The authors gratefully acknowledge support from award FA9550-13-1-0108 from the Air Force Office of Scientific Research of the USA. The authors additionally acknowledge support from award N00014-15-1-2502 from the Office of Naval Research of the USA, funding from the Institute for Critical Technology and Applied Science at Virginia Polytechnic Institute and State University, and from the National Science Foundation Graduate Research Fellowship Program, award number 1607310.

<ol>
	<li>Zhang, R., Heyde, K. C., Scott, F. Y., Paek, S. -. H., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programming+Surface+Chemistry+with+Engineered+Cells.">Programming Surface Chemistry with Engineered Cells.</a> ACS Synth. Biol. , (2016).</li><li>Zhou, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reduced+graphene+oxide+films+used+as+matrix+of+MALDI-TOF-MS+for+detection+of+octachlorodibenzo-p-dioxin.">Reduced graphene oxide films used as matrix of MALDI-TOF-MS for detection of octachlorodibenzo-p-dioxin.</a> Chem. Commun. 46, 6974-6976 (2010).</li><li>Pardee, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Low-Cost+Detection+of+Zika+Virus+Using+Programmable+Biomolecular+Components.">Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components.</a> Cell. 165, 1255-1266 (2016).</li><li>B&#228;hring, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+Sensing+Properties+of+a+Self-Assembled+Supramolecular+Oligomer.">Design and Sensing Properties of a Self-Assembled Supramolecular Oligomer.</a> Chem. Eur. J. 22, 1958-1967 (2016).</li><li>Nicolau Jr, D. V., Armitage, J. P., Maini, P. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directional+persistence+and+the+optimality+of+run-and-tumble+chemotaxis.">Directional persistence and the optimality of run-and-tumble chemotaxis.</a> Comp. Biol. Chem. 33, 269-274 (2009).</li><li>Du, J., Shao, Z., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+microbial+factories+for+synthesis+of+value-added+products.">Engineering microbial factories for synthesis of value-added products.</a> J. Ind. Microbiol. Biotechnol. 38, 873-890 (2011).</li><li>Kim, H., Kim, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electric+Field+Control+of+Bacteria-Powered+Microrobots+Using+a+Static+Obstacle+Avoidance+Algorithm.">Electric Field Control of Bacteria-Powered Microrobots Using a Static Obstacle Avoidance Algorithm.</a> IEEE Trans. Rob. 32, 125-137 (2016).</li><li>Gardner, T. S., Cantor, C. R., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+a+genetic+toggle+switch+in+Escherichia+coli.">Construction of a genetic toggle switch in Escherichia coli.</a> Nature. 403, 339-342 (2000).</li><li>Heyde, K. C., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+Host-Microbiome+Interactions+using+an+in+Silico+Model+of+Biomimetic+Robots+and+Engineered+Living+Cells.">Exploring Host-Microbiome Interactions using an in Silico Model of Biomimetic Robots and Engineered Living Cells.</a> Sci. Rep. 5, 11988 (2015).</li><li>Rice, M. K., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Creating+biological+nanomaterials+using+synthetic+biology.">Creating biological nanomaterials using synthetic biology.</a> Sci. Tech. Adv. Mater. 15, 014401 (2014).</li><li>Green, N. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin.+3.+The+nature+of+the+biotin-binding+site.">Avidin. 3. The nature of the biotin-binding site.</a> Biochem. J. 89, 599-609 (1963).</li><li>Mesulam, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tetramethyl+benzidine+for+horseradish+peroxidase+neurohistochemistry:+a+non-carcinogenic+blue+reaction+product+with+superior+sensitivity+for+visualizing+neural+afferents+and+efferents.">Tetramethyl benzidine for horseradish peroxidase neurohistochemistry: a non-carcinogenic blue reaction product with superior sensitivity for visualizing neural afferents and efferents.</a> J Histochem. Cytochem. 26, 106-117 (1978).</li><li>Litcofsky, K. D., Afeyan, R. B., Krom, R. J., Khalil, A. S., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iterative+plug-and-play+methodology+for+constructing+and+modifying+synthetic+gene+networks.">Iterative plug-and-play methodology for constructing and modifying synthetic gene networks.</a> Nat. Meth. 9, 1077-1080 (2012).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+Chemical+Synthesis,+Assembly,+and+Cloning+of+a+Mycoplasma+genitalium+Genome.">Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome.</a> Science. 319, 1215-1220 (2008).</li><li>Diamandis, E. P., Christopoulos, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biotin-(strept)avidin+system:+principles+and+applications+in+biotechnology.">The biotin-(strept)avidin system: principles and applications in biotechnology.</a> Clin. Chem. 37, 625-636 (1991).</li><li>Nerurkar, L. S., Namba, M., Brashears, G., Jacob, A. J., Lee, Y. J., Sever, J., L, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+detection+of+herpes+simplex+virus+in+clinical+specimens+by+use+of+capture+biotin-streptavidin+enzyme-linked+immunosorbent+assay.">Rapid detection of herpes simplex virus in clinical specimens by use of capture biotin-streptavidin enzyme-linked immunosorbent assay.</a> J. Clin. Micro. 20, 109-114 (1984).</li><li>Cui, Y., Wei, Q., Park, H., Lieber, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanowire+Nanosensors+for+Highly+Sensitive+and+Selective+Detection+of+Biological+and+Chemical+Species.">Nanowire Nanosensors for Highly Sensitive and Selective Detection of Biological and Chemical Species.</a> Science. 293, 1289-1292 (2001).</li></ol>

The authors have nothing to disclose.

