The authors gratefully acknowledge support from award FA9550-13-1-0108 from the Air Force Office of Scientific Research of the USA. The authors additionally acknowledge support from award N00014-15-1-2502 from the Office of Naval Research of the USA, funding from the Institute for Critical Technology and Applied Science at Virginia Polytechnic Institute and State University, and from the National Science Foundation Graduate Research Fellowship Program, award number 1607310.

<ol>
	<li>Zhang, R., Heyde, K. C., Scott, F. Y., Paek, S. -. H., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programming+Surface+Chemistry+with+Engineered+Cells.">Programming Surface Chemistry with Engineered Cells.</a> ACS Synth. Biol. , (2016).</li><li>Zhou, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reduced+graphene+oxide+films+used+as+matrix+of+MALDI-TOF-MS+for+detection+of+octachlorodibenzo-p-dioxin.">Reduced graphene oxide films used as matrix of MALDI-TOF-MS for detection of octachlorodibenzo-p-dioxin.</a> Chem. Commun. 46, 6974-6976 (2010).</li><li>Pardee, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Low-Cost+Detection+of+Zika+Virus+Using+Programmable+Biomolecular+Components.">Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components.</a> Cell. 165, 1255-1266 (2016).</li><li>B&#228;hring, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+Sensing+Properties+of+a+Self-Assembled+Supramolecular+Oligomer.">Design and Sensing Properties of a Self-Assembled Supramolecular Oligomer.</a> Chem. Eur. J. 22, 1958-1967 (2016).</li><li>Nicolau Jr, D. V., Armitage, J. P., Maini, P. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directional+persistence+and+the+optimality+of+run-and-tumble+chemotaxis.">Directional persistence and the optimality of run-and-tumble chemotaxis.</a> Comp. Biol. Chem. 33, 269-274 (2009).</li><li>Du, J., Shao, Z., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+microbial+factories+for+synthesis+of+value-added+products.">Engineering microbial factories for synthesis of value-added products.</a> J. Ind. Microbiol. Biotechnol. 38, 873-890 (2011).</li><li>Kim, H., Kim, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electric+Field+Control+of+Bacteria-Powered+Microrobots+Using+a+Static+Obstacle+Avoidance+Algorithm.">Electric Field Control of Bacteria-Powered Microrobots Using a Static Obstacle Avoidance Algorithm.</a> IEEE Trans. Rob. 32, 125-137 (2016).</li><li>Gardner, T. S., Cantor, C. R., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+a+genetic+toggle+switch+in+Escherichia+coli.">Construction of a genetic toggle switch in Escherichia coli.</a> Nature. 403, 339-342 (2000).</li><li>Heyde, K. C., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+Host-Microbiome+Interactions+using+an+in+Silico+Model+of+Biomimetic+Robots+and+Engineered+Living+Cells.">Exploring Host-Microbiome Interactions using an in Silico Model of Biomimetic Robots and Engineered Living Cells.</a> Sci. Rep. 5, 11988 (2015).</li><li>Rice, M. K., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Creating+biological+nanomaterials+using+synthetic+biology.">Creating biological nanomaterials using synthetic biology.</a> Sci. Tech. Adv. Mater. 15, 014401 (2014).</li><li>Green, N. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin.+3.+The+nature+of+the+biotin-binding+site.">Avidin. 3. The nature of the biotin-binding site.</a> Biochem. J. 89, 599-609 (1963).</li><li>Mesulam, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tetramethyl+benzidine+for+horseradish+peroxidase+neurohistochemistry:+a+non-carcinogenic+blue+reaction+product+with+superior+sensitivity+for+visualizing+neural+afferents+and+efferents.">Tetramethyl benzidine for horseradish peroxidase neurohistochemistry: a non-carcinogenic blue reaction product with superior sensitivity for visualizing neural afferents and efferents.</a> J Histochem. Cytochem. 26, 106-117 (1978).</li><li>Litcofsky, K. D., Afeyan, R. B., Krom, R. J., Khalil, A. S., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iterative+plug-and-play+methodology+for+constructing+and+modifying+synthetic+gene+networks.">Iterative plug-and-play methodology for constructing and modifying synthetic gene networks.</a> Nat. Meth. 9, 1077-1080 (2012).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+Chemical+Synthesis,+Assembly,+and+Cloning+of+a+Mycoplasma+genitalium+Genome.">Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome.</a> Science. 319, 1215-1220 (2008).</li><li>Diamandis, E. P., Christopoulos, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biotin-(strept)avidin+system:+principles+and+applications+in+biotechnology.">The biotin-(strept)avidin system: principles and applications in biotechnology.</a> Clin. Chem. 37, 625-636 (1991).</li><li>Nerurkar, L. S., Namba, M., Brashears, G., Jacob, A. J., Lee, Y. J., Sever, J., L, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+detection+of+herpes+simplex+virus+in+clinical+specimens+by+use+of+capture+biotin-streptavidin+enzyme-linked+immunosorbent+assay.">Rapid detection of herpes simplex virus in clinical specimens by use of capture biotin-streptavidin enzyme-linked immunosorbent assay.</a> J. Clin. Micro. 20, 109-114 (1984).</li><li>Cui, Y., Wei, Q., Park, H., Lieber, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanowire+Nanosensors+for+Highly+Sensitive+and+Selective+Detection+of+Biological+and+Chemical+Species.">Nanowire Nanosensors for Highly Sensitive and Selective Detection of Biological and Chemical Species.</a> Science. 293, 1289-1292 (2001).</li></ol>

The authors have nothing to disclose.

