Name: desthiobiotin-streptavidin-affinity mediated purification of rna-interacting proteins in mesothelioma cells
Uploaded: 2018-04-25T15:00:00.000+00:00
Duration: 11 min 11 s
Description: Watch this Scientific Journal Video about Desthiobiotin-Streptavidin-Affinity Mediated Purification of RNA-Interacting Proteins in Mesothelioma Cells at JoVE.com

Bu eser İsviçre Ulusal Bilim Vakfı Sinergia grant CRSII3 147697, Stiftung für Angewandte Krebsforschung ve Zürih Krebsliga tarafından desteklenmiştir.

1. hazırlanması sitozolik ve nükleer Protein fraksiyonu
<ol><li>Plaka 4 x 106 ACC-MESO-4 hücreleri RPMI - 1640 orta yetiştirilen bir T150 hücre kültür şişeye %10 FBS, 1 x penisilin/streptomisin (100 x) ve 2 mM L-glutamin (200 mM) ile desteklenmiştir. Hücrelerin % 80-90 (~5-5.5 x 106 hücreler) bir izdiham ulaştığınızda, nükleer ve sitozolik kesir protein çıkarılması ile devam edin. Not: ACC-MESO-4 hücre kültürünü RIKEN BioResource Merkezi11' den elde edildi.</li>
	<li>Orta Aspire edin, hücreleri 15 mL 1 x PBS ekleyerek yıkama, plaka birkaç kez hafifçe eğimli ve 1 x PBS Aspire edin. 3 mL % 0.25 ekleyin tripsin-EDTA ve kültür şişesi 3 dk 37 ° C'de kuluçkaya. Not: dekolmanı için mikroskop altında hücreleri bakın; Eğer hala dokunun bağlı 3 avucunun karşı şişeye kez.</li>
	<li>%10 FBS, 1 x penisilin/streptomisin (100 x) ve 2 mM L-glutamin (200 mM) ile RPMI-1640 Orta 7 mL ekleyin, bir 15 mL tüp hücrelerde toplamak ve spin aşağı 200 x g 5 min için de.</li>
	<li>Orta Aspire edin ve hücre Pelet 1,5 mL 1 x PBS ile resuspend sonra hücreleri 1.5 mL microcentrifuge tüp içine aktarın. Spin aşağı vasıl 500 x g ve 4 ° C 5 dk. atma süpernatant. Not: Bu adım ileriye doğru 4 ° C'de tüm Santrifüjü adımlarını gerçekleştirin ve buz üzerinde tüm reaktifler tutmak.</li>
	<li>Hücre Pelet buz gibi 1.5 mL 1 x PBS ile resuspend ve 500 x g ve 4 ° C'de 3 dakika süreyle hücreleri aşağı spin süpernatant atın. Not: Ben, CER II ve NER Kimyasalları 10, 0,55 ve 5 cilt cilt, sırasıyla Paketli tahmini hücre Pelet CER gerekli miktarda vardır; Aşağıdaki protokol 20 µL hacmi varsayar. Biz sadece reaktif CER gerekli miktarda hazırlanması tavsiye ben.</li>
	<li>Buz gibi sitoplazmik ayıklama reaktif 200 µL ekleyin (CER ben) 1 x İndinavir inhibitörü, örneğin, 2 µL ile takıma proteaz inhibitörü (EDTA içermeyen) 1 tablet 500 µL 100 x hisse senedi almak için su içinde seyreltik. Bu miktar reaktif CER ben da birim Paketli bir hücre Pelet 20 µL koşullar için yeterlidir.<ol>
<li>Hücre Paketli Pelet birim tahmin etmek için 1 x PBS 10, 20, 50 veya 100 µL ile dolu 1.5 mL tüp ile hücre Pelet içeren tüp karşılaştırın.</li>
	</ol>
</li>
	<li>Hücre pelet tarafından şiddetle vortexing 15 için tüp resuspend s ve buz için 10 dk. 11 eklemek µL buz gibi sitoplazmik ayıklama reaktif II (CER II) tüp, 5 için şiddetle girdap tüp kuluçkaya s ve 1dk buz üzerinde kuluçkaya.</li>
	<li>Şiddetle için 5 s ve santrifüj tüpü 16.000 g x, girdap ve 4 ° C'de 5 dakika süreyle Transfer süpernatant temiz önceden soğutulmuş tüp buz üzerinde. Daha fazla sitoplazmik kesir süpernatant olduğunu RNA-açılan deneyde kullanılan.</li>
	<li>1 µL İndinavir inhibitörü (100 x) ve şiddetle 15 için girdap ile takıma kalan Pelet 100 µL buz gibi nükleer ayıklama reaktif (NER) içinde resuspend s. Proteaz inhibitörleri ile desteklenmiş NER reaktif yalnızca gerekli miktarda hazırlanması tavsiye ediyoruz.</li>
	<li>Örnek zaman zaman vortexing 15 ile 40 dakika buz üzerinde kuluçkaya s (her 10 min).</li>
	<li>Tüp 16. 000 x g 10 dk. Transfer için de (bu nükleer protein fraksiyonu) süpernatant temiz bir önceden soğutulmuş tüp santrifüj kapasitesi.</li>
	<li>Hemen bicinchoninic (BCA) yöntemini kullanarak protein konsantrasyonu ölçerek devam ( Tablo malzemelerigörmek). Her kesir protein saflık için denetlemek için α-tübülin (sitozolik kesir pozitif algılamasını sadece) ve poli ADP-riboz polimeraz - PARP (nükleer kesir pozitif algılamasını sadece) karşı immunoblotting (şekil 1) gerçekleştirin. Protein görselleştirme için 4 bölümüne bakın.</li>
	<li>Protein etkinlik ve yerel durumlarına tutmak için aliquots sitozolik ve nükleer özler 25 µL hazırlayın. Ek-bu aliquots donma 5 s ve-80 ° C'de doğrudan mağaza için sıvı azot yerleştirerek</li>
</ol>2. RNA Desthiobiotin ile etiketleme
<ol><li>Ticari olarak sentezlenmiş RNA probları ve saf HPLC hakkına sahiptir. Nükleaz ücretsiz su 10 µM ile resuspend. Not: Sonda dizileri Tablo 1' de listelenmiştir.</li>
	<li>RNA, RNA-açılan tepki başına 50 pmol kullanın. Çözülme ve tüm reaktifler için % 30, etiket 3' terminus için RNA oligo, kullanılan PEG dışında buz üzerinde tutun.</li>
	<li>CALB2 3' UTR (vardır) etiketli 10 µM RNA probları 5 µL transfer, CALB2 3' UTR (mtARE) ve ilgisiz-RNA (IRE), 0,5 mL ince duvar microcentrifuge içine borular ve PCR makinesi 85 ° C'de 5 dk. yerleştirmek için tüpler hemen buz üzerinde kuluçkaya. Not: gevşeme ve etiketleme için RNA sonda erişilebilirliğini teşvik gibi bu adım önemlidir.</li>
	<li>Bir tek 30 µL tepki için aşağıdaki 10 µL karıştırmak için RNA içeren tüp ekleyin: nükleaz boş su 3 µL, 10 RNA ligaz tepki arabellek, RNase inhibitörü 1 µL x 3 µL (40 U/µL), Desthiobiotinylated sitidin Bisphosphate (1 mM) 1 µL ve T4 RNA ligaz (20 U/µL) 2 µL. Not: Ana mix A aşırı (3.2) 3 örnekleri hazırlamak için 9.6 µL nükleaz, ücretsiz su, 10 RNA ligaz tepki arabellek, RNase inhibitörü 3.2 µL x 9,6 µL mix (40 U/µL), 3.2 µL Desthiobiotinylated sitidin Bisphosphate (1 mM) ve T4 RNA ligaz (20 U/µL) 6.4 µL.</li>
	<li>Dikkatle 15 µL PEG tepki için % 30 ekleyin. Başka bir ipucu tepki karıştırmak için kullanın. Gecede 16 ° C'de tepki kuluçkaya</li>
	<li>Ertesi gün, aşağıdaki hazırlamak: 5 M NaCl (taze/nükleaz-free), kloroform: 24:1 oranında (örneğin, tepki - 96 µL kloroform ve izoamil alkol 4 µL başına), izoamil alkol buz gibi % 100 etanol ve buz gibi % 70 etanol.</li>
	<li>Nükleaz ücretsiz su 70 µL RNA etiketleme tepki tüpler için ekleyin. Kloroform 100 µL ekleyin: izoamil alkol ve girdap kısaca. Spin aşağı de 13.000 x g 3 dk. dikkatli bir şekilde çıkarın için yalnızca üst aşaması ve aktarımı için yeni bir 1,5 mL nükleaz ücretsiz tüp; daha düşük faz dokunmaktan kaçının.</li>
