המחברים בתודה להכיר תמיכה בפרס FA9550-13-1-0108 מלשכת חיל האוויר של המחקר המדעי של ארה&quot;ב. המחברים גם מכירים תמיכה מן הפרס N00014-15-1-2502 מן משרד המחקר של הצי של ארה&quot;ב, מימון מהמכון לטכנולוגיה קריטית ומדע יישומי במכון הפוליטכני וירג&#39;יניה סטייט, ומן מחקר לתארים מתקדמים הקרן הלאומית למדע אחוות תוכנית, מספר הפרסים 1,607,310.

<ol>
	<li>Zhang, R., Heyde, K. C., Scott, F. Y., Paek, S. -. H., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programming+Surface+Chemistry+with+Engineered+Cells.">Programming Surface Chemistry with Engineered Cells.</a> ACS Synth. Biol. , (2016).</li><li>Zhou, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reduced+graphene+oxide+films+used+as+matrix+of+MALDI-TOF-MS+for+detection+of+octachlorodibenzo-p-dioxin.">Reduced graphene oxide films used as matrix of MALDI-TOF-MS for detection of octachlorodibenzo-p-dioxin.</a> Chem. Commun. 46, 6974-6976 (2010).</li><li>Pardee, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Low-Cost+Detection+of+Zika+Virus+Using+Programmable+Biomolecular+Components.">Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components.</a> Cell. 165, 1255-1266 (2016).</li><li>B&#228;hring, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+Sensing+Properties+of+a+Self-Assembled+Supramolecular+Oligomer.">Design and Sensing Properties of a Self-Assembled Supramolecular Oligomer.</a> Chem. Eur. J. 22, 1958-1967 (2016).</li><li>Nicolau Jr, D. V., Armitage, J. P., Maini, P. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directional+persistence+and+the+optimality+of+run-and-tumble+chemotaxis.">Directional persistence and the optimality of run-and-tumble chemotaxis.</a> Comp. Biol. Chem. 33, 269-274 (2009).</li><li>Du, J., Shao, Z., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+microbial+factories+for+synthesis+of+value-added+products.">Engineering microbial factories for synthesis of value-added products.</a> J. Ind. Microbiol. Biotechnol. 38, 873-890 (2011).</li><li>Kim, H., Kim, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electric+Field+Control+of+Bacteria-Powered+Microrobots+Using+a+Static+Obstacle+Avoidance+Algorithm.">Electric Field Control of Bacteria-Powered Microrobots Using a Static Obstacle Avoidance Algorithm.</a> IEEE Trans. Rob. 32, 125-137 (2016).</li><li>Gardner, T. S., Cantor, C. R., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+a+genetic+toggle+switch+in+Escherichia+coli.">Construction of a genetic toggle switch in Escherichia coli.</a> Nature. 403, 339-342 (2000).</li><li>Heyde, K. C., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+Host-Microbiome+Interactions+using+an+in+Silico+Model+of+Biomimetic+Robots+and+Engineered+Living+Cells.">Exploring Host-Microbiome Interactions using an in Silico Model of Biomimetic Robots and Engineered Living Cells.</a> Sci. Rep. 5, 11988 (2015).</li><li>Rice, M. K., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Creating+biological+nanomaterials+using+synthetic+biology.">Creating biological nanomaterials using synthetic biology.</a> Sci. Tech. Adv. Mater. 15, 014401 (2014).</li><li>Green, N. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin.+3.+The+nature+of+the+biotin-binding+site.">Avidin. 3. The nature of the biotin-binding site.</a> Biochem. J. 89, 599-609 (1963).</li><li>Mesulam, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tetramethyl+benzidine+for+horseradish+peroxidase+neurohistochemistry:+a+non-carcinogenic+blue+reaction+product+with+superior+sensitivity+for+visualizing+neural+afferents+and+efferents.">Tetramethyl benzidine for horseradish peroxidase neurohistochemistry: a non-carcinogenic blue reaction product with superior sensitivity for visualizing neural afferents and efferents.</a> J Histochem. Cytochem. 26, 106-117 (1978).</li><li>Litcofsky, K. D., Afeyan, R. B., Krom, R. J., Khalil, A. S., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iterative+plug-and-play+methodology+for+constructing+and+modifying+synthetic+gene+networks.">Iterative plug-and-play methodology for constructing and modifying synthetic gene networks.</a> Nat. Meth. 9, 1077-1080 (2012).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+Chemical+Synthesis,+Assembly,+and+Cloning+of+a+Mycoplasma+genitalium+Genome.">Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome.</a> Science. 319, 1215-1220 (2008).</li><li>Diamandis, E. P., Christopoulos, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biotin-(strept)avidin+system:+principles+and+applications+in+biotechnology.">The biotin-(strept)avidin system: principles and applications in biotechnology.</a> Clin. Chem. 37, 625-636 (1991).</li><li>Nerurkar, L. S., Namba, M., Brashears, G., Jacob, A. J., Lee, Y. J., Sever, J., L, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+detection+of+herpes+simplex+virus+in+clinical+specimens+by+use+of+capture+biotin-streptavidin+enzyme-linked+immunosorbent+assay.">Rapid detection of herpes simplex virus in clinical specimens by use of capture biotin-streptavidin enzyme-linked immunosorbent assay.</a> J. Clin. Micro. 20, 109-114 (1984).</li><li>Cui, Y., Wei, Q., Park, H., Lieber, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanowire+Nanosensors+for+Highly+Sensitive+and+Selective+Detection+of+Biological+and+Chemical+Species.">Nanowire Nanosensors for Highly Sensitive and Selective Detection of Biological and Chemical Species.</a> Science. 293, 1289-1292 (2001).</li></ol>

החוקרים אין לי מה לחשוף.

