Name: desthiobiotin-streptavidin-affinity mediated purification of rna-interacting proteins in mesothelioma cells
Uploaded: 2018-04-25T15:00:00.000+00:00
Duration: 11 min 11 s
Description: Watch this Scientific Journal Video about Desthiobiotin-Streptavidin-Affinity Mediated Purification of RNA-Interacting Proteins in Mesothelioma Cells at JoVE.com

이 작품은 스위스 국립 과학 재단 Sinergia 그랜트 CRSII3 147697, 재단에 Angewandte Krebsforschung와 취리히 Krebsliga에 의해 지원 되었다.

1. Cytosolic 핵 단백질 분수의 준비
<ol><li>플레이트 4 x 106 ACC-MESO-4 셀 RPMI-1640 매체에에서 성장 T150 셀 문화 술병에 보충 10 %FBS, 1 x 페니실린/스 (100 x), 그리고 2 m L-글루타민 (200 m m) m. 셀 80-90% (6 셀 ~5-5.5 x 10)의 합류에 도달, 핵 및 cytosolic 분수의 단백질 추출 진행. 참고: ACC-MESO-4 셀 라인 RIKEN 유관 센터11에서 얻은 했다.</li>
	<li>중간 발음, 1 x PBS의 15 mL을 추가 하 여 셀을 세척, 기울기 접시 부드럽게 몇 번와 1 x PBS 발음. 0.25%의 3 개 mL를 추가 트립 신-EDTA와 문화 플라스 크 3 분 동안 37 ° C에서 품 어. 참고: 분리;에 대 한 현미경 셀 보고 아직도 수돗물을 연결 하는 경우는 3의 손바닥에 대 한 플라스 크 시간.</li>
	<li>7 mL RPMI 1640 매체와 10 %FBS, 1 x 페니실린/스 (100 배), 2 mM L-글루타민 (200mm) 보충의 추가, 15 mL 튜브에 세포를 수집 하 고 5 분 동안 200 x g에 아래로 회전.</li>
	<li>중간 발음 그리고 1.5 mL 1 x PBS 가진 펠 릿 셀 resuspend microcentrifuge 1.5 mL 튜브에 세포를 전송. 500 x g와 4 ° C 5 분 삭제는 상쾌한 아래로 회전 합니다. 참고:이 단계 이후,에서 4 ° C에서 원심 분리 단계를 모두 수행 하 고 얼음에 모든 시 약을 계속.</li>
	<li>1 x PBS의 얼음 처럼 차가운 1.5 mL와 셀 펠 릿 resuspend 및 회전 500 x g에서 셀 3 분에 4 ° C 감소 삭제는 상쾌한. 참고: CER의 필요한 금액 나, CER II 및 NER 시 약은 10, 0.55, 및 5 양의 예상된 셀 펠 릿 포장 볼륨, 각각; 다음 프로토콜 20 µ L의 볼륨을 가정합니다. 시 CER의 필요한 만큼만 준비 하는 것이 좋습니다 난.</li>
	<li>200 µ L 얼음 세포질 추출 시 약의 추가 (CER 나) 100 x 재고를 물 500 µ L에서의 프로 테아 제 억제제 (EDTA 무료) 1 태블릿을 희석 2 µ L 성분 억제 물, 예를 들어, x 1의 보완. 이 정도의 시 CER 내가 lyse 세포 펠 릿 포장 볼륨의 20 µ L에 충분 하다.<ol>
<li>셀 펠 릿 포장 볼륨을 추정, 1.5 mL 튜브 셀 펠 릿을 포함 하는 튜브를 비교 하 여 10, 20, 50 또는 100 µ L 1 x PBS의 가득 합니다.</li>
	</ol>
</li>
	<li>적극적으로 vortexing 15 튜브에 의해 셀 펠 릿 resuspend s 10 분 추가 11 µ L의 튜브, 5에 대 한 적극적으로 소용돌이를 얼음 처럼 차가운 세포질 추출 시 약 II (CER II)에 대 한 얼음에 튜브를 품 어와 s, 그리고 얼음에 1 분을 품 어.</li>