	<li>5 M NaCl, glikojen 1 µL ve buz gibi % 100 etanol 300 µL 10 µL ekleyin. -20 ° c 2 h için tüpü yerleştirin. Not: Bu adımda, ertesi gün deneme devam edilebilir.</li>
	<li>13.000 g x ve 4 ° C de 15 dakika süreyle santrifüj dikkatli atmak süpernatant Pelet bozmadan. Buz gibi % 70 etanol ve santrifüj 13.000 x g ve 4 ° C tekrar 5 min için 300 µL ekleyin.</li>
	<li>Tamamen süpernatant atın ve Pelet (15 dk) kuruması. Pelet nükleaz ücretsiz su 20 µL içinde resuspend. Not: Aynı gün RNA-açılan ile devam edin.</li>
	<li>2 dk 90 ° C'de RNA kuluçkaya ve Buza koyun. Etiketli RNA streptavidin manyetik boncuklar ön yıkama aşağıdaki adımı sırasında Buza koyun. Not: Daha uzun bir kuluçka süresi RNA sonda zarar verebilir.</li>
</ol>3. RNA-Protein açılan
<ol><li>
Streptavidin manyetik boncuklar ve kuluçka desthiobiotin-RNA ile ön yıkama
	<ol>
<li>Streptavidin manyetik boncuklar 50 pmol RNA başına 50 µL kullanın. Ancak, bu deney bağlı olarak optimize edilmelidir.</li>
		<li>Girdap 15 s ve hızlı bir şekilde temiz 1.5 mL kullanarak güvenli kilit tüp içine Kaldır 200 µL (ana mix; 3 + 1 reaksiyonlar için yeterli) için streptavidin manyetik boncuklar ile tüp pipet ipuçları kesmek. Tüp manyetik bir stand üzerine boncuk tüp tarafında toplamak ve 1 dk. Kaldır resuspension sıvı bekleyin yerleştirin.</li>
		<li>Boncuk yıkamak için manyetik standından tüpü çıkarması, 0.1 M NaOH, 0,05 M NaCl çözüm ve hafifçe yukarı ve aşağı birkaç kez damlalıklı 400 µL ekleyin. Tüp manyetik sandalyesine koyun. 1 dk bekleyin ve süpernatant toplamak. Yine bu adımı yineleyin.</li>
		<li>Boncuk 200 µL 100 mm NaCl ile yıkayın. Süpernatant kaldırın.</li>
		<li>200 µL 20 mm Tris (pH 7.5), boncuk pipetting tarafından resuspend, tüp manyetik kürsüye getirin, için 1 dakika bekleyin ve süpernatant kaldırmak ekleyin. Adımı tekrarlayın.</li>
		<li>Manyetik standından tüpü çıkarması, RNA yakalama arabelleğinin x 1 200 µL eklemek ve streptavidin manyetik boncuklar kısaca vortexing tarafından resuspend. Streptavidin manyetik boncuklar 50 µL kaldırın ve her etiketli-RNA tüp kesme pipet ucu kullanarak ekleyin. Tüpler, oda sıcaklığında bir rulo üzerinde 30 dk için kuluçkaya.</li>
	</ol>
</li>
	<li>
Bağlayıcı protein RNA
	<ol>
<li>Tüpler manyetik bir stand içine koyun, 1 dk bekleyin ve süpernatant kaldırın.</li>
		<li>20 mm Tris (pH 7.5) 50 µL için boncuk ekleyin ve pipetting tarafından resuspend. Tüpler manyetik bir stand içine koyun, 1 dk bekleyin ve süpernatant kaldırın. Bu adımı yineleyin.</li>
		<li>1 Protein-RNA bağlama arabellek x 100 µL için boncuk ekleyin ve pipetting tarafından resuspend.</li>
		<li>Bu arada, aşağıdaki karışımı hazırlayın: 10 x Protein-RNA bağlama arabellek, % 50 gliserol 30 µL, 50 µg sitoplazmik proteinlerin ve nükleaz ücretsiz 10 µL su 100 µL. Not: Ana mix B aşırı (3,3) 3 örnekleri aşağıdaki gibi hazırlamak: 10 Protein-RNA bağlama arabellek x 33 µL, 99 µL % 50 gliserol, sitoplazmik protein ve nükleaz ücretsiz su kadar 330 µL. 165 µg tutmak ana mix B buz üzerinde tüp.</li>
		<li>Tüpler manyetik stand içine koyun, 1 dk bekleyin ve süpernatant toplamak. Ana Mix B 100 µL eklemek, yavaşça yukarı ve aşağı pipetting tarafından resuspend ve kabarcıklar oluşturmaktan kaçının. Reaksiyon tüpler bir rulo üzerinde 4 ° C'de 60 dk için kuluçkaya.</li>
	</ol>
</li>
	<li>
Çamaşır ve elüsyon
	<ol>
<li>Tüpler manyetik bir stand içine yerleştirin, (bu akışı - FT) süpernatant toplamak ve yeni bir tüp içine aktarın. Not: Bu FT daha sonraki analizler için buz üzerinde tutun.</li>
		<li>1 yıkama arabellek boncukları üzerinde x 100 µL pipet, hafifçe resuspend, manyetik stand içine koy, 1 dk bekleyin ve süpernatant atmak. Bu 2 kez tekrarlayın.</li>
		<li>Yukarı ve aşağı pipetting tarafından mix ve 30 dk bir tüp shaker (950 devir/dakika) olarak 37 ° C'de kuluçkaya elüsyon arabelleği 40 µL manyetik boncuklar ekleyin.</li>
		<li>Tüpler manyetik bir stand içine yerleştirin, 1 dk bekleyin ve (Bu eluate - E) eluted örnek toplamak. Buz üzerinde ve aşağı akım analizi için kullanın. Not: Bu adımda, her test RNA sonda bir akışı aracılığıyla (FT) ve eluate (E) örnek oluşur.</li>
	</ol>
</li>
</ol>4. polyacrylamide Elektroforez ve Western Blot analizi
Not: Bu bölümde kullanılan arabellekleri için yemek tarifleri için Tablo 2 bakın. Gerçekleştirmek bir Western blot Laemmli yöntemi12göre.
<ol><li>Handcast % 12 SDS-sayfa jelleri (10-wells, 1.5 mm rondela, 66 µL). Çalışan bir jel karışım hazırlamak: 4 mL % 30 Akrilamid-bisacrylamide stok çözeltisi, alt Tris 2.4 mL tampon, dH2O, TEMED, 96 µL % 10 amonyum persülfat çözüm (APS) 9.6 µL 3.2 mL. Yığın jel karışımı hazırlayın: 3.25 mL dH2O, % 30 Akrilamid - bisacrylamide hisse senedi çözüm, üst Tris arabelleği 1.3 mL 0.5 mL, TEMED, 20 µL % 10 10 µL APS.</li>
	<li>6 x Laemmli arabelleği 16.6 µL ekleyin (örneğin, 14 mL (üst Tris arabellek) Tris/HCl/SDS pH 6.8, SDS, DTT, 6 mL gliserol ve %0.012 bromophenol mavi; 1.86 g, 2 g-20 ° C'de depolanan) FT örnek ve 6 x Laemmli arabellek içine E örnek 6.6 µL içine. Örnekleri 95 ° C'de 5 min için kuluçkaya</li>
	<li>(20 µL FT ve bütün Elute ~ 40 µL) örnekleri yüklemek ve 30 dk 60 V, gecede 20 V ile devam için çalıştırabilirsiniz.</li>
	<li>Yarı kuru electroblotting sistemiyle, proteinler için 80 dk 15 V PVDF membran üzerine aktarın. Not: PVDF membran protein transferi yapmadan önce etkinleştirilmesi gerekir. % 100 metanol için 1 dakika, 2 dk kuluçka ultrasaf su ardından membran kuluçkaya.</li>
	<li>Protein transferden sonra SDS-sayfa jel ile Coomassie çözüm, her 30 dk ultrasaf su ile yıkama üç numaralı adımları takip 3 h için kuluçkaya.</li>
	<li>Protein aktarımı sonunda 4.5 adımda gösterildiği gibi membran 1 h. yeniden etkinleştirmek için Kuru PVDF membran izin. Membran 1 x TTBS %5 BSA ile 1 h blok.</li>
	<li>Membran ile ilk antikor kuluçkaya: HuR veya mesothelin, her ikisi de seyreltilmiş 1: 1000 1 x TTBS 4 h oda sıcaklığında veya gecede 4 ° C'de % 5 BSA içinde</li>
	<li>7 dk. için üç kez membran 1 x TTBS yıkama ve tavşan Anti-fare horseradish peroksidaz (HRP) kuluçkaya-konjüge ikincil antikor seyreltilmiş %5 BSA, 1 x TTBS 1:10,000.</li>
	<li>Proteinler gelişmiş Kemiluminesan ve dijital görüntüleyici kullanarak görselleştirmek.</li>
</ol>

