftp_upload/54786/54786fig3.jpg" /> Abbildung 3:.. Zellmorphologie Bilder aufgenommen wurden zwei Wochen nach der Verdauung der Gefäße A) ECs abgeleitet from Eckzahn Aorta in Durchgang 2 B) ECs abgeleitet von Hunde- Hohlvene in Durchgang 2. C) ECs abgeleitet von Eckzahn Pfortader in Durchgang 2. Alle Bilder sind mit 4X Original Vergrößerung. Maßstabsbalken zeigen an 500 &amp; mgr; m. Legen Sie zeigt 10 - facher Vergrößerung. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54786/54786fig3large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54786/54786fig3large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> <img alt="Abbildung 4" src="/files/ftp_upload/54786/54786fig4.jpg" /> Abbildung 4: Gene Expression von CD31. Die Expression von CD31 in Endothelzellen in Passage 1 von Aorta abgeleitet, Hohlvene und Pfortader (n = 4 Hunde). Keine signifikanten Expressionsunterschiede wurden zwischen dem CaPECs und der CnAOECs beobachtet. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54786/54786fig4large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54786/54786fig4large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> <pclass = &quot;jove_content&quot; fo: keep-together.within-page = &quot;1&quot;&gt; <img alt="Abbildung 5" src="/files/ftp_upload/54786/54786fig5.jpg" /> Abbildung 5:. Angiogenesis Fotografien von CnAOECs und CaPECs aus Aorta, Hohlvene und Pfortader nach 6 h Inkubation auf einem Angiogenese Schieber (20 - facher Vergrößerung). Zweigbildung sichtbar nach 6 Stunden in der Kultur. A) CnAOECs. B) CaPECs abgeleitet von Aorta. C) CaPECs abgeleitet aus Hohlvene. D) CaPECs aus Pfortader abgeleitet. Alle Zellen wurden in der Passage 3. Maßstabsbalken zeigen 1 mm. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54786/54786fig5large.jpg" target="_blank">Bitte hier klicken</a> , um <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54786/54786fig5large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> GOI </td><td> Richtung </td><td colspan="2"> 5&#39;-Sequence-3 &#39; </strong&gt; </td><td> Tm Glühen </td><td> Produktgröße (bp) </td><td> Genbank - Nummer </td></tr><tr><td> CD31 </td><td> Vorwärts </td><td colspan="2"> GTTCTGCGTGTCAAGGTG </td><td> 59 ° C </td><td> 85 </td><td> XM_005624261.1 </td></tr><tr><td></td><td> Umkehren </td><td colspan="2"> TGTCCTTCCCAAACTCCA </td><td></td><td></td><td></td></tr><tr><td> beta-Actin </td><td> Vorwärts </td><td colspan="2"> GATATCGCTGCGCTTGTGGTC </td><td> 58 ° C </td><td> 384 </td><td> NM_001195845 </td></tr><tr><td></td><td> Umkehren </td><td colspan="2"> GGCTGGGGTGTTGAAAGTCTC </td><td></td><td></td><td></td></tr><tr><td> RPS19 </td><td> Vorwärts </td><td colspan="2"> CCTTCCTCAAAAAGTCTGGG </td><td> 63 ° C </td><td> 95 </td><td> XM_005616513 </td></tr><tr><td></td><td> Umkehren </td><td colspan="2"> GTTCTCATCGTAGGGAGCAAG </td><td></td><td></td><td></td></tr><tr><td> B2MG </td><td> Vorwärts </td><td colspan="2"> TCCTCATCCTCCTCGCT </td><td> 63 ° C </td><td> 85 </td><td> AB745507 </td></tr><tr><td></td><td> Umkehren </td><td colspan="2"> TTCTCTGCTGGGTGTCG </td><td></td><td></td><td></td></tr></tbody></table> Tabelle 1: qPCR Primer - Sets qPCR Primer für Hunde Referenzgenen und CD31..

Watch this Scientific Journal Video about Isolation and Culture of Primary Endothelial Cells from Canine Arteries and Veins at JoVE.com

Isolation and Culture of Primary Endothelial Cells from Canine Arteries and Veins

Novel isolation methods of primary endothelial cells from blood vessels are needed. This protocol describes a new technique that completely inverts blood vessels of interest, exposing only the endothelial side to enzymatic digestion. The resulting pure endothelial cell culture can be used to study cardiovascular diseases, disease modelling, and angiogenesis.