הצגנו אסטרטגיה חדשה עבור התממשקות תאים מהונדסים חיים עם משטח חומר פונקציונלי. הדבר זה הושג על ידי פיתוח קו תא מסוגל לסנתז רמות גבוהות של ביוטין כאשר מושרה עם IPTG. הרמות הגבוהות של ביוטין יכולות לשמש כדי לשנות את פני השטח הפונקציונליים. הפרוטוקולים המפורטים כיצד להנדס את שורת תאי E. coli וכיצד ליצור שני משטחים פונקציונליים שונים. צעדים קריטיים בפרוטוקול זה להתרחש לאורך כל הבנייה של הקו הסלולרי המהונדס. כדי למנוע בעיות במורד הזרם, המאפיינת את זני תאים מהונדסים עם שתי עקומות גדילה (איור 2) ותגובה ניאון (איור 3) מומלץ. האם בעיות פרוצדורליות להתעורר, אסטרטגיות שיבוט מולקולרי אחרות, כגון מיצוי PCR וגיבסון הרכבת 14, עשויות להיות תחליף צעדים במידת צורך. עבור אופטימיזציה של ביוטין Yield של הקו הסלולרי המהונדס, זה חיוני כדי להבטיח כי כמות מספקת של DTB מסופקת על התאים. במחקרים שלנו, מצאנו כי 200 ng / mL DTB שהושר גידול משמעותי סטטיסטית משמעותי בייצור ביוטין כאשר תאים היו מושרים עם IPTG. בנוסף, נטייה מוצלחת של BSA-ביוטין, SA-HRP, ו ביוטין-HRP היא חיונית לביצוע ביעילות וניטור תוכניות שליטה העקיפה וישירות. תשמור על עצמך כדי להימנע מחשיפה מיותרת לאור ולאפשר conjugates כדי לדגור לילה ב 4 ° C כדי להבטיח המצומד יעיל נוצר. הפרוטוקול שלנו מציע יתרונות על פני שיטות חלופיות 15 בשל יכולתה לזהות כמויות קטנות של ביוטין שרלוונטיים ביולוגי (בסולם pg / mL) לעומת ערכות זיהוי ביוטין זמינות מסחרי, כגון אלו המבוססים על 4&#39;-hydroxyazobenzene-2-קרבוקסיליות חומצה אסטרטגיות מחייב תחרותיות. למרות באמצעות ביו-streptavidinמערכת פח נפוצה בביוטכנולוגיה 16, 17, היכולת של המערכת שלנו להגיב כמויות קטנות של ביוטין מאפשרת לנו לקשר שורת התאים שלנו ישירות המהונדסת הגנטי עם המשטח הפונקציונלי. הגבלת פוטנציאל אחד הפרוטוקול שלנו היא הטווח דינמי כתוצאה של זיהוי ביוטין. ב תוכניות שליטה עקיפה וישירה, אנו מסוגלים לזהות ביוטין בין 10 2 -10 3 ו -10 4 -10 6 pg / mL, בהתאמה (איור 4). למרבה המזל, בטווח הנמוך של ערכת השליטה העקיפה מאפשר לנו לזהות בקלות ייצור ביוטין מתאי מהונדסים. עם זאת, הלהקה החזקה של הטווח הדינמי שליטה העקיפה מגבילה את יכולתו לחוש שינויים גדולים (פי 100) בריכוזים ביוטין. לשנות את הטווח הדינמי הוא תוכניות שליטה העקיפות וישירות ידרוש הנדסה נוספת. עם זאת, אם זיהוי של תאים לייצרד ביוטין הינה סוגיה, הכנת דילולים של supernatant ביוטין בשלב 4.6 צריך לאפשר לחוקר למקד את הטווח הדינמי של ערכת שליטה עקיפה (איור 5). מצאנו כי דילול 1: 5 של supernatant אפשר לנו למקד את הטווח הדינמי של ערכת השליטה העקיפה ביעילות. אסטרטגית דילול זה אמורה להקל על הצורך לשנות את הטווח הדינמי ישירות. מערכת הבת שני חלקים, תא-חומר המובא כאן מאפשרת מהונדסת תאים כדי לשנות את ההרכב של משטח פונקציונלי. תאים דינמיים, חיים יכולים לפרש הסביבה הכימית שלהם כדי לייצר תגובה גנטית. באמצעות הנדסה גנטית בתגובה זו כדי להגדיל את הייצור ביוטין, נוכל להעניק תאי חיים מהונדסים עם היכולת לשלוט ולתפעל משטח פונקציונלי. על ידי ביצוע הפרוטוקולים שהוצגו, תאים מהונדסים מסוגלים לפעול חיישנים דינמיים כמו, יכולת לקרוא, עיבוד, הקלטת התנאים סביב הem דרך ממשקים פונקציונליים. טכנולוגיה זו יכולה להשפיע בתחומים הנעים בין רפואה מולקולרית לגילוי אנליטי עבור תיקון הסביבה.

כאן אנו מדווחים בנהלי פיתוח מצע לתכנות מסוגל להגיב אות כימית מן קו תא מהונדס. 1 אנו עושים זאת על ידי יצירת ממשק streptavidin ביוטין שמגיב ביוטין מיוצר על ידי coli Escherichia המהונדס סינטטי (E. coli) תאים. בעבר, משטחים לתכנות כבר מהונדסים עבור מגוון רחב של יישומים מ זיהוי הרעלן 2 ונקודה של טיפול אבחון 3 עד הגנה וביטחון. 4 בעוד משטחים לתכנות יכולים להיות שימושיים כמו חיישנים ומפעיל, הם יכולים להיעשות &quot;חכמים&quot; על ידי להנחיל להם את היכולת להסתגל לאתגרים סביבתיים שונים. לעומת זאת, אפילו מיקרואורגניזמים פשוטים, כגון E. coli, יש הסתגלות טמונה ומסוגלים להגיב לאתגרים עם פתרונות מתוחכמים ולעתים קרובות בלתי צפויים. הסתגלות זו אפשרה E.אוכלוסיות coli, בשליטת רשתות גנים המורכבים שלהן, חסכונית לחפש משאבים, 5 ליצור מוצרים בעלי ערך מוסף, 6 ואפילו רובוטיקה כוח בקנה מידה מיקרו. 7 על ידי צימוד היתרונות אדפטיבית של תאי חיים עם שימוש משטחים לתכנות, נוכל ליצור מצע חכם מסוגל להגיב לתנאי סביבה שונים. ביולוגיה סינתטית נתן החוקרים יכולות חדשות כדי לתכנת את ההתנהגות של היצורים החיים. באמצעות הנדסה לתאים להכיל רשתות רגולטוריות גן חדש, חוקרים יכולים לעצב תאים כי תערוכה מגוונת של התנהגויות מתוכנות. 8, 9 מעבר מחקר בסיסי, התנהגויות אלו עשויות לשמש ליישומים כגון שליטת הרכבת חומר ביולוגי לייצר מוצרים בעלי ערך מוסף. 10 בזאת, אנו בפירוט כיצד השתמשנו בכלים של ביולוגיה סינתטית כדי engineer זן החיידק כי מסנתז ביוטין על אינדוקציה. זן זה פותח באמצעות שיטות שיבוט אנזים הגבלה להרכיב פלסמיד, pKE1-לאצי-bioB. פלסמיד זה, כאשר הפך K-12 זן E. coli MG1655, מעניק לתאים עם יכולת להביע רמות גבוהות של bioB, אנזים חיוני לסינתזת ביוטין. כאשר תאים שהשתנו היו מושרים עם איזופרופיל β-D-1-thiogalactopyranoside (IPTG) ובתנאי עם מבשר ביוטין, desthiobiotin (DTB), רמות גבוהות של ביוטין יוצרו. האינטראקציה המחייבת של ביוטין עם streptavidin היא אחת איגרות החוב הלא-קוולנטיים החזקים המצויים בטבע. ככזה, האינטראקציה streptavidin ביוטין הוא גם היטב מאופיין והעסיק מאוד בביוטכנולוגיה. 11 בתוך כתב היד הזה, אנו מציגים שתי אסטרטגיות העסקת אינטראקצית streptavidin ביוטין לחוש ולזהות ביוטין בייצור תאים עם משטח פונקציונלי. אָנוּמתייחסים משטחים מנוגדים אלה תוכניות שליטה &quot;עקיפה&quot; ו &quot;ישירה&quot;. בתכנית השליטה העקיפה, ביוטין-מיוצר תא מתחרה עם ביוטין כי כבר מצומדות ו משותק על משטח קלקר streptavidin אתרי קישור. בנוסף, streptavidin הוא מצומדות עם peroxidase חזרת (HRP). HRP משנה 3, 3 &#39;, 5, 5&#39;-tetramethylbenzidine (TMB), להפקת אותות אופטיים, 12 אשר עשוי להיות במעקב על ידי לכימות ספיגת ספקטרלי (כלומר, צפיפות אופטית) ב -450 ננומטר (OD 450). לפיכך, את ערכת השליטה העקיפה מאפשרת לחוקרים למדוד ביוטין בייצור תאים על ידי ניטור attentuation של אות OD 450. ערכת השליטה הישירה מנצלת את האירוע ביוטין-streptavidin על ידי streptavidin משתק ישירות משטח חומר ומאפשר ביוטין תא-פיק biotinylated HRP להתחרות על streptavidin אתרי קישור. שוב,רמות יחסיות של ביוטין בייצור התאים מנוטר על ידי מדידת אות OD 450. יחדיו, התאים המהונדסים משטחים פונקציונליים מאפשרים לנו לשלוט על התכונות של משטח לתכנות על ידי גרימת רשתות בתאים חיים. במילים אחרות, יצרנו מערכת שמנצלת את יכולת ההתאמה של היצורים החיים ואת אמינות מפרט של ממשק חומר מהונדס ידי קישור המערכות הללו יחד.