<ol>
	<li>Glisovic, T., Bachorik, J. L., Yong, J., Dreyfuss, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-binding+proteins+and+post-transcriptional+gene+regulation.">RNA-binding proteins and post-transcriptional gene regulation.</a> FEBS Letters. 582 (14), 1977-1986 (2008).</li><li>Mayr, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolution+and+biological+roles+of+alternative+3'UTRs.">Evolution and biological roles of alternative 3'UTRs.</a> Trends in Cell Biology. 26 (3), 227-237 (2016).</li><li>Matoulkova, E., Michalova, E., Vojtesek, B., Hrstka, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+the+3'+untranslated+region+in+post-transcriptional+regulation+of+protein+expression+in+mammalian+cells.">The role of the 3' untranslated region in post-transcriptional regulation of protein expression in mammalian cells.</a> RNA Biology. 9 (5), 563-576 (2012).</li><li>von Roretz, C., Di Marco, S., Mazroui, R., Gallouzi, I. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Turnover+of+AU-rich-containing+mRNAs+during+stress:+a+matter+of+survival.">Turnover of AU-rich-containing mRNAs during stress: a matter of survival.</a> Wiley Interdisciplinary Reviews: RNA. 2 (3), 336-347 (2011).</li><li>Fallmann, J., Sedlyarov, V., Tanzer, A., Kovarik, P., Hofacker, I. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=AREsite2:+An+enhanced+database+for+the+comprehensive+investigation+of+AU/GU/U-rich+elements.">AREsite2: An enhanced database for the comprehensive investigation of AU/GU/U-rich elements.</a> Nucleic Acids Research. 44, D90-D95 (2016).</li><li>Kresoja-Rakic, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Posttranscriptional+regulation+controls+calretinin+expression+in+malignant+pleural+mesothelioma.">Posttranscriptional regulation controls calretinin expression in malignant pleural mesothelioma.</a> Frontiers in Genetics. 8 (70), (2017).</li><li>Chu, C., Spitale, R. C., Chang, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Technologies+to+probe+functions+and+mechanisms+of+long+noncoding+RNAs.">Technologies to probe functions and mechanisms of long noncoding RNAs.</a> Nature Structural &amp; Molecular Biology. 22 (1), 29-35 (2015).</li><li>Diamandis, E. P., Christopoulos, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biotin-(strept)avidin+system:+principles+and+applications+in+biotechnology.">The biotin-(strept)avidin system: principles and applications in biotechnology.</a> Clinical Chemistry. 37 (5), 625-636 (1991).</li><li>Hirsch, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Easily+reversible+desthiobiotin+binding+to+streptavidin,+avidin,+and+other+biotin-binding+proteins:+Uses+for+protein+labeling,+detection,+and+isolation.">Easily reversible desthiobiotin binding to streptavidin, avidin, and other biotin-binding proteins: Uses for protein labeling, detection, and isolation.</a> Analytical Biochemistry. 308 (2), 343-357 (2002).</li><li>. Magnetic bead technology for better assay development Available from: <a target="_blank" href="https://assets.thermofisher.com/TFS-Assets/LSG/brochures/1602577-Magnetic-Bead-Technology-Brochure.pdf">https://assets.thermofisher.com/TFS-Assets/LSG/brochures/1602577-Magnetic-Bead-Technology-Brochure.pdf</a> (2013)</li><li>Usami, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+and+characterization+of+four+malignant+pleural+mesothelioma+cell+lines+from+Japanese+patients.">Establishment and characterization of four malignant pleural mesothelioma cell lines from Japanese patients.</a> Cancer Science. 97 (5), 387-394 (2006).</li><li>Laemmli, U. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cleavage+of+structural+proteins+during+the+assembly+of+the+head+of+bacteriophage+T4.">Cleavage of structural proteins during the assembly of the head of bacteriophage T4.</a> Nature. 227 (5259), 680-685 (1970).</li><li>Coulson, R. M., Cleveland, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ferritin+synthesis+is+controlled+by+iron-dependent+translational+derepression+and+by+changes+in+synthesis/transport+of+nuclear+ferritin+RNAs.">Ferritin synthesis is controlled by iron-dependent translational derepression and by changes in synthesis/transport of nuclear ferritin RNAs.</a> Proceedings of the National Academy of Sciences of the United States of America. 90 (16), 7613-7617 (1993).</li><li>Leibold, E. A., Munro, H. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytoplasmic+protein+binds+in+vitro+to+a+highly+conserved+sequence+in+the+5'+untranslated+region+of+ferritin+heavy-+and+light-subunit+mRNAs.">Cytoplasmic protein binds in vitro to a highly conserved sequence in the 5' untranslated region of ferritin heavy- and light-subunit mRNAs.</a> Proceedings of the National Academy of Sciences of the United States of America. 85 (7), 2171-2175 (1988).</li><li>Srikantan, S., Gorospe, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HuR+function+in+disease.">HuR function in disease.</a> Frontiers in Bioscience (Landmark Edition). 17, 189-205 (2012).</li><li>Morris, K. V., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+rise+of+regulatory+RNA.">The rise of regulatory RNA.</a> Nature Reviews: Genetics. 15 (6), 423-437 (2014).</li><li>Rinn, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+demarcation+of+active+and+silent+chromatin+domains+in+human+HOX+loci+by+noncoding+RNAs.">Functional demarcation of active and silent chromatin domains in human HOX loci by noncoding RNAs.</a> Cell. 129 (7), 1311-1323 (2007).</li><li>Zhao, J., Sun, B. K., Erwin, J. A., Song, J. J., Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polycomb+proteins+targeted+by+a+short+repeat+RNA+to+the+mouse+X+chromosome.">Polycomb proteins targeted by a short repeat RNA to the mouse X chromosome.</a> Science. 322 (5902), 750-756 (2008).</li><li>McHugh, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Xist+lncRNA+interacts+directly+with+SHARP+to+silence+transcription+through+HDAC3.">The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3.</a> Nature. 521 (7551), 232-236 (2015).</li></ol>

Yazarlar onlar rakip hiçbir mali çıkarları var bildirin.

Kodlamayan genom3' e 3' UTRs ait ve onların işlev7uygulamak için tüm kodlamayan RNA'ların proteinler ile etkileşim kurabilir. Ne zaman memeli genom pervasively transkripsiyonu için kurmak ve uzun kodlamayan RNA'ların16önemli bir kısmını üretilen, delillerin ortaya çıkan bu uzun kodlamayan RNA'ların ile etkileşimde bulunan gen ifadesinin düzenlenmesine çalışması gösterdi kompleksleri17Kromatin remodeling. Bu bilgi RNA-açılan tahlil kullanarak elde edilen. Gerçekleştirmek basit olarak böylece, interactors belirli bir RNA'ın deşifre başlatmak için ilk adım vitro biyokimyasal deneyleri RNA-açılan gibi olabilir.
Not, sadece sıra motifleri aynı zamanda RNA'ın ikincil yapı bir kritik rol oynar RNA işlevindeki etki alanları proteinler ile etkileşim için temel biçimi olarak. İkincil yapı fizyolojik olarak değişebilir ve vitro koşulları ve RNA-açılan falsepositives tanımlaması için neden olabilir. Örneğin, RNA-açılan EZH2, baskıcı karmaşık 2 (PRC2), polycomb bir parçası bir etkileşen etkin olmayan belirli transkript X tespit (Xist)18, RNA antianlamlı Arıtma kullanılan bir çalışmada kitle ile birleştiğinde ise spektrometresi (RAP-MS) tanımlanan diğer interactors gibi keskin (SMRT ve HDAC ilgili önleyici protein), SAF-1 (iskele ek faktör A) ve LBR (Okan B reseptör)19. Diğer fonksiyonel test yok bir RNA ve verilen bir protein arasındaki etkileşimi destekliyorsa, bu nedenle, bulgular daha fazla ile çıkarma tarafından takip immunoprecipitating verilen protein gibi tamamlayıcı bir protein-merkezli yaklaşım takıma ve bağımlı RNA karakterizasyonu.
Burada sunulan Protokolü HuR bağlama ARE motif için CALB2 içinde 3' UTR, daha önce işlevsel olarak pmiRGLO-luciferase tahlil6tarafından karakterize algılamak için kullanılan. Proteinlerin az miktarda nedeniyle, bu iletişim kuralı daha büyük protein miktarları gerekli nerede kütle spektrometresi gibi aşağı akım analizi için uygun değil. Bunun yerine, protokol RNA-kütle spektrometresi tarafından tanımlanan ama proteinler daha düşük bir miktarda kullanarak interactors düzeltin için kullanılabilir.
Beri düşmesine duyarlı olan RNA ile çalışma yöntemi içerir RNase enstrümanlarının çözüm ek olarak standart laboratuvar iyi uygulama ile çalışma yüzeyleri Temizleme öneririz. Mümkünse, RNA etiketleme ve arıtma laminar akış altında hazırlanması gerçekleştirin. RNA oligo saflığı da bağlayıcı koşulları etkileyebilir; Böylece, ticari olarak sentezlenmiş probları saf HPLC vardı. Değiştirilmiş, daha uzun ve son derece saf RNA oligos gerekiyorsa, sayfa arıtma yöntemini kullanın. Yerel proteinlerin aliquots buz gibi bu nedenle yavaş dondurma yaklaşım ve tekrarlanan dondurma ve çözme nedeniyle proteinlerin zarar kaçınarak ek hazırlayın.

