Yazarlar minnetle ABD Bilimsel Araştırma Hava Kuvvetleri Ofisi ödül FA9550-13-1-0108 destek kabul. Yazarlar ayrıca Virginia Politeknik Enstitüsü ve Devlet Üniversitesi&#39;nde Kritik Teknoloji ve Uygulamalı Bilimler Enstitüsü&#39;nde ve Ulusal Bilim Vakfı Lisansüstü Research fon, ABD Donanma Araştırma Ofisi ödül N00014-15-1-2502 destek kabul Burs Programı, ödül sayısı 1.607.310.

<ol>
	<li>Zhang, R., Heyde, K. C., Scott, F. Y., Paek, S. -. H., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programming+Surface+Chemistry+with+Engineered+Cells.">Programming Surface Chemistry with Engineered Cells.</a> ACS Synth. Biol. , (2016).</li><li>Zhou, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reduced+graphene+oxide+films+used+as+matrix+of+MALDI-TOF-MS+for+detection+of+octachlorodibenzo-p-dioxin.">Reduced graphene oxide films used as matrix of MALDI-TOF-MS for detection of octachlorodibenzo-p-dioxin.</a> Chem. Commun. 46, 6974-6976 (2010).</li><li>Pardee, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Low-Cost+Detection+of+Zika+Virus+Using+Programmable+Biomolecular+Components.">Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components.</a> Cell. 165, 1255-1266 (2016).</li><li>B&#228;hring, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+Sensing+Properties+of+a+Self-Assembled+Supramolecular+Oligomer.">Design and Sensing Properties of a Self-Assembled Supramolecular Oligomer.</a> Chem. Eur. J. 22, 1958-1967 (2016).</li><li>Nicolau Jr, D. V., Armitage, J. P., Maini, P. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directional+persistence+and+the+optimality+of+run-and-tumble+chemotaxis.">Directional persistence and the optimality of run-and-tumble chemotaxis.</a> Comp. Biol. Chem. 33, 269-274 (2009).</li><li>Du, J., Shao, Z., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+microbial+factories+for+synthesis+of+value-added+products.">Engineering microbial factories for synthesis of value-added products.</a> J. Ind. Microbiol. Biotechnol. 38, 873-890 (2011).</li><li>Kim, H., Kim, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electric+Field+Control+of+Bacteria-Powered+Microrobots+Using+a+Static+Obstacle+Avoidance+Algorithm.">Electric Field Control of Bacteria-Powered Microrobots Using a Static Obstacle Avoidance Algorithm.</a> IEEE Trans. Rob. 32, 125-137 (2016).</li><li>Gardner, T. S., Cantor, C. R., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+a+genetic+toggle+switch+in+Escherichia+coli.">Construction of a genetic toggle switch in Escherichia coli.</a> Nature. 403, 339-342 (2000).</li><li>Heyde, K. C., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+Host-Microbiome+Interactions+using+an+in+Silico+Model+of+Biomimetic+Robots+and+Engineered+Living+Cells.">Exploring Host-Microbiome Interactions using an in Silico Model of Biomimetic Robots and Engineered Living Cells.</a> Sci. Rep. 5, 11988 (2015).</li><li>Rice, M. K., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Creating+biological+nanomaterials+using+synthetic+biology.">Creating biological nanomaterials using synthetic biology.</a> Sci. Tech. Adv. Mater. 15, 014401 (2014).</li><li>Green, N. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin.+3.+The+nature+of+the+biotin-binding+site.">Avidin. 3. The nature of the biotin-binding site.</a> Biochem. J. 89, 599-609 (1963).</li><li>Mesulam, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tetramethyl+benzidine+for+horseradish+peroxidase+neurohistochemistry:+a+non-carcinogenic+blue+reaction+product+with+superior+sensitivity+for+visualizing+neural+afferents+and+efferents.">Tetramethyl benzidine for horseradish peroxidase neurohistochemistry: a non-carcinogenic blue reaction product with superior sensitivity for visualizing neural afferents and efferents.</a> J Histochem. Cytochem. 26, 106-117 (1978).</li><li>Litcofsky, K. D., Afeyan, R. B., Krom, R. J., Khalil, A. S., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iterative+plug-and-play+methodology+for+constructing+and+modifying+synthetic+gene+networks.">Iterative plug-and-play methodology for constructing and modifying synthetic gene networks.</a> Nat. Meth. 9, 1077-1080 (2012).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+Chemical+Synthesis,+Assembly,+and+Cloning+of+a+Mycoplasma+genitalium+Genome.">Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome.</a> Science. 319, 1215-1220 (2008).</li><li>Diamandis, E. P., Christopoulos, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biotin-(strept)avidin+system:+principles+and+applications+in+biotechnology.">The biotin-(strept)avidin system: principles and applications in biotechnology.</a> Clin. Chem. 37, 625-636 (1991).</li><li>Nerurkar, L. S., Namba, M., Brashears, G., Jacob, A. J., Lee, Y. J., Sever, J., L, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+detection+of+herpes+simplex+virus+in+clinical+specimens+by+use+of+capture+biotin-streptavidin+enzyme-linked+immunosorbent+assay.">Rapid detection of herpes simplex virus in clinical specimens by use of capture biotin-streptavidin enzyme-linked immunosorbent assay.</a> J. Clin. Micro. 20, 109-114 (1984).</li><li>Cui, Y., Wei, Q., Park, H., Lieber, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanowire+Nanosensors+for+Highly+Sensitive+and+Selective+Detection+of+Biological+and+Chemical+Species.">Nanowire Nanosensors for Highly Sensitive and Selective Detection of Biological and Chemical Species.</a> Science. 293, 1289-1292 (2001).</li></ol>

Yazarlar ifşa hiçbir şey yok.