We have presented a new strategy for interfacing engineered living cells with a functionalized material surface. This was accomplished by developing a cell line capable of synthesizing elevated levels of biotin when induced with IPTG. The elevated levels of biotin may then be used to modify the functionalized surface. The protocols detailed how to engineer the E. coli cell line and how to create two different functionalized surfaces.
Critical steps in this protocol occur throughout the construction of the engineered cell line. To avoid downstream issues, characterizing the engineered cell strains with both growth curves (Figure 2) and fluorescent response (Figure 3) is encouraged. Should procedural issues arise, other molecular cloning strategies, such as PCR extraction and Gibson assembly14, may be substituted for steps where appropriate. For optimizing the biotin yield of the engineered cell line, it is crucial to ensure that a sufficient amount of DTB is provided to the cells. In our studies, we found that 200 ng/mL DTB elicited a substantial and statistically significant increase in biotin production when cells were induced with IPTG. Additionally, successful conjugation of BSA-Biotin, SA-HRP, and Biotin-HRP is crucial for effectively performing and monitoring the indirect and direct control schemes. Take care to avoid unnecessary exposure to light and allow the conjugates to incubate overnight at 4 &#176;C to ensure an effective conjugate is formed.
Our protocol offers advantages over alternative methods15 due to its ability to detect small quantities of biotin that are biologically relevant (pg/mL scale) compared to commercially available biotin detection kits, such as those based on 4&#39;-hydroxyazobenzene-2-carboxylic acid competitive binding strategies. Although using the streptavidin-biotin system is common in biotechnology16,17, our system&#39;s ability to respond to small quantities of biotin allows us to directly link our genetically engineered cell line with the functionalized surface.
One potential limitation of our protocol is the resulting dynamic range of biotin detection. In the indirect and direct control schemes, we are able to detect biotin between 102-103 and 104-106 pg/mL, respectively (Figure 4). Fortunately, the low range of the indirect control scheme allows us to readily detect biotin production from engineered cells. However, the tight band of the indirect control dynamic range limits its ability to sense large changes (100-fold) in biotin concentrations. Altering the dynamic range for both the indirect and direct control schemes would require additional engineering. However, if detection of cell-produced biotin is an issue, preparing dilutions of the biotin supernatant in step 4.6 should allow the researcher to target the dynamic range of the indirect control scheme (Figure 5). We found that a 1:5 dilution of the supernatant allowed us to target the indirect control scheme&#39;s dynamic range effectively. This dilution strategy should alleviate the need to modify the dynamic range directly.
The two-part, cell-material system presented here allows engineered cells to modify the composition of a functionalized surface. Dynamic, living cells can interpret their chemical surroundings to produce a genetic response. By engineering this genetic response to increase biotin production, we can endow engineered living cells with the ability to control and manipulate a functionalized surface. By following the protocols presented, engineered cells are able to act as dynamic sensors, capable of reading, processing, and recording the conditions around them via functionalized interfaces. This technology could impact fields ranging from molecular medicine to analyte detection for environmental remediation.

Here, we report the procedures for developing a programmable substrate capable of responding to a chemical signal from an engineered cell line.1 We do this by creating a biotin-streptavidin interface that responds to biotin produced by synthetically engineered Escherichia coli (E. coli) cells. Previously, programmable surfaces have been engineered for a wide range of applications from toxin detection2 and point-of-care diagnosis3 to defense and security.4 While programmable surfaces can be useful as sensors and actuators, they can be made &#34;smarter&#34; by endowing them with the ability to adapt to different environmental challenges. In contrast, even simple microorganisms, such as E. coli, have inherent adaptability and are capable of responding to challenges with sophisticated and often unexpected solutions. This adaptability has enabled E. coli populations, controlled by their complex gene networks, to cost-effectively seek resources,5 create value-added products,6 and even power micro-scale robotics.7 By coupling the adaptive advantages of living cells with the use of programmable surfaces, we can create a smart substrate capable of responding to different environmental conditions.
Synthetic biology has given researchers new abilities to program the behavior of living organisms. By engineering cells to contain new gene regulatory networks, researchers can design cells that exhibit a range of programmed behaviors.8,9 Beyond basic research, these behaviors may be used for applications such as controlling material assembly and biologically producing value-added products.10 Herein, we detail how we used the tools of synthetic biology to engineer an E. coli strain that synthesizes biotin upon induction. This strain was developed by using restriction enzyme cloning methods to assemble a plasmid, pKE1-lacI-bioB. This plasmid, when transformed into E. coli strain K-12 MG1655, endows cells with the ability to express elevated levels of bioB, an essential enzyme for biotin synthesis. When transformed cells were induced with isopropyl &#946;-D-1-thiogalactopyranoside (IPTG) and provided with a biotin precursor, desthiobiotin (DTB), elevated levels of biotin were produced.
Biotin&#39;s binding interaction with streptavidin is one of the strongest non-covalent bonds found in nature. As such, the biotin-streptavidin interaction is both well-characterized and highly employed in biotechnology.11 Within this manuscript, we present two strategies employing the biotin-streptavidin interaction to sense and detect cell-produced biotin with a functionalized surface. We refer to these contrasting surfaces as &#34;indirect&#34; and &#34;direct&#34; control schemes. In the indirect control scheme, cell-produced biotin competes with biotin that has been conjugated and immobilized on a polystyrene surface for streptavidin binding sites. In addition, the streptavidin is conjugated with horseradish peroxidase (HRP). HRP modifies 3, 3&#39;, 5, 5&#39;-tetramethylbenzidine (TMB), to produce an optical signal,12 which may be monitored by quantifying the spectral absorbance (i.e., optical density) at 450 nm (OD450). Thus, the indirect control scheme allows researchers to measure cell-produced biotin by monitoring the attentuation of the OD450 signal.
The direct control scheme exploits the streptavidin-biotin event by immobilizing streptavidin directly to a material surface and allowing cell-produced biotin and biotinylated HRP to compete for streptavidin binding sites. Again, the relative levels of cell-produced biotin are monitored by measuring an OD450 signal.
Taken together, the engineered cells and functionalized surfaces allow us to control the properties of a programmable surface by inducing networks in living cells. In other words, we have created a system that takes advantage of the adaptability of living organisms and the reliability and specification of an engineered material interface by linking these systems together.