<table border="0" cellpadding="0" cellspacing="0" width="1072">
	<tbody>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">LB Broth, Miller&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">12-795-027</td>
			<td style="width:219px;"></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Agar</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP9744500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Carbenicillin&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP26481</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">M9, Minimimal Salts, 5X</td>
			<td style="width:209px;">Sigma-Aldrich</td>
			<td style="width:119px;">M6030</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Casamino Acids&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP1424-100</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Magnesium Sulfate, Anhydrous</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">M65-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Calcium Chloride, Dihydrate</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">C79-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Dextrose (D-Glucose), Anhydrous</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">D16-1</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">NEB Turbo Cell Line</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">C2984l</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Oligonucleotide Primers</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">N/A</td>
			<td>25N synthesis, DSL purification</td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Q5 High-Fidelity Polymerase</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">M0491S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Q5 Reaction Buffer</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">B9027S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">dNTP Solution Mix</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">N0447S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Agarose</td>
			<td style="width:209px;">Bioexpress</td>
			<td style="width:119px;">E-3120-125</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Ethidium Bromide, 1%</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP1302-10</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Gel Extraction Kits</td>
			<td style="width:209px;">Epoch Biolabs</td>
			<td style="width:119px;">2260250</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">GenCatch Plasmid DNA Miniprep Kit</td>
			<td style="width:209px;">Epoch Biolabs</td>
			<td style="width:119px;">2160250</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">AatII</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">R0117S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">SacII</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">R0157S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">HindIII-HF</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">R3104S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">EcoRI-HF</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">R3101S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Cutsmart Buffer</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">B7204S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">T4 DNA Ligase</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">M0202S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">T4 DNA Ligase Reaction Buffer</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">B0202S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">ColiRolle Glass Plating Beads&#160;</td>
			<td style="width:209px;">EMD Millipore</td>
			<td style="width:119px;">7101-3</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Glycerol</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP229-1</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Isopropyl &#946;-D-1-thiogalactopyranoside (IPTG)</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP1755-10</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">NHS-Desthiobiotin (DTB)</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">16129</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Succinimidyl Trans-4-(maleimidylmethyl) Cyclohexane-1-Carboxylate (SMCC)&#160;</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">S1534</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Dimethyl Sulfoxide (DMSO)&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP231-100</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Succinimidyl 3-(2-pyridyldithio) Propionate (SPDP)&#160;</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">S1531</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">NHS-LC-LC-biotin</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">21343</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Horseradish Peroxidase (HRP)&#160;</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">31490</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Phosphate Buffered Saline (PBS), 10X Solution</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP399500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Streptavidin (SA)&#160;</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">21145</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Bovine Serum Albumin (BSA)</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP1600-100</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Dithiothreitol (DTT)</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP172-5</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Ethylenediaminetetaacetic acid (EDTA)&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">S311-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Tween 80&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">T164-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Hydrogen Peroxide</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">H325-4</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">3, 3&#39;, 5, 5&#39;-tetramethylbenzidine (TMB)</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">AC229280050</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Vivaspin 500 Centrifugal Concentrators&#160;</td>
			<td style="width:209px;">Viva Products</td>
			<td style="width:119px;">VS0192</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Sodium Acetate, Anhydrous</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP333-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">96-Well Polystyrene Plates</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">266120</td>
			<td></td>
		</tr>
	</tbody>
</table>

using synthetic biology to engineer living cells that interface with programmable materials

פתחנו ממשק אביוטי-ביוטיים המאפשר תאים מהונדסים לשלוט בתכונות החומר של משטח פונקציונלי. מערכת זו נעשית על ידי יצירת שני מודולים: זן מהונדס סינטטי של תאי חיידק וממשק חומר פונקציונלי. בתוך נייר זה, אנו פרטנו פרוטוקול עבור גנטית הנדסת התנהגויות נבחרות בתוך זן של חיידק באמצעות אסטרטגיות שיבוט מולקולריות. לאחר שפותח, זן זה מייצר רמות גבוהות של ביוטין כאשר הם נחשפים inducer כימי. בנוסף, אנו פרוטוקולי פרט ליצירת שני משטחים פונקציונליים שונים, שכל אחת מהן מסוגלת להגיב ביוטין תא-מסונתז. יחדיו, אנו מציגים מתודולוגיה ליצירה צמודה, מערכת אביוטי-ביוטיים המאפשר מהונדסת תאים לשלוט רכב חומר והרכבה על מצעים דוממים.