Gen ekspresyonu ve gen ürünü son seviyesi sıkıca mRNA kararlılığı ve mRNA çeviri hızı1etkileyen tarafından düzenlenmiş. Çoğu yasal mekanizmaların kodlamayan RNA ve/veya RNA bağlanıcı proteinler (RBPs) etkileşimleri ile hedeflenen mRNA aracılığıyla sarf. Bu genellikle 3' Çevrilmeyen mRNA (3' UTR - genom2kodlamayan bölümüne ait) belirli CISiçeren bölgedir- transtarafından tanınan düzenleyici elemanlarının (CRE),-miRNA ya da RBPs gibi faktörler rol 3. en çok çalışılmış CIS-içinde 3' UTR, öğedir belirli AU bağlanıcı proteinler (AUBP) tarafından ve sırayla tanınır, adenin-zengini eleman (vardır) motifi neden olmaktadır ya mRNA bozulması/deadenylation (ARE-aracılı decay) veya mRNA sabitleme4.
Boyutu olduğunu 3' UTR'nin calretinin, mRNA (CALB2) 573 bp uzun ve AREsite2, bir bioinformatic araç5tarafından tahmin ettiği gibi sözde AUUUA pentamer içerir. Bir sözde olan motif varlığı ile tutarlı, pmirGLO vektör-muhabir tahlil bir istikrar rol CALB2 mRNA6içinde bu öğesinin gösterdi. Son olarak, vitro RNA-açılan calretinin stabilize AUBP tanımlamak için kullanılan olan motif aracılığıyla mRNA.
Tüm kodlamayan RNA'ların proteinler7ile etkileşim, vitro RNA-açılan bir iyi yolu ve RNA-interactors tanımlamak için seçim ilk tahlil moleküler mekanizmaları çözmekte yardımcı olmak için çünkü. Bu RNA-açılan yönteminde biotin (desthiobiotin) 3' terminus RNA iplikçiğinin, değiştirilmiş bir formla etiketli, ticari olarak sentezlenmiş RNA probları kullanılmıştır. RNA-desthiobiotin ile özellikle ilgi bağlı-RNA ile etkileşim proteinler aşağı çekmek için kullanılan manyetik boncuklar streptavidin etkileşimi aracılığıyla immobilize. Mesothelioma hücreleri sitozolik kısmını gelen sigara denatüre ve aktif proteinler, protein kaynağı olarak kullanılır. Böyle RNA bağlı proteinler manyetik boncuklar, % 12'si SDS-sayfa jel çalıştırmak, bir membran transfer ve farklı antikorlar ile probed üzerinden eluted.
Standart streptavidin-biotin benzeşme arıtma yordam, sert denatürasyon koşulları ilişkili proteinler8, elute için güçlü geri dönüşü olmayan biotin streptavidin bağ bozmak için gerekli olan ayrılma neden olabilir protein kompleksleri. Biotin, aksine desthiobiotin ters streptavidin için bağlar ve rekabetçi biotin için protein elüsyon nazik bırakılınca koşar ve doğal olarak biotinylated molekülleri9yalıtım kaçınarak, tamponlu bir çözüm ile yerlerinden olduğunu, Teknik yerli protein kompleksleri yerel koşullar altında yalıtmak için ideal olduğunu düşündüren.
Tuz konsantrasyonu, azalan bakiyeli ajanlar ve deterjan yüzde tarafından belirlenir, vitro bağlayıcı koşulları ve sıkılık, yakın bu hücresel bağlamda mevcut gerçek vivo içinde etkileşimleri tanımlamak için olması gerekir. Burada uygulanan bağlama koşulları daha önce bir AU-bağlayıcı protein10Hur kimliği için uygun olarak gösterilmiştir. Uygun ciltleme koşullardan en iyi duruma getirme zaman alıcı ve zor olabilir bu yana bu yaklaşım zaman kazanmak. Buna ek olarak, bu yöntem bir başlangıç iletişim kuralı olarak herhangi bir RNA-açılan deneme için kullanılan ve yavaş yavaş tuzları ve deterjanlar konsantrasyon değiştirme gliserol yüzdesini değiştirerek ve diğer tuzları ekleyerek optimize edilebilir. Ayrıca, biz bile bir kısa 25-nükleotit RNA-bir pentamer yataklık sonda vardır-motif belirli bir AUBP ile etkileşim göstermek için kullanılabileceğini gösterdi.

<table><tbody><tr><td>NE-PER Nuclear and cytoplasmic extraction kit</td><td>Thermo Fisher Scientific&amp;nbsp;</td><td>78833</td><td></td></tr><tr><td>Pierce Protease Inhibitor Tablets, EDTA-free</td><td>Thermo Fisher Scientific</td><td>A32965</td><td></td></tr><tr><td>Pierce BCA Protein Assay Kit</td><td>Thermo Fisher Scientific</td><td>23225</td><td></td></tr><tr><td>Pierce Magnetic RNA-protein Pull-Down Kit&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>20164</td><td>Includes magnetic beads and therefore the kit need to be stored at 4 &amp;deg;C</td></tr><tr><td>Pierce RNA 3&amp;rsquo; End Desthiobiotinylation Kit&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>20163</td><td>The kit is a part of the &quot;Pierce Magnetic RNA-protein Pull-Down Kit&quot;, and needs to be stored at -20 &amp;deg;C unlike the pull-down kit (4 &amp;deg;C).</td></tr><tr><td>DynaMag-2,&amp;nbsp; magnetic stand</td><td>Thermo Fisher Scientific</td><td>12321D</td><td></td></tr><tr><td>Anti - HuR (MOUSE) monoclonal antibody</td><td>Thermo Fisher Scientific</td><td>-</td><td>The antibody is included in the Pierce Magnetic RNA-protein Pull-Down Kit&amp;nbsp; - 1:1000 in 5% BSA 1x TTBS - rabbit anti-mouse secondary antibody 1:10,000 in 5% BSA 1x TTBS</td></tr><tr><td>Anti - &amp;alpha; - tubulin (MOUSE) monoclonal antibody</td><td>Santa Cruz</td><td>8035</td><td>1:1000 in 5% BSA 1x TTBS - rabbit anti-mouse secondary antibody 1:10,000 in 5% BSA 1x TTBS</td></tr><tr><td>Anti - PARP (RABBIT) Polyclonal antibody</td><td>Cell Signaling</td><td>9542</td><td>1:1000 in 5% BSA 1x TTBS - goat anti-rabbit secondary antibody 1:10,000 in 5% BSA 1x TTBS</td></tr><tr><td>Anti - Mesothelin (MOUSE) Monoclonal Antibody&amp;nbsp;</td><td>Rockland</td><td>200-301-A87</td><td></td></tr><tr><td>Secondary goat anti-rabbit antibody</td><td>Cell Signaling</td><td>7074</td><td></td></tr><tr><td>Secondary rabbit anti-mouse antibody</td><td>Sigma-Aldrich</td><td>A-9044</td><td></td></tr><tr><td>RPMI - 1640 medium</td><td>Sigma-Aldrich</td><td>R8758</td><td></td></tr><tr><td>FBS - Filtrated Bovine Serum</td><td>Pan Biotech&amp;nbsp;</td><td>P40-37500</td><td></td></tr><tr><td>Penicillin - streptomycin (100x)</td><td>Sigma-Aldrich&amp;nbsp;</td><td>P4333</td><td></td></tr><tr><td>L-Glutamine solution (200 mM)</td><td>Sigma-Aldrich&amp;nbsp;</td><td>G7513</td><td></td></tr><tr><td>0.25% Trypsin-EDTA (1x)</td><td>Gibco by Life technologies&amp;nbsp;</td><td>25200-056</td><td></td></tr><tr><td>Mini-PROTEAN 3 Cell</td><td>Bio-Rad</td><td>1653301</td><td></td></tr><tr><td>Mini Protean System Glass Plates&amp;nbsp;</td><td>Bio-Rad</td><td>1653308</td><td></td></tr><tr><td>Mini-PROTEAN Spacer Plates with 1.5 mm integrated spacer</td><td>Bio-Rad</td><td>1653312</td><td></td></tr><tr><td>Mini-PROTEAN Comb, 10-well, 1.5 mm, 66 &amp;micro;L</td><td>Bio-Rad</td><td>1653365</td><td></td></tr><tr><td>Mini-PROTEAN Tetra Cell Casting Modules</td><td>Bio-Rad</td><td>1658050</td><td></td></tr><tr><td>RNaseZap RNase Decontamination Solution</td><td>Thermo Fisher Scientific</td><td>AM9780</td><td></td></tr><tr><td>Rotiphorese gel 30 - aqueous 30% acrylamide and bisacrylamide stock solution at a ration of 37.5:1</td><td>Roth</td><td>3029</td><td></td></tr><tr><td>20% SDS&amp;nbsp;</td><td>PanReac AppliChem</td><td>A3942</td><td></td></tr><tr><td>PVDF transfer membrane&amp;nbsp;</td><td>Perkin Elmer</td><td>NEF1002</td><td>Need to be activated by incubating in pure methanol for 1 min followed by washing in water for 2 min&amp;nbsp;</td></tr><tr><td>Trans-Blot SD semi-dry transfer cell&amp;nbsp;</td><td>Bio-Rad</td><td>1703940</td><td></td></tr><tr><td>Clarity Western ECL Substrate</td><td>Bio-Rad</td><td>1705061</td><td></td></tr><tr><td>FusionFX&amp;nbsp; Digital Imager</td><td>Vilber</td><td>-</td><td></td></tr><tr><td>RNA oligo synthesis</td><td>Mycrosynth AG, Switzerland</td><td>-</td><td>the synthesis scale - 0.04 &amp;micro;mol - HPLC purified</td></tr><tr><td>Bovine serum albumin</td><td>Sigma-Aldrich</td><td>A7030</td><td></td></tr><tr><td>Hydrochloric Acid (HCl) 6 M</td><td>PanReac AppliChem</td><td>182883.1211</td><td></td></tr><tr><td>Ultra Pure 1 M Tris, pH 7.5&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>15567027</td><td></td></tr><tr><td>Glycerol&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>17904</td><td>50% sterile aliquots to be stored at -20&amp;deg;C</td></tr><tr><td>Pierce Streptavidin magnetic beads&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>88817</td><td>Please note that these magnetic beads have an average diameter of 1 &amp;micro;m (range from 0.5 - 1.5 &amp;micro;m). Furthermore, Dynabeads-M280 Streptavidin, which are beads of homogenouse size 2.8 &amp;micro;m, are also used in RNA-pulldown but be aware that this may affect purification process.</td></tr><tr><td>TEMED</td><td>Sigma-Aldrich</td><td>T9281</td><td></td></tr><tr><td>Ammonium persulfate&amp;nbsp;</td><td>Sigma-Aldrich</td><td>A3678</td><td></td></tr><tr><td>Coomassie G-250</td><td>Applichem</td><td>A3480</td><td></td></tr><tr><td>Aluminiumsulfate-(14-18)-hydrate&amp;nbsp;</td><td>Sigma-Aldrich</td><td>368458</td><td></td></tr><tr><td>ortho-phosphoric acid&amp;nbsp;</td><td>Applichem</td><td>A0637</td><td></td></tr></tbody></table>

