The authors would like to thank Mark Harrison and Gwen Hirsch of the University of Georgia for kindly providing the bacterial strain and other support to this study.

1. Sample Preparation
NOTE: Food samples are prepared for pre-enrichment according to Microbiology Laboratory Guidebook (MLG) of U.S. Department of Agriculture Food Safety and Inspection Service (USDA-FSIS)11 and Bacteriological analytical manual (BAM) of U.S. Food and Drug Administration (FDA)12.
<ol>
	<li>Aseptically place a 25 g portion of food sample such as black pepper, chicken breast, ground beef, and alfalfa sprouts or an environmental swab into a sterile laboratory blender bag with a built-in filter. Prepare an environmental swab by aseptically moistening a sponge with enrichment broth (Rappaport-Vassiliadis, RV). Then, drag the swab over entire surface or predetermined area and place it into a laboratory blender bag.</li>
</ol>
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/58612/58612fig1.jpg" /> 
Figure 1: Representative food and environmental samples for quasi-metagenomics detection and subtyping of Salmonella. Samples are placed in sterile filter stomacher bags along with RV broth. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58612/58612fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<ol start="2">
	<li>Thoroughly mix each 25 g sample with 225 mL of RV enrichment broth using a laboratory blender or hand massage for 30 s. 
	NOTE: Variants of RV broth as recommended by MLG and BAM may be used depending on sample types.</li>
	<li>Incubate sample-enrichment broth mixture in a laboratory incubator at 42 &#176;C for 4&#8211;24 h.</li>
	<li>After incubation, collect a 50 mL subsample of enrichment broth from the filtered side of the bag in a separate 50 mL centrifuge tube.</li>
	<li>Centrifuge the tube at 100 x g for 10 min to remove solid debris in the homogenate.</li>
	<li>Recover the supernatant carefully to a new 50 mL centrifuge tube and centrifuge the tubes at 3,000&#8211;6,000 x g for 10 min to recover cell pellet.</li>
	<li>(Optional) Discard the supernatant and wash the pellet by re-suspension in 5 mL of Buffered Peptone Water (BPW) and centrifuge the tubes at 3,000&#8211;6,000 &#215; g for 10 min. 
	NOTE: BPW can prepared by dissolving 10 g of peptone, 5 g of sodium chloride, 3.5 g of disodium phosphate, and 1.5 g of monopotassium phosphate into 1 L of distilled water. The final pH should be adjusted to 7.2 &#177; 0.2 at 25 &#176;C. Autoclave at 121 &#186;C for 15 min. Commercially available BPW can also be used.</li>
	<li>Discard supernatant and re-suspend the pellet in 5 mL of BPW.</li>
</ol>
2. Immunomagnetic Separation (IMS) and Multiple Displacement Amplification (MDA)
NOTE: To prevent cross-contamination between samples, work in a biosafety cabinet, change pipette tips for each tube, avoid touching the tube with the pipette, and do not place tubes close together in magnetic stand during the washing step.
<ol>
	<li>Thaw the sample buffer and the reaction buffer from the MDA kit on ice or at 4 &#176;C in advance.</li>
	<li>Mix 1 mL of re-suspended cell pellet in BPW with 20 &#956;L of anti-Salmonella beads in 1.5 mL microcentrifuge tubes and place it on the rotating mixer for 30 min at room temperature. 
	NOTE: Competitive flora, fat particulates, and proteins in the resuspended pellet can interfere with IMS. Dilution of re-suspended cell pellet in BPW is helpful to reduce the loss of the bead-Salmonella complexes from the magnetic stand during washing steps.</li>
	<li>Insert the tubes into the magnetic stand and allow 3 min for the proper recovery of beads by inverting the rack several times to concentrate the beads into a pellet on the side of the tube.</li>
	<li>Keep the tubes on the magnetic stand. Aspirate and discard the supernatant from each tube, as well as the remaining liquid in each tube&#8217;s cap. 
	NOTE: Be careful not to disturb the pellet of IMS beads on the side wall of the tube against the magnet.</li>
	<li>Remove the tube holder from the magnetic stand and add 1 mL of wash buffer (PBS containing 0.05 % (v/v) polysorbate 20) and invert several times to remove non-specifically binding bacteria from the complex.</li>
