Gli autori ringraziano il sostegno di premio FA9550-13-1-0108 dall&#39;Ufficio Air Force di ricerca scientifica degli Stati Uniti. Gli autori inoltre riconoscono il sostegno di premio N00014-15-1-2502 dal Office of Naval Research degli Stati Uniti, il finanziamento dell&#39;Istituto per Critical Tecnologia e Scienza Applicata presso Virginia Polytechnic Institute e State University, e dal National Science Foundation Graduate Research Fellowship Program, il numero di riconoscimento 1.607.310.

<ol>
	<li>Zhang, R., Heyde, K. C., Scott, F. Y., Paek, S. -. H., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programming+Surface+Chemistry+with+Engineered+Cells.">Programming Surface Chemistry with Engineered Cells.</a> ACS Synth. Biol. , (2016).</li><li>Zhou, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reduced+graphene+oxide+films+used+as+matrix+of+MALDI-TOF-MS+for+detection+of+octachlorodibenzo-p-dioxin.">Reduced graphene oxide films used as matrix of MALDI-TOF-MS for detection of octachlorodibenzo-p-dioxin.</a> Chem. Commun. 46, 6974-6976 (2010).</li><li>Pardee, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Low-Cost+Detection+of+Zika+Virus+Using+Programmable+Biomolecular+Components.">Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components.</a> Cell. 165, 1255-1266 (2016).</li><li>B&#228;hring, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+Sensing+Properties+of+a+Self-Assembled+Supramolecular+Oligomer.">Design and Sensing Properties of a Self-Assembled Supramolecular Oligomer.</a> Chem. Eur. J. 22, 1958-1967 (2016).</li><li>Nicolau Jr, D. V., Armitage, J. P., Maini, P. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directional+persistence+and+the+optimality+of+run-and-tumble+chemotaxis.">Directional persistence and the optimality of run-and-tumble chemotaxis.</a> Comp. Biol. Chem. 33, 269-274 (2009).</li><li>Du, J., Shao, Z., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+microbial+factories+for+synthesis+of+value-added+products.">Engineering microbial factories for synthesis of value-added products.</a> J. Ind. Microbiol. Biotechnol. 38, 873-890 (2011).</li><li>Kim, H., Kim, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electric+Field+Control+of+Bacteria-Powered+Microrobots+Using+a+Static+Obstacle+Avoidance+Algorithm.">Electric Field Control of Bacteria-Powered Microrobots Using a Static Obstacle Avoidance Algorithm.</a> IEEE Trans. Rob. 32, 125-137 (2016).</li><li>Gardner, T. S., Cantor, C. R., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+a+genetic+toggle+switch+in+Escherichia+coli.">Construction of a genetic toggle switch in Escherichia coli.</a> Nature. 403, 339-342 (2000).</li><li>Heyde, K. C., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+Host-Microbiome+Interactions+using+an+in+Silico+Model+of+Biomimetic+Robots+and+Engineered+Living+Cells.">Exploring Host-Microbiome Interactions using an in Silico Model of Biomimetic Robots and Engineered Living Cells.</a> Sci. Rep. 5, 11988 (2015).</li><li>Rice, M. K., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Creating+biological+nanomaterials+using+synthetic+biology.">Creating biological nanomaterials using synthetic biology.</a> Sci. Tech. Adv. Mater. 15, 014401 (2014).</li><li>Green, N. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin.+3.+The+nature+of+the+biotin-binding+site.">Avidin. 3. The nature of the biotin-binding site.</a> Biochem. J. 89, 599-609 (1963).</li><li>Mesulam, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tetramethyl+benzidine+for+horseradish+peroxidase+neurohistochemistry:+a+non-carcinogenic+blue+reaction+product+with+superior+sensitivity+for+visualizing+neural+afferents+and+efferents.">Tetramethyl benzidine for horseradish peroxidase neurohistochemistry: a non-carcinogenic blue reaction product with superior sensitivity for visualizing neural afferents and efferents.</a> J Histochem. Cytochem. 26, 106-117 (1978).</li><li>Litcofsky, K. D., Afeyan, R. B., Krom, R. J., Khalil, A. S., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iterative+plug-and-play+methodology+for+constructing+and+modifying+synthetic+gene+networks.">Iterative plug-and-play methodology for constructing and modifying synthetic gene networks.</a> Nat. Meth. 9, 1077-1080 (2012).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+Chemical+Synthesis,+Assembly,+and+Cloning+of+a+Mycoplasma+genitalium+Genome.">Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome.</a> Science. 319, 1215-1220 (2008).</li><li>Diamandis, E. P., Christopoulos, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biotin-(strept)avidin+system:+principles+and+applications+in+biotechnology.">The biotin-(strept)avidin system: principles and applications in biotechnology.</a> Clin. Chem. 37, 625-636 (1991).</li><li>Nerurkar, L. S., Namba, M., Brashears, G., Jacob, A. J., Lee, Y. J., Sever, J., L, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+detection+of+herpes+simplex+virus+in+clinical+specimens+by+use+of+capture+biotin-streptavidin+enzyme-linked+immunosorbent+assay.">Rapid detection of herpes simplex virus in clinical specimens by use of capture biotin-streptavidin enzyme-linked immunosorbent assay.</a> J. Clin. Micro. 20, 109-114 (1984).</li><li>Cui, Y., Wei, Q., Park, H., Lieber, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanowire+Nanosensors+for+Highly+Sensitive+and+Selective+Detection+of+Biological+and+Chemical+Species.">Nanowire Nanosensors for Highly Sensitive and Selective Detection of Biological and Chemical Species.</a> Science. 293, 1289-1292 (2001).</li></ol>

Gli autori non hanno nulla da rivelare.