	<li>5 s와 분리기 g x 16, 000에서 튜브에 대 한 적극적으로 소용돌이 4 ° C 5 분에 대 한 얼음에 깨끗 한 미리 냉장된 튜브에는 상쾌한을 전송. 상쾌한 더 세포질 분수는 RNA-풀 다운 실험에 사용.</li>
	<li>1 µ L 성분 억제 물 (100 x)와 적극적으로 15 소용돌이의 보충의 얼음 핵 추출 시 약 (NER) 100 µ L에서 나머지 펠 릿 resuspend s. NER 시 약 protease 억제제와 보충의 필요한 만큼만 준비 하는 것이 좋습니다.</li>
	<li>가끔 vortexing 15와 40 분 동안 얼음에 샘플을 품 어 s (매 10 분).</li>
	<li>깨끗 한 미리 냉장된 튜브를 튜브에서 16000 x g 10 분 전송에 대 한 (이것은 핵 단백질 분수) 상쾌한 원심.</li>
	<li>Bicinchoninic (BCA) 메서드를 사용 하 여 단백질 농도 측정 하 여 즉시 진행 ( 재료의 표참조). 각 분수의 단백질 순수성에 대 한 제어, α-tubulin (긍정적인 탐지 cytosolic 분수에만) 및 폴 리 ADP ribose 중 합 효소-PARP (긍정적인 탐지 핵 분수에만)에 대 한 immunoblotting (그림 1)을 수행 합니다. 단백질 시각화, 섹션 4 참조.</li>
	<li>단백질 활동 및 그들의 원시 상태를 유지 하기 위하여 cytosolic 핵 추출 물의 aliquots의 25 µ L를 준비 합니다. 5 s를-80 ° c.에 직접 저장소 액체 질소에 그들을 배치 하 여 스냅-동결이이 aliquots</li>
</ol>2. Desthiobiotin와 RNA의 라벨
<ol><li>상업적으로 합성 하는 RNA 프로브 및 HPLC 정화 있다. 10 µ M에서 nuclease 무료 물으로 resuspend. 참고: 프로브 시퀀스는 표 1에 나열 됩니다.</li>
	<li>RNA의 RNA-풀 다운 반응 당 50 pmol을 사용 합니다. 해 동 하 고 얼음에 목이 30%, RNA oligo의 라벨 3' 말단에 사용 제외 하 고 모든 시 약을 계속.</li>
	<li>5 µ L 10 µ M RNA 프로브, CALB2로 분류 3' UTR (있다)의 전송, CALB2 3' UTR (mtARE), 및 관련 RNA (분노), 0.5 mL 얇은 microcentrifuge로 튜브 5 분 위 튜브 즉시 얼음에 85 ° C에서 PCR 기계에 품 어. 참고:이 단계는 중요 하다, 그것은 휴식 및 라벨에 대 한 RNA 조사의 접근성을 촉진.</li>
	<li>단 하나 30 µ L 반응에 대 한 다음 10 µ L 믹스 RNA 포함 된 튜브에 추가: nuclease 무료 물 3 µ L, RNA 리가 반응 버퍼, RNase 억제제의 1 µ L x 10의 3 µ L (40 U / µ L), Desthiobiotinylated Cytidine Bisphosphate (1mm)의 1 µ L 그리고 T4 RNA 리가 (20 U / µ L)의 2 µ L. 참고: 마스터 믹스 A 초과 (3.2)에서 3 샘플, 혼합 준비 nuclease의 9.6 µ L 무료 물, RNA 리가 반응 버퍼, RNase 억제제의 3.2 µ L x 10의 9.6 µ L (40 U / µ L), Desthiobiotinylated Cytidine Bisphosphate (1mm)의 3.2 µ L 및 T4 RNA 리가 (20 U / µ L)의 6.4 µ L.</li>
	<li>신중 하 게 15 µ L의 말뚝 반응에 30% 추가. 또 다른 팁을 사용 하 여 혼합 반응. 품 어 하룻밤 16 ° c.에 반응</li>
	<li>다음 날, 다음 준비: 5 M NaCl (신선/nuclease-무료), 클로 프롬: isoamyl 알콜 24:1 비율 (예를 들어, 반응-96 µ L 클로 프롬 및 isoamyl 알콜의 4 µ L 당), 얼음 100% 에탄올, 그리고 차가운 70% 에탄올.</li>