	<li>Repeat steps 2.3&#8211;2.5 twice.</li>
	<li>After the 3rd wash, perform the final magnetic separation of beads by repeating steps 2.3&#8211;2.4. Remove tubes from magnetic rack and place them in a microfuge for 1 s to spin down beads. Then, place the tubes in the magnetic rack for 3 min before removing any residual wash buffer.</li>
	<li>Re-suspend the bead-Salmonella complexes in 9 &#956;L of Sample buffer and incubate at 95 &#176;C for 3 min for denaturation.</li>
	<li>After cooling to 4 &#176;C on ice, combine with 9 &#956;L of Reaction buffer plus 1 &#956;L of enzyme mix and keep on ice.</li>
	<li>In a thermal cycler, incubate tubes at 30 &#176;C for 2 h for amplification, followed by heating at 65 &#176;C for 10 min to inactivate the enzyme and cool to 4 &#176;C on ice.</li>
	<li>Assess the quantity and quality of the MDA products by measuring the DNA concentration and purity (260/280 ratio &#62; 1.8) on a fluorospectrometer instrument. 
	NOTE: Because of non-specific binding of IMS beads, genomic DNA from organisms other than Salmonella is likely to be present in the MDA products, but it does not affect downstream analysis.</li>
	<li>Store the final products (20 &#956;L) at -20 &#176;C until use for real-time PCR and/or library preparation for quasimetagenomics sequencing.</li>
</ol>
3. Real-Time PCR
NOTE: This step is optional for 1) detecting Salmonella without subtyping, and 2) assessing sample quality prior to quasimetagenomics sequencing.
<ol>
	<li>Prepare 18 &#956;L of PCR mixture per sample, containing Universal PCR Master Mix (10 &#956;L), forward primer (2 &#956;L, 900 nM), reverse primer (2 &#956;L, 900 nM), probe (2 &#956;L, 250 nM), and molecular grade water (2 &#956;L). 
	Note: Salmonella-specific oligonucleotide primers (forward: CTCACCAGGAGATTACAACATGG, reverse: AGCTCAGACCAAAAGTGACCATC) and probe were designed to amplify a 94-bp sequence within the ttr gene (GenBank accession no. AF 282268)13.</li>
	<li>Mix the MDA product from step 2.12 by gently pipetting up and down bead-Salmonella complexes along with liquid to create a suspension. Add 2 &#956;L of the suspension into 18 &#956;L of PCR mixture.</li>
	<li>Run real-time PCR using an optimized real-time PCR protocol, specifying two holding periods, one at 50 &#176;C for 2 min and another at 95 &#176;C for 10 min, followed by 40 cycles of 95 &#176;C for 15 s and 60 &#176;C for 60 s.</li>
	<li>Calculate the threshold cycle (Ct), which is the number of cycles required for the fluorescence from the amplified DNA to cross the threshold line. 
	NOTE: The threshold line is set in the linear phase between base line and plateau of the amplification plots of samples. Negative results correspond to Ct values over 40 or samples with Ct values higher than that of negative control.</li>
</ol>
4. Library Preparation for Quasimetagenomic Sequencing
NOTE: The MDA products can be sequenced by both short read and long read (nanopore) sequencing platforms. Use the latest version of DNA library prep kits provided by the manufacturers of the sequencing platforms. Perform DNA library preparation according to manufacturers&#8217; instruction. Use the 2D low-input genomic DNA protocol for library preparation for the long-read sequencing platform5. For library preparation for the short-read sequencing platform, minor modifications to the manufacturer&#8217;s protocol are provided below.
<ol>
	<li>Follow standard library preparation methods by adding buffer solutions and reagents to MDA products. Transfer 40 &#956;L of the sequencing prepped MDA&#160; products to a new plate and add 20 &#956;L of PCR purification beads to each well.</li>
	<li>Incubate the plate at room temperature for 10 min without shaking.</li>
	<li>Wash the beads with 80% ethanol and dry the beads for 12 min.</li>
	<li>Re-suspend dried beads in 53 &#956;L of resuspension buffer and incubate for 2 min without shaking.</li>
	<li>Dilute and pool libraries following manufacturer&#8217;s instruction. 
	NOTE: A 10 pM pooled and denatured library is now ready to be sequenced.</li>
</ol>