Biz bir fonksiyonelleştirilmiş malzeme yüzeyi ile yaşayan mühendislik hücrelerin arayüz için yeni bir strateji sundu. Bu IPTG ile indüklenmiştir zaman biyotin yüksek seviyelerde sentez edebilme yeteneğine sahip olan bir hücre hattı geliştirilmesi ile gerçekleştirildi. biotin yüksek seviyeler daha sonra fonksiyonalize yüzeyini değiştirmek için kullanılabilir. Protokoller E.coli hücre hattını mühendis nasıl ve iki farklı fonksiyonalize yüzeyler oluşturmak için nasıl ayrıntılı. Bu protokol kritik adımlar mühendislik hücre hattı inşaatı boyunca meydana gelir. Mansap sorunları, hem de büyüme eğrileri ile tasarlanmış hücre suşları karakterize (Şekil 2) ve floresan yanıt (Şekil 3) önlemek için teşvik edilmektedir. Usul sorunları ortaya çıkarsa, bu tür PCR çıkarma ve Gibson montajı 14 gibi diğer moleküler klonlama stratejileri, nerede adımlar için uygun ikame edilebilir. biotin Yie optimize içinişlenmiş hücre çizgisinin LD, DTB yeterli bir miktarda hücrelere sağlanan sağlamak için çok önemlidir. Çalışmalarımızda olarak, hücreler, IPTG ile indüklenmiştir zaman 200 ng / ml DTB biyotin üretiminde önemli ve anlamlı bir artış ortaya bulundu. Ayrıca, BSA-Biotin, SA-HRP ve Biotin-HRP başarılı çekimleri etkili bir performans ve dolaylı ve doğrudan kontrol şemaları izlemek için çok önemlidir. ışığa, gereksiz maruz kalmasını önlemek ve konjugatları etkin konjugat oluşturulmaktadır sağlamak için 4 ° C&#39;de bir gece boyunca inkübe izin dikkat edin. Bizim protokolünün örneğin 4&#39;-hydroxyazobenzene-2-karboksilik asite dayanan ticari olarak biyotin tespit kiti ile karşılaştırıldığında (pg / ml ölçeği) biyolojik olarak alakalı biyotin küçük miktarlarda tespit edebilme kabiliyeti için alternatif yöntemler 15 göre avantajlar sunar kompetitif bağlanma stratejileri. streptavidin bio kullanarak rağmenkalay sistem biyoteknoloji 16, 17 yaygındır, biotin küçük miktarlarda yanıt vermek sistemin yeteneği doğrudan işlevsel yüzey ile genetiği değiştirilmiş hücre hattını bağlamak için bize izin verir. Bizim protokol potansiyel bir sınırlama biotin algılama ortaya çıkan dinamik aralık olduğunu. Dolaylı ve doğrudan kontrol şemaları, biz (4 Şekil) sırasıyla / mL pg 4 -10 6 3 -10 2 10 ila 10 biyotin tespit edebiliyoruz. Neyse ki, dolaylı kontrol şeması düşük aralık bizi kolayca tasarlanmış hücrelerden biyotin üretimini algılamasını sağlar. Ancak, dolaylı kontrolü dinamik aralık sıkı bant biyotin konsantrasyonlarında büyük değişiklikler (100 kat) anlamda kabiliyetini sınırlar. hem dolaylı ve doğrudan kontrol şemaları için dinamik aralığı değiştirilmesi ek mühendislik gerektirir. Bununla birlikte, saptama hücre-üretmek eğerd biotin dolaylı kontrol şeması (Şekil 5) dinamik aralık hedef araştırmacı izin vermelidir adım 4.6 biotin süpernatant dilüsyonları hazırlamak, bir konudur. süpernatant 5 seyreltme bizi etkili dolaylı kontrol planın dinamik aralığı hedeflemesine izin: Biz 1 bulundu. Bu seyreltme stratejisi doğrudan dinamik aralığını değiştirmek ihtiyacını hafifletmek gerekir. Burada yer alan iki parçalı, hücre malzeme sistemi işlevsel yüzey bileşimini değiştirmek için hücreleri işenmiş sağlar. Dinamik, canlı hücreler genetik yanıt üretmek için kimyasal çevresi yorumlayabilir. biyotin üretimini artırmak için bu genetik yanıtı mühendislik, biz bir fonksiyonlaşmış yüzeyi kontrol ve manipüle etme yeteneği ile mühendislik yaşam hücreleri bağışlamak olabilir. sunulan protokolleri takip ederek, mühendislik hücreler okuma, işleme kapasitesine sahip olduğu dinamik sensörleri, hareket edebiliyoruz, ve inci etrafında koşulları kayıtfonksiyonlaşmış arabirimler üzerinden em. Bu teknoloji moleküler tıp çevresel iyileştirme için analit algılama değişen alanları etkileyebilir.