Isolierung und Kultur von primären Endothelzellen von Canine Arterien und der

Cardiovascular disease is studied in both human and veterinary medicine. Endothelial cells have been used extensively as an in vitro model to study ...

isolation-culture-primary-endothelial-cells-from-canine-arteries

Nanyang Technological University

Research

JoVE Journal

Medicine

11.2K Aufrufe.  Utrecht University. Novel isolation methods of primary endothelial cells from blood vessels are needed. This protocol describes a new technique that completely inverts blood vessels of interest, exposing only the endothelial side to enzymatic digestion. The resulting pure endothelial cell culture can be used to study cardiovascular diseases, disease modelling, and angiogenesis.

Serie: Isolation and Culture of Primary Endothelial Cells from Canine Arteries and Veins

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human pulp-derived stem cells (hDPSCs) possess high proliferation potential with multi-lineage differentiation capacity compare to the ordinary source of adult stem cells1-8; therefore, hDPSCs could be the good candidates for autologous transplantation in tissue engineering and regenerative medicine. Along with these benefits, possessing the mesenchymal stem cells (MSC) features, such as immunolodulatory effect, make hDPSCs more valuable, even in the case of allograft transplantation6,9,10. Therefore, the primary step for using this source of stem cells is to select the best protocol for isolating hDPSCs from pulp tissue. In order to achieve this goal, it is crucial to investigate the effect of various isolation conditions on different cellular behaviors, such as their common surface markers &amp; also their differentiation capacity.
Thus, here we separate human pulp tissue from impacted third molar teeth, and then used both existing protocols based on literature, for isolating hDPSCs,11-13 i.e. enzymatic dissociation of pulp tissue (DPSC-ED) or outgrowth from tissue explants (DPSC-OG). In this regards, we tried to facilitate the isolation methods by using dental diamond disk. Then, these cells characterized in terms of stromal-associated Markers (CD73, CD90, CD105 &amp; CD44), hematopoietic/endothelial Markers (CD34, CD45 &amp; CD11b), perivascular marker, like CD146 and also STRO-1. Afterwards, these two protocols were compared based on the differentiation potency into odontoblasts by both quantitative polymerase chain reaction (QPCR) &amp; Alizarin Red Staining. QPCR were used for the assessment of the expression of the mineralization-related genes (alkaline phosphatase; ALP, matrix extracellular phosphoglycoprotein; MEPE &amp; dentin sialophosphoprotein; DSPP).14

The method described isolation and characterization of human Dental Pulp Stem Cells (hDPSCs) by using either enzymatic dissociation of pulp (DPSC-ED) or direct outgrowth of stem cells from pulp tissue explants (DPSC-OG). Then followed by in vitro comparative differentiation of both types of hDPSCs into odontoblasts.

Isolation, Charakterisierung und vergleichende Differenzierung humaner Dental Pulp Stammzellen aus bleibenden Zähne mit zwei verschiedenen Methoden abgeleitet

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Forschung

Medizin

Patient Derived Cell Culture and Isolation of CD133+ Putative Cancer Stem Cells from Melanoma

Despite improved treatments options for melanoma available today, patients with advanced malignant melanoma still have a poor prognosis for progression-free and overall survival. Therefore, translational research needs to provide further molecular evidence to improve targeted therapies for malignant melanomas. In the past, oncogenic mechanisms related to melanoma were extensively studied in established cell lines. On the way to more personalized treatment regimens based on individual genetic profiles, we propose to use patient-derived cell lines instead of generic cell lines. Together with high quality clinical data, especially on patient follow-up, these cells will be instrumental to better understand the molecular mechanisms behind melanoma progression.
Here, we report the establishment of primary melanoma cultures from dissected fresh tumor tissue. This procedure includes mincing and dissociation of the tissue into single cells, removal of contaminations with erythrocytes and fibroblasts as well as primary culture and reliable verification of the cells' melanoma origin.
Recent reports revealed that melanomas, like the majority of tumors, harbor a small subpopulation of cancer stem cells (CSCs), which seem to exclusively fuel tumor initiation and progression towards the metastatic state. One of the key markers for CSC identification and isolation in melanoma is CD133. To isolate CD133+ CSCs from primary melanoma cultures, we have modified and optimized the Magnetic-Activated Cell Sorting (MACS) procedure from Miltenyi resulting in high sorting purity and viability of CD133+ CSCs and CD133- bulk, which can be cultivated and functionally analyzed thereafter.

Patient Derived Cell Culture and Isolation of CD133+ Putative Cancer Stem Cells from Melanoma

This article describes the preparation of freshly obtained melanoma tissue into primary cell cultures, and how to remove contaminations of erythrocytes and fibroblasts from the tumor cells. Finally, we describe how CD133+ putative melanoma stem cells are sorted from the CD133- bulk using Magnetic Activated Cell Sorting (MACS).