<ol>
	<li>Valderrama, W. B., Dudley, E. G., Doores, S., Cutter, C. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Commercially+Available+Rapid+Methods+for+Detection+of+Selected+Food-borne+Pathogens.">Commercially Available Rapid Methods for Detection of Selected Food-borne Pathogens.</a> Critical Reviews in Food Science and Nutrition. 56 (9), 1519-1531 (2016).</li><li>Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+metagenomic+sequencing+to+food+safety:+detection+of+Shiga+Toxin-producing+Escherichia+coli+on+fresh+bagged+spinach.">Application of metagenomic sequencing to food safety: detection of Shiga Toxin-producing Escherichia coli on fresh bagged spinach.</a> Applied and Environmental Microbiology. 81 (23), 8183-8191 (2015).</li><li>Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strain-Level+Discrimination+of+Shiga+Toxin-Producing+Escherichia+coli+in+Spinach+Using+Metagenomic+Sequencing.">Strain-Level Discrimination of Shiga Toxin-Producing Escherichia coli in Spinach Using Metagenomic Sequencing.</a> PLoS One. 11 (12), e0167870 (2016).</li><li>Hyeon, J. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quasi-metagenomics+and+realtime+sequencing+aided+detection+and+subtyping+of+Salmonella+enterica+from+food+samples.">Quasi-metagenomics and realtime sequencing aided detection and subtyping of Salmonella enterica from food samples.</a> Applied and Environmental Microbiology. , (2017).</li><li>Hyeon, J. Y., Deng, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+detection+of+Salmonella+in+raw+chicken+breast+using+real-time+PCR+combined+with+immunomagnetic+separation+and+whole+genome+amplification.">Rapid detection of Salmonella in raw chicken breast using real-time PCR combined with immunomagnetic separation and whole genome amplification.</a> Food Microbiology. 63, 111-116 (2017).</li><li>Hosono, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unbiased+whole-genome+amplification+directly+from+clinical+samples.">Unbiased whole-genome amplification directly from clinical samples.</a> Genome Research. 13 (5), 954-964 (2003).</li><li>Seth-Smith, H. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole-genome+sequences+of+Chlamydia+trachomatis+directly+from+clinical+samples+without+culture.">Whole-genome sequences of Chlamydia trachomatis directly from clinical samples without culture.</a> Genome Research. 23 (5), 855-866 (2013).</li><li>Jacobson, A. P., Gill, V. S., Irvin, K. A., Wang, H., Hammack, T. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+methods+to+prepare+samples+of+leafy+green+vegetables+for+preenrichment+with+the+Bacteriological+Analytical+Manual+Salmonella+culture+method.">Evaluation of methods to prepare samples of leafy green vegetables for preenrichment with the Bacteriological Analytical Manual Salmonella culture method.</a> Journal of Food Protection. 75 (2), 400-404 (2012).</li><li>Jacobson, A. P., Hammack, T. S., Andrews, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+sample+preparation+methods+for+the+isolation+of+Salmonella+from+alfalfa+and+mung+bean+seeds+with+the+Bacteriological+Analytical+Manual's+Salmonella+culture+method.">Evaluation of sample preparation methods for the isolation of Salmonella from alfalfa and mung bean seeds with the Bacteriological Analytical Manual's Salmonella culture method.</a> Journal of AOAC International. 91 (5), 1083-1089 (2008).</li><li>Deng, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+subtyping+methods+against+a+whole-genome-sequencing+standard+for+Salmonella+enterica+serotype+Enteritidis.">Comparative analysis of subtyping methods against a whole-genome-sequencing standard for Salmonella enterica serotype Enteritidis.</a> Journal of Clinical Microbiology. 53 (1), 212-218 (2015).</li><li>. Microbiology Laboratory Guidebook Available from: <a target="_blank" href="https://www.fsis.usda.gov/wps/portal/fsis/topics/science/laboratories-and-procedures/guidebooks-and-methods/microbiology-laboratory-guidebook/microbiology-laboratory-guidebook">https://www.fsis.usda.gov/wps/portal/fsis/topics/science/laboratories-and-procedures/guidebooks-and-methods/microbiology-laboratory-guidebook/microbiology-laboratory-guidebook</a> (2018)</li><li>. Bacteriological Analytical Manual (BAM) Chapter 5: Salmonella Available from: <a target="_blank" href="https://www.fda.gov/Food/FoodScienceResearch/LaboratoryMethods/ucm070149.htm">https://www.fda.gov/Food/FoodScienceResearch/LaboratoryMethods/ucm070149.htm</a> (2018)</li><li>Malorny, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diagnostic+real-time+PCR+for+detection+of+Salmonella+in+food.">Diagnostic real-time PCR for detection of Salmonella in food.</a> Applied and Environmental Microbiology. 70 (12), 7046-7052 (2004).</li><li>June, G. A., Sherrod, P. S., Hammack, T. S., Amaguana, R. M., Andrews, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Relative+effectiveness+of+selenite+cystine+broth,+tetrathionate+broth,+and+Rappaport-Vassiliadis+medium+for+the+recovery+of+Salmonella+from+raw+flesh+and+other+highly+contaminated+foods:+precollaborative+study.">Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella from raw flesh and other highly contaminated foods: precollaborative study.</a> Journal of AOAC International. 78 (2), 375-380 (1995).</li><li>Hammack, T. S., Amaguana, R. M., June, G. A., Sherrod, P. S., Andrews, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Relative+effectiveness+of+selenite+cystine+broth,+tetrathionate+broth,+and+Rappaport-Vassiliadis+medium+for+the+recovery+of+Salmonella+spp.+from+foods+with+a+low+microbial+load.">Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella spp. from foods with a low microbial load.</a> Journal of Food Protection. 62 (1), 16-21 (1999).</li><li>Wood, D. E., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kraken:+ultrafast+metagenomic+sequence+classification+using+exact+alignments.">Kraken: ultrafast metagenomic sequence classification using exact alignments.</a> Genome Biology. 15 (3), R46 (2014).</li><li>Davis, S., Pettengill, J. B., Luo, Y., Payne, J., Shpuntoff, A., Rand, H., Strain, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CFSAN+SNP+Pipeline:+an+automated+method+for+constructing+SNP+matrices+from+next-generation+sequence+data.">CFSAN SNP Pipeline: an automated method for constructing SNP matrices from next-generation sequence data.</a> PeerJ Computer Science. 1 (e20), (2015).</li><li>Zhang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Salmonella+serotype+determination+utilizing+high-throughput+genome+sequencing+data.">Salmonella serotype determination utilizing high-throughput genome sequencing data.</a> Journal of Clinical Microbiology. 53 (5), 1685-1692 (2015).</li><li>Rodrigue, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole+genome+amplification+and+de+novo+assembly+of+single+bacterial+cells.">Whole genome amplification and de novo assembly of single bacterial cells.</a> PLoS One. 4 (9), e6864 (2009).</li><li>Ramamurthy, T., Ghosh, A., Pazhani, G. P., Shinoda, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+Perspectives+on+Viable+but+Non-Culturable+(VBNC)+Pathogenic+Bacteria.">Current Perspectives on Viable but Non-Culturable (VBNC) Pathogenic Bacteria.</a> Front Public Health. 2, 103 (2014).</li></ol>