Burada, bir mühendislik hücre hattından bir kimyasal sinyali cevap verebilen bir programlanabilir alt tabakanın geliştirilmesi için prosedürler bildirmektedir. 1 Biz sentetik tasarlanmış Escherichia coli (E. coli) hücreler tarafından üretilen biyotin yanıt veren bir biyotin-streptavidin arayüz oluşturarak bunu. Daha önce, programlanabilir yüzeyler toksin tespiti 2 ve nokta-bakım teşhisi 3 savunma ve güvenlik için geniş bir uygulama yelpazesi için tasarlanmış edilmiştir. Programlanabilir yüzeyler sensörler ve aktüatörler olarak yararlı olabilir 4, onlar farklı çevresel zorluklara uyum yeteneği ile donatarak, &quot;akıllı&quot; hale getirilebilir. Bunun aksine, örneğin, E. coli gibi daha basit bir mikroorganizmalar doğal uyum ve karmaşık ve çoğu zaman, beklenmedik çözümlerle zorluklara yanıt yeteneğine sahiptir. Bu uyum E. sağladıkompleks gen ağları tarafından kontrol coli popülasyonları, maliyet-etkin bir kaynak aramaya, 5 katma değerli ürünler, 6 ve hatta güç mikro ölçekli robotik oluşturun. 7 programlanabilir yüzeylerin kullanımı ile yaşayan hücrelerin adaptif avantajlarını birleştirerek, farklı çevre koşullarına cevap verebilecek bir akıllı substrat oluşturabilirsiniz. Sentetik biyoloji canlıların davranışlarını programlamak için araştırmacılara yeni yetenekler vermiştir. yeni gen düzenleyici ağları içeren hücrelerin mühendislik, araştırmacılar programlanmış bir dizi davranışı gösteren hücreleri tasarlayabilirsiniz. Temel araştırma ötesinde 8, 9, bu davranışlar gibi katma değerli ürünler malzeme düzeneğini kontrol ve biyolojik üretmek gibi uygulamalar için kullanılabilir. 10 Burada, sentetik biyoloji araçlarını kullanılan ayrıntılarıyla nasıl trindüksiyondan sonra biotin sentezleyen bir E. coli suşu disi. Bu soy, bir plazmid, pKE1-lacl-biyobalistik monte sınırlama enzimi klonlama yöntemleri kullanılarak geliştirilmiştir. E. coli K-12 MG1655 dönüştürülmüştür, bu plasmid, biyobalistik, biyotin sentezi için gerekli bir enzimin, yüksek seviyelerde ifade yeteneğine sahip hücrelerin endows. dönüştürülmüş hücreler izopropil β-D-1-tiogalaktopiranosid (IPTG) ile teşvik ve bir biyotin ön, destiobiyotin (DTB) ile sağlanan zaman, biotin yüksek seviyelerde üretildi. streptavidin, biyotin en bağlanma etkileşimi doğada bulunan güçlü kovalent olmayan bağlar biridir. örneğin, biyotin-streptavidin interaksiyonundan iyi karakterize edilmiş ve son derece biyoteknoloji kullanılan hem de. Bu yazının içinde 11 biz duygusu ve işlevsel yüzey hücre üretilen biyotin algılamak için biyotin-streptavidin etkileşimi kullanan iki strateji sunuyoruz. Biz&quot;Dolaylı&quot; ve &quot;doğrudan&quot; kontrol programları gibi bu zıt yüzeylere bakın. Dolaylı kontrol şeması, hücre üretilen biyotin konjuge ve bağlayıcı siteler streptavidin bir polistiren yüzey üzerine immobilize edilmiş biotin ile rekabet eder. Buna ek olarak, streptavidin-yaban turpu peroksidaz (HRP) ile konjuge edilir. HRP 3, 3 &#39;, 5, 5&#39;-tetrametilbenzidin (TMB), 450 nm (OD 450), spektral emicilik (yani, optik yoğunluk) miktarının izlenebilir bir optik sinyalin, 12 üretilmesi için değiştirir. Böylece, dolaylı kontrol düzeni araştırmacılar OD 450 sinyal attentuation izleyerek hücre üretilen biyotin ölçmek için sağlar. doğrudan kontrol şeması bir malzeme yüzeyine doğrudan streptavidin hareketsiz hale ve bağlayıcı siteleri streptavidin için rekabet hücre üretilen biyotin ve biyotinile HRP izin vererek streptavidin-biotin olay patlatır. Yine,Hücre üretilen biyotin nispi seviyeleri, bir OD 450 sinyalinin ölçülmesi ile takip edilir. Birlikte ele alındığında, mühendislikten geçirilen hücreler ve fonksiyonalize yüzeyler US canlı hücre ağları uyararak programlanabilir yüzey özelliklerini kontrol sağlar. Diğer bir deyişle, biz birlikte bu sistemleri birbirine bağlayarak bir mühendislik malzemesi arayüzü canlıların uyum ve güvenilirlik ve şartname yararlanır bir sistem oluşturduk.

<table border="0" cellpadding="0" cellspacing="0" width="1072">
	<tbody>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">LB Broth, Miller&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">12-795-027</td>
			<td style="width:219px;"></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Agar</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP9744500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Carbenicillin&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP26481</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">M9, Minimimal Salts, 5X</td>
			<td style="width:209px;">Sigma-Aldrich</td>
			<td style="width:119px;">M6030</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Casamino Acids&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP1424-100</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Magnesium Sulfate, Anhydrous</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">M65-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Calcium Chloride, Dihydrate</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">C79-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Dextrose (D-Glucose), Anhydrous</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">D16-1</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">NEB Turbo Cell Line</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">C2984l</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Oligonucleotide Primers</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">N/A</td>
			<td>25N synthesis, DSL purification</td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Q5 High-Fidelity Polymerase</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">M0491S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Q5 Reaction Buffer</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">B9027S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">dNTP Solution Mix</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">N0447S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Agarose</td>
			<td style="width:209px;">Bioexpress</td>
			<td style="width:119px;">E-3120-125</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Ethidium Bromide, 1%</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP1302-10</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Gel Extraction Kits</td>
			<td style="width:209px;">Epoch Biolabs</td>
			<td style="width:119px;">2260250</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">GenCatch Plasmid DNA Miniprep Kit</td>
			<td style="width:209px;">Epoch Biolabs</td>
			<td style="width:119px;">2160250</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">AatII</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">R0117S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">SacII</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">R0157S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">HindIII-HF</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">R3104S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">EcoRI-HF</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">R3101S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Cutsmart Buffer</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">B7204S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">T4 DNA Ligase</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">M0202S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">T4 DNA Ligase Reaction Buffer</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">B0202S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">ColiRolle Glass Plating Beads&#160;</td>
			<td style="width:209px;">EMD Millipore</td>
			<td style="width:119px;">7101-3</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Glycerol</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP229-1</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Isopropyl &#946;-D-1-thiogalactopyranoside (IPTG)</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP1755-10</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">NHS-Desthiobiotin (DTB)</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">16129</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Succinimidyl Trans-4-(maleimidylmethyl) Cyclohexane-1-Carboxylate (SMCC)&#160;</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">S1534</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Dimethyl Sulfoxide (DMSO)&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP231-100</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Succinimidyl 3-(2-pyridyldithio) Propionate (SPDP)&#160;</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">S1531</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">NHS-LC-LC-biotin</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">21343</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Horseradish Peroxidase (HRP)&#160;</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">31490</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Phosphate Buffered Saline (PBS), 10X Solution</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP399500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Streptavidin (SA)&#160;</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">21145</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Bovine Serum Albumin (BSA)</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP1600-100</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Dithiothreitol (DTT)</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP172-5</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Ethylenediaminetetaacetic acid (EDTA)&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">S311-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Tween 80&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">T164-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Hydrogen Peroxide</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">H325-4</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">3, 3&#39;, 5, 5&#39;-tetramethylbenzidine (TMB)</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">AC229280050</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Vivaspin 500 Centrifugal Concentrators&#160;</td>
			<td style="width:209px;">Viva Products</td>
			<td style="width:119px;">VS0192</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Sodium Acetate, Anhydrous</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP333-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">96-Well Polystyrene Plates</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">266120</td>
			<td></td>
		</tr>
	</tbody>
</table>

using synthetic biology to engineer living cells that interface with programmable materials

Biz mühendislik hücreler işlevsel yüzey malzeme özelliklerini kontrol sağlayan bir abiyotik-biyotik bir arayüz geliştirdik. E. coli hücrelerinin bir sentetik tasarlanmış suşu ve işlevselleştirilmiş ara yüzüne: Bu sistem, iki modül oluşturarak yapılır. Bu metinde yer alan, biz detay genetik moleküler klonlama stratejileri kullanarak E.coli suşu içinde seçilen davranışları mühendislik için bir protokol. Bir kimyasal uyarıcı maruz kaldığında kez geliştirilen bu suş biotin yüksek seviyelerde üretir. Buna ek olarak, hücre sentezlenmiş biyotin cevap verebilecek her biri iki farklı işlevselleştirilmiş yüzeyler oluşturmak için ayrıntılarıyla protokolleri. Birlikte ele alındığında, biz cansız yüzeylerde malzeme bileşimi ve montaj kontrol hücreleri mühendislik sağlayan bir bağlantılı, abiyotik-biyotik sistemi oluşturmak için bir metodoloji sunuyoruz.