Abbiamo presentato una nuova strategia per l&#39;interfacciamento cellule ingegnerizzate vive con una superficie del materiale funzionalizzato. Ciò è stato realizzato attraverso lo sviluppo di una linea cellulare in grado di sintetizzare livelli elevati di biotina quando indotta con IPTG. Gli elevati livelli di biotina possono poi essere utilizzati per modificare la superficie funzionalizzata. I protocolli dettagliati come ingegnere alla linea di cellule di E. coli e come creare due superfici funzionalizzate differenti. Passaggi critici in questo protocollo si presentano durante la costruzione della linea cellulare ingegnerizzata. Per evitare problemi a valle, che caratterizzano i ceppi cellulari ingegnerizzate con entrambe le curve di crescita (figura 2) e di risposta fluorescente (Figura 3) è incoraggiata. Dovrebbero sorgere questioni procedurali, altre strategie di clonazione molecolare, come l&#39;estrazione PCR e Gibson assemblaggio 14, possono essere sostituiti per i passi, se del caso. Per ottimizzare il Yie biotinald della linea cellulare ingegnerizzata, è fondamentale per garantire che una quantità sufficiente di DTB viene fornito alle cellule. Nei nostri studi, abbiamo scoperto che 200 ng / mL DTB suscitato un sostanziale e statisticamente significativo aumento della produzione di biotina quando le cellule sono state indotte con IPTG. Inoltre, il successo coniugazione di BSA-biotina, SA-HRP, e biotina-HRP è di fondamentale importanza per l&#39;esecuzione e il monitoraggio dei sistemi di controllo indiretti e diretti in modo efficace. Fare attenzione per evitare l&#39;esposizione inutile alla luce e consentire ai coniugati di incubare una notte a 4 ° C al fine di garantire un efficace coniugato è formato. Il nostro protocollo offre vantaggi rispetto ai metodi alternativi 15 grazie alla sua capacità di rilevare piccole quantità di biotina che sono biologicamente rilevanti (pg scala / mL) rispetto al kit di rilevazione biotina disponibili in commercio, come quelli a base di acido 4&#39;-hydroxyazobenzene-2-carbossilico strategie di legame competitivo. Sebbene l&#39;utilizzo della streptavidina-bioSistema di stagno è comune nel settore delle biotecnologie 16, 17, la capacità del nostro sistema di rispondere a piccole quantità di biotina ci permette di collegare direttamente la nostra linea di cellule geneticamente modificato con la superficie funzionalizzata. Una potenziale limitazione del nostro protocollo è la gamma dinamica risultante di rilevamento biotina. Negli schemi di controllo indiretti e diretti, siamo in grado di rilevare la biotina tra i 10 -10 2 3 4 e 10 -10 6 pg / mL, rispettivamente (Figura 4). Fortunatamente, la gamma bassa dello schema di controllo indiretto permette di rilevare facilmente la produzione di biotina da cellule ingegnerizzate. Tuttavia, la stretta fascia della gamma dinamica controllo indiretto limita la sua capacità di percepire grandi variazioni (100 volte) in concentrazioni di biotina. Alterare la gamma dinamica per entrambi gli schemi di controllo diretti e indiretti richiederebbe engineering addizionale. Tuttavia, se il rilevamento di cellule produconod biotina è un problema, preparare diluizioni del surnatante biotina al punto 4.6 dovrebbe consentire al ricercatore di indirizzare la gamma dinamica del sistema di controllo indiretto (Figura 5). Abbiamo scoperto che una diluizione 1: 5 del surnatante ci ha permesso di raggiungere in modo efficace la gamma dinamica del sistema di controllo indiretto. Questa strategia diluizione deve alleviare la necessità di modificare direttamente la gamma dinamica. Le due parti, sistema cellulare materiale qui presentato permette ingegnerizzato cellule di modificare la composizione di una superficie funzionalizzata. , le cellule viventi dinamici in grado di interpretare l&#39;ambiente circostante chimici per produrre una risposta genetica. Mediante ingegneria genetica questa risposta per aumentare la produzione di biotina, possiamo dotare cellule viventi ingegnerizzate con la capacità di controllare e manipolare una superficie funzionalizzata. Seguendo i protocolli presentati, cellule ingegnerizzate sono in grado di agire sensori dinamici, capaci di lettura, elaborazione e registrazione delle condizioni intorno them tramite interfacce funzionalizzate. Questa tecnologia potrebbe avere un impatto campi che vanno dalla medicina molecolare per il rilevamento analiti per la bonifica ambientale.

Qui, si riportano le procedure per sviluppare un substrato programmabile capace di rispondere ad un segnale chimico da una linea cellulare ingegnerizzata. 1 Facciamo questo con la creazione di una interfaccia biotina-streptavidina che risponde alla biotina prodotta da coli sinteticamente ingegnerizzato Escherichia (E. coli) cellule. In precedenza, le superfici programmabili sono stati progettati per una vasta gamma di applicazioni, dalla rilevazione della tossina 2 e point-of-care diagnosi 3 di difesa e sicurezza. 4 Mentre superfici programmabili possono essere utili come sensori e attuatori, possono essere fatti &quot;intelligenti&quot; di dotandoli la capacità di adattarsi a differenti sfide ambientali. Al contrario, anche microrganismi semplici, come E. coli, hanno adattabilità intrinseca e sono in grado di rispondere alle sfide con soluzioni sofisticate e spesso inaspettati. Questa capacità di adattamento ha permesso E.popolazioni coli, controllate dai loro reti geniche complesse, a costi contenuti cercare risorse, 5 creare prodotti a valore aggiunto, 6 e perfino la robotica micro-scala di potenza. 7 Accoppiando i vantaggi adattivi di cellule viventi con l&#39;uso di superfici programmabili, possiamo creare un substrato intelligente in grado di rispondere alle diverse condizioni ambientali. Biologia sintetica ha dato ricercatori nuove capacità di programmare il comportamento degli organismi viventi. Da Engineering cellule di contenere reti di regolazione nuovo gene, i ricercatori possono progettare le cellule che presentano una serie di comportamenti programmati. 8, 9 Al di là della ricerca di base, questi comportamenti possono essere utilizzati per applicazioni come il controllo assemblaggio materiale e biologicamente la produzione di prodotti a valore aggiunto. 10 Qui, abbiamo dettaglio come abbiamo utilizzato gli strumenti della biologia sintetica per itgineer un ceppo di E. coli che sintetizza biotina su di induzione. Questo ceppo è stato sviluppato utilizzando metodi enzima di restrizione di clonazione per assemblare un plasmide, pKE1-lacI-bioB. Questo plasmide, quando trasformato in ceppo di E. coli K-12 MG1655, conferisce cellule con la capacità di esprimere livelli elevati di bioB, un enzima essenziale per la sintesi biotina. Quando le cellule trasformate sono state indotte con isopropil β-D-1-thiogalactopyranoside (IPTG) e provvisto di un precursore biotina, desthiobiotin (DTB), sono stati prodotti livelli elevati di biotina. interazione Legame di biotina con streptavidina è uno dei più forti legami non covalenti presenti in natura. Come tale, l&#39;interazione biotina-streptavidina è sia ben caratterizzati e altamente impiegati in biotecnologia. 11 All&#39;interno di questo manoscritto, presentiamo due strategie che impiegano l&#39;interazione biotina-streptavidina per rilevare e rilevare biotina cellule-prodotto con una superficie funzionalizzata. Noifare riferimento a queste superfici contrastanti come schemi di controllo &quot;diretto&quot; &quot;indiretti&quot; e. Nello schema controllo indiretto, biotina cellule prodotte compete con biotina che è stato coniugato e immobilizzato su una superficie polistirolo da streptavidina siti di legame. Inoltre, la streptavidina è coniugato con perossidasi di rafano (HRP). HRP modifica 3, 3 &#39;, 5, 5&#39;-tetrametilbenzidina (TMB), per produrre un segnale ottico, 12 che possono essere monitorato quantificando l&#39;assorbanza spettrale (cioè, densità ottica) a 450 nm (OD 450). Così, il sistema di controllo indiretto consente ai ricercatori di misurare biotina cellule-prodotto dal monitoraggio del attentuation del segnale OD 450. Lo schema di controllo diretto sfrutta l&#39;evento streptavidina-biotina immobilizzando streptavidina direttamente ad una superficie del materiale e consentendo biotina cellule prodotte e HRP biotinilato a competere per streptavidina siti di legame. Ancora una volta, lalivelli relativi di biotina cellule prodotte sono monitorati misurando un segnale OD 450. Nel loro insieme, le cellule ingegnerizzate e le superfici funzionalizzate ci permettono di controllare le proprietà di una superficie programmabili inducendo reti nelle cellule viventi. In altre parole, abbiamo creato un sistema che sfrutta l&#39;adattabilità degli organismi viventi e l&#39;affidabilità e la specificazione di un&#39;interfaccia materiale ingegnerizzato collegando questi sistemi.