<table border="0" cellpadding="0" cellspacing="0" width="1072">
	<tbody>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">LB Broth, Miller&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">12-795-027</td>
			<td style="width:219px;"></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Agar</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP9744500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Carbenicillin&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP26481</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">M9, Minimimal Salts, 5X</td>
			<td style="width:209px;">Sigma-Aldrich</td>
			<td style="width:119px;">M6030</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Casamino Acids&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP1424-100</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Magnesium Sulfate, Anhydrous</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">M65-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Calcium Chloride, Dihydrate</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">C79-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Dextrose (D-Glucose), Anhydrous</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">D16-1</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">NEB Turbo Cell Line</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">C2984l</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Oligonucleotide Primers</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">N/A</td>
			<td>25N synthesis, DSL purification</td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Q5 High-Fidelity Polymerase</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">M0491S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Q5 Reaction Buffer</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">B9027S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">dNTP Solution Mix</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">N0447S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Agarose</td>
			<td style="width:209px;">Bioexpress</td>
			<td style="width:119px;">E-3120-125</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Ethidium Bromide, 1%</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP1302-10</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Gel Extraction Kits</td>
			<td style="width:209px;">Epoch Biolabs</td>
			<td style="width:119px;">2260250</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">GenCatch Plasmid DNA Miniprep Kit</td>
			<td style="width:209px;">Epoch Biolabs</td>
			<td style="width:119px;">2160250</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">AatII</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">R0117S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">SacII</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">R0157S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">HindIII-HF</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">R3104S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">EcoRI-HF</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">R3101S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Cutsmart Buffer</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">B7204S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">T4 DNA Ligase</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">M0202S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">T4 DNA Ligase Reaction Buffer</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">B0202S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">ColiRolle Glass Plating Beads&#160;</td>
			<td style="width:209px;">EMD Millipore</td>
			<td style="width:119px;">7101-3</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Glycerol</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP229-1</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Isopropyl &#946;-D-1-thiogalactopyranoside (IPTG)</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP1755-10</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">NHS-Desthiobiotin (DTB)</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">16129</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Succinimidyl Trans-4-(maleimidylmethyl) Cyclohexane-1-Carboxylate (SMCC)&#160;</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">S1534</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Dimethyl Sulfoxide (DMSO)&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP231-100</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Succinimidyl 3-(2-pyridyldithio) Propionate (SPDP)&#160;</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">S1531</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">NHS-LC-LC-biotin</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">21343</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Horseradish Peroxidase (HRP)&#160;</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">31490</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Phosphate Buffered Saline (PBS), 10X Solution</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP399500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Streptavidin (SA)&#160;</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">21145</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Bovine Serum Albumin (BSA)</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP1600-100</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Dithiothreitol (DTT)</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP172-5</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Ethylenediaminetetaacetic acid (EDTA)&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">S311-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Tween 80&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">T164-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Hydrogen Peroxide</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">H325-4</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">3, 3&#39;, 5, 5&#39;-tetramethylbenzidine (TMB)</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">AC229280050</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Vivaspin 500 Centrifugal Concentrators&#160;</td>
			<td style="width:209px;">Viva Products</td>
			<td style="width:119px;">VS0192</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Sodium Acetate, Anhydrous</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP333-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">96-Well Polystyrene Plates</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">266120</td>
			<td></td>
		</tr>
	</tbody>
</table>

using synthetic biology to engineer living cells that interface with programmable materials

We have developed an abiotic-biotic interface that allows engineered cells to control the material properties of a functionalized surface. This system is made by creating two modules: a synthetically engineered strain of E. coli cells and a functionalized material interface. Within this paper, we detail a protocol for genetically engineering selected behaviors within a strain of E. coli using molecular cloning strategies. Once developed, this strain produces elevated levels of biotin when exposed to a chemical inducer. Additionally, we detail protocols for creating two different functionalized surfaces, each of which is able to respond to cell-synthesized biotin. Taken together, we present a methodology for creating a linked, abiotic-biotic system that allows engineered cells to control material composition and assembly on nonliving substrates.