Temsilcisi sonuçları ekteki beş şekillerde sunulmaktadır. Okuyucu görsel sentetik mühendislik E.coli suşu oluşturmak için kritik adımları böylece Öncelikle, biz grafiksel klonlama işlemini (Şekil 1) sunuyoruz. Hücrelerin popülasyon dinamiklerini karakterize etmek amacıyla, nüfusun, 600 nm (OD 600) de optik yoğunluk ölçümü ile üretilen bir büyüme eğrisi (Şekil 2) bulunur. Sonra, biz düzenleyici gen ağı bize optik IPTG ile indüksiyon üzerine hücre tarafından üretilen olacağını biyobalistik nispi miktarını ölçmek için izin biyobalistik için bir vekil olarak (Şekil 3) mCherry kullanarak, doğrulanmaktadır nasıl gösterir. Sonra, dolaylı kontrolü ve direkt kontrol fonksiyonlaşmış yüzeyler için yanıt verileri sunmak. Bu veriler araziler (Şekil 4) ücretsiz ölçülen çözümlerini kullanılarak geliştirilenBiotin işlevselleştirilmiş yüzeylerin tepki profillerini karakterize etmek. Son olarak, bu şekilde fonksiyonalize yüzey modifiye üzerine dizayn edilen hücreler, biyotin (Şekil 5) üretilmesi için indüklenir gösteren karakteristik verilerini sunmaktadır. <img alt="Şekil 1" src="/files/ftp_upload/55300/55300fig1.jpg" /> Şekil 1: Tasarım ve İndüklenebilir, Engineered Hücreleri inşaatı. (A), primerler biyotin sentez yolağındaki önemli bir enzimi kodlayan, E. coli genomu, adlı biyobalistik geni izole etmek için tasarlandı. (B) p L teto-1 -lacI ve p TRC-2 karşılık gelen sekanslar primerler ile genetik değiştirme anahtarını ihtiva eden bir plazmidden izole edilebilir. (Cı) ile ekstre biyobalistik geni ve geçiş anahtarı iki fragman daha sonra gen devre oluşturmak için de kullanılabilir. IND&#39;ye olabilir IPTG eklenmesiDTB biyobalistik için alt-tabaka olarak ilave edildiğinde biyobalistik ve böylece biyotin sentezi ifade üçe. (D) bir araya plazmid K-12 MG1655 E. coli &#39;ye transforme edildi. Bu DTB bir alt-tabaka olarak temin edilmiştir zaman işlenmiş hücre hattı ile biyobalistik ve böylece biyotin sentez ekspresyonunu indükleme IPTG varlığında neden oldu. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig1large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="şekil 2" src="/files/ftp_upload/55300/55300fig2.jpg" /> Şekil 2: İşlenmiş Hücreleri Büyüme Eğrileri. Işlenmiş, uyarılabilir MG1655 doğal tipte hücreler, büyütüldü ve minimal ortam (örneğin, biyotin içermeyen M9 ortam), hem de minimal ortam DTB ile takviye (200 ng / ml) ve / veya IPTG (0.5 mm) içinde izlenmiştir. Araziler OD 600 okuma ölçülen her 5 ml göstermektedir<html> 24 saat boyunca n. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig2large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 3," src="/files/ftp_upload/55300/55300fig3.jpg" /> Şekil 3: Engineered Gen Ağı Test. floresan protein MCherry yerine kullanılmıştır mühendislik hücreler IPTG ile uyarılmıştır zaman biz optik indüksiyon profili ölçmek böylece biyobalistik gen. Biz IPTG (mavi elmas) ile uyarılan değil hücreleri ile IPTG (kırmızı elmas) ile uyarılan hücreler kontrast. Bu sonuçlar, uyanlabilir gen ağ etkinliğini göstermektedir. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig3large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> /55300/55300fig4.jpg &quot;/&gt; Şekil 4: Fonksiyonel Malzeme Arayüz doğrulanması. Biotin konsantrasyonları için fonksiyonalize yüzey teşhir ederek, OD 450 absorbansı ölçülerek optik cevap ölçebilir. Bu sonuçlar, karşılık optik yoğunluğuna biyotin konsantrasyonu bağlama ABD bir kalibrasyon eğrisi oluşturmak için izin verir. Burada, hem dolaylı (solda) ve doğrudan (sağ) fonksiyonelleştirilmiş yüzey düzenleri için optik sinyal eğrileri vs biotin sunuyoruz. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig4large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 5," src="/files/ftp_upload/55300/55300fig5.jpg" /> Şekil 5: İşlenmiş Hücreler Malzeme Arayüzü kontrol edin. protokol bölümleri 5 veya 6 yararlanarak, biz kaynaklı, mühendislik c ürünlerini kullanmak mümkünarşın kimyasal fonksiyonalize yüzeyini değiştirmek için. Biz OD 450 ölçerek optik bu yanıtları izleyebilirsiniz. Bundan başka, Şekil 4 içinde geliştirilen kalibrasyon eğrisi kullanılarak, yoğunlaştırma olan biyotine karşılık optik yoğunluğu bağlantı olabilir. Burada doğal tipte hücreler (beyaz), pKE1-lacl-biyobalistik plazmid (turuncu) ihtiva eden indüklenmemiş hücreleri için dolaylı bir kontrol şeması fonksiyonalize yüzey ile ölçülen farklı biyotin konsantrasyonları, ve pKE1-lacl-biyobalistik ihtiva eden bağlı hücrelerin mevcut plazmid (gri). <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig5large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Kimyasal </td><td> nihai konsantrasyon </td><td> Tutar </td></tr><tr><td> 5x M9 tuzları </td><td> 1x </td><td> 20 mL </td></tr><tr><td> 1 M MgSO 4 </td><td> 2 mM </td><td> 200 uL </td></tr><tr><td> 1 M CaCI2 </td><td> 0.1 mM </td><td> 10 uL </td></tr><tr><td> % 20 glükoz </td><td> % 0,40 </td><td> 2 mL </td></tr><tr><td> % 2 biyotin-serbest kasamido asit </td><td> % 0.02 </td><td> 1 mL </td></tr><tr><td> DI Su </td><td> N / A </td><td> 76.8 ml </td></tr></tbody></table> Tablo 1: M9 aracı tarifi. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> isim </td><td colspan="2"> primer sekans </td><td> kullanım </td></tr><tr><td> 1-F </td><td colspan="2"> CCGCCGGAATTCTCCCTATCAGTGATAGAGATT </td><td> laeI kaset çıkarma </td></tr><tr><td> 1-r </td><td colspan="2"> CCGACGTCTCACTGCCCGCTTTCCAGTC </td><td> laeI kaset çıkarma </td></tr><tr><td> nBioB1-F </td><td colspan="2"> CCCAAGCTTCTGAAATGAGCTGTTGACAATTAATCAT </td><td> P trc-2 çıkarma </td></tr><tr><td> nBioB1-r </td><td colspan="2"> GGGGGGTTCTTTTAATAAAGGTACCGTGTGAAATTGTT </td><td> P trc-2 çıkarma </td></tr><tr><td> nBioB2-f1 </td><td colspan="2"> ACCCCCCTAAGGAGGTCATCATGGCTCACCGCCCACG </td><td> biyobalistik çıkarma </td></tr><tr><td> nBioB2-r </td><td colspan="2"> TCCCCGCGGTCATAATGCTGCCGCGTTGTAATATTC </td><td> biyobalistik çıkarma </td></tr><tr><td> nBioB2-f2 </td><td colspan="2"> ACGGTACCTTTATTAAAAGAACCCCCCTAAGGAGGTCATC </td><td> Sentetik RBS ekleme </td></tr></tbody></table> Tablo 2: astar listesi. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td&gt; Adım 1 </td><td> Adım 2 </td><td> Aşama 3 </td><td> Aşama 4 </td><td> Adım 5 </td><td> Aşama 6 </td><td> Aşama 7 </td><td> Aşama 8 </td><td> Aşama 9 </td></tr><tr><td> 98 ° C </td><td> 98 ° C </td><td> 70 ° C </td><td> 72 ° C </td><td> 98 ° C </td><td> 60 ° C </td><td> 72 ° C </td><td> 72 ° C </td><td> 4 ° C </td></tr><tr><td> 00:30 </td><td> 00:10 </td><td> 00:30 </td><td> 01: 00 / kb </td><td> 00:10 </td><td> 00:30 </td><td> 01: 00 / kb </td><td> 02:00 </td><td> ∞ </td></tr><tr><td rowspan="2"></td><td colspan="3"> 12 kez tekrarlayın </td><td colspan="3" rowspan="2"> 25 kez tekrarlayın </td><td colspan="2" rowspan="2"></td></tr><tr><td colspan="3"> -1 C / döngüsü ° </td></tr></tbody></table>Tablo 3: PCR Programı. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> isim </td><td> hacim </td></tr><tr><td> Hücre lizatı (şablon) </td><td> 10 uL </td></tr><tr><td> Astar (her biri) </td><td> 0.625 uL (her biri) </td></tr><tr><td> 5x Q5 tampon </td><td> 5 uL </td></tr><tr><td> Q5 Polimeraz </td><td> 0.25 uL </td></tr><tr><td> dNTP karışımı </td><td> 0.5 uL </td></tr><tr><td> DI Su </td><td> 6.75 uL </td></tr></tbody></table> Tablo 4: Tüm Hücre PCR Reaksiyon (25 ul). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> isim </td><td> hacim </td></tr><tr><td> 10x reaksiyon tamponu </td><td> 5 uL </td></tr><tr><td> enzim 1 </td><td> 1 pL </td></tr><tr><td> Enzim 2 </td><td> 1 pL </td></tr><tr><td> Şablon DNA, </td><td> 1 ug </td></tr><tr><td> DI Su </td><td> 43 uL - DNA hacmi </td></tr></tbody></table> Tablo 5: kısıtlayıcı enzim sindirimi Reaksiyon (50 ul). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> isim </td><td> hacim </td></tr><tr><td> DNA </td><td> + X ug insert 50 ug vektör </td></tr><tr><td> 10x ligaz tamponu </td><td> 1 pL </td></tr><tr><td> T4 ligaz </td><td> 1 pL </td></tr><tr><td> DI Su </td><td> 8 uL - DNA hacmi </td></tr></tbody></table>Tablo 6: ligasyon reaksiyonu (10 uL). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> isim </td><td> konsantrasyon </td><td> notlar </td></tr><tr><td> CaCl2 </td><td> 100 mM </td><td></td></tr><tr><td> Carbeniccilin </td><td> 50 mg / ml (1000x) </td><td></td></tr><tr><td> DTB </td><td> 50 ug / ml </td><td></td></tr><tr><td> IPTG </td><td> 0.5 M </td><td></td></tr><tr><td> SMCC </td><td> 20 mg / ml </td><td> 100uL DMSO içinde 2mg </td></tr><tr><td> SPDP </td><td> 20 mg / ml </td><td> 100uL DMSO içinde 2mg </td></tr><tr><td> LC-LC-biyotin </td><td> 20 mg / ml </td><td> 100uL DMSO içinde 2mg </td></tr><tr><td> HRP </td><td> 10 mg / ml </td><td> PBS içinde </td></tr><tr><td> SA (dolaylı) </td><td> 10 mg / ml </td><td> PBS içinde </td></tr><tr><td> SA (doğrudan) </td><td> 0.17 ug / ml </td><td> PBS içinde </td></tr><tr><td> BSA </td><td> 20 mg / ml </td><td> PBS içinde </td></tr><tr><td> DTT </td><td> 100mM </td><td> DI Water </td></tr><tr><td> EDTA </td><td> 5 mM </td><td> 10 ml PBS içine 18.6 mg </td></tr><tr><td> Kazein </td><td> % 0,50 </td><td> PBS içinde </td></tr><tr><td> Tween 80 </td><td> % 20 </td><td> DI Water </td></tr><tr><td> PBS Tween 80 </td><td> % 0.05 </td><td></td></tr><tr><td> Sodyum asetat </td><td> 50 mM </td><td> DI Water, 3 M HCI kullanılarak 5.1 pH ayarlayın </td></tr><tr><td> TMB </td><td> % 1 </td><td> DMSO içinde </td></tr><tr><td> H2O 2 </td><td> % 3 </td><td> DI Water </td></tr><tr><td> H 2 SO 4 </td><td> 2M </td><td> DI Water </td></tr></tbody></table>Tablo 7: Reaktif Solutions listesi.