The authors declare that they have no competing financial interests.

Because of the often-low abundance and in-homogenous presence of Salmonella in food and environmental samples, culture enrichment before IMS-MDA is still necessary for Salmonella detection and subtyping; it is therefore a critical step of the protocol. To identify optimal conditions to increase the abundance of Salmonella relative to sample background flora, different enrichment media may be evaluated for specific samples. According to MLG and BAM, both selective medium such as RV broth and non...

Metagenomics sequencing theoretically allows concerted detection and subtyping of foodborne pathogens. However, food samples present challenges to the pathogen analysis by direct sequencing of the food microbiome. First, foodborne pathogens are often present at low levels in food samples. Most of the commercially available rapid detection methods still require 8&#8211;48 h culturing to enrich pathogen cells to a detectable level1. Second, many foods contain abundant microflora cells and/or food DNA, making foodborne pathogen DNA a small fraction of food metagenome and an elusive target for detection and subtyping by direct metagenomic sequencing.
Modification of food microbiomes has been reported to allow substantial concentration of foodborne pathogen DNA to facilitate sequencing-based detection of Shiga toxin-producing Escherichia coli2,3 and Salmonella enterica4. Because modified food microbiomes are still mixtures of different microbial species, their sequencing is termed as quasi-metagenomic analysis4. Microbiome modification can be performed by culture enrichment alone2,3 or in combination with immunomagnetic separation (IMS) and multiple displacement amplification (MDA)4,5. IMS can selectively capture pathogen cells from the enrichment culture via antibody-coated magnetic beads. MDA can generate sufficient amounts of genomic DNA for sequencing through the highly efficient &#632;29 DNA polymerase6. IMS-MDA has allowed culture-independent pathogen detection from clinical samples7, and shortening of the culture enrichment for quasi-metagenomic detection and subtyping of Salmonella in food samples4.
The overall goal of this method is to prepare quasi-metagenomic DNA from food samples to allow targeted concentration of Salmonella genomic DNA and subsequent detection and subtyping of the Salmonella contaminant by sequencing. Compared to standard methods for Salmonella detection8,9 and subtyping10, the quasimetagenomic approach can substantially shorten the turnaround time from contaminated food and environmental samples to molecular subtypes of the pathogen by unifying the two typically separated analyses into a single workflow. This method is particularly useful for applications such as foodborne outbreak response and other trace back investigations where robust pathogen subtyping is required in addition to pathogen detection and rapid analytical turnaround is important.

<table>
	<tbody>
		<tr>
			<td>Laboratory blender bag w/filter</td>
			<td>VWR</td>
			<td>10048-886</td>
			<td></td>
		</tr>
		<tr>
			<td>Buffered peptone water</td>
			<td>Oxoid Micorbiology Products</td>
			<td>CM0509</td>
			<td></td>
		</tr>
		<tr>
			<td>Rappaport Vassiliadis broth</td>
			<td>Neogen Acumedia</td>
			<td>7730A</td>
			<td></td>
		</tr>
		<tr>
			<td>Polysorbate 20&#160;</td>
			<td>Millipore Sigma</td>
			<td>P9416</td>
			<td>Tween 20</td>
		</tr>
		<tr>
			<td>Stomacher blender</td>
			<td>Seward&#160;</td>
			<td>30010108</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Fisher Scientific</td>
			<td>75005194</td>
			<td></td>
		</tr>
		<tr>
			<td>50ml Centrifuge tubes</td>
			<td>Fisher Scientific</td>
			<td>05-539-6</td>
			<td></td>
		</tr>
		<tr>
			<td>Thermal Cycler</td>
			<td>Techne Prime</td>
			<td>EW-93945-13</td>
			<td></td>
		</tr>
		<tr>
			<td>StepOne Real-Time Thermal cycler</td>
			<td>Applied Biosystems</td>
			<td>4.76357</td>
			<td></td>
		</tr>
		<tr>
			<td>AMPure XP beads</td>
			<td>Beckman Coulter</td>
			<td>A63881</td>
			<td>PCR purification beads; mix well before use; store at 4C</td>
		</tr>
		<tr>
			<td>Nextera XT library prep kit</td>
			<td>Illumina</td>
			<td>FC-131-1024</td>
			<td>Store at -80C</td>
		</tr>
		<tr>
			<td>MinIon library prep kit</td>
			<td>Oxford Nanopore</td>
			<td>SQK-LSK108</td>
			<td>Store at -80C</td>
		</tr>
		<tr>
			<td>NanoDrop</td>
			<td>Thermo Scientific</td>
			<td>ND-2000</td>
			<td></td>
		</tr>
		<tr>
			<td>Dynabead Anti-Salmonella beads</td>
			<td>Applied Biosystems</td>
			<td>71002</td>
			<td>Vortex well prior to use</td>
		</tr>
		<tr>
			<td>Illustra GenomiPhi V2 DNA amplification kit (MDA kit) 
			-Sample buffer 
			-Reaction buffer 
			-Enzyme mix</td>
			<td>GE Healthcare</td>
			<td>25-6600-30</td>
			<td>Store at -80C</td>
		</tr>
		<tr>
			<td>HulaMixer</td>
			<td>Invitrogen</td>
			<td>15920D</td>
			<td></td>
		</tr>
		<tr>
			<td>DynaMag magnetic rack</td>
			<td>Invitrogen</td>
			<td>12321D</td>
			<td></td>
		</tr>
		<tr>
			<td>TaqMan Universal PCR mastermix</td>
			<td>Applied Biosystems</td>
			<td>4304437</td>
			<td>Mix well before use; store at 4C</td>
		</tr>
		<tr>
			<td>Microfuge</td>
			<td>Fisher Scientific</td>
			<td>05-090-100</td>
			<td></td>
		</tr>
	</tbody>
</table>