Representative results are presented in the accompanying five figures. First, we present the cloning process graphically (Figure 1) so that the reader can visually follow the critical steps for creating the synthetically engineered E. coli strain. In order to characterize the population dynamics of the cells, we provide a growth curve (Figure 2) generated by measuring the optical density at 600 nm (OD600) of the population. Then, we show how the regulatory gene network is verified, by using mCherry as a proxy for bioB (Figure 3), allowing us to optically measure the relative amount of bioB that would be produced by the cell upon induction with IPTG. Next, we present response data for the indirect-control and direct-control functionalized surfaces. These data plots (Figure 4) were developed by using measured solutions of free biotin to characterize the functionalized surfaces&#39; response profiles. Finally, we present characteristic data showing how the engineered cells are induced to produce biotin (Figure 5), thereby modifying the functionalized surfaces.
<img alt="Figure 1" src="/files/ftp_upload/55300/55300fig1.jpg" /> 
Figure 1: Design and Construction of Inducible, Engineered Cells. (A) Primers were designed to isolate the bioB gene from the E. coli genome, which encodes a crucial enzyme in the biotin synthesis pathway. (B) The PL,tetO-1-lacI and Ptrc-2 sequences can be isolated from a plasmid containing a genetic toggle switch with corresponding primers. (C) The extracted bioB gene and the two fragments from the toggle switch can then be used to create the gene circuit. The addition of IPTG can then induce the expression of bioB and thereby biotin synthesis when DTB is added as a substrate for bioB. (D) The assembled plasmid was transformed into K-12 MG1655 E. coli. This caused the presence of IPTG to induce the expression of bioB and thereby biotin synthesis by the engineered cell line when DTB was provided as a substrate. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/55300/55300fig2.jpg" /> 
Figure 2: Growth Curves for Engineered Cells. The engineered, inducible MG1655 wild-type cells were grown and monitored in minimal media (i.e., biotin-free M9 media), as well as minimal media supplemented with DTB (200 ng/mL) and/or IPTG (0.5 mM). The plots show the OD600 reading, measured every 5 min for 24 h. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/55300/55300fig3.jpg" /> 
Figure 3: Testing the Engineered Gene Network. The fluorescent protein mCherry was used in place of the bioB gene so that we could optically measure the induction profile when engineered cells were induced with IPTG. We contrast the cells induced with IPTG (red diamonds) with the cells not induced with IPTG (blue diamonds). These results demonstrate the efficacy of the inducible gene network. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" src="/files/ftp_upload/55300/55300fig4.jpg" /> 
Figure 4: Verification of the Functionalized Material Interface. By exposing our functionalized surface to varying concentrations of biotin, we are able to measure the optical response by measuring OD450 absorbance. These results allow us to generate a calibration curve, linking the concentration of biotin to the optical intensity of the response. Here, we present the biotin vs. optical signal curves for both the indirect (left) and direct (right) functionalized surface schemes. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" src="/files/ftp_upload/55300/55300fig5.jpg" /> 
Figure 5: Engineered Cells Control Material Interface. By utilizing protocol sections 5 or 6, we are able to use the products of induced, engineered cells to chemically modify the functionalized surface. We can monitor these responses optically by measuring OD450. Furthermore, by using the calibration curve developed in Figure 4, we can link the optical intensity of the response to the biotin within the concentration. We present here the different biotin concentrations, measured by our indirect control scheme functionalized surface, for wild-type cells (white), uninduced cells containing the pKE1-lacI-bioB plasmid (orange), and induced cells containing the pKE1-lacI-bioB plasmid (grey). <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Chemical</td>
			<td>Final Concentration</td>
			<td>Amount&#160;</td>
		</tr>
		<tr>
			<td>5x M9 salts&#160;</td>
			<td>1x</td>
			<td>20 mL</td>
		</tr>
		<tr>
			<td>1 M MgSO4</td>
			<td>2 mM</td>
			<td>200 &#956;L</td>
		</tr>
		<tr>
			<td>1 M CaCl2</td>
			<td>0.1 mM</td>
			<td>10 &#956;L</td>
		</tr>
		<tr>
			<td>20% glucose</td>
			<td>0.40%</td>
			<td>2 mL</td>
		</tr>
		<tr>
			<td>2% biotin-free Casamino acid&#160;</td>
			<td>0.02%</td>
			<td>1 mL</td>
		</tr>
		<tr>
			<td>DI Water</td>
			<td>N/A</td>
			<td>76.8 mL</td>
		</tr>
	</tbody>
</table>
Table 1: M9 Media Recipe.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Name</td>
			<td colspan="2">Primer Sequence&#160;</td>
			<td>Usage</td>
		</tr>
		<tr>