Patienten abgeleitet Zellkultur und Isolierung von CD133<sup&gt; +</sup&gt; Mutmaßliche Cancer Stem Cells von Melanoma

Despite improved treatments options for melanoma available today, patients with advanced malignant melanoma still have a poor prognosis for ...

Primary Culture of Human Vestibular Schwannomas

Vestibular schwannomas (VSs) represent Schwann cell (SC) tumors of the vestibular nerve, compromising 10% of all intracranial neoplasms. VSs occur in either sporadic or familial (neurofibromatosis type 2, NF2) forms, both associated with inactivating defects in the NF2 tumor suppressor gene. Treatment for VSs is generally surgical resection or radiosurgery, however the morbidity of such procedures has driven investigations into less invasive treatments. Historically, lack of access to fresh tissue specimens and the fact that schwannoma cells are not immortalized have significantly hampered the use of primary cultures for investigation of schwannoma tumorigenesis. To overcome the limited supply of primary cultures, the immortalized HEI193 VS cell line was generated by transduction with HPV E6 and E7 oncogenes. This oncogenic transduction introduced significant molecular and phenotypic alterations to the cells, which limit their use as a model for human schwannoma tumors. We therefore illustrate a simplified, reproducible protocol for culture of primary human VS cells. This easily mastered technique allows for molecular and cellular investigations that more accurately recapitulate the complexity of VS disease.

Vestibular Schwannomas (VSs) are non-malignant tumors of Schwann cell (SC) origin, associated with mutations in the NF2 tumor suppressor gene. We report a reproducible, efficient protocol for primary human VS cell culture that allows for molecular and cellular experimental manipulation and analysis and recapitulates the heterogeneous nature of human disease.

Primäre Kultur der Menschen vestibuläre Schwannome

Vestibular schwannomas (VSs) represent Schwann cell (SC) tumors of the vestibular nerve, compromising 10% of all intracranial neoplasms. VSs occur in ...

Method for Obtaining Primary Ovarian Cancer Cells From Solid Specimens

Reliable tools for investigating ovarian cancer initiation and progression are urgently needed. While the use of ovarian cancer cell lines remains a valuable tool for understanding ovarian cancer, their use has many limitations. These include the lack of heterogeneity and the plethora of genetic alterations associated with extended in vitro passaging.&#160;Here we describe a method that allows for rapid establishment of primary ovarian cancer cells form solid clinical specimens collected at the time of surgery. The method consists of subjecting clinical specimens to enzymatic digestion for 30 min. The isolated cell suspension is allowed to grow and can be used for downstream application including drug screening. The advantage of primary ovarian cancer cell lines over established ovarian cancer cell lines is that they are representative of the original specific clinical specimens they are derived from and can be derived from different sites whether primary or metastatic ovarian cancer.

This study describes a detailed method for isolation and characterization of primary ovarian cancer cells from solid clinical specimens. Ovarian cancer clinical specimens are subjected to enzymatic digestion to obtain viable, fibroblast-free epithelial ovarian cancer (EOC) cells highly suitable for downstream applications.

Verfahren zur Gewinnung von Primäreierstockkrebszellen von Solid Proben

Reliable tools for investigating ovarian cancer initiation and progression are urgently needed. While the use of ovarian cancer cell lines remains a ...

Isolation, Cryopreservation and Culture of Human Amnion Epithelial Cells for Clinical Applications

Human amnion epithelial cells (hAECs) derived from term or pre-term amnion membranes have attracted attention from researchers and clinicians as a potential source of cells for regenerative medicine. The reason for this interest is evidence that these cells have highly multipotent differentiation ability, low immunogenicity, and anti-inflammatory functions. These properties have prompted researchers to investigate the potential of hAECs to be used to treat a variety of diseases and disorders in pre-clinical animal studies with much success.
hAECs have found widespread application for the treatment of a range of diseases and disorders. Potential clinical applications of hAECs include the treatment of stroke, multiple sclerosis, liver disease, diabetes and chronic and acute lung diseases. Progressing from pre-clinical animal studies into clinical trials requires a higher standard of quality control and safety for cell therapy products. For safety and quality control considerations, it is preferred that cell isolation protocols use animal product-free reagents. 
We have developed protocols to allow researchers to isolate, cryopreserve and culture hAECs using animal product-free reagents. The advantage of this method is that these cells can be isolated, characterized, cryopreserved and cultured without the risk of delivering potentially harmful animal pathogens to humans, while maintaining suitable cell yields, viabilities and growth potential. For researchers moving from pre-clinical animal studies to clinical trials, these methodologies will greatly accelerate regulatory approval, decrease risks and improve the quality of their therapeutic cell population.