We have presented a new strategy for interfacing engineered living cells with a functionalized material surface. This was accomplished by developing a cell line capable of synthesizing elevated levels of biotin when induced with IPTG. The elevated levels of biotin may then be used to modify the functionalized surface. The protocols detailed how to engineer the E. coli cell line and how to create two different functionalized surfaces.
Critical steps in this protocol occur throughout the construction of the engineered cell line. To avoid downstream issues, characterizing the engineered cell strains with both growth curves (Figure 2) and fluorescent response (Figure 3) is encouraged. Should procedural issues arise, other molecular cloning strategies, such as PCR extraction and Gibson assembly14, may be substituted for steps where appropriate. For optimizing the biotin yield of the engineered cell line, it is crucial to ensure that a sufficient amount of DTB is provided to the cells. In our studies, we found that 200 ng/mL DTB elicited a substantial and statistically significant increase in biotin production when cells were induced with IPTG. Additionally, successful conjugation of BSA-Biotin, SA-HRP, and Biotin-HRP is crucial for effectively performing and monitoring the indirect and direct control schemes. Take care to avoid unnecessary exposure to light and allow the conjugates to incubate overnight at 4 &#176;C to ensure an effective conjugate is formed.
Our protocol offers advantages over alternative methods15 due to its ability to detect small quantities of biotin that are biologically relevant (pg/mL scale) compared to commercially available biotin detection kits, such as those based on 4&#39;-hydroxyazobenzene-2-carboxylic acid competitive binding strategies. Although using the streptavidin-biotin system is common in biotechnology16,17, our system&#39;s ability to respond to small quantities of biotin allows us to directly link our genetically engineered cell line with the functionalized surface.
One potential limitation of our protocol is the resulting dynamic range of biotin detection. In the indirect and direct control schemes, we are able to detect biotin between 102-103 and 104-106 pg/mL, respectively (Figure 4). Fortunately, the low range of the indirect control scheme allows us to readily detect biotin production from engineered cells. However, the tight band of the indirect control dynamic range limits its ability to sense large changes (100-fold) in biotin concentrations. Altering the dynamic range for both the indirect and direct control schemes would require additional engineering. However, if detection of cell-produced biotin is an issue, preparing dilutions of the biotin supernatant in step 4.6 should allow the researcher to target the dynamic range of the indirect control scheme (Figure 5). We found that a 1:5 dilution of the supernatant allowed us to target the indirect control scheme&#39;s dynamic range effectively. This dilution strategy should alleviate the need to modify the dynamic range directly.
The two-part, cell-material system presented here allows engineered cells to modify the composition of a functionalized surface. Dynamic, living cells can interpret their chemical surroundings to produce a genetic response. By engineering this genetic response to increase biotin production, we can endow engineered living cells with the ability to control and manipulate a functionalized surface. By following the protocols presented, engineered cells are able to act as dynamic sensors, capable of reading, processing, and recording the conditions around them via functionalized interfaces. This technology could impact fields ranging from molecular medicine to analyte detection for environmental remediation.

Here, we report the procedures for developing a programmable substrate capable of responding to a chemical signal from an engineered cell line.1 We do this by creating a biotin-streptavidin interface that responds to biotin produced by synthetically engineered Escherichia coli (E. coli) cells. Previously, programmable surfaces have been engineered for a wide range of applications from toxin detection2 and point-of-care diagnosis3 to defense and security.4 While programmable surfaces can be useful as sensors and actuators, they can be made &#34;smarter&#34; by endowing them with the ability to adapt to different environmental challenges. In contrast, even simple microorganisms, such as E. coli, have inherent adaptability and are capable of responding to challenges with sophisticated and often unexpected solutions. This adaptability has enabled E. coli populations, controlled by their complex gene networks, to cost-effectively seek resources,5 create value-added products,6 and even power micro-scale robotics.7 By coupling the adaptive advantages of living cells with the use of programmable surfaces, we can create a smart substrate capable of responding to different environmental conditions.
Synthetic biology has given researchers new abilities to program the behavior of living organisms. By engineering cells to contain new gene regulatory networks, researchers can design cells that exhibit a range of programmed behaviors.8,9 Beyond basic research, these behaviors may be used for applications such as controlling material assembly and biologically producing value-added products.10 Herein, we detail how we used the tools of synthetic biology to engineer an E. coli strain that synthesizes biotin upon induction. This strain was developed by using restriction enzyme cloning methods to assemble a plasmid, pKE1-lacI-bioB. This plasmid, when transformed into E. coli strain K-12 MG1655, endows cells with the ability to express elevated levels of bioB, an essential enzyme for biotin synthesis. When transformed cells were induced with isopropyl &#946;-D-1-thiogalactopyranoside (IPTG) and provided with a biotin precursor, desthiobiotin (DTB), elevated levels of biotin were produced.
Biotin&#39;s binding interaction with streptavidin is one of the strongest non-covalent bonds found in nature. As such, the biotin-streptavidin interaction is both well-characterized and highly employed in biotechnology.11 Within this manuscript, we present two strategies employing the biotin-streptavidin interaction to sense and detect cell-produced biotin with a functionalized surface. We refer to these contrasting surfaces as &#34;indirect&#34; and &#34;direct&#34; control schemes. In the indirect control scheme, cell-produced biotin competes with biotin that has been conjugated and immobilized on a polystyrene surface for streptavidin binding sites. In addition, the streptavidin is conjugated with horseradish peroxidase (HRP). HRP modifies 3, 3&#39;, 5, 5&#39;-tetramethylbenzidine (TMB), to produce an optical signal,12 which may be monitored by quantifying the spectral absorbance (i.e., optical density) at 450 nm (OD450). Thus, the indirect control scheme allows researchers to measure cell-produced biotin by monitoring the attentuation of the OD450 signal.
The direct control scheme exploits the streptavidin-biotin event by immobilizing streptavidin directly to a material surface and allowing cell-produced biotin and biotinylated HRP to compete for streptavidin binding sites. Again, the relative levels of cell-produced biotin are monitored by measuring an OD450 signal.
Taken together, the engineered cells and functionalized surfaces allow us to control the properties of a programmable surface by inducing networks in living cells. In other words, we have created a system that takes advantage of the adaptability of living organisms and the reliability and specification of an engineered material interface by linking these systems together.