	<li>RNA 라벨 반응 관에 nuclease 무료 물 70 µ L를 추가 합니다. 클로 프롬의 100 µ L를 추가: isoamyl 알콜과 소용돌이 짧게. 스핀-다운 13000 x g에서 3 분 신중 하 게 제거만 위 단계와 새로운 nuclease 무료 1.5 mL 튜브;에 대 한 낮은 단계를 만지지 마십시오.</li>
	<li>5 M NaCl, 글 리 코겐의 1 µ L 및 얼음 100% 에탄올의 300 µ L 10 µ L를 추가 합니다. 2 시간 동안-20 ° C에 튜브를 놓습니다. 참고:이 단계에서 실험 다음 날에 계속 될 수 있다.</li>
	<li>15 분을 위한 13000 g x 및 4 ° C에서 원심 분리기는 펠 렛을 방해 하지 않고 신중 하 게는 상쾌한을 버리십시오. 얼음 처럼 차가운 70% 에탄올과 원심 분리기 13000 x g에서 다시 및 4 ° C 5 분의 300 µ L를 추가 합니다.</li>
	<li>상쾌한을 완전히 무시 하 고 펠 릿 (15 분)를 건조. 20 µ L nuclease 무료 물에 펠 릿을 resuspend. 참고: 같은 날에 RNA-풀 다운으로 진행.</li>
	<li>2 분 동안 90 ° C에서 RNA를 품 어 고 얼음에 놓습니다. Streptavidin 자석 구슬의 사전 세척의 다음 단계 동안 얼음에 셔 서 RNA를 놓습니다. 참고: 장시간 보육 RNA 조사를 손상 될 수 있습니다.</li>
</ol>3. RNA-단백질 풀 다운
<ol><li>
미리 세척 streptavidin 자석 구슬 및 desthiobiotin RNA를 가진 외피
	<ol>
<li>50 pmol RNA 당 streptavidin 자석 구슬의 50 µ L을 사용 합니다. 그러나,이 실험에 따라 최적화 되어야 합니다.</li>
		<li>소용돌이와 streptavidin 자석 구슬 15 s, 그리고 신속 하 게 제거 200 µ L (마스터 믹스, 3 + 1 반응에 대 한 충분 한) 사용 하 여 깨끗 한 1.5 mL 튜브 안전 잠금에 대 한 튜브 컷 피 펫 팁. 구슬 튜브의 측면에서 수집 하 고 기다리는 1 분 제거 물의 resuspension 액체 튜브 마그네틱 스탠드에 놓습니다.</li>
		<li>구슬 세척, 마그네틱 스탠드에서 튜브를 제거, 0.1 M NaOH, 0.05 M NaCl 솔루션, 그리고 부드럽게 몇 번 위아래로 피펫으로의 400 µ L를 추가 합니다. 마그네틱 스탠드에 다시 튜브를 놓습니다. 1 분 대기 고는 상쾌한을 수집 합니다. 이 단계를 다시 반복 합니다.</li>
		<li>워시 100 m NaCl m의 200 µ L와 구슬. 제거는 상쾌한.</li>
		<li>트리 스 (pH 7.5), pipetting으로 구슬 resuspend, 튜브 자석 스탠드에, 1 분 동안 대기 놓고 제거는 상쾌한 20 m m의 200 µ L를 추가 합니다. 단계를 반복 합니다.</li>
		<li>마그네틱 스탠드에서 튜브를 제거, RNA 캡처 버퍼, x 1의 200 µ L을 추가 하 고 간단히 vortexing에 의해 streptavidin 자석 구슬 resuspend. Streptavidin 자석 구슬의 50 µ L을 제거 하 고 잘라 피 펫 팁을 사용 하 여 각 레이블이 RNA 튜브에 추가. 롤러에 실 온에서 30 분 동안 튜브를 품 어.</li>
	</ol>
</li>
	<li>
RNA 단백질의 바인딩
	<ol>
<li>마그네틱 스탠드에 튜브를 배치 하 고 1 분 대기는 상쾌한을 제거 합니다.</li>
		<li>구슬에 20 mM Tris (pH 7.5)의 50 µ L을 추가 하 고 pipetting으로 resuspend. 마그네틱 스탠드에 튜브를 배치, 1 분을 기다려 하 고 상쾌한을 제거 합니다. 이 단계를 반복 합니다.</li>