quasi-metagenomic analysis of salmonella from food and environmental samples

Quasi-metagenomics sequencing refers to the sequencing-based analysis of modified microbiomes of food and environmental samples. In this protocol, microbiome modification is designed to concentrate genomic DNA of a target foodborne pathogen contaminant to facilitate the detection and subtyping of the pathogen in a single workflow. Here, we explain and demonstrate the sample preparation steps for the quasi-metagenomics analysis of Salmonella enterica from representative food and environmental samples including alfalfa sprouts, ground black pepper, ground beef, chicken breast and environmental swabs. Samples are first subjected to the culture enrichment of Salmonella for a shortened and adjustable duration (4&#8211;24 h). Salmonella cells are then selectively captured from the enrichment culture by immunomagnetic separation (IMS). Finally, multiple displacement amplification (MDA) is performed to amplify DNA from IMS-captured cells. The DNA output of this protocol can be sequenced by high throughput sequencing platforms. An optional quantitative PCR analysis can be performed to replace sequencing for Salmonella detection or assess the concentration of Salmonella DNA before sequencing.

Prior to quasimetagenomic sequencing, the overall quantity and purity of IMS-MDA products can be evaluated by fluorospectrometer (Table 1).
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td>Enrichment time (h)</td>
			<td>Ct value</td>
			<td>Concentration (ng/ul)</td>
			<td>Purity (260/280)</td>
		</tr>
		<tr>
			<td><stron...

Watch this Scientific Journal Video about Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples at JoVE.com

Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples

Here, we present a protocol to prepare DNA samples from food and environmental microbiomes for concerted detection and subtyping of Salmonella through quasimetagenomic sequencing. The combined use of culture enrichment, immunomagnetic separation (IMS), and multiple displacement amplification (MDA) allows effective concentration of Salmonella genomic DNA from food and environmental samples.&#160;

Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples

Quasi-metagenomics sequencing refers to the sequencing-based analysis of modified microbiomes of food and environmental samples. In this protocol, ...

quasi-metagenomic-analysis-salmonella-from-food-environmental

Research

JoVE Journal

Biology

8.5K Views.  Center for Food Safety. Here, we present a protocol to prepare DNA samples from food and environmental microbiomes for concerted detection and subtyping of Salmonella through quasimetagenomic sequencing. The combined use of culture enrichment, immunomagnetic separation (IMS), and multiple displacement amplification (MDA) allows effective concentration of Salmonella genomic DNA from food and environmental samples. 

Video: Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples

Analyzing Gene Expression from Marine Microbial Communities using Environmental Transcriptomics

Analogous to metagenomics, environmental transcriptomics (metatranscriptomics) retrieves and sequences environmental mRNAs from a microbial assemblage without prior knowledge of what genes the community might be expressing. Thus it provides the most unbiased perspective on community gene expression in situ. Environmental transcriptomics protocols are technically difficult since prokaryotic mRNAs generally lack the poly(A) tails that make isolation of eukaryotic messages relatively straightforward 1 and because of the relatively short half lives of mRNAs 2. In addition, mRNAs are much less abundant than rRNAs in total RNA extracts, thus an rRNA background often overwhelms mRNA signals. However, techniques for overcoming some of these difficulties have recently been developed. A procedure for analyzing environmental transcriptomes by creating clone libraries using random primers to reverse-transcribe and amplify environmental mRNAs was recently described was successful in two different natural environments, but results were biased by selection of the random primers used to initiate cDNA synthesis 3. Advances in linear amplification of mRNA obviate the need for random primers in the amplification step and make it possible to use less starting material decreasing the collection and processing time of samples and thereby minimizing RNA degradation 4. In vitro transcription methods for amplifying mRNA involve polyadenylating the mRNA and incorporating a T7 promoter onto the 3 end of the transcript. Amplified RNA (aRNA) can then be converted to double stranded cDNA using random hexamers and directly sequenced by pyrosequencing 5. A first use of this method at Station ALOHA demonstrated its utility for characterizing microbial community gene expression 6.

We present a method for generating cDNA from environmental mRNA. In general, total RNA is first collected from the environment, rRNA is selectively removed, mRNA is selectively amplified, and cDNA synthesized from the enriched mRNA pool is sequenced. Recovered sequences can be annotated using standard bioinformatics techniques to identify the expressed genes.

Analogous to metagenomics, environmental transcriptomics (metatranscriptomics) retrieves and sequences environmental mRNAs from a microbial assemblage ...