desthiobiotin-streptavidin-affinity mediated purification of rna-interacting proteins in mesothelioma cells

Vitro RNA-açılan özel RNA yapıları ve motifleri tanımak RNA bağlanıcı proteinler belirlenmesi amaçlı iletişim kurallarının ilk adımda hala büyük ölçüde kullanılır. Bu RNA-açılan iletişim kuralında, biotin, desthiobiotin, 3' terminus streptavidin için geri döndürülebilir olarak bağlar ve böylece daha fazla altında proteinlerin elüsyon sağlayan RNA iplikçiğinin, değiştirilmiş bir formu ile ticari olarak sentezlenmiş RNA probları etiketlenir fizyolojik koşullar. RNA-desthiobiotin ile özellikle faiz RNA ile etkileşim proteinler aşağı çekmek için kullanılan manyetik boncuklar streptavidin etkileşimi aracılığıyla immobilize. Mesothelioma hücreleri sitozolik kısmını gelen sigara denatüre ve aktif proteinler, protein kaynağı olarak kullanılır. Burada anlatılan yöntem bilinen RNA proteinler ve bir faiz dizisini içeren 25-nükleotit (nt) uzun RNA prob arasındaki etkileşimi algılamaya uygulanır. Bu sabitleme veya öğeleri RNA molekülleri bir muhabir vektör tahlil kullanılarak elde mevcut istikrarsızlaştırıcı fonksiyonel karakterizasyonu tamamlamak yararlıdır.