			<td>1-f</td>
			<td colspan="2">CCGCCGGAATTCTCCCTATCAGTGATAGAGATT</td>
			<td>lacI cassette extraction</td>
		</tr>
		<tr>
			<td>1-r</td>
			<td colspan="2">CCGACGTCTCACTGCCCGCTTTCCAGTC</td>
			<td>lacI cassette extraction</td>
		</tr>
		<tr>
			<td>nBioB1-f</td>
			<td colspan="2">CCCAAGCTTCTGAAATGAGCTGTTGACAATTAATCAT</td>
			<td>Ptrc-2 extraction</td>
		</tr>
		<tr>
			<td>nBioB1-r</td>
			<td colspan="2">GGGGGGTTCTTTTAATAAAGGTACCGTGTGAAATTGTT</td>
			<td>Ptrc-2 extraction</td>
		</tr>
		<tr>
			<td>nBioB2-f1</td>
			<td colspan="2">ACCCCCCTAAGGAGGTCATCATGGCTCACCGCCCACG</td>
			<td>bioB extraction</td>
		</tr>
		<tr>
			<td>nBioB2-r</td>
			<td colspan="2">TCCCCGCGGTCATAATGCTGCCGCGTTGTAATATTC</td>
			<td>bioB extraction</td>
		</tr>
		<tr>
			<td>nBioB2-f2</td>
			<td colspan="2">ACGGTACCTTTATTAAAAGAACCCCCCTAAGGAGGTCATC</td>
			<td>Synthetic RBS addition</td>
		</tr>
	</tbody>
</table>
Table 2: List of Primers.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Step 1</td>
			<td>Step 2</td>
			<td>Step 3</td>
			<td>Step 4</td>
			<td>Step 5</td>
			<td>Step 6</td>
			<td>Step 7</td>
			<td>Step 8</td>
			<td>Step 9</td>
		</tr>
		<tr>
			<td>98&#176;C</td>
			<td>98&#176;C</td>
			<td>70&#176;C</td>
			<td>72&#176;C</td>
			<td>98&#176;C</td>
			<td>60&#176;C</td>
			<td>72&#176;C</td>
			<td>72&#176;C</td>
			<td>4&#176;C</td>
		</tr>
		<tr>
			<td>0:30</td>
			<td>0:10</td>
			<td>0:30</td>
			<td>01:00/kb</td>
			<td>0:10</td>
			<td>0:30</td>
			<td>01:00/kb</td>
			<td>2:00</td>
			<td>&#8734;</td>
		</tr>
		<tr>
			<td rowspan="2"></td>
			<td colspan="3">Repeat 12 times</td>
			<td colspan="3" rowspan="2">Repeat 25 times</td>
			<td colspan="2" rowspan="2"></td>
		</tr>
		<tr>
			<td colspan="3">-1&#176;C / cycle</td>
		</tr>
	</tbody>
</table>
Table 3: PCR Program.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Volume&#160;</td>
		</tr>
		<tr>
			<td>Cell Lysate (template)</td>
			<td>10 &#956;L</td>
		</tr>
		<tr>
			<td>Primer (each)</td>
			<td>0.625 &#956;L (each)</td>
		</tr>
		<tr>
			<td>5x Q5 buffer</td>
			<td>5 &#956;L</td>
		</tr>
		<tr>
			<td>Q5 Polymerase</td>
			<td>0.25 &#956;L</td>
		</tr>
		<tr>
			<td>dNTP Mix</td>
			<td>0.5 &#956;L</td>
		</tr>
		<tr>
			<td>DI Water</td>
			<td>6.75 &#956;L</td>
		</tr>
	</tbody>
</table>
Table 4: Whole Cell PCR Reaction (25 &#181;L).
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Volume&#160;</td>
		</tr>
		<tr>
			<td>10x&#160; Reaction buffer</td>
			<td>5 &#181;L</td>
		</tr>
		<tr>
			<td>Enzyme 1</td>
			<td>1 &#956;L</td>
		</tr>
		<tr>
			<td>Enzyme 2</td>
			<td>1 &#956;L</td>
		</tr>
		<tr>
			<td>Template DNA</td>
			<td>1 &#181;g</td>
		</tr>
		<tr>
			<td>DI Water</td>
			<td>43 &#181;L &#8211; volume of DNA</td>
		</tr>
	</tbody>
</table>
Table 5: Restriction Enzyme Digestion Reaction (50 &#181;L).
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Volume&#160;</td>
		</tr>
		<tr>
			<td>DNA</td>
			<td>50 &#956;g vector + X &#956;g insert</td>
		</tr>
		<tr>
			<td>10x Ligase Buffer</td>
			<td>1 &#956;L</td>
		</tr>
		<tr>
			<td>T4 Ligase</td>
			<td>1 &#956;L</td>
		</tr>
		<tr>
			<td>DI Water</td>
			<td>8 &#181;L &#8211; volume of DNA</td>
		</tr>
	</tbody>
</table>
Table 6: Ligation Reaction (10 &#181;L).
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Concentration</td>
			<td>Notes</td>
		</tr>
		<tr>
			<td>CaCl2</td>
			<td>100 mM</td>
			<td></td>
		</tr>
		<tr>
			<td>Carbeniccilin</td>
			<td>50 mg/mL (1000x)</td>
			<td></td>
		</tr>
		<tr>
			<td>DTB</td>
			<td>50 &#956;g/mL</td>
			<td></td>
		</tr>
		<tr>
			<td>IPTG</td>
			<td>0.5 M</td>
			<td></td>
		</tr>
		<tr>
			<td>SMCC</td>
			<td>20 mg/mL</td>
			<td>2 mg into 100uL DMSO</td>
		</tr>
		<tr>
			<td>SPDP</td>
			<td>20 mg/mL</td>
			<td>2 mg into 100uL DMSO</td>
		</tr>
		<tr>
			<td>LC-LC-biotin</td>
			<td>20 mg/mL</td>
			<td>2 mg into 100uL DMSO</td>
		</tr>
		<tr>
			<td>HRP</td>
			<td>10 mg/mL</td>
			<td>In PBS</td>
		</tr>
		<tr>
			<td>SA (indirect)</td>
			<td>10 mg/mL</td>
			<td>In PBS</td>
		</tr>
		<tr>
			<td>SA (direct)</td>
			<td>0.17 &#956;g/mL</td>
			<td>In PBS</td>
		</tr>
		<tr>
			<td>BSA</td>
			<td>20 mg/mL</td>
			<td>In PBS</td>
		</tr>
		<tr>
			<td>DTT</td>
			<td>100mM</td>
			<td>In DI Water</td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>5 mM</td>
			<td>18.6 mg into 10 mL PBS</td>
		</tr>
		<tr>
			<td>Casein</td>
			<td>0.50%</td>
			<td>In PBS</td>
		</tr>
		<tr>
			<td>Tween 80</td>
			<td>20%</td>
			<td>In DI Water</td>
		</tr>
		<tr>
			<td>Tween 80 in PBS</td>
			<td>0.05%</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Acetate</td>
			<td>50 mM</td>
			<td>In DI Water, Adjust to 5.1 pH using 3 M HCl</td>
		</tr>
		<tr>
			<td>TMB</td>
			<td>1%</td>
			<td>In DMSO</td>
		</tr>
		<tr>
			<td>H2O2</td>
			<td>3%</td>
			<td>In DI Water</td>
		</tr>
		<tr>
			<td>H2SO4</td>
			<td>2 M</td>
			<td>In DI Water</td>
		</tr>
	</tbody>
</table>
Table 7: List of Reagent Solutions.