<table border="0" cellpadding="0" cellspacing="0" width="1072">
	<tbody>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">LB Broth, Miller&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">12-795-027</td>
			<td style="width:219px;"></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Agar</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP9744500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Carbenicillin&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP26481</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">M9, Minimimal Salts, 5X</td>
			<td style="width:209px;">Sigma-Aldrich</td>
			<td style="width:119px;">M6030</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Casamino Acids&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP1424-100</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Magnesium Sulfate, Anhydrous</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">M65-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Calcium Chloride, Dihydrate</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">C79-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Dextrose (D-Glucose), Anhydrous</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">D16-1</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">NEB Turbo Cell Line</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">C2984l</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Oligonucleotide Primers</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">N/A</td>
			<td>25N synthesis, DSL purification</td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Q5 High-Fidelity Polymerase</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">M0491S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Q5 Reaction Buffer</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">B9027S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">dNTP Solution Mix</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">N0447S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Agarose</td>
			<td style="width:209px;">Bioexpress</td>
			<td style="width:119px;">E-3120-125</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Ethidium Bromide, 1%</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP1302-10</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Gel Extraction Kits</td>
			<td style="width:209px;">Epoch Biolabs</td>
			<td style="width:119px;">2260250</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">GenCatch Plasmid DNA Miniprep Kit</td>
			<td style="width:209px;">Epoch Biolabs</td>
			<td style="width:119px;">2160250</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">AatII</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">R0117S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">SacII</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">R0157S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">HindIII-HF</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">R3104S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">EcoRI-HF</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">R3101S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Cutsmart Buffer</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">B7204S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">T4 DNA Ligase</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">M0202S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">T4 DNA Ligase Reaction Buffer</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">B0202S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">ColiRolle Glass Plating Beads&#160;</td>
			<td style="width:209px;">EMD Millipore</td>
			<td style="width:119px;">7101-3</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Glycerol</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP229-1</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Isopropyl &#946;-D-1-thiogalactopyranoside (IPTG)</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP1755-10</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">NHS-Desthiobiotin (DTB)</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">16129</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Succinimidyl Trans-4-(maleimidylmethyl) Cyclohexane-1-Carboxylate (SMCC)&#160;</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">S1534</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Dimethyl Sulfoxide (DMSO)&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP231-100</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Succinimidyl 3-(2-pyridyldithio) Propionate (SPDP)&#160;</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">S1531</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">NHS-LC-LC-biotin</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">21343</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Horseradish Peroxidase (HRP)&#160;</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">31490</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Phosphate Buffered Saline (PBS), 10X Solution</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP399500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Streptavidin (SA)&#160;</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">21145</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Bovine Serum Albumin (BSA)</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP1600-100</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Dithiothreitol (DTT)</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP172-5</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Ethylenediaminetetaacetic acid (EDTA)&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">S311-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Tween 80&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">T164-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Hydrogen Peroxide</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">H325-4</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">3, 3&#39;, 5, 5&#39;-tetramethylbenzidine (TMB)</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">AC229280050</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Vivaspin 500 Centrifugal Concentrators&#160;</td>
			<td style="width:209px;">Viva Products</td>
			<td style="width:119px;">VS0192</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Sodium Acetate, Anhydrous</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP333-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">96-Well Polystyrene Plates</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">266120</td>
			<td></td>
		</tr>
	</tbody>
</table>

using synthetic biology to engineer living cells that interface with programmable materials

Abbiamo sviluppato un&#39;interfaccia abiotico-biotici che permette alle cellule ingegnerizzate per controllare le proprietà del materiale di una superficie funzionalizzata. Questo sistema è composto creando due moduli: un ceppo sinteticamente stratificato di cellule di E. coli e un&#39;interfaccia materiale funzionalizzato. All&#39;interno di questo documento, i dettagli di un protocollo per l&#39;ingegneria genetica comportamenti selezionati all&#39;interno di un ceppo di E. coli che utilizzano strategie di clonazione molecolare. Una volta sviluppato, questo ceppo produce livelli elevati di biotina quando esposti ad un induttore chimico. Inoltre, noi dettaglio protocolli per creare due superfici funzionalizzate differenti, ognuno dei quali è in grado di rispondere alla biotina cellule sintetizzato. Nel loro insieme, presentiamo una metodologia per la creazione di un sistema collegato, abiotici-biotici che permette progettato cellule per controllare la composizione dei materiali e il montaggio su substrati non viventi.