תוצאות נציגים מוצגות חמש דמויות המצורפות. ראשית, אנו מציגים את תהליך השיבוט גרפי (איור 1), כך שהקורא יכול חזותי בצע את השלבים הקריטיים ליצירת זן החיידק המהונדס הסינטטי. על מנת לאפיין את הדינמיקה באוכלוסייה של התאים, אנו מספקים עקומת צמיחה (איור 2) שנוצרה על ידי מדידת הצפיפות האופטית ב 600 ננומטר (OD 600) של האוכלוסייה. לאחר מכן, אנו מראים כיצד לרשת גן בקרה מאומתת, באמצעות mCherry כמדד bioB (איור 3), מה שמאפשר לנו למדוד אופטית לכמות היחסית של bioB הצריכה להיווצר על ידי התא על אינדוקציה עם IPTG. בשלב בא, אנו מציגים נתונים בתגובה על הבקרה-העקיפה משטחים פונקציונליים ישירה שליטים. מגרשי נתונים אלה (איור 4) שפותחו באמצעות פתרונות נמדדים של חינםביוטין לאפיין את הפרופילים לתשובת המשטחים הפונקציונליים. לבסוף, אנו מציגים נתונים מאפיינים מראים כיצד התאים המהונדסים הם המושרה לייצר ביוטין (איור 5), ובכך שינוי המשטחים הפונקציונליים. <img alt="איור 1" src="/files/ftp_upload/55300/55300fig1.jpg" /> איור 1: עיצוב ובנייה של מושרת, תאים מהונדסים. Primers (א) נועד לבודד את גן bioB מן הגנום E. coli, אשר מקודד אנזים חיוני במסלול הסינתזה ביוטין. (ב) L P, TETO-1 ו -lacI P רצפי TRC-2 יכולים להיות מבודדים פלסמיד המכיל מתג למתג גנטי עם פריימרים מקבילים. (C) גן bioB החילוץ ושני הקטעים מתוך במתג לאחר מכן ניתן להשתמש כדי ליצור את מעגל הגן. התוספת של IPTG אז יכול indתחיקת הבעת bioB וסינתזה ביוטין ובכך כאשר DTB מתווסף כמו מצע עבור bioB. (ד) הפלסמיד התאספו הפך K-12 MG1655 E. coli. זה גרם בנוכחות IPTG להשרות את הביטוי של bioB וסינתזה ביוטין ובכך ידי שורת תאים מהונדסים כאשר DTB סופק כמצע. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig1large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 2" src="/files/ftp_upload/55300/55300fig2.jpg" /> איור 2: עקומות גדילה עבור תאים מהונדסים. המהונדס, מושרת MG1655 wild-type התאים בגרו פיקוח תקשורת מינימאלית (כלומר, ביוטין ללא מדיה M9), כמו גם תקשורת מינימאלית השלימה עם DTB (200 ng / mL) ו / או IPTG (0.5 מ&quot;מ). המגרשים להראות קריאה OD 600, נמדד כל 5 ק&quot;מ<html> n במשך 24 שעות. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig2large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 3" src="/files/ftp_upload/55300/55300fig3.jpg" /> איור 3: בדיקת רשת Engineered ג&#39;ין. חלבון פלואורסצנטי mCherry שימש במקום bioB גן כדי שנוכל אופטי יכול למדוד את פרופיל האינדוקציה כאשר תאים מהונדסים היו מושרים עם IPTG. אנו בניגוד לתאים מושרים עם IPTG (יהלומים אדומים) עם התאים לא מושרה עם IPTG (יהלומים כחולים). תוצאות אלו מראות את היעילות של רשת הגנים המושרית. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig3large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> /55300/55300fig4.jpg &quot;/&gt; איור 4: אימות של ממשק החומר הפונקציונלי. על ידי חשיפת המשטח הפונקציונלי שלנו ריכוזים שונים של ביוטין, אנו מסוגלים למדוד את התגובה האופטית על ידי מדידת OD 450 ספיגים. תוצאות אלו מאפשרות לנו ליצור עקומת כיול, המקשרות את הריכוז של ביוטין לעוצמת האופטית של התגובה. כאן, אנו מציגים ביוטין לעומת עקומות אות אופטיות היא עקיף (משמאל) וישיר (מימין) תוכניות המשטח פונקציונליים. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig4large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 5" src="/files/ftp_upload/55300/55300fig5.jpg" /> איור 5: תאים מהונדסים שליטה ממשק חומר. על ידי ניצול סעיפי פרוטוקול 5 או 6, אנו מסוגלים להשתמש במוצרים של מושרה, ג מהונדסאמות כדי לשנות את פני השטח הפונקציונליים כימיות. אנחנו יכולים לעקוב אחרי התגובות האלה אופטיות ידי מדידת OD 450. יתר על כן, באמצעות עקומת הכיול שפותחה באיור 4, אנו יכולים לקשר את העוצמת האופטית של התגובה ביוטין בתוך הריכוז. אנו מציגים כאן את הריכוזים ביוטין השונים, שהיא נמדדות על ידי המשטח פונקציונלי ערכת השליטה העקיפה שלנו, עבור wild-type תאים (לבן), תאי uninduced המכילים את הפלסמיד pKE1-לאצים-bioB (כתום), ותאי מושרה המכילים את pKE1-לאצים-bioB פלסמיד (אפור). <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig5large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> כִּימִי </td><td> ריכוז סופי </td><td> כמות </td></tr><tr><td> מלחי 5x M9 </td><td> 1x </td><td> 20 מ&quot;ל </td></tr><tr><td> 1 M MgSO 4 </td><td> 2 מ&quot;מ </td><td> 200 μL </td></tr><tr><td> 1 M CaCl 2 </td><td> 0.1 מ&quot;מ </td><td> 10 μL </td></tr><tr><td> גלוקוז 20% </td><td> 0.40% </td><td> 2 מ&quot;ל </td></tr><tr><td> 2% חומצה Casamino ללא ביוטין </td><td> 0.02% </td><td> 1 מ&quot;ל </td></tr><tr><td> מי DI </td><td> N / A </td><td> 76.8 מ&quot;ל </td></tr></tbody></table> טבלה 1: מתכון מדיה M9. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> שֵׁם </td><td colspan="2"> רצף פריימר </td><td> נוֹהָג </td></tr><tr><td> 1-f </td><td colspan="2"> CCGCCGGAATTCTCCCTATCAGTGATAGAGATT </td><td> מיצוי קלטת לאצים </td></tr><tr><td> 1-r </td><td colspan="2"> CCGACGTCTCACTGCCCGCTTTCCAGTC </td><td> מיצוי קלטת לאצים </td></tr><tr><td> nBioB1-f </td><td colspan="2"> CCCAAGCTTCTGAAATGAGCTGTTGACAATTAATCAT </td><td> מיצוי P TRC-2 </td></tr><tr><td> nBioB1-r </td><td colspan="2"> GGGGGGTTCTTTTAATAAAGGTACCGTGTGAAATTGTT </td><td> מיצוי P TRC-2 </td></tr><tr><td> nBioB2-F1 </td><td colspan="2"> ACCCCCCTAAGGAGGTCATCATGGCTCACCGCCCACG </td><td> מיצוי bioB </td></tr><tr><td> nBioB2-r </td><td colspan="2"> TCCCCGCGGTCATAATGCTGCCGCGTTGTAATATTC </td><td> מיצוי bioB </td></tr><tr><td> nBioB2-f2 </td><td colspan="2"> ACGGTACCTTTATTAAAAGAACCCCCCTAAGGAGGTCATC </td><td> בנוסף RBS סינתטי </td></tr></tbody></table> טבלה 2: רשימת פריימרים. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td<html> &gt; שלב 1 </td><td> שלב 2 </td><td> שלב 3 </td><td> שלב 4 </td><td> שלב 5 </td><td> שלב 6 </td><td> שלב 7 </td><td> שלב 8 </td><td> שלב 9 </td></tr><tr><td> 98 ° C </td><td> 98 ° C </td><td> 70 ° C </td><td> 72 ° C </td><td> 98 ° C </td><td> 60 ° C </td><td> 72 ° C </td><td> 72 ° C </td><td> 4 ° C </td></tr><tr><td> 00:30 </td><td> 00:10 </td><td> 00:30 </td><td> 01: 00 / kb </td><td> 00:10 </td><td> 00:30 </td><td> 01: 00 / kb </td><td> 02:00 </td><td> ∞ </td></tr><tr><td rowspan="2"></td><td colspan="3"> חזור 12 פעמים </td><td colspan="3" rowspan="2"> חזור 25 פעמים </td><td colspan="2" rowspan="2"></td></tr><tr><td colspan="3"> -1 ° C / מחזור </td></tr></tbody></table>er.within-page = &quot;1&quot;&gt; טבלה 3: תוכנית ה- PCR. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> שֵׁם </td><td> כֶּרֶך </td></tr><tr><td> Cell Lysate (תבנית) </td><td> 10 μL </td></tr><tr><td> פריימר (ליחידה) </td><td> 0.625 μL (ליחידה) </td></tr><tr><td> חיץ Q5 5x </td><td> 5 μL </td></tr><tr><td> פולימראז Q5 </td><td> 0.25 μL </td></tr><tr><td> dNTP Mix </td><td> 0.5 μL </td></tr><tr><td> מי DI </td><td> 6.75 μL </td></tr></tbody></table> לוח 4: שלמות תא תגובת PCR (25 μL). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> שֵׁם </td><td> כֶּרֶך </td></tr><tr><td> 10<html> x חיץ תגובה </td><td> 5 μL </td></tr><tr><td> אנזים 1 </td><td> 1 μL </td></tr><tr><td> אנזים 2 </td><td> 1 μL </td></tr><tr><td> DNA תבנית </td><td> 1 מיקרוגרם </td></tr><tr><td> מי DI </td><td> 43 μL - נפח של ה- DNA </td></tr></tbody></table> לוח 5: הגבלת תגובת עיכול האנזים (50 μL). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> שֵׁם </td><td> כֶּרֶך </td></tr><tr><td> DNA </td><td> 50 מיקרוגרם וקטור + X מיקרוגרם הכנס </td></tr><tr><td> 10x אנזים הצפה </td><td> 1 μL </td></tr><tr><td> T4 אנזים </td><td> 1 μL </td></tr><tr><td> מי DI </td><td> 8 μL - נפח של ה- DNA </td></tr></tbody></table>יפ-together.within-page = &quot;1&quot;&gt; לוח 6: תגובת קשירה (10 μL). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> שֵׁם </td><td> ריכוז </td><td> הערות </td></tr><tr><td> CaCl 2 </td><td> 100 מ&quot;מ </td><td></td></tr><tr><td> Carbeniccilin </td><td> 50 מ&quot;ג / מ&quot;ל ​​(1000x) </td><td></td></tr><tr><td> DTB </td><td> 50 מיקרוגרם / מ&quot;ל </td><td></td></tr><tr><td> IPTG </td><td> 0.5 M </td><td></td></tr><tr><td> SMCC </td><td> 20 מ&quot;ג / מ&quot;ל </td><td> 2 מ&quot;ג לתוך 100uL DMSO </td></tr><tr><td> SPDP </td><td> 20 מ&quot;ג / מ&quot;ל </td><td> 2 מ&quot;ג לתוך 100uL DMSO </td></tr><tr><td> LC-LC-ביוטין </td><td> 20 מ&quot;ג / מ&quot;ל </td><td> 2 מ&quot;ג לתוך 100uL DMSO </td></tr><tr><td> HRP </td><td> 10 מ&quot;ג / מ&quot;ל </td><td> ב PBS </td></tr><tr><td> SA (בעקיפין) </td><td> 10 מ&quot;ג / מ&quot;ל </td><html><td> ב PBS </td></tr><tr><td> SA (ישיר) </td><td> 0.17 מיקרוגרם / מ&quot;ל </td><td> ב PBS </td></tr><tr><td> BSA </td><td> 20 מ&quot;ג / מ&quot;ל </td><td> ב PBS </td></tr><tr><td> DTT </td><td> 100mm </td><td> ב DI מים </td></tr><tr><td> EDTA </td><td> 5 מ&quot;מ </td><td> 18.6 מ&quot;ג ל -10 מ&quot;ל PBS </td></tr><tr><td> קזאין </td><td> 0.50% </td><td> ב PBS </td></tr><tr><td> Tween 80 </td><td> 20% </td><td> ב DI מים </td></tr><tr><td> Tween 80 ב PBS </td><td> 0.05% </td><td></td></tr><tr><td> אצטט נתרן </td><td> 50 מ&quot;מ </td><td> במים DI, התאם ל -5.1 pH באמצעות 3 M HCl </td></tr><tr><td> TMB </td><td> 1% </td><td> ב DMSO </td></tr><tr><td> H 2 O 2 </td><td> 3% </td><td> ב DI מים </td></tr><tr><td> H 2 SO 4 </td><td> 2 M </td><td> ב DI מים </td></tr></tbody></table>page = &quot;1&quot;&gt; לוח 7: רשימת פתרונות המגיבים.