Watch this Scientific Journal Video about Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials at JoVE.com

Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials

This paper presents a series of protocols for developing engineered cells and functionalized surfaces that enable synthetically engineered E. coli to control and manipulate programmable material surfaces.

We have developed an abiotic-biotic interface that allows engineered cells to control the material properties of a functionalized surface. This system is ...

using-synthetic-biology-to-engineer-living-cells-that-interface-with

Nanyang Technological University

Research

JoVE Journal

Bioengineering

8.8K Views.  Carnegie Mellon University. This paper presents a series of protocols for developing engineered cells and functionalized surfaces that enable synthetically engineered E. coli to control and manipulate programmable material surfaces.

Video: Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials

Bridging the Bio-Electronic Interface with Biofabrication

Advancements in lab-on-a-chip technology promise to revolutionize both research and medicine through lower costs, better sensitivity, portability, and higher throughput. The incorporation of biological components onto biological microelectromechanical systems (bioMEMS) has shown great potential for achieving these goals. Microfabricated electronic chips allow for micrometer-scale features as well as an electrical connection for sensing and actuation. Functional biological components give the system the capacity for specific detection of analytes, enzymatic functions, and whole-cell capabilities. Standard microfabrication processes and bio-analytical techniques have been successfully utilized for decades in the computer and biological industries, respectively. Their combination and interfacing in a lab-on-a-chip environment, however, brings forth new challenges. There is a call for techniques that can build an interface between the electrode and biological component that is mild and is easy to fabricate and pattern.
Biofabrication, described here, is one such approach that has shown great promise for its easy-to-assemble incorporation of biological components with versatility in the on-chip functions that are enabled. Biofabrication uses biological materials and biological mechanisms (self-assembly, enzymatic assembly) for bottom-up hierarchical assembly. While our labs have demonstrated these concepts in many formats 1,2,3, here we demonstrate the assembly process based on electrodeposition followed by multiple applications of signal-based interactions. The assembly process consists of the electrodeposition of biocompatible stimuli-responsive polymer films on electrodes and their subsequent functionalization with biological components such as DNA, enzymes, or live cells 4,5. Electrodeposition takes advantage of the pH gradient created at the surface of a biased electrode from the electrolysis of water 6,7,. Chitosan and alginate are stimuli-responsive biological polymers that can be triggered to self-assemble into hydrogel films in response to imposed electrical signals 8. The thickness of these hydrogels is determined by the extent to which the pH gradient extends from the electrode. This can be modified using varying current densities and deposition times 6,7. This protocol will describe how chitosan films are deposited and functionalized by covalently attaching biological components to the abundant primary amine groups present on the film through either enzymatic or electrochemical methods 9,10. Alginate films and their entrapment of live cells will also be addressed 11. Finally, the utility of biofabrication is demonstrated through examples of signal-based interaction, including chemical-to-electrical, cell-to-cell, and also enzyme-to-cell signal transmission. 
Both the electrodeposition and functionalization can be performed under near-physiological conditions without the need for reagents and thus spare labile biological components from harsh conditions. Additionally, both chitosan and alginate have long been used for biologically-relevant purposes 12,13. Overall, biofabrication, a rapid technique that can be simply performed on a benchtop, can be used for creating micron scale patterns of functional biological components on electrodes and can be used for a variety of lab-on-a-chip applications.

This article describes a biofabrication approach: deposition of stimuli-responsive polysaccharides in the presence of biased electrodes to create biocompatible films which can be functionalized with cells or proteins. We demonstrate a bench-top strategy for the generation of the films as well as their basic uses for creating interactive biofunctionalized surfaces for lab-on-a-chip applications.

Advancements in lab-on-a-chip technology promise to revolutionize both research and medicine through lower costs, better sensitivity, portability, and ...

Measuring the Mechanical Properties of Living Cells Using Atomic Force Microscopy

Mechanical properties of cells and extracellular matrix (ECM) play important roles in many biological processes including stem cell differentiation, tumor formation, and wound healing. Changes in stiffness of cells and ECM are often signs of changes in cell physiology or diseases in tissues. Hence, cell stiffness is an index to evaluate the status of cell cultures. Among the multitude of methods applied to measure the stiffness of cells and tissues, micro-indentation using an Atomic Force Microscope (AFM) provides a way to reliably measure the stiffness of living cells. This method has been widely applied to characterize the micro-scale stiffness for a variety of materials ranging from metal surfaces to soft biological tissues and cells. The basic principle of this method is to indent a cell with an AFM tip of selected geometry and measure the applied force from the bending of the AFM cantilever. Fitting the force-indentation curve to the Hertz model for the corresponding tip geometry can give quantitative measurements of material stiffness. This paper demonstrates the procedure to characterize the stiffness of living cells using AFM. Key steps including the process of AFM calibration, force-curve acquisition, and data analysis using a MATLAB routine are demonstrated. Limitations of this method are also discussed.

This paper demonstrates a protocol to characterize the mechanical properties of living cells by means of microindentation using an Atomic Force Microscope (AFM).

Mechanical  properties of cells and extracellular matrix (ECM) play important roles in many  biological processes including stem cell differentiation, ...

Ratiometric Biosensors that Measure Mitochondrial Redox State and ATP in Living Yeast Cells

Mitochondria have roles in many cellular processes, from energy metabolism and calcium homeostasis to control of cellular lifespan and programmed cell death. These processes affect and are affected by the redox status of and ATP production by mitochondria. Here, we describe the use of two ratiometric, genetically encoded biosensors that can detect mitochondrial redox state and ATP levels at subcellular resolution in living yeast cells. Mitochondrial redox state is measured using redox-sensitive Green Fluorescent Protein (roGFP) that is targeted to the mitochondrial matrix. Mito-roGFP contains cysteines at positions 147 and 204 of GFP, which undergo reversible and environment-dependent oxidation and reduction, which in turn alter the excitation spectrum of the protein. MitGO-ATeam is a F&ouml;rster resonance energy transfer (FRET) probe in which the &epsilon; subunit of the FoF1-ATP synthase is sandwiched between FRET donor and acceptor fluorescent proteins. Binding of ATP to the &epsilon; subunit results in conformation changes in the protein that bring the FRET donor and acceptor in close proximity and allow for fluorescence resonance energy transfer from the donor to acceptor.