Risultati rappresentativi sono presentati nelle cinque figure allegate. In primo luogo, vi presentiamo il processo di clonazione verrà visualizzata graficamente (figura 1), in modo che il lettore possa seguire visivamente i passaggi critici per la creazione del sinteticamente ingegnerizzato ceppo di E. coli. Per caratterizzare la dinamica di popolazione delle cellule, forniamo una curva di crescita (figura 2) generato misurando la densità ottica a 600 nm (OD 600) della popolazione. Poi, si mostra come la rete gene regolatore è verificato, utilizzando mCherry come proxy per bioB (Figura 3), che permette di misurare otticamente la quantità relativa di bioB che sarebbe prodotta dalla cellula su induzione con IPTG. In seguito, presentiamo dati di risposta per l&#39;indiretto di controllo e le superfici funzionalizzate-controllo diretto. Questi grafici dei dati (Figura 4) sono stati sviluppati utilizzando soluzioni misurati del liberobiotina per caratterizzare i profili di risposta delle superfici funzionalizzate. Infine, presentiamo dati caratteristici che mostrano come le cellule ingegnerizzate sono indotte a produrre biotina (Figura 5), modificando così le superfici funzionalizzate. <img alt="Figura 1" src="/files/ftp_upload/55300/55300fig1.jpg" /> Figura 1: Progettazione e Costruzione di inducibili, cellule ingegnerizzate. (A) I primer sono stati progettati per isolare il gene bioB dal genoma di E. coli, che codifica un enzima cruciale nella via di sintesi biotina. (B) Il P L, teto-1 e P -lacI sequenze TRC-2 può essere isolato da un plasmide contenente un interruttore genetico con primer corrispondenti. (C) Il gene bioB estratto e due frammenti del commutatore possono essere utilizzati per creare il circuito gene. L&#39;aggiunta di IPTG possono poi indUCE l&#39;espressione di bioB e sintesi così biotina quando viene aggiunto DTB come substrato per bioB. (D) Il plasmide assemblata è stata trasformata in K-12 MG1655 E. coli. Questo ha causato la presenza di IPTG per indurre l&#39;espressione di bioB e sintesi così biotina dalla linea cellulare ingegnerizzata quando DTB è stato fornito come substrato. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig1large.jpg" target="_blank">Clicca qui per vedere una versione più grande di questa figura.</a> <img alt="figura 2" src="/files/ftp_upload/55300/55300fig2.jpg" /> Figura 2: curve di crescita per cellule ingegnerizzate. I, inducibili MG1655 cellule wild-type ingegnerizzati sono state coltivate e monitorate nei media minima (cioè, senza biotina M9 media), così come i media minime integrato con DTB (200 ng / mL) e / o di IPTG (0,5 mm). I grafici mostrano la lettura OD 600, misurata ogni 5 mi<html> n per 24 h. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig2large.jpg" target="_blank">Clicca qui per vedere una versione più grande di questa figura.</a> <img alt="Figura 3" src="/files/ftp_upload/55300/55300fig3.jpg" /> Figura 3: Test del Gene Network Engineered. La proteina fluorescente mCherry stato utilizzato al posto del bioB gene in modo da poter otticamente misurare il profilo di induzione quando le cellule ingegnerizzate sono state indotte con IPTG. Ci confrontiamo le cellule indotte con IPTG (diamanti rossi) con le cellule non indotte con IPTG (diamanti blu). Questi risultati dimostrano l&#39;efficacia della rete gene inducibile. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig3large.jpg" target="_blank">Clicca qui per vedere una versione più grande di questa figura.</a> /55300/55300fig4.jpg &quot;/&gt; Figura 4: Verifica della funzionalizzato materiale di interfaccia. Esponendo nostra superficie funzionalizzata a concentrazioni variabili di biotina, siamo in grado di misurare la risposta ottica misurando OD 450 assorbanza. Questi risultati ci permettono di generare una curva di calibrazione, che collega la concentrazione di biotina all&#39;intensità ottica della risposta. Qui, vi presentiamo la biotina contro le curve dei segnali ottici per entrambi i regimi di superficie indiretta (a sinistra) e diretta (a destra) funzionalizzati. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig4large.jpg" target="_blank">Clicca qui per vedere una versione più grande di questa figura.</a> <img alt="Figura 5" src="/files/ftp_upload/55300/55300fig5.jpg" /> Figura 5: Engineered cellule di controllo di interfaccia materiale. Utilizzando sezioni di protocollo 5 o 6, siamo in grado di utilizzare i prodotti di indotto, ingegnerizzato cells di modificare chimicamente la superficie funzionalizzata. Siamo in grado di monitorare queste risposte otticamente misurando OD 450. Inoltre, utilizzando la curva di taratura sviluppata nella figura 4, possiamo collegare l&#39;intensità ottica della risposta alla biotina all&#39;interno della concentrazione. Presentiamo qui le diverse concentrazioni di biotina, misurate dal nostro schema funzionalizzata superficie di controllo indiretto, per le cellule wild-type (bianco), cellule non indotte contenenti il ​​plasmide pKE1-lacI-bioB (arancione), e le cellule indotte contenenti il ​​pKE1-lacI-bioB plasmide (grigio). <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig5large.jpg" target="_blank">Clicca qui per vedere una versione più grande di questa figura.