Watch this Scientific Journal Video about Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials at JoVE.com

Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials

Bu yazıda mühendislik hücreleri ve sentetik kontrol ve programlanabilir malzeme yüzeylerini işlemek için E. coli mühendislik enable işlevselleştirilmiş yüzeylerin geliştirilmesi için bir dizi protokol sunar.

Yaşayan Hücreleri Mühendise Sentetik Biyoloji kullanarak That Programlanabilir Malzemelerle Arayüzü

We have developed an abiotic-biotic interface that allows engineered cells to control the material properties of a functionalized surface. This system is ...

using-synthetic-biology-to-engineer-living-cells-that-interface-with

Nanyang Technological University

Research

JoVE Journal

Bioengineering

8.8K Görüntüleme.  Carnegie Mellon University.  Bu yazıda mühendislik hücreleri ve sentetik kontrol ve programlanabilir malzeme yüzeylerini işlemek için E. coli mühendislik enable işlevselleştirilmiş yüzeylerin geliştirilmesi için bir dizi protokol sunar. 

Video: Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials

Bridging the Bio-Electronic Interface with Biofabrication

Advancements in lab-on-a-chip technology promise to revolutionize both research and medicine through lower costs, better sensitivity, portability, and higher throughput. The incorporation of biological components onto biological microelectromechanical systems (bioMEMS) has shown great potential for achieving these goals. Microfabricated electronic chips allow for micrometer-scale features as well as an electrical connection for sensing and actuation. Functional biological components give the system the capacity for specific detection of analytes, enzymatic functions, and whole-cell capabilities. Standard microfabrication processes and bio-analytical techniques have been successfully utilized for decades in the computer and biological industries, respectively. Their combination and interfacing in a lab-on-a-chip environment, however, brings forth new challenges. There is a call for techniques that can build an interface between the electrode and biological component that is mild and is easy to fabricate and pattern.
Biofabrication, described here, is one such approach that has shown great promise for its easy-to-assemble incorporation of biological components with versatility in the on-chip functions that are enabled. Biofabrication uses biological materials and biological mechanisms (self-assembly, enzymatic assembly) for bottom-up hierarchical assembly. While our labs have demonstrated these concepts in many formats 1,2,3, here we demonstrate the assembly process based on electrodeposition followed by multiple applications of signal-based interactions. The assembly process consists of the electrodeposition of biocompatible stimuli-responsive polymer films on electrodes and their subsequent functionalization with biological components such as DNA, enzymes, or live cells 4,5. Electrodeposition takes advantage of the pH gradient created at the surface of a biased electrode from the electrolysis of water 6,7,. Chitosan and alginate are stimuli-responsive biological polymers that can be triggered to self-assemble into hydrogel films in response to imposed electrical signals 8. The thickness of these hydrogels is determined by the extent to which the pH gradient extends from the electrode. This can be modified using varying current densities and deposition times 6,7. This protocol will describe how chitosan films are deposited and functionalized by covalently attaching biological components to the abundant primary amine groups present on the film through either enzymatic or electrochemical methods 9,10. Alginate films and their entrapment of live cells will also be addressed 11. Finally, the utility of biofabrication is demonstrated through examples of signal-based interaction, including chemical-to-electrical, cell-to-cell, and also enzyme-to-cell signal transmission. 
Both the electrodeposition and functionalization can be performed under near-physiological conditions without the need for reagents and thus spare labile biological components from harsh conditions. Additionally, both chitosan and alginate have long been used for biologically-relevant purposes 12,13. Overall, biofabrication, a rapid technique that can be simply performed on a benchtop, can be used for creating micron scale patterns of functional biological components on electrodes and can be used for a variety of lab-on-a-chip applications.

This article describes a biofabrication approach: deposition of stimuli-responsive polysaccharides in the presence of biased electrodes to create biocompatible films which can be functionalized with cells or proteins. We demonstrate a bench-top strategy for the generation of the films as well as their basic uses for creating interactive biofunctionalized surfaces for lab-on-a-chip applications.

Biofabrication ile Bio-Elektronik Arayüz Bridging

Advancements in lab-on-a-chip technology promise to revolutionize both research and medicine through lower costs, better sensitivity, portability, and ...

Biyomühendislik

Measuring the Mechanical Properties of Living Cells Using Atomic Force Microscopy

Mechanical properties of cells and extracellular matrix (ECM) play important roles in many biological processes including stem cell differentiation, tumor formation, and wound healing. Changes in stiffness of cells and ECM are often signs of changes in cell physiology or diseases in tissues. Hence, cell stiffness is an index to evaluate the status of cell cultures. Among the multitude of methods applied to measure the stiffness of cells and tissues, micro-indentation using an Atomic Force Microscope (AFM) provides a way to reliably measure the stiffness of living cells. This method has been widely applied to characterize the micro-scale stiffness for a variety of materials ranging from metal surfaces to soft biological tissues and cells. The basic principle of this method is to indent a cell with an AFM tip of selected geometry and measure the applied force from the bending of the AFM cantilever. Fitting the force-indentation curve to the Hertz model for the corresponding tip geometry can give quantitative measurements of material stiffness. This paper demonstrates the procedure to characterize the stiffness of living cells using AFM. Key steps including the process of AFM calibration, force-curve acquisition, and data analysis using a MATLAB routine are demonstrated. Limitations of this method are also discussed.

This paper demonstrates a protocol to characterize the mechanical properties of living cells by means of microindentation using an Atomic Force Microscope (AFM).

Atomik Kuvvet Mikroskobu kullanarak Yaşam Hücrelerinin Mekanik Özellikleri Ölçme

Mechanical  properties of cells and extracellular matrix (ECM) play important roles in many  biological processes including stem cell differentiation, ...

Ratiometric Biosensors that Measure Mitochondrial Redox State and ATP in Living Yeast Cells

Mitochondria have roles in many cellular processes, from energy metabolism and calcium homeostasis to control of cellular lifespan and programmed cell death. These processes affect and are affected by the redox status of and ATP production by mitochondria. Here, we describe the use of two ratiometric, genetically encoded biosensors that can detect mitochondrial redox state and ATP levels at subcellular resolution in living yeast cells. Mitochondrial redox state is measured using redox-sensitive Green Fluorescent Protein (roGFP) that is targeted to the mitochondrial matrix. Mito-roGFP contains cysteines at positions 147 and 204 of GFP, which undergo reversible and environment-dependent oxidation and reduction, which in turn alter the excitation spectrum of the protein. MitGO-ATeam is a F&ouml;rster resonance energy transfer (FRET) probe in which the &epsilon; subunit of the FoF1-ATP synthase is sandwiched between FRET donor and acceptor fluorescent proteins. Binding of ATP to the &epsilon; subunit results in conformation changes in the protein that bring the FRET donor and acceptor in close proximity and allow for fluorescence resonance energy transfer from the donor to acceptor.