We describe the use of two ratiometric, genetically encoded biosensors, which are based on GFP, to monitor mitochondrial redox state and ATP levels at subcellular resolution in living yeast cells.

Mitochondria have roles in many cellular processes, from energy metabolism and calcium homeostasis to control of cellular lifespan and programmed cell ...

Generation of Shear Adhesion Map Using SynVivo Synthetic Microvascular Networks

Cell/particle adhesion assays are critical to understanding the biochemical interactions involved in disease pathophysiology and have important applications in the quest for the development of novel therapeutics. Assays using static conditions fail to capture the dependence of adhesion on shear, limiting their correlation with in vivo environment. Parallel plate flow chambers that quantify adhesion under physiological fluid flow need multiple experiments for the generation of a shear adhesion map. In addition, they do not represent the in vivo scale and morphology and require large volumes (~ml) of reagents for experiments. In this study, we demonstrate the generation of shear adhesion map from a single experiment using a microvascular network based microfluidic device, SynVivo-SMN. This device recreates the complex in vivo vasculature including geometric scale, morphological elements, flow features and cellular interactions in an in vitro format, thereby providing a biologically realistic environment for basic and applied research in cellular behavior, drug delivery, and drug discovery. The assay was demonstrated by studying the interaction of the 2 &#181;m biotin-coated particles with avidin-coated surfaces of the microchip. The entire range of shear observed in the microvasculature is obtained in a single assay enabling adhesion vs. shear map for the particles under physiological conditions.

Flow chambers used in adhesion experiments typically consist of linear flow paths and require multiple experiments at different flow rates to generate a shear adhesion map. SynVivo-SMN enables the generation of shear adhesion map using a single experiment utilizing microliter volumes resulting in significant savings in time and consumables.

Cell/particle adhesion assays are critical to understanding the biochemical interactions involved in disease pathophysiology and have important ...

Characterization Of Multi-layered Fish Scales (Atractosteus spatula) Using Nanoindentation, X-ray CT, FTIR, and SEM

The hierarchical architecture of protective biological materials such as mineralized fish scales, gastropod shells, ram&#8217;s horn, antlers, and turtle shells provides unique design principles with potentials for guiding the design of protective materials and systems in the future. Understanding the structure-property relationships for these material systems at the microscale and nanoscale where failure initiates is essential. Currently, experimental techniques such as nanoindentation, X-ray CT, and SEM provide researchers with a way to correlate the mechanical behavior with hierarchical microstructures of these material systems1-6. However, a well-defined standard procedure for specimen preparation of mineralized biomaterials is not currently available. In this study, the methods for probing spatially correlated chemical, structural, and mechanical properties of the multilayered scale of A. spatula using nanoindentation, FTIR, SEM, with energy-dispersive X-ray (EDX) microanalysis, and X-ray CT are presented.

Characterization Of Multi-layered Fish Scales Atractosteus spatula Using Nanoindentation, X-ray CT, FTIR, and SEM

This paper presents the methods used for probing spatially correlated chemical, structural, and mechanical properties of the multilayered scale of Atractosteus spatula (A. spatula) using nanoindentation, Fourier transform infrared (FTIR) spectroscopy, scanning electron microscopy (SEM), and X-ray computed tomography (X-ray CT). The experimental results have been used to investigate the design principles of protective biological materials.

The hierarchical architecture of protective biological materials such as mineralized fish scales, gastropod shells, ram&#8217;s horn, antlers, and turtle ...

Development of Amelogenin-chitosan Hydrogel for In Vitro Enamel Regrowth with a Dense Interface

Biomimetic enamel reconstruction is a significant topic in material science and dentistry as a novel approach for the treatment of dental caries or erosion. Amelogenin has been proven to be a critical protein for controlling the organized growth of apatite crystals. In this paper, we present a detailed protocol for superficial enamel reconstruction by using a novel amelogenin-chitosan hydrogel. Compared to other conventional treatments, such as topical fluoride and mouthwash, this method not only has the potential to prevent the development of dental caries but also promotes significant and durable enamel restoration. The organized enamel-like microstructure regulated by amelogenin assemblies can significantly improve the mechanical properties of etched enamel, while the dense enamel-restoration interface formed by an in situ regrowth of apatite crystals can improve the effectiveness and durability of restorations. Furthermore, chitosan hydrogel is easy to use and can suppress bacterial infection, which is the major risk factor for the occurrence of dental caries. Therefore, this biocompatible and biodegradable amelogenin-chitosan hydrogel shows promise as a biomaterial for the prevention, restoration, and treatment of defective enamel.

Development of Amelogenin-chitosan Hydrogel for In Vitro Enamel Regrowth with a Dense Interface

In this article, we describe a protocol for fabricating an amelogenin-chitosan hydrogel for superficial enamel reconstruction. Organized in situ growth of apatite crystals in the hydrogel formed a dense enamel-restoration interface, which will improve the effectiveness and durability of restorations.

Biomimetic enamel reconstruction is a significant topic in material science and dentistry as a novel approach for the treatment of dental caries or ...

Sealable Femtoliter Chamber Arrays for Cell-free Biology

Cell-free systems provide a flexible platform for probing specific networks of biological reactions isolated from the complex resource sharing (e.g., global gene expression, cell division) encountered within living cells. However, such systems, used in conventional macro-scale bulk reactors, often fail to exhibit the dynamic behaviors and efficiencies characteristic of their living micro-scale counterparts. Understanding the impact of internal cell structure and scale on reaction dynamics is crucial to understanding complex gene networks. Here we report a microfabricated device that confines cell-free reactions in cellular scale volumes while allowing flexible characterization of the enclosed molecular system. This multilayered poly(dimethylsiloxane) (PDMS) device contains femtoliter-scale reaction chambers on an elastomeric membrane which can be actuated (open and closed). When actuated, the chambers confine Cell-Free Protein Synthesis (CFPS) reactions expressing a fluorescent protein, allowing for the visualization of the reaction kinetics over time using time-lapse fluorescent microscopy. Here we demonstrate how this device may be used to measure the noise structure of CFPS reactions in a manner that is directly analogous to those used to characterize cellular systems, thereby enabling the use of noise biology techniques used in cellular systems to characterize CFPS gene circuits and their interactions with the cell-free environment.