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> chimico </td><td> Concentrazione finale </td><td> Quantità </td></tr><tr><td> sali 5x M9 </td><td> 1x </td><td> 20 mL </td></tr><tr><td> 1 M MgSO 4 </td><td> 2 mm </td><td> 200 ml </td></tr><tr><td> 1 M CaCl 2 </td><td> 0,1 mm </td><td> 10 microlitri </td></tr><tr><td> 20% di glucosio </td><td> 0,40% </td><td> 2 ml </td></tr><tr><td> L&#39;acido Casamino senza biotina 2% </td><td> 0,02% </td><td> 1 mL </td></tr><tr><td> DI acqua </td><td> N / A </td><td> 76,8 mL </td></tr></tbody></table> Tabella 1: M9 media ricetta. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Nome </td><td colspan="2"> Sequenza Primer </td><td> uso </td></tr><tr><td> 1-F </td><td colspan="2"> CCGCCGGAATTCTCCCTATCAGTGATAGAGATT </td><td> Estrazione cassetta lacI </td></tr><tr><td> 1-r </td><td colspan="2"> CCGACGTCTCACTGCCCGCTTTCCAGTC </td><td> Estrazione cassetta lacI </td></tr><tr><td> nBioB1-f </td><td colspan="2"> CCCAAGCTTCTGAAATGAGCTGTTGACAATTAATCAT </td><td> P TRC-2 di estrazione </td></tr><tr><td> nBioB1-r </td><td colspan="2"> GGGGGGTTCTTTTAATAAAGGTACCGTGTGAAATTGTT </td><td> P TRC-2 di estrazione </td></tr><tr><td> nBioB2-f1 </td><td colspan="2"> ACCCCCCTAAGGAGGTCATCATGGCTCACCGCCCACG </td><td> estrazione bioB </td></tr><tr><td> nBioB2-r </td><td colspan="2"> TCCCCGCGGTCATAATGCTGCCGCGTTGTAATATTC </td><td> estrazione bioB </td></tr><tr><td> nBioB2-f2 </td><td colspan="2"> ACGGTACCTTTATTAAAAGAACCCCCCTAAGGAGGTCATC </td><td> Inoltre RBS sintetico </td></tr></tbody></table> Tabella 2: Elenco di primer. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td&gt; Fase 1 </td><td> Passo 2 </td><td> fase 3 </td><td> fase 4 </td><td> fase 5 </td><td> passo 6 </td><td> passo 7 </td><td> step 8 </td><td> passo 9 </td></tr><tr><td> 98 ° C </td><td> 98 ° C </td><td> 70 ° C </td><td> 72 ° C </td><td> 98 ° C </td><td> 60 ° C </td><td> 72 ° C </td><td> 72 ° C </td><td> 4 ° C </td></tr><tr><td> 00:30 </td><td> 00:10 </td><td> 00:30 </td><td> 01: 00 / kb </td><td> 00:10 </td><td> 00:30 </td><td> 01: 00 / kb </td><td> 02:00 </td><td> ∞ </td></tr><tr><td rowspan="2"></td><td colspan="3"> Ripetere 12 volte </td><td colspan="3" rowspan="2"> Ripetere 25 volte </td><td colspan="2" rowspan="2"></td></tr><tr><td colspan="3"> -1 ° C / ciclo </td></tr></tbody></table>Tabella 3: programma PCR. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Nome </td><td> Volume </td></tr><tr><td> Lisato (template) </td><td> 10 microlitri </td></tr><tr><td> Primer (ciascuno) </td><td> 0,625 ml (ciascuno) </td></tr><tr><td> tampone Q5 5x </td><td> 5 ml </td></tr><tr><td> Q5 polimerasi </td><td> 0,25 ml </td></tr><tr><td> dNTP Mix </td><td> 0,5 ml </td></tr><tr><td> DI acqua </td><td> 6.75 ml </td></tr></tbody></table> Tabella 4: Tutta la cella PCR Reazione (25 mL). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Nome </td><td> Volume </td></tr><tr><td> 10x tampone di reazione </td><td> 5 ml </td></tr><tr><td> Enzyme 1 </td><td> 1 ml </td></tr><tr><td> Enzyme 2 </td><td> 1 ml </td></tr><tr><td> DNA template </td><td> 1 mcg </td></tr><tr><td> DI acqua </td><td> 43 ml - volume di DNA </td></tr></tbody></table> Tabella 5: enzimi di restrizione di reazione (50 mL). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Nome </td><td> Volume </td></tr><tr><td> DNA </td><td> 50 mcg vettore + X mcg inserto </td></tr><tr><td> 10x Ligase Buffer </td><td> 1 ml </td></tr><tr><td> T4 ligasi </td><td> 1 ml </td></tr><tr><td> DI acqua </td><td> 8 ml - volume di DNA </td></tr></tbody></table>Tabella 6: legatura di reazione (10 ml). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Nome </td><td> Concentrazione </td><td> Gli appunti </td></tr><tr><td> CaCl 2 </td><td> 100 mM </td><td></td></tr><tr><td> Carbeniccilin </td><td> 50 mg / ml (1000x) </td><td></td></tr><tr><td> DTB </td><td> 50 mg / ml </td><td></td></tr><tr><td> IPTG </td><td> 0.5 M </td><td></td></tr><tr><td> SMCC </td><td> 20 mg / ml </td><td> 2 mg in 100uL DMSO </td></tr><tr><td> SPDP </td><td> 20 mg / ml </td><td> 2 mg in 100uL DMSO </td></tr><tr><td> LC-LC-biotina </td><td> 20 mg / ml </td><td> 2 mg in 100uL DMSO </td></tr><tr><td> HRP </td><td> 10 mg / ml </td><td> in PBS </td></tr><tr><td> SA (indiretto) </td><td> 10 mg / ml </td><td> in PBS </td></tr><tr><td> SA (diretta) </td><td> 0,17 mg / mL </td><td> in PBS </td></tr><tr><td> BSA </td><td> 20 mg / ml </td><td> in PBS </td></tr><tr><td> digitale terrestre </td><td> 100mM </td><td> In DI Acqua </td></tr><tr><td> EDTA </td><td> 5 mM </td><td> 18,6 mg in 10 ml di PBS </td></tr><tr><td> Caseina </td><td> 0,50% </td><td> in PBS </td></tr><tr><td> Tween 80 </td><td> 20% </td><td> In DI Acqua </td></tr><tr><td> Tween 80 in PBS </td><td> 0,05% </td><td></td></tr><tr><td> Acetato di sodio </td><td> 50 mm </td><td> In DI Acqua, Regolare al 5,1 pH con 3 M HCl </td></tr><tr><td> TMB </td><td> 1% </td><td> In DMSO </td></tr><tr><td> H 2 O 2 </td><td> 3% </td><td> In DI Acqua </td></tr><tr><td> H 2 SO 4 </td><td> 2 M </td><td> In DI Acqua </td></tr></tbody></table>Tabella 7: Elenco dei reagenti Solutions.