We describe the use of two ratiometric, genetically encoded biosensors, which are based on GFP, to monitor mitochondrial redox state and ATP levels at subcellular resolution in living yeast cells.

Yaşam Maya Hücreleri Mitokondriyal Redoks Devlet ve ATP ölçün oranlı metrik Biyosensörler

Mitochondria have roles in many cellular processes, from energy metabolism and calcium homeostasis to control of cellular lifespan and programmed cell ...

Generation of Shear Adhesion Map Using SynVivo Synthetic Microvascular Networks

Cell/particle adhesion assays are critical to understanding the biochemical interactions involved in disease pathophysiology and have important applications in the quest for the development of novel therapeutics. Assays using static conditions fail to capture the dependence of adhesion on shear, limiting their correlation with in vivo environment. Parallel plate flow chambers that quantify adhesion under physiological fluid flow need multiple experiments for the generation of a shear adhesion map. In addition, they do not represent the in vivo scale and morphology and require large volumes (~ml) of reagents for experiments. In this study, we demonstrate the generation of shear adhesion map from a single experiment using a microvascular network based microfluidic device, SynVivo-SMN. This device recreates the complex in vivo vasculature including geometric scale, morphological elements, flow features and cellular interactions in an in vitro format, thereby providing a biologically realistic environment for basic and applied research in cellular behavior, drug delivery, and drug discovery. The assay was demonstrated by studying the interaction of the 2 &#181;m biotin-coated particles with avidin-coated surfaces of the microchip. The entire range of shear observed in the microvasculature is obtained in a single assay enabling adhesion vs. shear map for the particles under physiological conditions.

Flow chambers used in adhesion experiments typically consist of linear flow paths and require multiple experiments at different flow rates to generate a shear adhesion map. SynVivo-SMN enables the generation of shear adhesion map using a single experiment utilizing microliter volumes resulting in significant savings in time and consumables.

SynVivo Sentetik Mikrovasküler Ağları kullanma Kesme Yapışma Haritası Üretimi

Cell/particle adhesion assays are critical to understanding the biochemical interactions involved in disease pathophysiology and have important ...

Characterization Of Multi-layered Fish Scales (Atractosteus spatula) Using Nanoindentation, X-ray CT, FTIR, and SEM

The hierarchical architecture of protective biological materials such as mineralized fish scales, gastropod shells, ram&#8217;s horn, antlers, and turtle shells provides unique design principles with potentials for guiding the design of protective materials and systems in the future. Understanding the structure-property relationships for these material systems at the microscale and nanoscale where failure initiates is essential. Currently, experimental techniques such as nanoindentation, X-ray CT, and SEM provide researchers with a way to correlate the mechanical behavior with hierarchical microstructures of these material systems1-6. However, a well-defined standard procedure for specimen preparation of mineralized biomaterials is not currently available. In this study, the methods for probing spatially correlated chemical, structural, and mechanical properties of the multilayered scale of A. spatula using nanoindentation, FTIR, SEM, with energy-dispersive X-ray (EDX) microanalysis, and X-ray CT are presented.

Characterization Of Multi-layered Fish Scales Atractosteus spatula Using Nanoindentation, X-ray CT, FTIR, and SEM

This paper presents the methods used for probing spatially correlated chemical, structural, and mechanical properties of the multilayered scale of Atractosteus spatula (A. spatula) using nanoindentation, Fourier transform infrared (FTIR) spectroscopy, scanning electron microscopy (SEM), and X-ray computed tomography (X-ray CT). The experimental results have been used to investigate the design principles of protective biological materials.

Çok katmanlı Balık Ölçekler (Of Karakterizasyonu<em&gt; Atractosteus spatula</em&gt;) Nanoindentation, X-ray CT, FTIR ve SEM kullanma

The hierarchical architecture of protective biological materials such as mineralized fish scales, gastropod shells, ram&#8217;s horn, antlers, and turtle ...

Development of Amelogenin-chitosan Hydrogel for In Vitro Enamel Regrowth with a Dense Interface

Biomimetic enamel reconstruction is a significant topic in material science and dentistry as a novel approach for the treatment of dental caries or erosion. Amelogenin has been proven to be a critical protein for controlling the organized growth of apatite crystals. In this paper, we present a detailed protocol for superficial enamel reconstruction by using a novel amelogenin-chitosan hydrogel. Compared to other conventional treatments, such as topical fluoride and mouthwash, this method not only has the potential to prevent the development of dental caries but also promotes significant and durable enamel restoration. The organized enamel-like microstructure regulated by amelogenin assemblies can significantly improve the mechanical properties of etched enamel, while the dense enamel-restoration interface formed by an in situ regrowth of apatite crystals can improve the effectiveness and durability of restorations. Furthermore, chitosan hydrogel is easy to use and can suppress bacterial infection, which is the major risk factor for the occurrence of dental caries. Therefore, this biocompatible and biodegradable amelogenin-chitosan hydrogel shows promise as a biomaterial for the prevention, restoration, and treatment of defective enamel.

Development of Amelogenin-chitosan Hydrogel for In Vitro Enamel Regrowth with a Dense Interface

In this article, we describe a protocol for fabricating an amelogenin-chitosan hydrogel for superficial enamel reconstruction. Organized in situ growth of apatite crystals in the hydrogel formed a dense enamel-restoration interface, which will improve the effectiveness and durability of restorations.

Için Amelogenin-kitosan hidrojelin geliştirilmesi<em&gt; In Vitro</emBir Yoğun Arayüzü ile&gt; Emaye büyütme

Biomimetic enamel reconstruction is a significant topic in material science and dentistry as a novel approach for the treatment of dental caries or ...