<table><tbody><tr><td>LB Broth, Miller&amp;nbsp;</td><td>Fisher Scientific</td><td>12-795-027</td><td></td></tr><tr><td>Agar</td><td>Fisher Scientific</td><td>BP9744500</td><td></td></tr><tr><td>Carbenicillin&amp;nbsp;</td><td>Fisher Scientific</td><td>BP26481</td><td></td></tr><tr><td>M9, Minimimal Salts, 5x</td><td>Sigma-Aldrich</td><td>M6030</td><td></td></tr><tr><td>Casamino Acids&amp;nbsp;</td><td>Fisher Scientific</td><td>BP1424-100</td><td></td></tr><tr><td>Magnesium Sulfate, Anhydrous</td><td>Fisher Scientific</td><td>M65-500</td><td></td></tr><tr><td>Calcium Chloride, Dihydrate</td><td>Fisher Scientific</td><td>C79-500</td><td></td></tr><tr><td>Dextrose (D-Glucose), Anhydrous</td><td>Fisher Scientific</td><td>D16-1</td><td></td></tr><tr><td>NEB Turbo Cell Line</td><td>New England Biolabs</td><td>C2984l</td><td></td></tr><tr><td>Oligonucleotide Primers</td><td>Thermo Fisher Scientific</td><td>N/A</td><td>25N synthesis, DSL purification</td></tr><tr><td>Q5 High-Fidelity Polymerase</td><td>New England Biolabs</td><td>M0491S</td><td></td></tr><tr><td>Q5 Reaction Buffer</td><td>New England Biolabs</td><td>B9027S</td><td></td></tr><tr><td>dNTP Solution Mix</td><td>New England Biolabs</td><td>N0447S</td><td></td></tr><tr><td>Agarose</td><td>Bioexpress</td><td>E-3120-125</td><td></td></tr><tr><td>Ethidium Bromide, 1%</td><td>Fisher Scientific</td><td>BP1302-10</td><td></td></tr><tr><td>Gel Extraction Kits</td><td>Epoch Biolabs</td><td>2260250</td><td></td></tr><tr><td>GenCatch Plasmid DNA Miniprep Kit</td><td>Epoch Biolabs</td><td>2160250</td><td></td></tr><tr><td>AatII</td><td>New England Biolabs</td><td>R0117S</td><td></td></tr><tr><td>SacII</td><td>New England Biolabs</td><td>R0157S</td><td></td></tr><tr><td>HindIII-HF</td><td>New England Biolabs</td><td>R3104S</td><td></td></tr><tr><td>EcoRI-HF</td><td>New England Biolabs</td><td>R3101S</td><td></td></tr><tr><td>Cutsmart Buffer</td><td>New England Biolabs</td><td>B7204S</td><td></td></tr><tr><td>T4 DNA Ligase</td><td>New England Biolabs</td><td>M0202S</td><td></td></tr><tr><td>T4 DNA Ligase Reaction Buffer</td><td>New England Biolabs</td><td>B0202S</td><td></td></tr><tr><td>ColiRolle Glass Plating Beads&amp;nbsp;</td><td>EMD Millipore</td><td>7101-3</td><td></td></tr><tr><td>Glycerol</td><td>Fisher Scientific</td><td>BP229-1</td><td></td></tr><tr><td>Isopropyl &amp;beta;-D-1-thiogalactopyranoside (IPTG)</td><td>Fisher Scientific</td><td>BP1755-10</td><td></td></tr><tr><td>NHS-Desthiobiotin (DTB)</td><td>Thermo Fisher Scientific</td><td>16129</td><td></td></tr><tr><td>Succinimidyl Trans-4-(maleimidylmethyl) Cyclohexane-1-Carboxylate (SMCC)&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>S1534</td><td></td></tr><tr><td>Dimethyl Sulfoxide (DMSO)&amp;nbsp;</td><td>Fisher Scientific</td><td>BP231-100</td><td></td></tr><tr><td>Succinimidyl 3-(2-pyridyldithio) Propionate (SPDP)&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>S1531</td><td></td></tr><tr><td>NHS-LC-LC-biotin</td><td>Thermo Fisher Scientific</td><td>21343</td><td></td></tr><tr><td>Horseradish Peroxidase (HRP)&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>31490</td><td></td></tr><tr><td>Phosphate Buffered Saline (PBS), 10x Solution</td><td>Fisher Scientific</td><td>BP399500</td><td></td></tr><tr><td>Streptavidin (SA)&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>21145</td><td></td></tr><tr><td>Bovine Serum Albumin (BSA)</td><td>Fisher Scientific</td><td>BP1600-100</td><td></td></tr><tr><td>Dithiothreitol (DTT)</td><td>Fisher Scientific</td><td>BP172-5</td><td></td></tr><tr><td>Ethylenediaminetetaacetic acid (EDTA)&amp;nbsp;</td><td>Fisher Scientific</td><td>S311-500</td><td></td></tr><tr><td>Tween 80&amp;nbsp;</td><td>Fisher Scientific</td><td>T164-500</td><td></td></tr><tr><td>Hydrogen Peroxide</td><td>Fisher Scientific</td><td>H325-4</td><td></td></tr><tr><td>3, 3&#039;, 5, 5&#039;-tetramethylbenzidine (TMB)</td><td>Fisher Scientific</td><td>AC229280050</td><td></td></tr><tr><td>Vivaspin 500 Centrifugal Concentrators&amp;nbsp;</td><td>Viva Products</td><td>VS0192</td><td></td></tr><tr><td>Sodium Acetate, Anhydrous</td><td>Fisher Scientific</td><td>BP333-500</td><td></td></tr><tr><td>96-Well Polystyrene Plates</td><td>Thermo Fisher Scientific</td><td>266120</td><td></td></tr></tbody></table>

using synthetic biology to engineer living cells that interface with programmable materials

We have developed an abiotic-biotic interface that allows engineered cells to control the material properties of a functionalized surface. This system is made by creating two modules: a synthetically engineered strain of E. coli cells and a functionalized material interface. Within this paper, we detail a protocol for genetically engineering selected behaviors within a strain of E. coli using molecular cloning strategies. Once developed, this strain produces elevated levels of biotin when exposed to a chemical inducer. Additionally, we detail protocols for creating two different functionalized surfaces, each of which is able to respond to cell-synthesized biotin. Taken together, we present a methodology for creating a linked, abiotic-biotic system that allows engineered cells to control material composition and assembly on nonliving substrates.