We describe a protocol to isolate and culture human amnion epithelial cells (hAECs) using animal product-free reagents in accordance with current good manufacturing practices (cGMP) guidelines.

Isolation, Kryokonservierung und Kultur der Menschen Amnion Epithelzellen für Klinische Anwendungen

Human amnion epithelial cells (hAECs) derived from term or pre-term amnion membranes have attracted attention from researchers and clinicians as a ...

Isolation of Human Lymphatic Endothelial Cells by Multi-parameter Fluorescence-activated Cell Sorting

Lymphatic system disorders such as primary lymphedema, lymphatic malformations and lymphatic tumors are rare conditions that cause significant morbidity but little is known about their biology. Isolating highly pure human lymphatic endothelial cells (LECs) from diseased and healthy tissue would facilitate studies of the lymphatic endothelium at genetic, molecular and cellular levels. It is anticipated that these investigations may reveal targets for new therapies that may change the clinical management of these conditions. A protocol describing the isolation of human foreskin LECs and lymphatic malformation lymphatic endothelial cells (LM LECs) is presented. To obtain a single cell suspension tissue was minced and enzymatically treated using dispase II and collagenase II. The resulting single cell suspension was then labelled with antibodies to cluster of differentiation (CD) markers CD34, CD31, Vascular Endothelial Growth Factor-3 (VEGFR-3) and PODOPLANIN. Stained viable cells were sorted on a fluorescently activated cell sorter (FACS) to separate the CD34LowCD31PosVEGFR-3PosPODOPLANINPos LM LEC population from other endothelial and non-endothelial cells. The sorted LM LECs were cultured and expanded on fibronectin-coated flasks for further experimental use.

The goal of this protocol is to isolate lymphatic endothelial cells lining human lymphatic malformation cyst-like vessels and foreskins using fluorescence-activated cell sorting (FACS). Subsequent cell culturing and expansion of these cells permits a new level of experimental sophistication for genetic, proteomic, functional and cell differentiation studies.

Isolation of Human Lymphatic Endothelzellen durch Multiparameter-Fluoreszenz-aktivierten Zellsortierung

Lymphatic system disorders such as primary lymphedema, lymphatic malformations and lymphatic tumors are rare conditions that cause significant morbidity ...

Isolation and Propagation of Circulating Tumor Cells from a Mouse Cancer Model

Cancer metastasis is the foremost cause of cancer-associated deaths. Recent studies have shown that circulating tumor cells (CTCs) are important in cancer metastasis. Indeed, the number of CTCs correlates with tumor size. Here, a detailed description is provided of a methodology for isolation and propagation of CTCs from a syngeneic mouse model of hepatocellular carcinoma (HCC) which allows for downstream analysis of potentially important molecular mechanisms of solid organ tumor metastasis. This method is efficient and reproducible. It is a non-invasive technique and, therefore, has potential to replace the invasive biopsy of tissues from humans which may be associated with complications. Therefore, the method discussed here allows for the isolation and propagation of CTCs from whole blood samples such that they can be examined and characterized. This has potential for future adaptation for clinical applications such as diagnosis, and personalized targeted therapy.

Circulating tumor cells (CTCs) have been shown to play an important role in tumor metastasis. Here, a method for the isolation and propagation of CTCs from the whole blood of a syngeneic mouse tumor model of hepatocellular carcinoma (HCC) metastasis is described.

Isolierung und Vermehrung von zirkulierenden Tumorzellen aus einer Maus Cancer

Cancer metastasis is the foremost cause of cancer-associated deaths. Recent studies have shown that circulating tumor cells (CTCs) are important in cancer ...

Isolation and Culture Expansion of Tumor-specific Endothelial Cells

Freshly isolated tumor-specific endothelial cells (TEC) can be used to explore molecular mechanisms of tumor angiogenesis and serve as an in vitro model for developing new angiogenesis inhibitors for cancer. However, long-term in vitro expansion of murine endothelial cells (EC) is challenging due to phenotypic drift in culture (endothelial-to-mesenchymal transition) and contamination with non-EC. This is especially true for TEC which are readily outcompeted by co-purified fibroblasts or tumor cells in culture. Here, a high fidelity isolation method that takes advantage of immunomagnetic enrichment coupled with colony selection and in vitro expansion is described. This approach generates pure EC fractions that are entirely free of contaminating stromal or tumor cells. It is also shown that lineage-traced Cdh5cre:ZsGreenl/s/l reporter mice, used with the protocol described herein, are a valuable tool to verify cell purity as the isolated EC colonies from these mice show durable and brilliant ZsGreen fluorescence in culture.