Bu deneyde, calretinin 3' UTR barındıran ARE motifi (CALB2 3' UTR (vardır) 25-nt) 25-nt uzun parçası özellikle insan-antijen R (HuR) protein için bilinen bir mRNA sabitleyici bağlar olup olmadığını test etmek için kullanılmıştır. ARE öğesi, bir 25-nt RNA özgüllük test etmek için daha önce olan motif sabitleme etkisini ortadan kaldırmak için gösterildi, ARE-motif mutasyon içeren CALB2 3' UTR (mtARE) kullanılan6yoklamaydı. Üçüncü RNA sonda 28 nt olan negatif kontrol sitozolik protein demir-yanıt veren13,14bağlamak için bilinen iyi tanımlanmış demir duyarlı elemanı (ilgisiz RNA (IRE)), içeren RNA ilgisiz temsil eder. HuR mRNA sabitleyici sitozol15olarak çekirdek ama işlevleri içinde lokalize ağırlıklı olduğu için nükleer/sitozolik ayıklama etkin proteinler sitozol elde etmek için gerçekleştirildi.
Nükleer/sitozolik kesirler saflığı göstermek için proteinler PARP protein sadece beklenen ( olarak nükleer kesir olarak algılandı, ancak gösterdi o α-tübülin sadece sitozolik kesir algılandı Western blot tarafından analiz edildi Şekil 1). CALB2 3' UTR üzerinden eluate vardır-sonda gösterdi bağlama Hur HuR yoktu Oysa mutant üzerinden eluate içinde CALB 3' UTR (mtARE) sonda. HuR yapıldı Ayrıca demir duyarlı protein (şekil 2A) bağlar ilgisiz RNA sonda eluate içinde yok. Bu protein RNA ile etkileşimde bulunmaz gibi daha fazla özgüllük CALB 3' UTR (vardır) ve HuR arasında göstermek için membran Ayrıca anti-mesothelin (MSLN) antikor ile probed. Eluates tüm üç örnek üzerinden hiçbir varlığı mesothelin gösterdi. Birlikte ele alındığında, bu teskin olan motif CALB2 içinde 3' UTR özellikle HuR protein bağlayabilirsiniz gösterir.
Coomassie jel (şekil 2B) Boyama proteinler eşit miktarda üç farklı RNA probları ile kuluçkaya kullanılmıştır gösterir. Sitozolik özü kullanılan düşük miktarda ve membran aktarmak nedeniyle bu boyama eluate proteinleri algılanması için aksi takdirde Western blot analizi ile tespit edildi (E) şerit izin vermedi.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57516/57516fig1.jpg"> Şekil 1: Western blot analizi sitozolik ve nükleer protein fraksiyonu 5 µg. PARP protein nükleer kesir (N) var, ancak sitozolik (C) kesir yok. Α-tübülin sitozolik kesir (C) var, ancak nükleer kesir (N) yok. <a href="/files/ftp_upload/57516/57516fig1large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57516/57516fig2.jpg"> Şekil 2: Western blot gösterir HuR tarafından 25-nt CALB2 3' UTR (vardır) yakalanır. A) FT: akış yoluyla kuluçka sonra RNA sonda ile; E: proteinler kuluçka eluted ve bağlama RNA sondalar. Probları: CALB2 3' UTR (mtARE) - calretinin 3' olan motif içinde 3 mutasyona uğramış nükleotit içerir UTR'nin parçası 25-nt; UR RNA (IRE) - 28-nt RNA sonda demir duyarlı proteinleri bağlar iyi tanımlanmış bir demir-yanıt veren öğe ile. Membran daha fazla mesothelin (MSLN), RNA ile etkileşimde bulunmaz bir protein için sondaj. B) Coomassie proteinler eşit miktarda RNA ile inkübe gösteren protein transferden sonra jöleyi boyama sondalar. <a href="/files/ftp_upload/57516/57516fig2large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>RNA sonda</td>
			<td>Sıra</td>
			<td>Konsantrasyon</td>
		</tr>
<tr>
<td>CALB2 3' UTR (vardır) 25nt</td>
			<td>UCGCUGUAUGAUUUAGGCUUCUAUG</td>
			<td>10 ΜM</td>
		</tr>
<tr>
<td>CALB2 3' UTR (mtARE) 25nt</td>
			<td>UCGCUGUAUGGUCUGGGCUUCUAUG</td>
			<td>10 ΜM</td>
		</tr>
<tr>
<td>İlgisiz RNA - IRE 28nt</td>
			<td>UCCUGCUUCAACAGUGCUUGGACGGAAC</td>
			<td>10 ΜM</td>
		</tr>
</tbody></table>Tablo 1 : RNA dizisi probları
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Jel çalıştırmak için alt Tris arabellek</td>
			<td></td>
		</tr>
<tr>
<td>1,5 M</td>
			<td>Tris Bankası</td>
		</tr>
<tr>
<td>%0.40</td>
			<td>SDS çözüm</td>
		</tr>
<tr>
<td>addjust pH HCL kullanarak 8.8 için (6 mol/L)</td>
			<td></td>
		</tr>
<tr>
<td>ile doldur</td>
			<td>dH2O</td>
		</tr>
<tr>
<td>İstifleme için üst Tris SDS-sayfa jel</td>
			<td></td>
		</tr>
<tr>
<td>500 mM</td>
			<td>Tris Bankası</td>
		</tr>
<tr>
<td>%0,4</td>
			<td>SDS çözüm</td>
		</tr>
<tr>
<td>PH HCL kullanarak 6,8 için ayarlamak (6 mol/L)</td>
			<td></td>
		</tr>
<tr>
<td>ile doldur</td>
			<td>dH2O</td>
		</tr>
<tr>
<td>10 x çalışan arabellek</td>
			<td></td>
		</tr>
<tr>
<td>250 mM</td>
			<td>Tris Bankası</td>
		</tr>
<tr>
<td>1.92 M</td>
			<td>Glisin</td>
		</tr>
<tr>
<td>PH HCL kullanarak 8,3 için ayarlamak (6 mol/L)</td>
			<td></td>
		</tr>
<tr>
<td>ile doldur</td>
			<td>dH2O</td>
		</tr>
<tr>
<td>Filtre veya basınçlı kap ve mağaza 4° c</td>
			<td></td>
		</tr>
<tr>
<td>1 X çalıştıran arabellek</td>
			<td></td>
		</tr>
<tr>
<td>100 mL</td>
			<td>10 x çalışan arabellek</td>
		</tr>
<tr>
<td>% 0.05</td>
			<td>SDS çözüm</td>
		</tr>
<tr>
<td>1 L ile doldurmak</td>
			<td>dH2O</td>
		</tr>
<tr>
<td>10 x Aktarım arabellek</td>
			<td></td>
		</tr>
<tr>
<td>480 mM</td>
			<td>Tris Bankası</td>
		</tr>
<tr>
<td>390 mM</td>
			<td>Glisin</td>
		</tr>
<tr>
<td>%0,38</td>
			<td>SDS çözüm</td>
		</tr>
<tr>
<td>ile doldur</td>
			<td>dH2O</td>
		</tr>
<tr>
<td>Not: 0.22 um filtre ve 4 ° C'de depolayın</td>
			<td></td>
		</tr>
<tr>
<td>1 X Aktarım arabellek (yarı kuru sistemler için)</td>
			<td></td>
		</tr>
<tr>
<td>20 mL</td>
			<td>10 x Aktarım arabellek</td>
		</tr>
<tr>
<td>40 mL</td>
			<td>metanol</td>
		</tr>
<tr>
<td>200 mL doldurulması</td>
			<td>dH20</td>
		</tr>
<tr>
<td>10 X TBS (Tris arabelleğe alınmış serum)</td>
			<td></td>
		</tr>
<tr>
<td>250 mM</td>
			<td>Tris Bankası</td>
		</tr>
<tr>
<td>1,36 M</td>
			<td>NaCl</td>
		</tr>
<tr>
<td>27 mM</td>
			<td>KCl</td>
		</tr>
<tr>
<td>PH 7.4 için ayarlamak</td>
			<td></td>
		</tr>
<tr>
<td>ile doldur</td>
			<td>dH2O</td>
		</tr>
<tr>
<td>Filtre</td>
			<td></td>
		</tr>
<tr>
<td>1 X TTBS (0.1 ara-20 Tris-tampon serum)</td>
			<td></td>
		</tr>
<tr>
<td>1 X</td>
			<td>10 X TBS</td>
		</tr>
<tr>
<td>%0.10</td>
			<td>Ara-20</td>
		</tr>
<tr>
<td>ile doldur</td>
			<td>dH2O</td>
		</tr>
<tr>
<td>RNA yakalama arabelleğinin (1 X)</td>
			<td></td>
		</tr>
<tr>
<td>20 mM</td>
			<td>Tris (pH 7.5)</td>
		</tr>
<tr>
<td>1 M</td>
			<td>NaCl</td>
		</tr>
<tr>
<td>1 mM</td>
			<td>EDTA</td>
		</tr>
<tr>
<td>Protein-RNA bağlama arabellek (10 x)</td>
			<td></td>
		</tr>
<tr>
<td>200 mM</td>
			<td>Tris (pH 7.5)</td>
		</tr>
<tr>
<td>500 mM</td>
			<td>NaCl</td>
		</tr>
<tr>
<td>20 mM</td>
			<td>MgCl2</td>
		</tr>
<tr>
<td>% 1</td>
			<td>Ara-20</td>
		</tr>
<tr>
<td>Arabellek yıkayın (1 x)</td>
			<td></td>
		</tr>
<tr>
<td>20 mM</td>
			<td>Tris (pH 7.5)</td>
		</tr>
<tr>
<td>10 mM</td>
			<td>NaCl</td>
		</tr>
<tr>
<td>% 0.1</td>
			<td>Ara-20</td>
		</tr>
<tr>
<td>Elüsyon arabellek</td>
			<td></td>
		</tr>
<tr>
<td>4 mM</td>
			<td>biotin</td>
		</tr>
<tr>
<td>20 mM</td>
			<td>Tris (pH 7.5)</td>
		</tr>
<tr>
<td>50 mM</td>
			<td>NaCl</td>
		</tr>
<tr>
<td>Coomassie çözüm</td>
			<td></td>
		</tr>
<tr>
<td>%0.02</td>
			<td>Coomassie G-250</td>
		</tr>
<tr>
<td>% 5</td>
			<td>Aluminiumsulfate-(14-18)-hidrat</td>
		</tr>
<tr>
<td>% 10</td>
			<td>Alkol</td>
		</tr>
<tr>
<td>% 2</td>
			<td>Orto fosforik asit</td>
		</tr>
</tbody></table>Tablo 2: Yemek tarifleri

Watch this Scientific Journal Video about Desthiobiotin-Streptavidin-Affinity Mediated Purification of RNA-Interacting Proteins in Mesothelioma Cells at JoVE.com

Desthiobiotin-Streptavidin-Affinity Mediated Purification of RNA-Interacting Proteins in Mesothelioma Cells

Desthiobiotin-Streptavidin-benzeşme arıtma mezotelyoma hücrelerdeki RNA etkileşim proteinlerin aracılı

Desthiobiotin bir adenin-zengini eleman (vardır) motifi içeren bir sentetik 25-nükleotit RNA oligo, etiketleme sitozolik vardır-bağlayıcı proteinin belirli bağlantı verir.

The in vitro RNA-pulldown is still largely used in the first steps of protocols aimed at identifying RNA-binding proteins that recognize specific RNA ...

desthiobiotin-streptavidin-affinity-mediated-purification-rna

Nanyang Technological University

Research

JoVE Journal

Cancer Research

7.9K Görüntüleme.  University Hospital Zurich. Desthiobiotin bir adenin-zengini eleman (vardır) motifi içeren bir sentetik 25-nükleotit RNA oligo, etiketleme sitozolik vardır-bağlayıcı proteinin belirli bağlantı verir.

Video: Desthiobiotin-Streptavidin-Affinity Mediated Purification of RNA-Interacting Proteins in Mesothelioma Cells

Novel RNA-Binding Proteins Isolation by the RaPID Methodology

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern biology. Only a few in vitro and in vivo methods enable the identification of RBPs associated with a particular target mRNA. However, their main limitations are the identification of RBPs in a non-cellular environment (in vitro) or the low efficiency isolation of RNA of interest (in vivo). An RNA-binding protein purification and identification (RaPID) methodology was designed to overcome these limitations in yeast and enable efficient isolation of proteins that are associated in vivo. To achieve this, the RNA of interest is tagged with MS2 loops, and co-expressed with a fusion protein of an MS2-binding protein and a streptavidin-binding protein (SBP). Cells are then subjected to crosslinking and lysed, and complexes are isolated through streptavidin beads. The proteins that co-purify with the tagged RNA can then be determined by mass spectrometry. We recently used this protocol to identify novel proteins associated with the ER-associated PMP1 mRNA. Here, we provide a detailed protocol of RaPID, and discuss some of its limitations and advantages.

RNA-protein interactions lie at the heart of many cellular processes. Here, we describe an in vivo method to isolate specific RNA and identify novel proteins that are associated with it. This could shed new light on how RNAs are regulated in the cell.

Rapid Metodoloji tarafından Roman RNA Bağlayıcı Proteinler İzolasyon

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern ...