Representative results are presented in the accompanying five figures. First, we present the cloning process graphically (Figure 1) so that the reader can visually follow the critical steps for creating the synthetically engineered E. coli strain. In order to characterize the population dynamics of the cells, we provide a growth curve (Figure 2) generated by measuring the optical density at 600 nm (OD600) of the population. Then, we show how the regulatory gene network is verified, by using mCherry as a proxy for bioB (Figure 3), allowing us to optically measure the relative amount of bioB that would be produced by the cell upon induction with IPTG. Next, we present response data for the indirect-control and direct-control functionalized surfaces. These data plots (Figure 4) were developed by using measured solutions of free biotin to characterize the functionalized surfaces&#39; response profiles. Finally, we present characteristic data showing how the engineered cells are induced to produce biotin (Figure 5), thereby modifying the functionalized surfaces.
<img alt="Figure 1" src="/files/ftp_upload/55300/55300fig1.jpg" /> 
Figure 1: Design and Construction of Inducible, Engineered Cells. (A) Primers were designed to isolate the bioB gene from the E. coli genome, which encodes a crucial enzyme in the biotin synthesis pathway. (B) The PL,tetO-1-lacI and Ptrc-2 sequences can be isolated from a plasmid containing a genetic toggle switch with corresponding primers. (C) The extracted bioB gene and the two fragments from the toggle switch can then be used to create the gene circuit. The addition of IPTG can then induce the expression of bioB and thereby biotin synthesis when DTB is added as a substrate for bioB. (D) The assembled plasmid was transformed into K-12 MG1655 E. coli. This caused the presence of IPTG to induce the expression of bioB and thereby biotin synthesis by the engineered cell line when DTB was provided as a substrate. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/55300/55300fig2.jpg" /> 
Figure 2: Growth Curves for Engineered Cells. The engineered, inducible MG1655 wild-type cells were grown and monitored in minimal media (i.e., biotin-free M9 media), as well as minimal media supplemented with DTB (200 ng/mL) and/or IPTG (0.5 mM). The plots show the OD600 reading, measured every 5 min for 24 h. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/55300/55300fig3.jpg" /> 
Figure 3: Testing the Engineered Gene Network. The fluorescent protein mCherry was used in place of the bioB gene so that we could optically measure the induction profile when engineered cells were induced with IPTG. We contrast the cells induced with IPTG (red diamonds) with the cells not induced with IPTG (blue diamonds). These results demonstrate the efficacy of the inducible gene network. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" src="/files/ftp_upload/55300/55300fig4.jpg" /> 
Figure 4: Verification of the Functionalized Material Interface. By exposing our functionalized surface to varying concentrations of biotin, we are able to measure the optical response by measuring OD450 absorbance. These results allow us to generate a calibration curve, linking the concentration of biotin to the optical intensity of the response. Here, we present the biotin vs. optical signal curves for both the indirect (left) and direct (right) functionalized surface schemes. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" src="/files/ftp_upload/55300/55300fig5.jpg" /> 
Figure 5: Engineered Cells Control Material Interface. By utilizing protocol sections 5 or 6, we are able to use the products of induced, engineered cells to chemically modify the functionalized surface. We can monitor these responses optically by measuring OD450. Furthermore, by using the calibration curve developed in Figure 4, we can link the optical intensity of the response to the biotin within the concentration. We present here the different biotin concentrations, measured by our indirect control scheme functionalized surface, for wild-type cells (white), uninduced cells containing the pKE1-lacI-bioB plasmid (orange), and induced cells containing the pKE1-lacI-bioB plasmid (grey). <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Chemical</td>
			<td>Final Concentration</td>
			<td>Amount&#160;</td>
		</tr>
		<tr>
			<td>5x M9 salts&#160;</td>
			<td>1x</td>
			<td>20 mL</td>
		</tr>
		<tr>
			<td>1 M MgSO4</td>
			<td>2 mM</td>
			<td>200 &#956;L</td>
		</tr>
		<tr>
			<td>1 M CaCl2</td>
			<td>0.1 mM</td>
			<td>10 &#956;L</td>
		</tr>
		<tr>
			<td>20% glucose</td>
			<td>0.40%</td>
			<td>2 mL</td>
		</tr>
		<tr>
			<td>2% biotin-free Casamino acid&#160;</td>
			<td>0.02%</td>
			<td>1 mL</td>
		</tr>
		<tr>
			<td>DI Water</td>
			<td>N/A</td>
			<td>76.8 mL</td>
		</tr>
	</tbody>
</table>
Table 1: M9 Media Recipe.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Name</td>
			<td colspan="2">Primer Sequence&#160;</td>
			<td>Usage</td>
		</tr>
		<tr>