Chronic Salmonella Infected Mouse Model

The bacterial infected mouse model is a powerful model system for studying areas such as infection, inflammation, immunology, signal transduction, and tumorigenesis. Many researchers have taken advantage of the colitis induced by Salmonella typhimurium for the studies on the early phase of inflammation and infection. However, only few reports are on the chronic infection in vivo. Mice with Salmonella persistent existence in the gastrointestinal tract allow us to explore the long-term host-bacterial interaction, signal transduction, and tumorigenesis. We have established a chronic bacterial infected mouse model with Salmonella typhimurium colonization in the mouse intestine over 6 months. To use this system, it is necessary for the researcher to learn how to prepare the bacterial culture and gavage the animals. We detail a methodology for prepare bacterial culture and gavage mice. We also show how to detect the Salmonella persistence in the gastrointestinal tract. Overall, this protocol will aid researchers using the bacterial infected mouse model to address fundamentally important biological and microbiological questions.

Chronic Salmonella Infected Mouse Model

Establish a chronic bacterial infected mouse model with persistent Salmonella typhimurium colonization in intestine for 27 weeks.

The bacterial infected mouse model is a powerful model system for studying areas such as infection, inflammation, immunology, signal transduction, and ...

High-Throughput Measurement and Classification of Organic P in Environmental Samples

Many types of organic phosphorus (P) molecules exist in environmental samples1. Traditional P measurements do not detect these organic P compounds since they do not react with colorimetric reagents2,3. Enzymatic hydrolysis (EH) is an emerging method for accurately characterizing organic P forms in environmental samples4,5. This method is only trumped in accuracy by Phosphorus-31 Nuclear Magnetic Resonance Spectroscopy (31P-NMR) -a method that is expensive and requires specialized technical training6. We have adapted an enzymatic hydrolysis method capable of measuring three classes of phosphorus (monoester P, diester P and inorganic P) to a microplate reader system7. This method provides researchers with a fast, accurate, affordable and user-friendly means to measure P species in soils, sediments, manures and, if concentrated, aquatic samples. This is the only high-throughput method for measuring the forms and enzyme-lability of organic P that can be performed in a standard laboratory. The resulting data provides insight to scientists studying system nutrient content and eutrophication potential.

This protocol describes a high-throughput method of enzymatic hydrolysis that utilizes a microplate reader to measure and classify soil phosphorus as P monoesters, P diesters and inorganic P. Up to 96 samples can be measured at one time in a standard laboratory.

Many types of organic phosphorus (P) molecules exist in environmental samples1.  Traditional P measurements do not detect these organic P compounds since ...

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. coli O157:H7 by targeting ORF Z3276. With this assay, we can detect as low as a few copies of the genome of DNA of E. coli O157:H7. The sensitivity and specificity of the assay were confirmed by intensive validation tests with a large number of E. coli O157:H7 strains (n = 369) and non-O157 strains (n = 112). Furthermore, we have combined propidium monoazide (PMA) procedure with the newly developed qPCR protocol for selective detection of live cells from dead cells. Amplification of DNA from PMA-treated dead cells was almost completely inhibited in contrast to virtually unaffected amplification of DNA from PMA-treated live cells. Additionally, the protocol has been modified and adapted to a 96-well plate format for an easy and consistent handling of a large number of samples. This method is expected to have an impact on accurate microbiological and epidemiological monitoring of food safety and environmental source.

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A qPCR assay was developed for detection of Escherichia coli O157:H7 targeting a unique genetic marker, Z3276. The qPCR was combined with propidium monoazide (PMA) treatment for live cell detection. This protocol has been modified and adapted to a 96-well plate format for easy and consistent handling of numerous samples

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. ...

One-step Purification of Twin-Strep-tagged Proteins and Their Complexes on Strep-Tactin Resin Cross-linked With Bis(sulfosuccinimidyl) Suberate (BS3)

Affinity purification of Strep-tagged fusion proteins on resins carrying an engineered streptavidin (Strep-Tactin) has become a widely used method for isolation of protein complexes under physiological conditions. Fusion proteins containing two copies of Strep-tag II, designated twin-Strep-tag or SIII-tag, have the advantage of higher affinity for Strep-Tactin compared to those containing only a single Strep-tag, thus allowing more efficient protein purification. However, this advantage is offset by the fact that elution of twin-Strep-tagged proteins with biotin may be incomplete, leading to low protein recovery. The recovery can be dramatically improved by using denaturing elution with sodium dodecyl sulfate (SDS), but this leads to sample contamination with Strep-Tactin released from the resin, making the assay incompatible with downstream proteomic analysis. To overcome this limitation, we have developed a method whereby resin-coupled tetramer of Strep-Tactin is first stabilized by covalent cross-linking with Bis(sulfosuccinimidyl) suberate (BS3) and the resulting cross-linked resin is then used to purify target protein complexes in a single batch purification step. Efficient elution with SDS ensures good protein recovery, while the absence of contaminating Strep-Tactin allows downstream protein analysis by mass spectrometry. As a proof of concept, we describe here a protocol for purification of SIII-tagged viral protein VPg-Pro from nuclei of virus-infected N. benthamiana plants using the Strep-Tactin polymethacrylate resin cross-linked with BS3. The same protocol can be used to purify any twin-Strep-tagged protein of interest and characterize its physiological binding partners.