Genetik

Biotin-based Pulldown Assay to Validate mRNA Targets of Cellular miRNAs

MicroRNAs (miRNAs) are a class of small noncoding RNAs that post-transcriptionally regulate cellular gene expression. MiRNAs bind to the 3&#39; untranslated region (UTR) of target mRNA to inhibit protein translation or in some instances cause mRNA degradation. The binding of the miRNA to the 3&#39; UTR of the target mRNA is mediated by a 2&#8211;8 nucleotide seed sequence at the 5&#39; end of miRNA. While the role of miRNAs as cellular regulatory molecules is well established, identification of the target mRNAs with functional relevance remains a challenge. Bioinformatic tools have been employed to predict sequences within the 3&#39; UTR of mRNAs as potential targets for miRNA binding. These tools have also been utilized to determine the evolutionary conservation of such sequences among related species in an attempt to predict functional role. However, these computational methods often generate false positive results and are limited to predicting canonical interaction between miRNA and mRNA. Therefore, experimental procedures that measure direct binding of miRNA to its mRNA target are necessary to establish functional interaction. In this report, we describe a sensitive method for validating direct interaction between the cellular miRNA miR-125b and the 3&#39; UTR of PARP-1 mRNA. We elaborate a protocol in which synthetic biotinylated-miRNA mimics were transfected into mammalian cells and the miRNA-mRNA complex in the cellular lysate was pulled down with streptavidin-coated magnetic beads. Finally, the target mRNA in the pulled-down nucleic acid complex was quantified using a qPCR-based strategy.

This report describes a fast and reliable method for validating mRNA targets of cellular miRNAs. The method uses synthetic biotinylated Locked Nucleic Acid (LNA)-based miRNA mimics to capture target mRNA. Subsequently, streptavidin-coated magnetic beads are employed to pulldown the target mRNA for quantification by qPCR polymerase chain reaction.

Biotin tabanlı açılan tahlil için Doğrula mRNA hedefleri hücresel miRNAs

MicroRNAs (miRNAs) are a class of small noncoding RNAs that post-transcriptionally regulate cellular gene expression. MiRNAs bind to the 3&#39; ...

An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes

RNA-binding proteins (RBPs) play key roles in the post-transcriptional control of gene expression. Therefore, biochemical characterization of mRNA-protein complexes is essential to understanding mRNA regulation inferred by interacting proteins or non-coding RNAs. Herein, we describe a tandem RNA isolation procedure (TRIP) that enables the purification of endogenously formed mRNA-protein complexes from cellular extracts. The two-step protocol involves the isolation of polyadenylated mRNAs with antisense oligo(dT) beads and subsequent capture of an mRNA of interest with 3&#39;-biotinylated 2&#39;-O-methylated antisense RNA oligonucleotides, which can then be isolated with streptavidin beads. TRIP was used to recover in vivo crosslinked mRNA-ribonucleoprotein (mRNP) complexes from yeast, nematodes and human cells for further RNA and protein analysis. Thus, TRIP is a versatile approach that can be adapted to all types of polyadenylated RNAs across organisms to study the dynamic re-arrangement of mRNPs imposed by intracellular or environmental cues.

A tandem RNA isolation procedure (TRIP) for recovery of endogenously formed mRNA-protein complexes is described. Specifically, RNA-protein complexes are crosslinked in vivo, polyadenylated RNAs are isolated from extracts with oligo(dT) beads, and particular mRNAs are captured with modified RNA antisense oligonucleotides. Proteins bound to mRNAs are detected by immunoblot analysis.

Ökaryotik mRNA-Protein kompleksleri kurtarmak için bir Tandem oligonükleotid tabanlı RNA izolasyon yordamı

RNA-binding proteins (RBPs) play key roles in the post-transcriptional control of gene expression. Therefore, biochemical characterization of mRNA-protein ...

Biyokimya

In Vitro Biochemical Assays using Biotin Labels to Study Protein-Nucleic Acid Interactions

Protein-nucleic acid interactions play important roles in biological processes such as transcription, recombination, and RNA metabolism. Experimental methods to study protein-nucleic acid interactions require the use of fluorescent tags, radioactive isotopes, or other labels to detect and analyze specific target molecules. Biotin, a non-radioactive nucleic acid label, is commonly used in electrophoretic mobility shift assays (EMSA) but has not been regularly employed to monitor protein activity during nucleic acid processes. This protocol illustrates the utility of biotin labeling during in vitro enzymatic reactions, demonstrating that this label works well with a range of different biochemical assays. Specifically, in alignment with previous findings using radioisotope 32P-labeled substrates, it is confirmed via biotin-labeled EMSA that MEIOB (a protein specifically involved in the meiotic recombination) is a DNA-binding protein, that MOV10 (an RNA helicase) resolves biotin-labeled RNA duplex structures, and that MEIOB cleaves biotin-labeled single-stranded DNA. This study demonstrates that biotin is capable of substituting 32P in various nucleic acid-related biochemical assays in vitro.&#160;

Presented here are protocols for in vitro biochemical assays using biotin labels that may be widely&#160;applicable for studying protein-nucleic acid interactions.

Protein-Nüklik asit etkileşimlerini Incelemek için biotin etiketlerini kullanarak In vitro biyokimyasal asder

Protein-nucleic acid interactions play important roles in biological processes such as transcription, recombination, and RNA metabolism. Experimental ...

Single-step Purification of Macromolecular Complexes Using RNA Attached to Biotin and a Photo-cleavable Linker

For many years, the exceptionally strong and rapidly formed interaction between biotin and streptavidin has been successfully utilized for partial purification of biologically important RNA/protein complexes. However, this strategy suffers from one major disadvantage that limits its broader utilization: the biotin/streptavidin interaction can be broken only under denaturing conditions that also disrupt the integrity of the eluted complexes, hence precluding their subsequent functional analysis and/or further purification by other methods. In addition, the eluted samples are frequently contaminated with the background proteins that nonspecifically associate with streptavidin beads, complicating the analysis of the purified complexes by silver staining and mass spectrometry. To overcome these limitations, we developed a variant of the biotin/streptavidin strategy in which biotin is attached to an RNA substrate via a photo-cleavable linker and the complexes immobilized on streptavidin beads are selectively eluted to solution in a native form by long wave UV, leaving the background proteins on the beads. Shorter RNA binding substrates can be synthesized chemically with biotin and the photo-cleavable linker covalently attached to the 5&#39; end of the RNA, whereas longer RNA substrates can be provided with the two groups by a complementary oligonucleotide. These two variants of the UV-elution method were tested for purification of the U7 snRNP-dependent processing complexes that cleave histone pre-mRNAs at the 3&#39; end and they both proved to compare favorably to other previously developed purification methods. The UV-eluted samples contained readily detectable amounts of the U7 snRNP that was free of major protein contaminants and suitable for direct analysis by mass spectrometry and functional assays. The described method can be readily adapted for purification of other RNA binding complexes and used in conjunction with single- and double-stranded DNA binding sites to purify DNA-specific proteins and macromolecular complexes.

RNA/protein complexes purified using botin-streptavidin strategy are eluted to solution under denaturing conditions in a form unsuitable for further purification and functional analysis. Here, we describe a modification of this strategy that utilizes a photo-cleavable linker in RNA and a gentle UV-elution step, yielding native and fully functional RNA/protein complexes.

Tek adım arıtma RNA bağlı Biotin ve fotoğraf yarilabilir bir bağlayıcı kullanarak makromoleküllerin kompleksleri

For many years, the exceptionally strong and rapidly formed interaction between biotin and streptavidin has been successfully utilized for partial ...

Transcriptome-Wide Profiling of Protein-RNA Interactions by Cross-Linking and Immunoprecipitation Mediated by FLAG-Biotin Tandem Purification

RNA and RNA-binding proteins (RBPs) control multiple biological processes. The spatial and temporal arrangement of RNAs and RBPs underlies the delicate regulation of these processes. A strategy called CLIP-seq (cross-linking and immunoprecipitation) has been developed to capture endogenous protein-RNA interactions with UV cross-linking followed by immunoprecipitation. Despite the wide use of conventional CLIP-seq method in RBP study, the CLIP method is limited by the availability of high-quality antibodies, potential contaminants from the copurified RBPs, requirement of isotope manipulation, and potential loss of information during a tedious experimental procedure. Here we describe a modified CLIP-seq method called FbioCLIP-seq using the FLAG-biotin tag tandem purification. Through tandem purification and stringent wash conditions, almost all the interacting RNA-binding proteins are removed. Thus, the RNAs interacting indirectly mediated by these copurified RBPs are also reduced. Our FbioCLIP-seq method allows efficient detection of direct protein-bound RNAs without SDS-PAGE and membrane transfer procedures in an isotope-free and protein-specific antibody-free manner.

Here we present a modified CLIP-seq protocol called FbioCLIP-seq with FLAG-biotin tandem purification to determine the RNA targets of RNA-binding proteins (RBPs) in mammalian cells.

Flag-Biotin Tandem Arınma Aracılı Çapraz Bağlama ve İmmünopits Ile Protein-RNA Etkileşimlerinin Transkripsiyon-Geniş Profilleme

RNA and RNA-binding proteins (RBPs) control multiple biological processes. The spatial and temporal arrangement of RNAs and RBPs underlies the delicate ...