			<td>1-f</td>
			<td colspan="2">CCGCCGGAATTCTCCCTATCAGTGATAGAGATT</td>
			<td>lacI cassette extraction</td>
		</tr>
		<tr>
			<td>1-r</td>
			<td colspan="2">CCGACGTCTCACTGCCCGCTTTCCAGTC</td>
			<td>lacI cassette extraction</td>
		</tr>
		<tr>
			<td>nBioB1-f</td>
			<td colspan="2">CCCAAGCTTCTGAAATGAGCTGTTGACAATTAATCAT</td>
			<td>Ptrc-2 extraction</td>
		</tr>
		<tr>
			<td>nBioB1-r</td>
			<td colspan="2">GGGGGGTTCTTTTAATAAAGGTACCGTGTGAAATTGTT</td>
			<td>Ptrc-2 extraction</td>
		</tr>
		<tr>
			<td>nBioB2-f1</td>
			<td colspan="2">ACCCCCCTAAGGAGGTCATCATGGCTCACCGCCCACG</td>
			<td>bioB extraction</td>
		</tr>
		<tr>
			<td>nBioB2-r</td>
			<td colspan="2">TCCCCGCGGTCATAATGCTGCCGCGTTGTAATATTC</td>
			<td>bioB extraction</td>
		</tr>
		<tr>
			<td>nBioB2-f2</td>
			<td colspan="2">ACGGTACCTTTATTAAAAGAACCCCCCTAAGGAGGTCATC</td>
			<td>Synthetic RBS addition</td>
		</tr>
	</tbody>
</table>
Table 2: List of Primers.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Step 1</td>
			<td>Step 2</td>
			<td>Step 3</td>
			<td>Step 4</td>
			<td>Step 5</td>
			<td>Step 6</td>
			<td>Step 7</td>
			<td>Step 8</td>
			<td>Step 9</td>
		</tr>
		<tr>
			<td>98&#176;C</td>
			<td>98&#176;C</td>
			<td>70&#176;C</td>
			<td>72&#176;C</td>
			<td>98&#176;C</td>
			<td>60&#176;C</td>
			<td>72&#176;C</td>
			<td>72&#176;C</td>
			<td>4&#176;C</td>
		</tr>
		<tr>
			<td>0:30</td>
			<td>0:10</td>
			<td>0:30</td>
			<td>01:00/kb</td>
			<td>0:10</td>
			<td>0:30</td>
			<td>01:00/kb</td>
			<td>2:00</td>
			<td>&#8734;</td>
		</tr>
		<tr>
			<td rowspan="2"></td>
			<td colspan="3">Repeat 12 times</td>
			<td colspan="3" rowspan="2">Repeat 25 times</td>
			<td colspan="2" rowspan="2"></td>
		</tr>
		<tr>
			<td colspan="3">-1&#176;C / cycle</td>
		</tr>
	</tbody>
</table>
Table 3: PCR Program.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Volume&#160;</td>
		</tr>
		<tr>
			<td>Cell Lysate (template)</td>
			<td>10 &#956;L</td>
		</tr>
		<tr>
			<td>Primer (each)</td>
			<td>0.625 &#956;L (each)</td>
		</tr>
		<tr>
			<td>5x Q5 buffer</td>
			<td>5 &#956;L</td>
		</tr>
		<tr>
			<td>Q5 Polymerase</td>
			<td>0.25 &#956;L</td>
		</tr>
		<tr>
			<td>dNTP Mix</td>
			<td>0.5 &#956;L</td>
		</tr>
		<tr>
			<td>DI Water</td>
			<td>6.75 &#956;L</td>
		</tr>
	</tbody>
</table>
Table 4: Whole Cell PCR Reaction (25 &#181;L).
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Volume&#160;</td>
		</tr>
		<tr>
			<td>10x&#160; Reaction buffer</td>
			<td>5 &#181;L</td>
		</tr>
		<tr>
			<td>Enzyme 1</td>
			<td>1 &#956;L</td>
		</tr>
		<tr>
			<td>Enzyme 2</td>
			<td>1 &#956;L</td>
		</tr>
		<tr>
			<td>Template DNA</td>
			<td>1 &#181;g</td>
		</tr>
		<tr>
			<td>DI Water</td>
			<td>43 &#181;L &#8211; volume of DNA</td>
		</tr>
	</tbody>
</table>
Table 5: Restriction Enzyme Digestion Reaction (50 &#181;L).
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Volume&#160;</td>
		</tr>
		<tr>
			<td>DNA</td>
			<td>50 &#956;g vector + X &#956;g insert</td>
		</tr>
		<tr>
			<td>10x Ligase Buffer</td>
			<td>1 &#956;L</td>
		</tr>
		<tr>
			<td>T4 Ligase</td>
			<td>1 &#956;L</td>
		</tr>
		<tr>
			<td>DI Water</td>
			<td>8 &#181;L &#8211; volume of DNA</td>
		</tr>
	</tbody>
</table>
Table 6: Ligation Reaction (10 &#181;L).
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Concentration</td>
			<td>Notes</td>
		</tr>
		<tr>
			<td>CaCl2</td>
			<td>100 mM</td>
			<td></td>
		</tr>
		<tr>
			<td>Carbeniccilin</td>
			<td>50 mg/mL (1000x)</td>
			<td></td>
		</tr>
		<tr>
			<td>DTB</td>
			<td>50 &#956;g/mL</td>
			<td></td>
		</tr>
		<tr>
			<td>IPTG</td>
			<td>0.5 M</td>
			<td></td>
		</tr>
		<tr>
			<td>SMCC</td>
			<td>20 mg/mL</td>
			<td>2 mg into 100uL DMSO</td>
		</tr>
		<tr>
			<td>SPDP</td>
			<td>20 mg/mL</td>
			<td>2 mg into 100uL DMSO</td>
		</tr>
		<tr>
			<td>LC-LC-biotin</td>
			<td>20 mg/mL</td>
			<td>2 mg into 100uL DMSO</td>
		</tr>
		<tr>
			<td>HRP</td>
			<td>10 mg/mL</td>
			<td>In PBS</td>
		</tr>
		<tr>
			<td>SA (indirect)</td>
			<td>10 mg/mL</td>
			<td>In PBS</td>
		</tr>
		<tr>
			<td>SA (direct)</td>
			<td>0.17 &#956;g/mL</td>
			<td>In PBS</td>
		</tr>
		<tr>
			<td>BSA</td>
			<td>20 mg/mL</td>
			<td>In PBS</td>
		</tr>
		<tr>
			<td>DTT</td>
			<td>100mM</td>
			<td>In DI Water</td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>5 mM</td>
			<td>18.6 mg into 10 mL PBS</td>
		</tr>
		<tr>
			<td>Casein</td>
			<td>0.50%</td>
			<td>In PBS</td>
		</tr>
		<tr>
			<td>Tween 80</td>
			<td>20%</td>
			<td>In DI Water</td>
		</tr>
		<tr>
			<td>Tween 80 in PBS</td>
			<td>0.05%</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Acetate</td>
			<td>50 mM</td>
			<td>In DI Water, Adjust to 5.1 pH using 3 M HCl</td>
		</tr>
		<tr>
			<td>TMB</td>
			<td>1%</td>
			<td>In DMSO</td>
		</tr>
		<tr>
			<td>H2O2</td>
			<td>3%</td>
			<td>In DI Water</td>
		</tr>
		<tr>
			<td>H2SO4</td>
			<td>2 M</td>
			<td>In DI Water</td>
		</tr>
	</tbody>
</table>
Table 7: List of Reagent Solutions.