Watch this Scientific Journal Video about Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials at JoVE.com

Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials

Questo documento presenta una serie di protocolli per lo sviluppo di cellule ingegnerizzate e superfici funzionalizzate che consentono sinteticamente progettati E. coli di controllare e manipolare superfici materiche programmabili.

Utilizzando biologia sintetica per Ingegnere cellule viventi che si interfacciano con materiali programmabili

We have developed an abiotic-biotic interface that allows engineered cells to control the material properties of a functionalized surface. This system is ...

using-synthetic-biology-to-engineer-living-cells-that-interface-with

Nanyang Technological University

Research

JoVE Journal

Bioengineering

8.8K Views.  Carnegie Mellon University.  Questo documento presenta una serie di protocolli per lo sviluppo di cellule ingegnerizzate e superfici funzionalizzate che consentono sinteticamente progettati E. coli di controllare e manipolare superfici materiche programmabili. 

Video: Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials

Bridging the Bio-Electronic Interface with Biofabrication

Advancements in lab-on-a-chip technology promise to revolutionize both research and medicine through lower costs, better sensitivity, portability, and higher throughput. The incorporation of biological components onto biological microelectromechanical systems (bioMEMS) has shown great potential for achieving these goals. Microfabricated electronic chips allow for micrometer-scale features as well as an electrical connection for sensing and actuation. Functional biological components give the system the capacity for specific detection of analytes, enzymatic functions, and whole-cell capabilities. Standard microfabrication processes and bio-analytical techniques have been successfully utilized for decades in the computer and biological industries, respectively. Their combination and interfacing in a lab-on-a-chip environment, however, brings forth new challenges. There is a call for techniques that can build an interface between the electrode and biological component that is mild and is easy to fabricate and pattern.
Biofabrication, described here, is one such approach that has shown great promise for its easy-to-assemble incorporation of biological components with versatility in the on-chip functions that are enabled. Biofabrication uses biological materials and biological mechanisms (self-assembly, enzymatic assembly) for bottom-up hierarchical assembly. While our labs have demonstrated these concepts in many formats 1,2,3, here we demonstrate the assembly process based on electrodeposition followed by multiple applications of signal-based interactions. The assembly process consists of the electrodeposition of biocompatible stimuli-responsive polymer films on electrodes and their subsequent functionalization with biological components such as DNA, enzymes, or live cells 4,5. Electrodeposition takes advantage of the pH gradient created at the surface of a biased electrode from the electrolysis of water 6,7,. Chitosan and alginate are stimuli-responsive biological polymers that can be triggered to self-assemble into hydrogel films in response to imposed electrical signals 8. The thickness of these hydrogels is determined by the extent to which the pH gradient extends from the electrode. This can be modified using varying current densities and deposition times 6,7. This protocol will describe how chitosan films are deposited and functionalized by covalently attaching biological components to the abundant primary amine groups present on the film through either enzymatic or electrochemical methods 9,10. Alginate films and their entrapment of live cells will also be addressed 11. Finally, the utility of biofabrication is demonstrated through examples of signal-based interaction, including chemical-to-electrical, cell-to-cell, and also enzyme-to-cell signal transmission. 
Both the electrodeposition and functionalization can be performed under near-physiological conditions without the need for reagents and thus spare labile biological components from harsh conditions. Additionally, both chitosan and alginate have long been used for biologically-relevant purposes 12,13. Overall, biofabrication, a rapid technique that can be simply performed on a benchtop, can be used for creating micron scale patterns of functional biological components on electrodes and can be used for a variety of lab-on-a-chip applications.

This article describes a biofabrication approach: deposition of stimuli-responsive polysaccharides in the presence of biased electrodes to create biocompatible films which can be functionalized with cells or proteins. We demonstrate a bench-top strategy for the generation of the films as well as their basic uses for creating interactive biofunctionalized surfaces for lab-on-a-chip applications.

Colmare il Bio-Electronic Interface con Biofabrication

Advancements in lab-on-a-chip technology promise to revolutionize both research and medicine through lower costs, better sensitivity, portability, and ...

Ricerca

Bioingegneria

Measuring the Mechanical Properties of Living Cells Using Atomic Force Microscopy

Mechanical properties of cells and extracellular matrix (ECM) play important roles in many biological processes including stem cell differentiation, tumor formation, and wound healing. Changes in stiffness of cells and ECM are often signs of changes in cell physiology or diseases in tissues. Hence, cell stiffness is an index to evaluate the status of cell cultures. Among the multitude of methods applied to measure the stiffness of cells and tissues, micro-indentation using an Atomic Force Microscope (AFM) provides a way to reliably measure the stiffness of living cells. This method has been widely applied to characterize the micro-scale stiffness for a variety of materials ranging from metal surfaces to soft biological tissues and cells. The basic principle of this method is to indent a cell with an AFM tip of selected geometry and measure the applied force from the bending of the AFM cantilever. Fitting the force-indentation curve to the Hertz model for the corresponding tip geometry can give quantitative measurements of material stiffness. This paper demonstrates the procedure to characterize the stiffness of living cells using AFM. Key steps including the process of AFM calibration, force-curve acquisition, and data analysis using a MATLAB routine are demonstrated. Limitations of this method are also discussed.

This paper demonstrates a protocol to characterize the mechanical properties of living cells by means of microindentation using an Atomic Force Microscope (AFM).

Misurare le proprietà meccaniche del Living cellule utilizzando microscopia a forza atomica

Mechanical  properties of cells and extracellular matrix (ECM) play important roles in many  biological processes including stem cell differentiation, ...

Ratiometric Biosensors that Measure Mitochondrial Redox State and ATP in Living Yeast Cells

Mitochondria have roles in many cellular processes, from energy metabolism and calcium homeostasis to control of cellular lifespan and programmed cell death. These processes affect and are affected by the redox status of and ATP production by mitochondria. Here, we describe the use of two ratiometric, genetically encoded biosensors that can detect mitochondrial redox state and ATP levels at subcellular resolution in living yeast cells. Mitochondrial redox state is measured using redox-sensitive Green Fluorescent Protein (roGFP) that is targeted to the mitochondrial matrix. Mito-roGFP contains cysteines at positions 147 and 204 of GFP, which undergo reversible and environment-dependent oxidation and reduction, which in turn alter the excitation spectrum of the protein. MitGO-ATeam is a F&ouml;rster resonance energy transfer (FRET) probe in which the &epsilon; subunit of the FoF1-ATP synthase is sandwiched between FRET donor and acceptor fluorescent proteins. Binding of ATP to the &epsilon; subunit results in conformation changes in the protein that bring the FRET donor and acceptor in close proximity and allow for fluorescence resonance energy transfer from the donor to acceptor.