Watch this Scientific Journal Video about Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials at JoVE.com

Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials

מאמר זה מציג סדרה של פרוטוקולים לפיתוח תאים מהונדסים ומשטחים פונקציונליים המאפשרים מהונדס חיידק סינטטי לשלוט ולטפל משטחי חומר לתכנות.

באמצעות ביולוגיה סינתטית מהנדס תאים חיים המתממשקות חומרים לתכנות

We have developed an abiotic-biotic interface that allows engineered cells to control the material properties of a functionalized surface. This system is ...

using-synthetic-biology-to-engineer-living-cells-that-interface-with

Nanyang Technological University

Research

JoVE Journal

Bioengineering

8.8K Views.  Carnegie Mellon University.  מאמר זה מציג סדרה של פרוטוקולים לפיתוח תאים מהונדסים ומשטחים פונקציונליים המאפשרים מהונדס חיידק סינטטי לשלוט ולטפל משטחי חומר לתכנות. 

Video: Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials

Bridging the Bio-Electronic Interface with Biofabrication

Advancements in lab-on-a-chip technology promise to revolutionize both research and medicine through lower costs, better sensitivity, portability, and higher throughput. The incorporation of biological components onto biological microelectromechanical systems (bioMEMS) has shown great potential for achieving these goals. Microfabricated electronic chips allow for micrometer-scale features as well as an electrical connection for sensing and actuation. Functional biological components give the system the capacity for specific detection of analytes, enzymatic functions, and whole-cell capabilities. Standard microfabrication processes and bio-analytical techniques have been successfully utilized for decades in the computer and biological industries, respectively. Their combination and interfacing in a lab-on-a-chip environment, however, brings forth new challenges. There is a call for techniques that can build an interface between the electrode and biological component that is mild and is easy to fabricate and pattern.
Biofabrication, described here, is one such approach that has shown great promise for its easy-to-assemble incorporation of biological components with versatility in the on-chip functions that are enabled. Biofabrication uses biological materials and biological mechanisms (self-assembly, enzymatic assembly) for bottom-up hierarchical assembly. While our labs have demonstrated these concepts in many formats 1,2,3, here we demonstrate the assembly process based on electrodeposition followed by multiple applications of signal-based interactions. The assembly process consists of the electrodeposition of biocompatible stimuli-responsive polymer films on electrodes and their subsequent functionalization with biological components such as DNA, enzymes, or live cells 4,5. Electrodeposition takes advantage of the pH gradient created at the surface of a biased electrode from the electrolysis of water 6,7,. Chitosan and alginate are stimuli-responsive biological polymers that can be triggered to self-assemble into hydrogel films in response to imposed electrical signals 8. The thickness of these hydrogels is determined by the extent to which the pH gradient extends from the electrode. This can be modified using varying current densities and deposition times 6,7. This protocol will describe how chitosan films are deposited and functionalized by covalently attaching biological components to the abundant primary amine groups present on the film through either enzymatic or electrochemical methods 9,10. Alginate films and their entrapment of live cells will also be addressed 11. Finally, the utility of biofabrication is demonstrated through examples of signal-based interaction, including chemical-to-electrical, cell-to-cell, and also enzyme-to-cell signal transmission. 
Both the electrodeposition and functionalization can be performed under near-physiological conditions without the need for reagents and thus spare labile biological components from harsh conditions. Additionally, both chitosan and alginate have long been used for biologically-relevant purposes 12,13. Overall, biofabrication, a rapid technique that can be simply performed on a benchtop, can be used for creating micron scale patterns of functional biological components on electrodes and can be used for a variety of lab-on-a-chip applications.

This article describes a biofabrication approach: deposition of stimuli-responsive polysaccharides in the presence of biased electrodes to create biocompatible films which can be functionalized with cells or proteins. We demonstrate a bench-top strategy for the generation of the films as well as their basic uses for creating interactive biofunctionalized surfaces for lab-on-a-chip applications.

גישור ממשק ביו אלקטרונית עם Biofabrication

Advancements in lab-on-a-chip technology promise to revolutionize both research and medicine through lower costs, better sensitivity, portability, and ...

Measuring the Mechanical Properties of Living Cells Using Atomic Force Microscopy

Mechanical properties of cells and extracellular matrix (ECM) play important roles in many biological processes including stem cell differentiation, tumor formation, and wound healing. Changes in stiffness of cells and ECM are often signs of changes in cell physiology or diseases in tissues. Hence, cell stiffness is an index to evaluate the status of cell cultures. Among the multitude of methods applied to measure the stiffness of cells and tissues, micro-indentation using an Atomic Force Microscope (AFM) provides a way to reliably measure the stiffness of living cells. This method has been widely applied to characterize the micro-scale stiffness for a variety of materials ranging from metal surfaces to soft biological tissues and cells. The basic principle of this method is to indent a cell with an AFM tip of selected geometry and measure the applied force from the bending of the AFM cantilever. Fitting the force-indentation curve to the Hertz model for the corresponding tip geometry can give quantitative measurements of material stiffness. This paper demonstrates the procedure to characterize the stiffness of living cells using AFM. Key steps including the process of AFM calibration, force-curve acquisition, and data analysis using a MATLAB routine are demonstrated. Limitations of this method are also discussed.

This paper demonstrates a protocol to characterize the mechanical properties of living cells by means of microindentation using an Atomic Force Microscope (AFM).

מדידת התכונות המכאניות של תאי חיים באמצעות מיקרוסקופ כוח אטומי

Mechanical  properties of cells and extracellular matrix (ECM) play important roles in many  biological processes including stem cell differentiation, ...

Ratiometric Biosensors that Measure Mitochondrial Redox State and ATP in Living Yeast Cells

Mitochondria have roles in many cellular processes, from energy metabolism and calcium homeostasis to control of cellular lifespan and programmed cell death. These processes affect and are affected by the redox status of and ATP production by mitochondria. Here, we describe the use of two ratiometric, genetically encoded biosensors that can detect mitochondrial redox state and ATP levels at subcellular resolution in living yeast cells. Mitochondrial redox state is measured using redox-sensitive Green Fluorescent Protein (roGFP) that is targeted to the mitochondrial matrix. Mito-roGFP contains cysteines at positions 147 and 204 of GFP, which undergo reversible and environment-dependent oxidation and reduction, which in turn alter the excitation spectrum of the protein. MitGO-ATeam is a F&ouml;rster resonance energy transfer (FRET) probe in which the &epsilon; subunit of the FoF1-ATP synthase is sandwiched between FRET donor and acceptor fluorescent proteins. Binding of ATP to the &epsilon; subunit results in conformation changes in the protein that bring the FRET donor and acceptor in close proximity and allow for fluorescence resonance energy transfer from the donor to acceptor.