Watch this Scientific Journal Video about Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials at JoVE.com

Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials

This paper presents a series of protocols for developing engineered cells and functionalized surfaces that enable synthetically engineered E. coli to control and manipulate programmable material surfaces.

We have developed an abiotic-biotic interface that allows engineered cells to control the material properties of a functionalized surface. This system is ...

using-synthetic-biology-to-engineer-living-cells-that-interface-with

Nanyang Technological University

Research

JoVE Journal

Bioengineering

8.8K Views.  Carnegie Mellon University. This paper presents a series of protocols for developing engineered cells and functionalized surfaces that enable synthetically engineered E. coli to control and manipulate programmable material surfaces.

Video: Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials

Manipulating Living Cells to Construct Stable 3D Cellular Assembly Without Artificial Scaffold

Regenerative medicine and tissue engineering offer several advantages for the treatment of intractable diseases, and several studies have demonstrated the importance of 3-dimensional (3D) cellular assemblies in these fields. Artificial scaffolds have often been used to construct 3D cellular assemblies. However, the scaffolds used to construct cellular assemblies are sometimes toxic and may change the properties of the cells. Thus, it would be beneficial to establish a non-toxic method for facilitating cell-cell contact. In this paper, we introduce a novel method for constructing stable cellular assemblies by using optical tweezers with dextran. One of the advantages of this method is that it establishes stable cell-to-cell contact within a few minutes. This new method allows the construction of 3D cellular assemblies in a natural hydrophilic polymer and is expected to be useful for constructing next-generation 3D single-cell assemblies in the fields of regenerative medicine and tissue engineering.

We demonstrate a novel method for constructing a single-cell-based 3-dimensional (3D) assembly without an artificial scaffold.

Regenerative medicine and tissue engineering offer several advantages for the treatment of intractable diseases, and several studies have demonstrated the ...

Biochemistry

Engineering Intracellular Protein Sensors in Mammalian Cells

Proteins can function as biomarkers of pathological conditions, such as neurodegenerative diseases, infections or metabolic syndromes. Engineering cells to sense and respond to these biomarkers may help the understanding of molecular mechanisms underlying pathologies, as well as to develop new cell-based therapies. While several systems that detect extracellular proteins have been developed, a modular framework that can be easily re-engineered to sense different intracellular proteins was missing.
Here, we describe a protocol to implement a modular genetic platform that senses intracellular proteins and activates a specific cellular response. The device operates on intracellular antibodies or small peptides to sense with high specificity the protein of interest, triggering the transcriptional activation of output genes, through a TEV protease (TEVp)-based actuation module. TEVp is a viral protease that selectively cleaves short cognate peptides and is widely used in biotechnology and synthetic biology for its high orthogonality to the cleavage site. Specifically, we engineered devices that recognize and respond to protein-biomarkers of viral infections and genetic diseases, including mutated huntingtin, NS3 serine-protease, Tat and Nef proteins to detect Huntington&#8217;s disease, hepatitis C virus (HCV) and human immunodeficiency virus (HIV) infections, respectively. Importantly, the system can be hand tailored for the desired input-output functional outcome, such as fluorescent readouts for biosensors, stimulation of antigen presentation for immune response, or initiation of apoptosis to eliminate unhealthy cells.

Here, we present a protocol for engineering genetically-encoded intracellular protein sensor-actuator(s). The device specifically detects target proteins through intracellular antibodies (intrabodies) and responds by switching on gene transcriptional output. A general framework is built to rapidly replace intrabodies, enabling rapid detection of any desired protein, without altering the general architecture.

Proteins can function as biomarkers of pathological conditions, such as neurodegenerative diseases, infections or metabolic syndromes. Engineering cells ...

Genetics

Automated Robotic Liquid Handling Assembly of Modular DNA Devices

Recent advances in modular DNA assembly techniques have enabled synthetic biologists to test significantly more of the available &#34;design space&#34; represented by &#34;devices&#34; created as combinations of individual genetic components. However, manual assembly of such large numbers of devices is time-intensive, error-prone, and costly. The increasing sophistication and scale of synthetic biology research necessitates an efficient, reproducible way to accommodate large-scale, complex, and high throughput device construction.
Here, a DNA assembly protocol using the Type-IIS restriction endonuclease based Modular Cloning (MoClo) technique is automated on two liquid-handling robotic platforms. Automated liquid-handling robots require careful, often times tedious optimization of pipetting parameters for liquids of different viscosities (e.g. enzymes, DNA, water, buffers), as well as explicit programming to ensure correct aspiration and dispensing of DNA parts and reagents. This makes manual script writing for complex assemblies just as problematic as manual DNA assembly, and necessitates a software tool that can automate script generation. To this end, we have developed a web-based software tool, http://mocloassembly.com, for generating combinatorial DNA device libraries from basic DNA parts uploaded as Genbank files. We provide access to the tool, and an export file from our liquid handler software which includes optimized liquid classes, labware parameters, and deck layout. All DNA parts used are available through Addgene, and their digital maps can be accessed via the Boston University BDC ICE Registry. Together, these elements provide a foundation for other organizations to automate modular cloning experiments and similar protocols.
The automated DNA assembly workflow presented here enables the repeatable, automated, high-throughput production of DNA devices, and reduces the risk of human error arising from repetitive manual pipetting. Sequencing data show the automated DNA assembly reactions generated from this workflow are ~95% correct and require as little as 4% as much hands-on time, compared to manual reaction preparation.

Here, an automated workflow to perform modular DNA &#34;device&#34; assembly using a modular cloning DNA assembly method on liquid-handling robots is presented. The protocol uses an intuitive software tool for generating liquid handler picklists for combinatorial DNA device library generation, which we demonstrate using two liquid handling platforms.

Recent advances in modular DNA assembly techniques have enabled synthetic biologists to test significantly more of the available &#34;design space&#34; ...