We describe the use of two ratiometric, genetically encoded biosensors, which are based on GFP, to monitor mitochondrial redox state and ATP levels at subcellular resolution in living yeast cells.

Biosensori MIL Tale misura mitocondriale stato redox e ATP in cellule viventi di lievito

Mitochondria have roles in many cellular processes, from energy metabolism and calcium homeostasis to control of cellular lifespan and programmed cell ...

Generation of Shear Adhesion Map Using SynVivo Synthetic Microvascular Networks

Cell/particle adhesion assays are critical to understanding the biochemical interactions involved in disease pathophysiology and have important applications in the quest for the development of novel therapeutics. Assays using static conditions fail to capture the dependence of adhesion on shear, limiting their correlation with in vivo environment. Parallel plate flow chambers that quantify adhesion under physiological fluid flow need multiple experiments for the generation of a shear adhesion map. In addition, they do not represent the in vivo scale and morphology and require large volumes (~ml) of reagents for experiments. In this study, we demonstrate the generation of shear adhesion map from a single experiment using a microvascular network based microfluidic device, SynVivo-SMN. This device recreates the complex in vivo vasculature including geometric scale, morphological elements, flow features and cellular interactions in an in vitro format, thereby providing a biologically realistic environment for basic and applied research in cellular behavior, drug delivery, and drug discovery. The assay was demonstrated by studying the interaction of the 2 &#181;m biotin-coated particles with avidin-coated surfaces of the microchip. The entire range of shear observed in the microvasculature is obtained in a single assay enabling adhesion vs. shear map for the particles under physiological conditions.

Flow chambers used in adhesion experiments typically consist of linear flow paths and require multiple experiments at different flow rates to generate a shear adhesion map. SynVivo-SMN enables the generation of shear adhesion map using a single experiment utilizing microliter volumes resulting in significant savings in time and consumables.

Generazione di Shear Adesione mappa usando SynVivo reti microvascolari sintetico

Cell/particle adhesion assays are critical to understanding the biochemical interactions involved in disease pathophysiology and have important ...

Characterization Of Multi-layered Fish Scales (Atractosteus spatula) Using Nanoindentation, X-ray CT, FTIR, and SEM

The hierarchical architecture of protective biological materials such as mineralized fish scales, gastropod shells, ram&#8217;s horn, antlers, and turtle shells provides unique design principles with potentials for guiding the design of protective materials and systems in the future. Understanding the structure-property relationships for these material systems at the microscale and nanoscale where failure initiates is essential. Currently, experimental techniques such as nanoindentation, X-ray CT, and SEM provide researchers with a way to correlate the mechanical behavior with hierarchical microstructures of these material systems1-6. However, a well-defined standard procedure for specimen preparation of mineralized biomaterials is not currently available. In this study, the methods for probing spatially correlated chemical, structural, and mechanical properties of the multilayered scale of A. spatula using nanoindentation, FTIR, SEM, with energy-dispersive X-ray (EDX) microanalysis, and X-ray CT are presented.

Characterization Of Multi-layered Fish Scales Atractosteus spatula Using Nanoindentation, X-ray CT, FTIR, and SEM

This paper presents the methods used for probing spatially correlated chemical, structural, and mechanical properties of the multilayered scale of Atractosteus spatula (A. spatula) using nanoindentation, Fourier transform infrared (FTIR) spectroscopy, scanning electron microscopy (SEM), and X-ray computed tomography (X-ray CT). The experimental results have been used to investigate the design principles of protective biological materials.

Caratterizzazione di Fish Scales Sovrapposizione (<em&gt; Atractosteus spatola</em&gt;) Usando Nanoindentazione, X-ray CT, FTIR e SEM

The hierarchical architecture of protective biological materials such as mineralized fish scales, gastropod shells, ram&#8217;s horn, antlers, and turtle ...

Development of Amelogenin-chitosan Hydrogel for In Vitro Enamel Regrowth with a Dense Interface

Biomimetic enamel reconstruction is a significant topic in material science and dentistry as a novel approach for the treatment of dental caries or erosion. Amelogenin has been proven to be a critical protein for controlling the organized growth of apatite crystals. In this paper, we present a detailed protocol for superficial enamel reconstruction by using a novel amelogenin-chitosan hydrogel. Compared to other conventional treatments, such as topical fluoride and mouthwash, this method not only has the potential to prevent the development of dental caries but also promotes significant and durable enamel restoration. The organized enamel-like microstructure regulated by amelogenin assemblies can significantly improve the mechanical properties of etched enamel, while the dense enamel-restoration interface formed by an in situ regrowth of apatite crystals can improve the effectiveness and durability of restorations. Furthermore, chitosan hydrogel is easy to use and can suppress bacterial infection, which is the major risk factor for the occurrence of dental caries. Therefore, this biocompatible and biodegradable amelogenin-chitosan hydrogel shows promise as a biomaterial for the prevention, restoration, and treatment of defective enamel.

Development of Amelogenin-chitosan Hydrogel for In Vitro Enamel Regrowth with a Dense Interface

In this article, we describe a protocol for fabricating an amelogenin-chitosan hydrogel for superficial enamel reconstruction. Organized in situ growth of apatite crystals in the hydrogel formed a dense enamel-restoration interface, which will improve the effectiveness and durability of restorations.

Sviluppo di amelogenina-chitosano Hydrogel per<em&gt; In Vitro</em&gt; Smalto ricrescita con una interfaccia Dense

Biomimetic enamel reconstruction is a significant topic in material science and dentistry as a novel approach for the treatment of dental caries or ...