We describe the use of two ratiometric, genetically encoded biosensors, which are based on GFP, to monitor mitochondrial redox state and ATP levels at subcellular resolution in living yeast cells.

Biosensors רציומטרי שלמדוד את מצב חיזור מיטוכונדריאלי וה-ATP בתאי שמרי חיים

Mitochondria have roles in many cellular processes, from energy metabolism and calcium homeostasis to control of cellular lifespan and programmed cell ...

Generation of Shear Adhesion Map Using SynVivo Synthetic Microvascular Networks

Cell/particle adhesion assays are critical to understanding the biochemical interactions involved in disease pathophysiology and have important applications in the quest for the development of novel therapeutics. Assays using static conditions fail to capture the dependence of adhesion on shear, limiting their correlation with in vivo environment. Parallel plate flow chambers that quantify adhesion under physiological fluid flow need multiple experiments for the generation of a shear adhesion map. In addition, they do not represent the in vivo scale and morphology and require large volumes (~ml) of reagents for experiments. In this study, we demonstrate the generation of shear adhesion map from a single experiment using a microvascular network based microfluidic device, SynVivo-SMN. This device recreates the complex in vivo vasculature including geometric scale, morphological elements, flow features and cellular interactions in an in vitro format, thereby providing a biologically realistic environment for basic and applied research in cellular behavior, drug delivery, and drug discovery. The assay was demonstrated by studying the interaction of the 2 &#181;m biotin-coated particles with avidin-coated surfaces of the microchip. The entire range of shear observed in the microvasculature is obtained in a single assay enabling adhesion vs. shear map for the particles under physiological conditions.

Flow chambers used in adhesion experiments typically consist of linear flow paths and require multiple experiments at different flow rates to generate a shear adhesion map. SynVivo-SMN enables the generation of shear adhesion map using a single experiment utilizing microliter volumes resulting in significant savings in time and consumables.

דור של שאר הידבקות מפה באמצעות רשתות כלי הדם סינטטיים SynVivo

Cell/particle adhesion assays are critical to understanding the biochemical interactions involved in disease pathophysiology and have important ...

Characterization Of Multi-layered Fish Scales (Atractosteus spatula) Using Nanoindentation, X-ray CT, FTIR, and SEM

The hierarchical architecture of protective biological materials such as mineralized fish scales, gastropod shells, ram&#8217;s horn, antlers, and turtle shells provides unique design principles with potentials for guiding the design of protective materials and systems in the future. Understanding the structure-property relationships for these material systems at the microscale and nanoscale where failure initiates is essential. Currently, experimental techniques such as nanoindentation, X-ray CT, and SEM provide researchers with a way to correlate the mechanical behavior with hierarchical microstructures of these material systems1-6. However, a well-defined standard procedure for specimen preparation of mineralized biomaterials is not currently available. In this study, the methods for probing spatially correlated chemical, structural, and mechanical properties of the multilayered scale of A. spatula using nanoindentation, FTIR, SEM, with energy-dispersive X-ray (EDX) microanalysis, and X-ray CT are presented.

Characterization Of Multi-layered Fish Scales Atractosteus spatula Using Nanoindentation, X-ray CT, FTIR, and SEM

This paper presents the methods used for probing spatially correlated chemical, structural, and mechanical properties of the multilayered scale of Atractosteus spatula (A. spatula) using nanoindentation, Fourier transform infrared (FTIR) spectroscopy, scanning electron microscopy (SEM), and X-ray computed tomography (X-ray CT). The experimental results have been used to investigate the design principles of protective biological materials.

אפיון של קשקשים דגים שכבתיים Multi-(<em&gt; מרית Atractosteus</em&gt;) באמצעות Nanoindentation, רנטגן CT, FTIR, וSEM

The hierarchical architecture of protective biological materials such as mineralized fish scales, gastropod shells, ram&#8217;s horn, antlers, and turtle ...

Development of Amelogenin-chitosan Hydrogel for In Vitro Enamel Regrowth with a Dense Interface

Biomimetic enamel reconstruction is a significant topic in material science and dentistry as a novel approach for the treatment of dental caries or erosion. Amelogenin has been proven to be a critical protein for controlling the organized growth of apatite crystals. In this paper, we present a detailed protocol for superficial enamel reconstruction by using a novel amelogenin-chitosan hydrogel. Compared to other conventional treatments, such as topical fluoride and mouthwash, this method not only has the potential to prevent the development of dental caries but also promotes significant and durable enamel restoration. The organized enamel-like microstructure regulated by amelogenin assemblies can significantly improve the mechanical properties of etched enamel, while the dense enamel-restoration interface formed by an in situ regrowth of apatite crystals can improve the effectiveness and durability of restorations. Furthermore, chitosan hydrogel is easy to use and can suppress bacterial infection, which is the major risk factor for the occurrence of dental caries. Therefore, this biocompatible and biodegradable amelogenin-chitosan hydrogel shows promise as a biomaterial for the prevention, restoration, and treatment of defective enamel.

Development of Amelogenin-chitosan Hydrogel for In Vitro Enamel Regrowth with a Dense Interface

In this article, we describe a protocol for fabricating an amelogenin-chitosan hydrogel for superficial enamel reconstruction. Organized in situ growth of apatite crystals in the hydrogel formed a dense enamel-restoration interface, which will improve the effectiveness and durability of restorations.

פיתוח של Hydrogel Amelogenin-chitosan עבור<em&gt; במבחנה</em&gt; אמייל לצמיחה מחודשת עם ממשק צפוף

Biomimetic enamel reconstruction is a significant topic in material science and dentistry as a novel approach for the treatment of dental caries or ...