One-step Purification of Twin-Strep-tagged Proteins and Their Complexes on Strep-Tactin Resin Cross-linked With Bissulfosuccinimidyl Suberate BS3

A method is described for efficient purification of twin-Strep-tagged fusion proteins and their specific complexes on modified streptavidin (Strep-Tactin) resin covalently cross-linked with Bis(sulfosuccinimidyl) suberate (BS3). The method has the advantages of fast speed, good target protein recovery and high purity, and is compatible with subsequent analysis by mass spectrometry.

Affinity purification of Strep-tagged fusion proteins on resins carrying an engineered streptavidin (Strep-Tactin) has become a widely used method for ...

Phosphopeptide Analysis of Rodent Epididymal Spermatozoa

Spermatozoa are quite unique amongst cell types. Although produced in the testis, both nuclear gene transcription and translation are switched off once the pre-cursor round cell begins to elongate and differentiate into what is morphologically recognized as a spermatozoon. However, the spermatozoon is very immature, having no ability for motility or egg recognition. Both of these events occur once the spermatozoa transit a secondary organ known as the epididymis. During the ~12 day passage that it takes for a sperm cell to pass through the epididymis, post-translational modifications of existing proteins play a pivotal role in the maturation of the cell. One major facet of such is protein phosphorylation. In order to characterize phosphorylation events taking place during sperm maturation, both pure sperm cell populations and pre-fractionation of phosphopeptides must be established. Using back flushing techniques, a method for the isolation of pure spermatozoa of high quality and yield from the distal or caudal epididymides is outlined. The steps for solubilization, digestion, and pre-fractionation of sperm phosphopeptides through TiO2 affinity chromatography are explained. Once isolated, phosphopeptides can be injected into MS to identify both protein phosphorylation events on specific amino acid residues and quantify the levels of phosphorylation taking place during the sperm maturation processes.

Proteomic analysis of any cell type is highly dependent on both purity and pre-fractionation of the starting material in order to de-complexify the sample prior to liquid chromatography mass spectrometry (MS). By using back-flushing techniques, pure spermatozoa can be obtained from rodents. Following digestion, phosphopeptides can be enriched using TiO2.

Spermatozoa are quite unique amongst cell types. Although produced in the testis, both nuclear gene transcription and translation are switched off once ...

A Hydroponic Co-cultivation System for Simultaneous and Systematic Analysis of Plant/Microbe Molecular Interactions and Signaling

An experimental design mimicking natural plant-microbe interactions is very important to delineate the complex plant-microbe signaling processes. Arabidopsis thaliana-Agrobacterium tumefaciens provides an excellent model system to study bacterial pathogenesis and plant interactions. Previous studies of plant-Agrobacterium interactions have largely relied on plant cell suspension cultures, the artificial wounding of plants, or the artificial induction of microbial virulence factors or plant defenses by synthetic chemicals. However, these methods are distinct from the natural signaling in planta, where plants and microbes recognize and respond in spatial and temporal manners. This work presents a hydroponic cocultivation system where intact plants are supported by metal mesh screens and cocultivated with Agrobacterium. In this cocultivation system, no synthetic phytohormone or chemical that induces microbial virulence or plant defense is supplemented. The hydroponic cocultivation system closely resembles natural plant-microbe interactions and signaling homeostasis in planta. Plant roots can be separated from the medium containing Agrobacterium, and the signaling and responses of both the plant hosts and the interacting microbes can be investigated simultaneously and systematically. At any given timepoint/interval, plant tissues or bacteria can be harvested separately for various &#34;omics&#34; analyses, demonstrating the power and efficacy of this system. The hydroponic cocultivation system can be easily adapted to study: 1) the reciprocal signaling of diverse plant-microbe systems, 2) signaling between a plant host and multiple microbial species (i.e.&#160;microbial consortia or microbiomes), 3) how nutrients and chemicals are implicated in plant-microbe signaling, and 4) how microbes interact with plant hosts and contribute to plant tolerance to biotic or abiotic stresses.

The described hydroponic cocultivation system supports intact plants with metal mesh screens and cocultivates them with bacteria. Plant tissue, bacteria, and secreted molecules can then be separately harvested for downstream analyses, simultaneously allowing for the molecular responses of both plant hosts and interacting microbes or microbiomes to be investigated.

An experimental design mimicking natural plant-microbe interactions is very important to delineate the complex plant-microbe signaling processes. ...

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

CMAH (cytidine monophosphate-N-acetylneuraminic acid hydroxylase) is responsible for the oxidation of cytidine monophosphate-N-acetylneuraminic acids in mammals. However, humans cannot oxidize cytidine monophosphate-N-acetylneuraminic acid to cytidine monophosphate-N-glycolylneuraminic acid due to a primary exon deletion of the CMAH gene. To understand the effects and implications of the lack of CMAH activity in more detail, a Cmah knock-out model in mice is of keen interest in basic and applied research. The analysis method to determine the phenotype of this mouse model is herein described in detail, and is based on the detection of both N-acetylneuraminic acid and N-glycolylenuraminic acid in the liver and milk of wild-type and Cmah knock-out mice. Endogenous sialic acids are released and derivatized with o-phenylenediamine to generate fluorogenic derivatives, which can be subsequently analyzed by HPLC. The presented protocol can be also applied for the analysis of milk and tissue samples from various other origins, and may be of use to investigate the nutritional and health effects of N-glycolylneuraminic acid.