Sealable Femtoliter Chamber Arrays for Cell-free Biology

Cell-free systems provide a flexible platform for probing specific networks of biological reactions isolated from the complex resource sharing (e.g., global gene expression, cell division) encountered within living cells. However, such systems, used in conventional macro-scale bulk reactors, often fail to exhibit the dynamic behaviors and efficiencies characteristic of their living micro-scale counterparts. Understanding the impact of internal cell structure and scale on reaction dynamics is crucial to understanding complex gene networks. Here we report a microfabricated device that confines cell-free reactions in cellular scale volumes while allowing flexible characterization of the enclosed molecular system. This multilayered poly(dimethylsiloxane) (PDMS) device contains femtoliter-scale reaction chambers on an elastomeric membrane which can be actuated (open and closed). When actuated, the chambers confine Cell-Free Protein Synthesis (CFPS) reactions expressing a fluorescent protein, allowing for the visualization of the reaction kinetics over time using time-lapse fluorescent microscopy. Here we demonstrate how this device may be used to measure the noise structure of CFPS reactions in a manner that is directly analogous to those used to characterize cellular systems, thereby enabling the use of noise biology techniques used in cellular systems to characterize CFPS gene circuits and their interactions with the cell-free environment.

A microfabricated device with sealable femtoliter-volume reaction chambers is described. This report includes a protocol for sealing cell-free protein synthesis reactants inside these chambers for the purpose of understanding the role of crowding and confinement in gene expression.

Array sigillabile Femtoliter camera di Biologia gratis-Cell

Cell-free systems provide a flexible platform for probing specific networks of biological reactions isolated from the complex resource sharing (e.g., ...

Creating a Structurally Realistic Finite Element Geometric Model of a Cardiomyocyte to Study the Role of Cellular Architecture in Cardiomyocyte Systems Biology

With the advent of three-dimensional (3D) imaging technologies such as electron tomography, serial-block-face scanning electron microscopy and confocal microscopy, the scientific community has unprecedented access to large datasets at sub-micrometer resolution that characterize the architectural remodeling that accompanies changes in cardiomyocyte function in health and disease. However, these datasets have been under-utilized for&#160;investigating the role of cellular architecture remodeling in cardiomyocyte function. The purpose of this protocol is to outline how to create an accurate finite element model of a cardiomyocyte using high resolution electron microscopy and confocal microscopy images. A detailed and accurate model of cellular architecture has significant potential to provide new insights into cardiomyocyte biology, more than experiments alone can garner. The power of this method lies in its ability to computationally fuse information from two disparate imaging modalities of cardiomyocyte ultrastructure to develop one unified and detailed model of the cardiomyocyte. This protocol outlines steps to integrate electron tomography and confocal microscopy images of adult male Wistar (name for a specific breed of albino rat) rat cardiomyocytes to develop a half-sarcomere finite element model of the cardiomyocyte. The procedure generates a 3D finite element model that contains an accurate, high-resolution depiction (on the order of ~35 nm) of the distribution of mitochondria, myofibrils and ryanodine receptor clusters that release the necessary calcium for cardiomyocyte contraction from the sarcoplasmic reticular network (SR) into the myofibril and cytosolic compartment. The model generated here as an illustration does not incorporate details of the transverse-tubule architecture or the sarcoplasmic reticular network and is therefore a minimal model of the cardiomyocyte. Nevertheless, the model can already be applied in simulation-based investigations into the role of cell structure in calcium signaling and mitochondrial bioenergetics, which is illustrated and discussed using two case studies that are presented following the detailed protocol.

This protocol outlines a novel method to create a spatially detailed finite element model of the intracellular architecture of cardiomyocytes from electron microscopy and confocal microscopy images. The power of this spatially detailed model is demonstrated using case studies in calcium signaling and bioenergetics.

Creazione di un modello geometrico strutturalmente realistico agli elementi finiti di un Cardiomyocyte per studiare il ruolo dell'architettura cellulare in biologia dei sistemi del Cardiomyocyte

With the advent of three-dimensional (3D) imaging technologies such as electron tomography, serial-block-face scanning electron microscopy and confocal ...

Measurement of Force-Sensitive Protein Dynamics in Living Cells Using a Combination of Fluorescent Techniques

Cells sense and respond to physical cues in their environment by converting mechanical stimuli into biochemically-detectable signals in a process called mechanotransduction. A crucial step in mechanotransduction is the transmission of forces between the external and internal environments. To transmit forces, there must be a sustained, unbroken physical linkage created by a series of protein-protein interactions. For a given protein-protein interaction, mechanical load can either have no effect on the interaction, lead to faster disassociation of the interaction, or even stabilize the interaction. Understanding how molecular load dictates protein turnover in living cells can provide valuable information about the mechanical state of a protein, in turn elucidating its role in mechanotransduction. Existing techniques for measuring force-sensitive protein dynamics either lack direct measurements of protein load or rely on the measurements performed outside of the cellular context. Here, we describe a protocol for the F&#246;rster resonance energy transfer-fluorescence recovery after photobleaching (FRET-FRAP) technique, which enables the measurement of force-sensitive protein dynamics within living cells. This technique is potentially applicable to any FRET-based tension sensor, facilitating the study of force-sensitive protein dynamics in variety of subcellular structures and in different cell types.

Here, we present a protocol for the simultaneous use of F&#246;rster resonance energy transfer-based tension sensors to measure protein load and fluorescence recovery after photobleaching to measure protein dynamics enabling the measurement of force-sensitive protein dynamics within living cells.

Misurazione delle dinamiche di sensibili alla forza della proteina in cellule viventi, utilizzando una combinazione di tecniche di fluorescenza

Cells sense and respond to physical cues in their environment by converting mechanical stimuli into biochemically-detectable signals in a process called ...

A Microfluidic Platform for Stimulating Chondrocytes with Dynamic Compression

Mechanical stimuli are known to modulate biological functions of cells and tissues. Recent studies have suggested that compressive stress alters growth plate cartilage architecture and results in growth modulation of long bones of children. To determine the role of compressive stress in bone growth, we created a microfluidic device actuated by pneumatic pressure, to dynamically (or statically) compress growth plate chondrocytes embedded in alginate hydrogel cylinders. In this article, we describe detailed methods for fabricating and characterizing this device. The advantages of our protocol are: 1) Five different magnitudes of compressive stress can be generated on five technical replicates in a single platform, 2) It is easy to visualize cell morphology via a conventional light microscope, 3) Cells can be rapidly isolated from the device after compression to facilitate downstream assays, and 4) The platform can be applied to study mechanobiology of any cell type that can grow in hydrogels.

This article provides detailed methods for fabricating and characterizing a pneumatically actuating microfluidic device for chondrocyte compression.

Una piattaforma microfluidica per stimolare i condrociti con la compressione dinamica

Mechanical stimuli are known to modulate biological functions of cells and tissues. Recent studies have suggested that compressive stress alters growth ...