CFPS Protocols for Micro-Compartmentalized Synthetic Cells

Cell-Free Protein Synthesis System for Building Synthetic Cells

The Cell-Free Protein Synthesis (CFPS) system has been widely employed to facilitate the bottom-up assembly of synthetic cells. It serves as the host for the core machinery of the Central Dogma, standing as an optimal chassis for the integration and assembly of diverse artificial cellular mimicry systems. Despite its frequent use in the fabrication of synthetic cells, establishing a tailored and robust CFPS system for a specific application remains a nontrivial challenge. In this methods paper, we present a comprehensive protocol for the CFPS system, routinely employed in constructing synthetic cells. This protocol encompasses key stages in the preparation of the CFPS system, including the cell extract, template preparation, and routine expression optimization utilizing a fluorescent reporter protein. Additionally, we show representative results by encapsulating the CFPS system within various micro-compartments, such as monolayer droplets, double-emulsion vesicles, and chambers situated atop supported lipid bilayers. Finally, we elucidate the critical steps and conditions necessary for the successful assembly of these CFPS systems in distinct environments. We expect that our approach will facilitate the establishment of good working practices among various laboratories within the continuously expanding synthetic cell community, thereby accelerating progress in the field of synthetic cell development.

Author Spotlight: Optimizing CFPS Systems for Synthetic Cell Construction

This protocol describes the Cell-Free Protein Synthesis (CFPS) system used in constructing synthetic cells. It outlines key stages with representative results in different micro-compartments. The protocol aims to establish best practices for diverse laboratories in the synthetic cell community, advancing progress in synthetic cell development.

The Cell-Free Protein Synthesis (CFPS) system has been widely employed to facilitate the bottom-up assembly of synthetic cells. It serves as the host for ...

Functional Surface-immobilization of Genes Using Multistep Strand Displacement Lithography

Immobilization of genes on lithographically structured surfaces allows the study of compartmentalized gene expression processes in an open microfluidic bioreactor system. In contrast to other approaches towards artificial cellular systems, such a setup allows for a continuous supply with gene expression reagents and simultaneous draining of waste products. This facilitates the implementation of cell-free gene expression processes over extended periods of time, which is important for the realization of dynamic gene regulatory feedback systems. Here we provide a detailed protocol for the fabrication of genetic biochips using a simple-to-use lithographic technique based on DNA strand displacement reactions, which exclusively uses commercially available components. We also provide a protocol on the integration of compartmentalized genes with a polydimethylsiloxane (PDMS)-based microfluidic system. Furthermore, we show that the system is compatible with total internal reflection fluorescence (TIRF) microscopy, which can be used for the direct observation of molecular interactions between DNA and molecules contained in the expression mix.

We describe a simple lithographic procedure for the immobilization of gene-length DNA molecules on a surface, which can be used to perform cell-free gene expression experiments on biochips.

Immobilization of genes on lithographically structured surfaces allows the study of compartmentalized gene expression processes in an open microfluidic ...

A Multilayer Microfluidic Platform for the Conduction of Prolonged Cell-Free Gene Expression

The limitations of cell-based synthetic biology are becoming increasingly apparent as researchers aim to develop larger and more complex synthetic genetic regulatory circuits. The analysis of synthetic genetic regulatory networks in vivo is time consuming and suffers from a lack of environmental control, with exogenous synthetic components interacting with host processes resulting in undesired behavior. To overcome these issues, cell-free characterization of novel circuitry is becoming more prevalent. In vitro transcription and translation (IVTT) mixtures allow the regulation of the experimental environment and can be optimized for each unique system. The protocols presented here detail the fabrication of a multilayer microfluidic device that can be utilized to sustain IVTT reactions for prolonged durations. In contrast to batch reactions, where resources are depleted over time and (by-) products accumulate, the use of microfluidic devices allows the replenishment of resources as well as the removal of reaction products. In this manner, the cellular environment is emulated by maintaining an out-of-equilibrium environment in which the dynamic behavior of gene circuits can be investigated over extended periods of time. To fully exploit the multilayer microfluidic device, hardware and software have been integrated to automate the IVTT reactions. By combining IVTT reactions with the microfluidic platform presented here, it becomes possible to comprehensively analyze complex network behaviors, furthering our understanding of the mechanisms that regulate cellular processes.

The fabrication process of a PDMS-based, multilayer, microfluidic device that allows in vitro transcription and translation (IVTT) reactions to be performed over prolonged periods is described. Furthermore, a comprehensive overview of the hardware and software required to automate and maintain these reactions for prolonged durations is provided.

The limitations of cell-based synthetic biology are becoming increasingly apparent as researchers aim to develop larger and more complex synthetic genetic ...

Preparing Protein Producing Synthetic Cells using Cell Free Bacterial Extracts, Liposomes and Emulsion Transfer

The bottom-up assembly approach for construction of synthetic cells is an effective tool for isolating and investigating cellular processes in a cell mimicking environment. Furthermore, the development of cell-free expression systems has demonstrated the ability to reconstitute the protein production, transcription and translation processes (DNA&#8594;RNA&#8594;protein) in a controlled manner, harnessing synthetic biology. Here we describe a protocol for preparing a cell-free expression system, including the production of a potent bacterial lysate and encapsulating this lysate inside cholesterol-rich lipid-based giant unilamellar vesicles (GUVs) (i.e., stable liposomes), to form synthetic cells. The protocol describes the methods for preparing the components of the synthetic cells including the production of active bacterial lysates, followed by a detailed step-by-step preparation of the synthetic cells based on a water-in-oil emulsion transfer method. These facilitate the production of millions of synthetic cells in a simple and affordable manner with a high versatility for producing different types of proteins. The obtained synthetic cells can be used to investigate protein/RNA production and activity in an isolated environment, in directed evolution, and also as a controlled drug delivery platform for on-demand production of therapeutic proteins inside the body.

This protocol describes the method, materials, equipment and steps for bottom-up preparation of RNA and protein producing synthetic cells. The inner aqueous compartment of the synthetic cells contained the S30 bacterial lysate encapsulated within a lipid bilayer (i.e., stable liposomes), using a water-in-oil emulsion transfer method.

The bottom-up assembly approach for construction of synthetic cells is an effective tool for isolating and investigating cellular processes in a cell ...