An Optimized Quantitative Pull-Down Analysis of RNA-Binding Proteins Using Short Biotinylated RNA

Protein-RNA interactions regulate gene expression and cellular functions at transcriptional and post-transcriptional levels. For this reason, identifying the binding partners of an RNA of interest remains of high importance to unveil the mechanisms behind many cellular processes. However, RNA molecules might interact transiently and dynamically with some RNA-binding proteins (RBPs), especially with non-canonical ones. Hence, improved methods to isolate and identify such RBPs are greatly needed.
To identify the protein partners of a known RNA sequence efficiently and quantitatively, we developed a method based on the pull-down and characterization of all interacting proteins, starting from cellular total protein extract. We optimized the protein pull-down using biotinylated RNA pre-loaded on streptavidin-coated beads. As a proof of concept, we employed a short RNA sequence known to bind the neurodegeneration-associated protein TDP-43 and a negative control of a different nucleotide composition but the same length. After blocking the beads with yeast tRNA, we loaded the biotinylated RNA sequences on the streptavidin beads and incubated them with the total protein extract from HEK 293T cells. After incubation and several washing steps to remove nonspecific binders, we eluted the interacting proteins with a high-salt solution, compatible with the most commonly used protein quantification reagents and with sample preparation for mass spectrometry. We quantified the enrichment of TDP-43 in the pull-down performed with the known RNA binder compared to the negative control by mass spectrometry. We used the same technique to verify the selective interactions of other proteins computationally predicted to be unique binders of our RNA of interest or of the control. Finally, we validated the protocol by western blot via the detection of TDP-43 with an appropriate antibody. 
This protocol will allow the study of the protein partners of an RNA of interest in near-to-physiological conditions, helping uncover unique and unpredicted protein-RNA interactions.

Here, we present an optimized in vitro method to uncover, quantify, and validate protein interactors of specific RNA sequences, using total protein extract from human cells, streptavidin beads coated with biotinylated RNA, and mass spectrometry analysis.

Kısa Biyotinile RNA Kullanan RNA Bağlayıcı Proteinlerin Optimize Edilmiş Kantitatif Aşağı Çekme Analizi

Protein-RNA interactions regulate gene expression and cellular functions at transcriptional and post-transcriptional levels. For this reason, identifying ...

Orthotopic Implantation and Peripheral Immune Cell Monitoring in the II-45 Syngeneic Rat Mesothelioma Model

The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of the role of the tumor microenvironment in treatment response, collectively point to the need for immune-competent orthotopic models for pre-clinical testing of these new therapies. This paper demonstrates how to establish an orthotopic immune-competent rat model of pleural malignant mesothelioma. Monitoring disease progression in orthotopic models is confounded by the internal location of the tumors. To longitudinally monitor disease progression and its effect on circulating immune cells in this and other rat models of cancer, a single tube flow cytometry assay requiring only 25 &#181;l whole blood is described. This provides accurate quantification of seven immune parameters: total lymphocytes, monocytes and neutrophils, as well as the T-cell subsets CD4 and CD8, B-cells and Natural Killer cells. Different subsets of these parameters are useful in different circumstances and models, with the neutrophil to lymphocyte ratio having the greatest utility for monitoring disease progression in the mesothelioma model. Analyzing circulating immune cell levels using this single tube method may also assist in monitoring the response to immune-based treatments and understanding the underlying mechanisms leading to success or failure of treatment.

The generation of an orthotopic rat model of pleural malignant mesothelioma by implantation of II-45 mesothelioma cells into the pleural cavity of immune competent rats is presented. A flow cytometric method to analyze seven immune cell subsets in these animals from a 25 &#181;l&#160;blood sample is also described.

II-45 singenik Rat Mezotelyoma Modelinde Ortotopik Yerleştirilmesi ve Periferik Bağışıklık Hücre İzleme

The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of ...

Tıp

Isolation of Translating Ribosomes Containing Peptidyl-tRNAs for Functional and Structural Analyses

Recently, structural and biochemical studies have detailed many of the molecular events that occur in the ribosome during inhibition of protein synthesis by antibiotics and during nascent polypeptide synthesis. Some of these antibiotics, and regulatory nascent polypeptides mostly in the form of peptidyl-tRNAs, inhibit either peptide bond formation or translation termination1-7. These inhibitory events can stop the movement of the ribosome, a phenomenon termed "translational arrest". Translation arrest induced by either an antibiotic or a nascent polypeptide has been shown to regulate the expression of genes involved in diverse cellular functions such as cell growth, antibiotic resistance, protein translocation and cell metabolism8-13. Knowledge of how antibiotics and regulatory nascent polypeptides alter ribosome function is essential if we are to understand the complete role of the ribosome in translation, in every organism.
Here, we describe a simple methodology that can be used to purify, exclusively, for analysis, those ribosomes translating a specific mRNA and containing a specific peptidyl-tRNA14. This procedure is based on selective isolation of translating ribosomes bound to a biotin-labeled mRNA. These translational complexes are separated from other ribosomes in the same mixture, using streptavidin paramagnetic beads (SMB) and a magnetic field (MF). Biotin-labeled mRNAs are synthesized by run-off transcription assays using as templates PCR-generated DNA fragments that contain T7 transcriptional promoters. T7 RNA polymerase incorporates biotin-16-UMP from biotin-UTP; under our conditions approximately ten biotin-16-UMP molecules are incorporated in a 600 nt mRNA with a 25% UMP content. These biotin-labeled mRNAs are then isolated, and used in in vitro translation assays performed with release factor 2 (RF2)-depleted cell-free extracts obtained from Escherichia coli strains containing wild type or mutant ribosomes. Ribosomes translating the biotin-labeled mRNA sequences are stalled at the stop codon region, due to the absence of the RF2 protein, which normally accomplishes translation termination. Stalled ribosomes containing the newly synthesized peptidyl-tRNA are isolated and removed from the translation reactions using SMB and an MF. These beads only bind biotin-containing messages.
The isolated, translational complexes, can be used to analyze the structural and functional features of wild type or mutant ribosomal components, or peptidyl-tRNA sequences, as well as determining ribosome interaction with antibiotics or other molecular factors 1,14-16. To examine the function of these isolated ribosome complexes, peptidyl-transferase assays can be performed in the presence of the antibiotic puromycin1. To study structural changes in translational complexes, well established procedures can be used, such as i) crosslinking to specific amino acids14 and/or ii) alkylation protection assays1,14,17.

A major impediment to biochemical analyses of ribosomes containing nascent peptidyl-tRNAs has been the presence of other ribosomes in the same samples, ribosomes not involved in the translation of the specific mRNA sequence being analyzed. We developed a simple methodology to purify, exclusively, the ribosomes containing the nascent peptidyl-tRNA of interest.

Fonksiyonel ve Yapısal Analizler için Peptidil tRNAs İçeren Çeviri Ribozomlar izolasyonu

Recently, structural and biochemical studies have detailed many of the molecular events that occur in the ribosome during inhibition of protein synthesis ...

Biyoloji

<meta charset="utf8"></head><body>RPA-ssDNA Bağlanma Kinetiğinin Etiketsiz Yöntemler Kullanılarak Kantitatif Analizi

Analyzing DNA-Protein Interactions with Streptavidin-Based Biolayer Interferometry

Protein-DNA interactions underpin essential cellular processes. Understanding these interactions is critical for elucidating the molecular mechanisms of various pathways. Key factors such as the structure, sequence, and length of a DNA molecule can significantly influence protein binding. Bio-layer interferometry (BLI) is a label-free technique that measures binding kinetics between molecules, offering a straightforward and precise approach to quantitatively study protein-DNA interactions. A major advantage of BLI over traditional gel-based methods is its ability to provide real-time data on binding kinetics, enabling accurate measurement of the equilibrium dissociation constant (KD) for dynamic protein-DNA interactions. This article presents a basic protocol for determining the KD value of the interaction between a DNA replication protein, replication protein A (RPA), and a single-stranded DNA (ssDNA) substrate. RPA binds ssDNA with high affinity but must also be easily displaced to facilitate subsequent protein interactions within biological pathways. In the described BLI assay, biotinylated ssDNA is immobilized on a streptavidin-coated biosensor. The binding kinetics (association and dissociation) of RPA to the biosensor-bound DNA are then measured. The resulting data are analyzed to derive precise values for the association rate constant (ka), dissociation rate constant (kd), and equilibrium binding constant (KD) using system software.

<meta charset="utf8"></head><body>DNA-Protein Etkileşimlerinin Streptavidin Tabanlı Biyotabaka İnterferometrisi ile İncelenmesi

This article describes a protocol for studying DNA-protein interactions using a streptavidin-based biolayer interferometry (BLI) system. It outlines the essential steps and considerations for utilizing either basic or advanced binding kinetics to determine the equilibrium binding affinity (KD) of the interaction.

DNA-Protein Etkileşimlerinin Streptavidin Tabanlı Biyotabaka İnterferometrisi ile İncelenmesi

Protein-DNA interactions underpin essential cellular processes. Understanding these interactions is critical for elucidating the molecular mechanisms of ...