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

We describe a HPLC-based method for the determination of N-acetylneuraminic acid and N-glycolylenuraminic acid in mouse liver and milk.

CMAH (cytidine monophosphate-N-acetylneuraminic acid hydroxylase) is responsible for the oxidation of cytidine monophosphate-N-acetylneuraminic acids in ...

Laboratory Protocol for Genetic Gut Content Analyses of Aquatic Macroinvertebrates Using Group-specific rDNA Primers

Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the invasion of non-indigenous species. However, an exact identification of field predator-prey interactions is difficult in many cases. These analyses are often based on a visual evaluation of gut content or the analysis of stable isotope ratios (&#948;15N and &#948;13C). Such methods require comprehensive knowledge about, respectively, morphologic diversity or isotopic signature from individual prey organisms, leading to obstacles in the exact identification of prey organisms. Visual gut content analyses especially underestimate soft bodied prey organisms, because maceration, ingestion and digestion of prey organisms make identification of specific species difficult. Hence, polymerase chain reaction (PCR) based strategies, for example the use of group-specific primer sets, provide a powerful tool for the investigation of food web interactions. Here, we describe detailed protocols to investigate the gut contents of macroinvertebrate consumers from the field using group-specific primer sets for nuclear ribosomal deoxyribonucleic acid (rDNA). DNA can be extracted either from whole specimens (in the case of small taxa) or out of gut contents of specimens collected in the field. Presence and functional efficiency of the DNA templates need to be confirmed directly from the tested individual using universal primer sets targeting the respective subunit of DNA. We also demonstrate that consumed prey can be determined further down to species level via PCR with unmodified group-specific primers combined with subsequent single strand conformation polymorphism (SSCP) analyses using polyacrylamide gels. Furthermore, we show that the use of different fluorescent dyes as labels enables parallel screening for DNA fragments of different prey groups from multiple gut content samples via automated fragment analysis.

Most common gut content analyses of macroinvertebrates are visual. Requiring intense knowledge about morphological diversity of prey organisms, they miss soft bodied prey and, due to strong comminution of prey, are nearly impossible for some organisms, including amphipods. We provide detailed, novel genetic approaches for macroinvertebrate prey identification in the diet of amphipods.

Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the ...

Precise, High-throughput Analysis of Bacterial Growth

Bacterial growth is a central concept in the development of modern microbial physiology, as well as in the investigation of cellular dynamics at the systems level. Recent studies have reported correlations between bacterial growth and genome-wide events, such as genome reduction and transcriptome reorganization. Correctly analyzing bacterial growth is crucial for understanding the growth-dependent coordination of gene functions and cellular components. Accordingly, the precise quantitative evaluation of bacterial growth in a high-throughput manner is required. Emerging technological developments offer new experimental tools that allow updates of the methods used for studying bacterial growth. The protocol introduced here employs a microplate reader with a highly optimized experimental procedure for the reproducible and precise evaluation of bacterial growth. This protocol was used to evaluate the growth of several previously described Escherichia coli strains. The main steps of the protocol are as follows: the preparation of a large number of cell stocks in small vials for repeated tests with reproducible results, the use of 96-well plates for high-throughput growth evaluation, and the manual calculation of two major parameters (i.e., maximal growth rate and population density) representing the growth dynamics. In comparison to the traditional colony-forming unit (CFU) assay, which counts the cells that are cultured in glass tubes over time on agar plates, the present method is more efficient and provides more detailed temporal records of growth changes, but has a stricter detection limit at low population densities. In summary, the described method is advantageous for the precise and reproducible high-throughput analysis of bacterial growth, which can be used to draw conceptual conclusions or to make theoretical observations.

Quantitative evaluation of bacterial growth is essential to understanding microbial physiology as a systems-level phenomenon. A protocol for experimental manipulation and an analytical approach are introduced, allowing for precise, high-throughput analysis of bacterial growth, which is a key subject of interest in systems biology.

Bacterial growth is a central concept in the development of modern microbial physiology, as well as in the investigation of cellular dynamics at the ...

Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples

Summary

Explore More Videos

Chapters in this video

Analyzing Gene Expression from Marine Microbial Communities using Environmental Transcriptomics

Chronic Salmonella Infected Mouse Model

High-Throughput Measurement and Classification of Organic P in Environmental Samples

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

One-step Purification of Twin-Strep-tagged Proteins and Their Complexes on Strep-Tactin Resin Cross-linked With Bis(sulfosuccinimidyl) Suberate (BS3)

Phosphopeptide Analysis of Rodent Epididymal Spermatozoa

A Hydroponic Co-cultivation System for Simultaneous and Systematic Analysis of Plant/Microbe Molecular Interactions and Signaling

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

Laboratory Protocol for Genetic Gut Content Analyses of Aquatic Macroinvertebrates Using Group-specific rDNA Primers

Precise, High-throughput Analysis of Bacterial Growth