Sealable Femtoliter Chamber Arrays for Cell-free Biology

Cell-free systems provide a flexible platform for probing specific networks of biological reactions isolated from the complex resource sharing (e.g., global gene expression, cell division) encountered within living cells. However, such systems, used in conventional macro-scale bulk reactors, often fail to exhibit the dynamic behaviors and efficiencies characteristic of their living micro-scale counterparts. Understanding the impact of internal cell structure and scale on reaction dynamics is crucial to understanding complex gene networks. Here we report a microfabricated device that confines cell-free reactions in cellular scale volumes while allowing flexible characterization of the enclosed molecular system. This multilayered poly(dimethylsiloxane) (PDMS) device contains femtoliter-scale reaction chambers on an elastomeric membrane which can be actuated (open and closed). When actuated, the chambers confine Cell-Free Protein Synthesis (CFPS) reactions expressing a fluorescent protein, allowing for the visualization of the reaction kinetics over time using time-lapse fluorescent microscopy. Here we demonstrate how this device may be used to measure the noise structure of CFPS reactions in a manner that is directly analogous to those used to characterize cellular systems, thereby enabling the use of noise biology techniques used in cellular systems to characterize CFPS gene circuits and their interactions with the cell-free environment.

A microfabricated device with sealable femtoliter-volume reaction chambers is described. This report includes a protocol for sealing cell-free protein synthesis reactants inside these chambers for the purpose of understanding the role of crowding and confinement in gene expression.

מערכים רבים סגר Femtoliter הלשכה לביולוגיה ללא סלולארי

Cell-free systems provide a flexible platform for probing specific networks of biological reactions isolated from the complex resource sharing (e.g., ...

Creating a Structurally Realistic Finite Element Geometric Model of a Cardiomyocyte to Study the Role of Cellular Architecture in Cardiomyocyte Systems Biology

With the advent of three-dimensional (3D) imaging technologies such as electron tomography, serial-block-face scanning electron microscopy and confocal microscopy, the scientific community has unprecedented access to large datasets at sub-micrometer resolution that characterize the architectural remodeling that accompanies changes in cardiomyocyte function in health and disease. However, these datasets have been under-utilized for&#160;investigating the role of cellular architecture remodeling in cardiomyocyte function. The purpose of this protocol is to outline how to create an accurate finite element model of a cardiomyocyte using high resolution electron microscopy and confocal microscopy images. A detailed and accurate model of cellular architecture has significant potential to provide new insights into cardiomyocyte biology, more than experiments alone can garner. The power of this method lies in its ability to computationally fuse information from two disparate imaging modalities of cardiomyocyte ultrastructure to develop one unified and detailed model of the cardiomyocyte. This protocol outlines steps to integrate electron tomography and confocal microscopy images of adult male Wistar (name for a specific breed of albino rat) rat cardiomyocytes to develop a half-sarcomere finite element model of the cardiomyocyte. The procedure generates a 3D finite element model that contains an accurate, high-resolution depiction (on the order of ~35 nm) of the distribution of mitochondria, myofibrils and ryanodine receptor clusters that release the necessary calcium for cardiomyocyte contraction from the sarcoplasmic reticular network (SR) into the myofibril and cytosolic compartment. The model generated here as an illustration does not incorporate details of the transverse-tubule architecture or the sarcoplasmic reticular network and is therefore a minimal model of the cardiomyocyte. Nevertheless, the model can already be applied in simulation-based investigations into the role of cell structure in calcium signaling and mitochondrial bioenergetics, which is illustrated and discussed using two case studies that are presented following the detailed protocol.

This protocol outlines a novel method to create a spatially detailed finite element model of the intracellular architecture of cardiomyocytes from electron microscopy and confocal microscopy images. The power of this spatially detailed model is demonstrated using case studies in calcium signaling and bioenergetics.

יצירת מודל גיאומטרי מבנית מציאותי סופיים של Cardiomyocyte ללמוד את התפקיד של אדריכלות הסלולר Cardiomyocyte במערכות ביולוגיות

With the advent of three-dimensional (3D) imaging technologies such as electron tomography, serial-block-face scanning electron microscopy and confocal ...

Measurement of Force-Sensitive Protein Dynamics in Living Cells Using a Combination of Fluorescent Techniques

Cells sense and respond to physical cues in their environment by converting mechanical stimuli into biochemically-detectable signals in a process called mechanotransduction. A crucial step in mechanotransduction is the transmission of forces between the external and internal environments. To transmit forces, there must be a sustained, unbroken physical linkage created by a series of protein-protein interactions. For a given protein-protein interaction, mechanical load can either have no effect on the interaction, lead to faster disassociation of the interaction, or even stabilize the interaction. Understanding how molecular load dictates protein turnover in living cells can provide valuable information about the mechanical state of a protein, in turn elucidating its role in mechanotransduction. Existing techniques for measuring force-sensitive protein dynamics either lack direct measurements of protein load or rely on the measurements performed outside of the cellular context. Here, we describe a protocol for the F&#246;rster resonance energy transfer-fluorescence recovery after photobleaching (FRET-FRAP) technique, which enables the measurement of force-sensitive protein dynamics within living cells. This technique is potentially applicable to any FRET-based tension sensor, facilitating the study of force-sensitive protein dynamics in variety of subcellular structures and in different cell types.

Here, we present a protocol for the simultaneous use of F&#246;rster resonance energy transfer-based tension sensors to measure protein load and fluorescence recovery after photobleaching to measure protein dynamics enabling the measurement of force-sensitive protein dynamics within living cells.

מדידה של דינמיקה רגישים ל"כוח הפזורים חלבונים בתאים חיים באמצעות שילוב של טכניקות פלורסנט

Cells sense and respond to physical cues in their environment by converting mechanical stimuli into biochemically-detectable signals in a process called ...

A Microfluidic Platform for Stimulating Chondrocytes with Dynamic Compression

Mechanical stimuli are known to modulate biological functions of cells and tissues. Recent studies have suggested that compressive stress alters growth plate cartilage architecture and results in growth modulation of long bones of children. To determine the role of compressive stress in bone growth, we created a microfluidic device actuated by pneumatic pressure, to dynamically (or statically) compress growth plate chondrocytes embedded in alginate hydrogel cylinders. In this article, we describe detailed methods for fabricating and characterizing this device. The advantages of our protocol are: 1) Five different magnitudes of compressive stress can be generated on five technical replicates in a single platform, 2) It is easy to visualize cell morphology via a conventional light microscope, 3) Cells can be rapidly isolated from the device after compression to facilitate downstream assays, and 4) The platform can be applied to study mechanobiology of any cell type that can grow in hydrogels.

This article provides detailed methods for fabricating and characterizing a pneumatically actuating microfluidic device for chondrocyte compression.

פלטפורמת מיקרופלואידיג לעירור כונדרוציטים עם דחיסה דינמית

Mechanical stimuli are known to modulate biological functions of cells and tissues. Recent studies have suggested that compressive stress alters growth ...