A microfabricated device with sealable femtoliter-volume reaction chambers is described. This report includes a protocol for sealing cell-free protein synthesis reactants inside these chambers for the purpose of understanding the role of crowding and confinement in gene expression.

Cell-free systems provide a flexible platform for probing specific networks of biological reactions isolated from the complex resource sharing (e.g., ...

Creating a Structurally Realistic Finite Element Geometric Model of a Cardiomyocyte to Study the Role of Cellular Architecture in Cardiomyocyte Systems Biology

With the advent of three-dimensional (3D) imaging technologies such as electron tomography, serial-block-face scanning electron microscopy and confocal microscopy, the scientific community has unprecedented access to large datasets at sub-micrometer resolution that characterize the architectural remodeling that accompanies changes in cardiomyocyte function in health and disease. However, these datasets have been under-utilized for&#160;investigating the role of cellular architecture remodeling in cardiomyocyte function. The purpose of this protocol is to outline how to create an accurate finite element model of a cardiomyocyte using high resolution electron microscopy and confocal microscopy images. A detailed and accurate model of cellular architecture has significant potential to provide new insights into cardiomyocyte biology, more than experiments alone can garner. The power of this method lies in its ability to computationally fuse information from two disparate imaging modalities of cardiomyocyte ultrastructure to develop one unified and detailed model of the cardiomyocyte. This protocol outlines steps to integrate electron tomography and confocal microscopy images of adult male Wistar (name for a specific breed of albino rat) rat cardiomyocytes to develop a half-sarcomere finite element model of the cardiomyocyte. The procedure generates a 3D finite element model that contains an accurate, high-resolution depiction (on the order of ~35 nm) of the distribution of mitochondria, myofibrils and ryanodine receptor clusters that release the necessary calcium for cardiomyocyte contraction from the sarcoplasmic reticular network (SR) into the myofibril and cytosolic compartment. The model generated here as an illustration does not incorporate details of the transverse-tubule architecture or the sarcoplasmic reticular network and is therefore a minimal model of the cardiomyocyte. Nevertheless, the model can already be applied in simulation-based investigations into the role of cell structure in calcium signaling and mitochondrial bioenergetics, which is illustrated and discussed using two case studies that are presented following the detailed protocol.

This protocol outlines a novel method to create a spatially detailed finite element model of the intracellular architecture of cardiomyocytes from electron microscopy and confocal microscopy images. The power of this spatially detailed model is demonstrated using case studies in calcium signaling and bioenergetics.

With the advent of three-dimensional (3D) imaging technologies such as electron tomography, serial-block-face scanning electron microscopy and confocal ...

Measurement of Force-Sensitive Protein Dynamics in Living Cells Using a Combination of Fluorescent Techniques

Cells sense and respond to physical cues in their environment by converting mechanical stimuli into biochemically-detectable signals in a process called mechanotransduction. A crucial step in mechanotransduction is the transmission of forces between the external and internal environments. To transmit forces, there must be a sustained, unbroken physical linkage created by a series of protein-protein interactions. For a given protein-protein interaction, mechanical load can either have no effect on the interaction, lead to faster disassociation of the interaction, or even stabilize the interaction. Understanding how molecular load dictates protein turnover in living cells can provide valuable information about the mechanical state of a protein, in turn elucidating its role in mechanotransduction. Existing techniques for measuring force-sensitive protein dynamics either lack direct measurements of protein load or rely on the measurements performed outside of the cellular context. Here, we describe a protocol for the F&#246;rster resonance energy transfer-fluorescence recovery after photobleaching (FRET-FRAP) technique, which enables the measurement of force-sensitive protein dynamics within living cells. This technique is potentially applicable to any FRET-based tension sensor, facilitating the study of force-sensitive protein dynamics in variety of subcellular structures and in different cell types.

Here, we present a protocol for the simultaneous use of F&#246;rster resonance energy transfer-based tension sensors to measure protein load and fluorescence recovery after photobleaching to measure protein dynamics enabling the measurement of force-sensitive protein dynamics within living cells.

Cells sense and respond to physical cues in their environment by converting mechanical stimuli into biochemically-detectable signals in a process called ...

A Microfluidic Platform for Stimulating Chondrocytes with Dynamic Compression

Mechanical stimuli are known to modulate biological functions of cells and tissues. Recent studies have suggested that compressive stress alters growth plate cartilage architecture and results in growth modulation of long bones of children. To determine the role of compressive stress in bone growth, we created a microfluidic device actuated by pneumatic pressure, to dynamically (or statically) compress growth plate chondrocytes embedded in alginate hydrogel cylinders. In this article, we describe detailed methods for fabricating and characterizing this device. The advantages of our protocol are: 1) Five different magnitudes of compressive stress can be generated on five technical replicates in a single platform, 2) It is easy to visualize cell morphology via a conventional light microscope, 3) Cells can be rapidly isolated from the device after compression to facilitate downstream assays, and 4) The platform can be applied to study mechanobiology of any cell type that can grow in hydrogels.

This article provides detailed methods for fabricating and characterizing a pneumatically actuating microfluidic device for chondrocyte compression.

Mechanical stimuli are known to modulate biological functions of cells and tissues. Recent studies have suggested that compressive stress alters growth ...