Sealable Femtoliter Chamber Arrays for Cell-free Biology

Cell-free systems provide a flexible platform for probing specific networks of biological reactions isolated from the complex resource sharing (e.g., global gene expression, cell division) encountered within living cells. However, such systems, used in conventional macro-scale bulk reactors, often fail to exhibit the dynamic behaviors and efficiencies characteristic of their living micro-scale counterparts. Understanding the impact of internal cell structure and scale on reaction dynamics is crucial to understanding complex gene networks. Here we report a microfabricated device that confines cell-free reactions in cellular scale volumes while allowing flexible characterization of the enclosed molecular system. This multilayered poly(dimethylsiloxane) (PDMS) device contains femtoliter-scale reaction chambers on an elastomeric membrane which can be actuated (open and closed). When actuated, the chambers confine Cell-Free Protein Synthesis (CFPS) reactions expressing a fluorescent protein, allowing for the visualization of the reaction kinetics over time using time-lapse fluorescent microscopy. Here we demonstrate how this device may be used to measure the noise structure of CFPS reactions in a manner that is directly analogous to those used to characterize cellular systems, thereby enabling the use of noise biology techniques used in cellular systems to characterize CFPS gene circuits and their interactions with the cell-free environment.

A microfabricated device with sealable femtoliter-volume reaction chambers is described. This report includes a protocol for sealing cell-free protein synthesis reactants inside these chambers for the purpose of understanding the role of crowding and confinement in gene expression.

Hücre-serbest Biyoloji yapışmalı femtoliter Odası Diziler

Cell-free systems provide a flexible platform for probing specific networks of biological reactions isolated from the complex resource sharing (e.g., ...

Creating a Structurally Realistic Finite Element Geometric Model of a Cardiomyocyte to Study the Role of Cellular Architecture in Cardiomyocyte Systems Biology

With the advent of three-dimensional (3D) imaging technologies such as electron tomography, serial-block-face scanning electron microscopy and confocal microscopy, the scientific community has unprecedented access to large datasets at sub-micrometer resolution that characterize the architectural remodeling that accompanies changes in cardiomyocyte function in health and disease. However, these datasets have been under-utilized for&#160;investigating the role of cellular architecture remodeling in cardiomyocyte function. The purpose of this protocol is to outline how to create an accurate finite element model of a cardiomyocyte using high resolution electron microscopy and confocal microscopy images. A detailed and accurate model of cellular architecture has significant potential to provide new insights into cardiomyocyte biology, more than experiments alone can garner. The power of this method lies in its ability to computationally fuse information from two disparate imaging modalities of cardiomyocyte ultrastructure to develop one unified and detailed model of the cardiomyocyte. This protocol outlines steps to integrate electron tomography and confocal microscopy images of adult male Wistar (name for a specific breed of albino rat) rat cardiomyocytes to develop a half-sarcomere finite element model of the cardiomyocyte. The procedure generates a 3D finite element model that contains an accurate, high-resolution depiction (on the order of ~35 nm) of the distribution of mitochondria, myofibrils and ryanodine receptor clusters that release the necessary calcium for cardiomyocyte contraction from the sarcoplasmic reticular network (SR) into the myofibril and cytosolic compartment. The model generated here as an illustration does not incorporate details of the transverse-tubule architecture or the sarcoplasmic reticular network and is therefore a minimal model of the cardiomyocyte. Nevertheless, the model can already be applied in simulation-based investigations into the role of cell structure in calcium signaling and mitochondrial bioenergetics, which is illustrated and discussed using two case studies that are presented following the detailed protocol.

This protocol outlines a novel method to create a spatially detailed finite element model of the intracellular architecture of cardiomyocytes from electron microscopy and confocal microscopy images. The power of this spatially detailed model is demonstrated using case studies in calcium signaling and bioenergetics.

Cardiomyocyte sistemleri Biyoloji hücresel mimarisi rolü eğitim için bir Cardiomyocyte bir yapısal olarak gerçekçi Sonlu elemanlar geometrik Model oluşturma

With the advent of three-dimensional (3D) imaging technologies such as electron tomography, serial-block-face scanning electron microscopy and confocal ...

Measurement of Force-Sensitive Protein Dynamics in Living Cells Using a Combination of Fluorescent Techniques

Cells sense and respond to physical cues in their environment by converting mechanical stimuli into biochemically-detectable signals in a process called mechanotransduction. A crucial step in mechanotransduction is the transmission of forces between the external and internal environments. To transmit forces, there must be a sustained, unbroken physical linkage created by a series of protein-protein interactions. For a given protein-protein interaction, mechanical load can either have no effect on the interaction, lead to faster disassociation of the interaction, or even stabilize the interaction. Understanding how molecular load dictates protein turnover in living cells can provide valuable information about the mechanical state of a protein, in turn elucidating its role in mechanotransduction. Existing techniques for measuring force-sensitive protein dynamics either lack direct measurements of protein load or rely on the measurements performed outside of the cellular context. Here, we describe a protocol for the F&#246;rster resonance energy transfer-fluorescence recovery after photobleaching (FRET-FRAP) technique, which enables the measurement of force-sensitive protein dynamics within living cells. This technique is potentially applicable to any FRET-based tension sensor, facilitating the study of force-sensitive protein dynamics in variety of subcellular structures and in different cell types.

Here, we present a protocol for the simultaneous use of F&#246;rster resonance energy transfer-based tension sensors to measure protein load and fluorescence recovery after photobleaching to measure protein dynamics enabling the measurement of force-sensitive protein dynamics within living cells.

Kuvvet duyarlı Protein Dynamics floresan teknikleri bir arada kullanarak canlı hücrelerdeki ölçümü

Cells sense and respond to physical cues in their environment by converting mechanical stimuli into biochemically-detectable signals in a process called ...

A Microfluidic Platform for Stimulating Chondrocytes with Dynamic Compression

Mechanical stimuli are known to modulate biological functions of cells and tissues. Recent studies have suggested that compressive stress alters growth plate cartilage architecture and results in growth modulation of long bones of children. To determine the role of compressive stress in bone growth, we created a microfluidic device actuated by pneumatic pressure, to dynamically (or statically) compress growth plate chondrocytes embedded in alginate hydrogel cylinders. In this article, we describe detailed methods for fabricating and characterizing this device. The advantages of our protocol are: 1) Five different magnitudes of compressive stress can be generated on five technical replicates in a single platform, 2) It is easy to visualize cell morphology via a conventional light microscope, 3) Cells can be rapidly isolated from the device after compression to facilitate downstream assays, and 4) The platform can be applied to study mechanobiology of any cell type that can grow in hydrogels.

This article provides detailed methods for fabricating and characterizing a pneumatically actuating microfluidic device for chondrocyte compression.

Dinamik Sıkıştırma ile Chondrocytes Uyarıcı için Bir Mikroakışkan Platform

Mechanical stimuli are known to modulate biological functions of cells and tissues. Recent studies have suggested that compressive stress alters growth ...