Simple, Affordable, and Modular Patterning of Cells using DNA

The relative positioning of cells is a key feature of the microenvironment that organizes cell-cell interactions. To study the interactions between cells of the same or different type, micropatterning techniques have proved useful. DNA Programmed Assembly of Cells (DPAC) is a micropatterning technique that targets the adhesion of cells to a substrate or other cells using DNA hybridization. The most basic operations in DPAC begin with decorating cell membranes with lipid-modified oligonucleotides, then flowing them over a substrate that has been patterned with complementary DNA sequences. Cells adhere selectively to the substrate only where they find a complementary DNA sequence. Non-adherent cells are washed away, revealing a pattern of adherent cells. Additional operations include further rounds of cell-substrate or cell-cell adhesion, as well as transferring the patterns formed by DPAC to an embedding hydrogel for long-term culture. Previously, methods for patterning oligonucleotides on surfaces and decorating cells with DNA sequences required specialized equipment and custom DNA synthesis, respectively. We report an updated version of the protocol, utilizing an inexpensive benchtop photolithography setup and commercially available cholesterol modified oligonucleotides (CMOs) deployed using a modular format. CMO-labeled cells adhere with high efficiency to DNA-patterned substrates. This approach can be used to pattern multiple cell types at once with high precision and to create arrays of microtissues embedded within an extracellular matrix. Advantages of this method include its high resolution, ability to embed cells into a three-dimensional microenvironment without disrupting the micropattern, and flexibility in patterning any cell type.

Here we present a protocol to micropattern cells at single-cell resolution using DNA-programmed adhesion. This protocol uses a benchtop photolithography platform to create patterns of DNA oligonucleotides on a glass slide and then labels cell membranes with commercially available complementary oligonucleotides. Hybridization of the oligos results in programmed cell adhesion.

The relative positioning of cells is a key feature of the microenvironment that organizes cell-cell interactions. To study the interactions between cells ...

Rapid Characterization of Genetic Parts with Cell-Free Systems

Characterizing and cataloging genetic parts are critical to the design of useful genetic circuits. Having well-characterized parts allows for the fine-tuning of genetic circuits, such that their function results in predictable outcomes. With the growth of synthetic biology as a field, there has been an explosion of genetic circuits that have been implemented in microbes to execute functions pertaining to sensing, metabolic alteration, and cellular computing. Here, we show a rapid and cost-effective method for characterizing genetic parts. Our method utilizes cell-free lysate, prepared in-house as a medium to evaluate parts via the expression of a reporter protein. Template DNA is prepared by PCR amplification using inexpensive primers to add variant parts to the reporter gene, and the template is added to the reaction as linear DNA without cloning. Parts that can be added in this way include promoters, operators, ribosome binding sites, insulators, and terminators. This approach, combined with the incorporation of an acoustic liquid handler and 384-well plates, allows the user to carry out high-throughput evaluations of genetic parts in a single day. By comparison, cell-based screening approaches require time-consuming cloning and have longer testing times due to overnight culture and culture density normalization steps. Further, working in cell-free lysate allows the user to exact tighter control over the expression conditions through the addition of exogenous components and DNA at precise concentrations. Results obtained from cell-free screening can be used directly in applications of cell-free systems or, in some cases, as a way to predict function in whole cells.

Well-characterized genetic parts are necessary for the design of novel genetic circuits. Here we describe a cost-effective, high-throughput method for rapidly characterizing genetic parts. Our method reduces cost and time by combining cell-free lysates, linear DNA to avoid cloning, and acoustic liquid handling to increase throughput and reduce reaction volumes.

Characterizing and cataloging genetic parts are critical to the design of useful genetic circuits. Having well-characterized parts allows for the ...

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for expressing proteins and genetic circuits in a controlled manner as well as for providing a prototyping environment for synthetic biology.2,3 To achieve the latter goal, cell-free expression systems that preserve endogenous Escherichia coli transcription-translation mechanisms are able to more accurately reflect in vivo cellular dynamics than those based on T7 RNA polymerase transcription. We describe the preparation and execution of an efficient endogenous E. coli based transcription-translation (TX-TL) cell-free expression system that can produce equivalent amounts of protein as T7-based systems at a 98% cost reduction to similar commercial systems.4,5 The preparation of buffers and crude cell extract are described, as well as the execution of a three tube TX-TL reaction. The entire protocol takes five days to prepare and yields enough material for up to 3000 single reactions in one preparation. Once prepared, each reaction takes under 8 hr from setup to data collection and analysis. Mechanisms of regulation and transcription exogenous to E. coli, such as lac/tet repressors and T7 RNA polymerase, can be supplemented.6 Endogenous properties, such as mRNA and DNA degradation rates, can also be adjusted.7 The TX-TL cell-free expression system has been demonstrated for large-scale circuit assembly, exploring biological phenomena, and expression of proteins under both T7- and endogenous promoters.6,8 Accompanying mathematical models are available.9,10 The resulting system has unique applications in synthetic biology as a prototyping environment, or "TX-TL biomolecular breadboard."

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology

This five-day protocol outlines all steps, equipment, and supplemental software necessary for creating and running an efficient endogenous Escherichia coli based TX-TL cell-free expression system from scratch. With reagents, the protocol takes 8 hours or less to setup a reaction, collect, and process data.

Ideal cell-free expression systems can theoretically emulate an in vivo cellular environment in a controlled in vitro platform.1 This is useful for ...

Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials

Summary

Explore More Videos

Chapters in this video

Manipulating Living Cells to Construct Stable 3D Cellular Assembly Without Artificial Scaffold

Engineering Intracellular Protein Sensors in Mammalian Cells

Automated Robotic Liquid Handling Assembly of Modular DNA Devices

Cell-Free Protein Synthesis System for Building Synthetic Cells

Functional Surface-immobilization of Genes Using Multistep Strand Displacement Lithography

A Multilayer Microfluidic Platform for the Conduction of Prolonged Cell-Free Gene Expression

Preparing Protein Producing Synthetic Cells using Cell Free Bacterial Extracts, Liposomes and Emulsion Transfer

Simple, Affordable, and Modular Patterning of Cells using DNA

Rapid Characterization of Genetic Parts with Cell-Free Systems

Protocols for Implementing an Escherichia coli Based TX-TL Cell-Free Expression System for Synthetic Biology