We report a reliable method to isolate and culture primary tumor-specific endothelial cells from genetically engineered mouse models.

Isolierung und Kultur Expansion von tumorspezifischen Endothelzellen

Freshly isolated tumor-specific endothelial cells (TEC) can be used to explore molecular mechanisms of tumor angiogenesis and serve as an in vitro model ...

Isolation of Endothelial Progenitor Cells from Healthy Volunteers and Their Migratory Potential Influenced by Serum Samples After Cardiac Surgery

Endothelial progenitor cells (EPCs) are recruited from the bone marrow under pathological conditions like hypoxia and are crucially involved in the neovascularization of ischemic tissues. The origin, classification and characterization of EPCs are complex; notwithstanding, two prominent sub-types of EPCs have been established: so-called &#34;early&#34; EPCs (subsequently referred to as early-EPCs) and late-outgrowth EPCs (late-EPCs). They can be classified by biological properties as well as by their appearance during in vitro culture. While &#34;early&#34; EPCs appear in less than a week after culture of peripheral blood-derived mononuclear cells in EC-specific media, late-outgrowth EPCs can be found after 2-3 weeks. Late-outgrowth EPCs have been recognized to be directly involved in neovascularization, mainly through their ability to differentiate into mature endothelial cells, whereas &#34;early&#34; EPCs express various angiogenic factors as endogenous cargo to promote angiogenesis in a paracrine manner. During myocardial ischemia/reperfusion (I/R), various factors control the homing of EPCs to regions of blood vessel formation.
Macrophage migration inhibitory factor (MIF) is a chemokine-like pro-inflammatory and ubiquitously expressed cytokine and was recently described to function as key regulator of EPCs migration at physiological concentrations1. Interestingly, MIF is stored in intracellular pools and can rapidly be released into the blood stream after several stimuli (e.g. myocardial infarction). 
This protocol describes a method for the reliable isolation and culture of early-EPCs from adult human peripheral blood based on CD34-positive selection with subsequent culture in medium containing endothelial growth factors on fibronectin-coated plates for use in in vitro migration assays against serum samples of cardiac surgical patients. Furthermore, the migratory influence of MIF on chemotaxis of EPCs compared to other well-known angiogenesis-stimulating cytokines is demonstrated.

Endothelial progenitor cells (EPCs) are crucially involved in the neovascularization of ischemic tissues. This method describes the isolation of human EPCs from peripheral blood, as well as the identification of their migratory potential against serum samples of cardiac surgical patients.

Isolierung von endothelialen Vorläuferzellen von gesunden Freiwilligen und ihre Migratory Potential Beeinflusst von Serumproben nach einer Herzoperation

Endothelial progenitor cells (EPCs) are recruited from the bone marrow under pathological conditions like hypoxia and are crucially involved in the ...

A Cell Culture Model of Resistance Arteries

The myoendothelial junction (MEJ), a unique signaling microdomain in small diameter resistance arteries, exhibits localization of specific proteins and signaling processes that can control vascular tone and blood pressure. As it is a projection from either the endothelial or smooth muscle cell, and due to its small size (on average, an area of ~1 &#181;m2), the MEJ is difficult to study in isolation. However, we have developed a cell culture model called the vascular cell co-culture (VCCC) that allows for in vitro MEJ formation, endothelial cell polarization, and dissection of signaling proteins and processes in the vascular wall of resistance arteries. The VCCC has a multitude of applications and can be adapted to suit different cell types. The model consists of two cell types grown on opposite sides of a filter with 0.4 &#181;m pores in which the in vitro MEJs can form. Here we describe how to create the VCCC via plating of cells and isolation of endothelial, MEJ, and smooth muscle fractions, which can then be used for protein isolation or activity assays. The filter with intact cell layers can be fixed, embedded, and sectioned for immunofluorescent analysis. Importantly, many of the discoveries from this model have been confirmed using intact resistance arteries, underscoring its physiological relevance.

A cell culture model of resistance arteries is described, allowing for the dissection of signaling pathways in endothelium, smooth muscle, or between endothelium and smooth muscle (the myoendothelial junction). The selective application of agonists or protein isolation, electron microscopy, or immunofluorescence can be utilized using this cell culture model.

Eine Kultur Zellmodell der Widerstand Arterien

The myoendothelial junction (MEJ), a unique signaling microdomain in small diameter resistance arteries, exhibits localization of specific proteins and ...