		<li>구슬에 단백질-RNA 바인딩 버퍼 x 1의 100 µ L을 추가 하 고 pipetting으로 resuspend.</li>
		<li>한편, 다음 믹스를 준비: 10 µ L 단백질-RNA 바인딩 버퍼, 50% 글리세롤의 30 µ L, 세포질 단백질의과 nuclease 무료 50 µ g x 10의 최대 100 µ L를 물. 참고: 다음과 같이 초과 (3.3)에서 3 샘플에 대 한 마스터 혼합 B를 준비: 단백질-RNA 바인딩 버퍼 x 10의 33 µ L, 50% 글리세롤의 99 µ L, 세포질 단백질과 nuclease 무료 물까지 330 µ L.의 165 µ g 유지의 마스터 B 얼음에 튜브.</li>
		<li>마그네틱 스탠드에 튜브를 배치 하 고 1 분 대기는 상쾌한을 수집 합니다. 마스터 혼합 B 100 µ L을 추가 하 고 부드럽게 위아래로 pipetting으로 resuspend 거품을 만들지 마십시오. 롤러에 4 ° C에서 60 분에 대 한 반응 튜브를 품 어.</li>
	</ol>
</li>
	<li>
세척 및 차입
	<ol>
<li>마그네틱 스탠드에 튜브를 배치, (즉, 통해-FT) 상쾌한, 수집 하 고 새 튜브로 전송. 참고: 나중에 분석을 위한 얼음에이 피트 유지.</li>
		<li>플라스틱 구슬에 워시 버퍼 x 1의 100 µ L, 부드럽게 resuspend, 마그네틱 스탠드에 다시 넣어, 1 분, 대기 고는 상쾌한 삭제. 2 번이이 단계를 반복 합니다.</li>
		<li>자성 구슬에 차입 버퍼의 40 µ L를 추가 하 고 아래로, pipetting으로 섞어 30 분 동안 튜브 셰이 커 (950 rpm)에 37 ° C에서 품 어.</li>
		<li>튜브 마그네틱 스탠드에, 1 분을 기다려 놓고 (eluate-E는) eluted 샘플을 수집 합니다. 얼음에 놓고 다운스트림 분석을 위해 사용 합니다. 참고:이 단계에서 각 시험된 RNA 프로브 자형 (FT) 및 eluate (E) 샘플을 구성 됩니다.</li>
	</ol>
</li>
</ol>4. polyacrylamide 전기 및 서양 오 점 분석
주:이 섹션에서 사용 되는 버퍼에 대 한 조리법에 대 한 표 2를 참조 하십시오. 서 부 수행 Laemmli 방법을12에 따르면 오.
<ol><li>Handcast 12 %SDS 페이지 젤 (10-우물, 1.5 m m 간격, 66 µ L). 실행 중인 젤 믹스 준비: 30% 아크릴-bisacrylamide 재고 솔루션, 낮은 트리 스의 2.4 mL의 4 mL, dH2O, TEMED, 10% 염화 persulfate 솔루션 (APS)의 96 µ L의 9.6 µ L의 3.2 mL 버퍼. 겹쳐 쌓이는 젤 믹스 준비: dH2O, 30% 아크릴-bisacrylamide 재고 솔루션, 위 Tris 버퍼의 1.3 mL의 0.5 mL, TEMED, 10%의 20 µ L의 10 µ L의 3.25 mL AP.</li>
	<li>6 x Laemmli 버퍼의 16.6 µ L을 추가 (예, 트리 스/HCl/SDS pH 6.8의 14 mL (위 Tris 버퍼), sds, DTT, 글리세롤, 및 0.012 %bromophenol 블루; 6 mL의 1.86 g 2 g-20 ° C에 저장) 피트 샘플 및 샘플 전자로 6 x Laemmli 버퍼의 6.6 µ L로. 95 ° c.에 5 분에 대 한 샘플을 품 어</li>
	<li>(피트 및 전체 20 µ L Elute ~ 40 µ L) 샘플 로드 60 V, 20 V 밤새 계속 30 분 동안 그들을 실행 하 고.</li>
	<li>세미 드라이 electroblotting 시스템을 사용 하 여, 단백질 15 V 80 분에 대 한 PVDF 막에 전송 합니다. 참고: PVDF 막 단백질 전송 수행 하기 전에 활성화 해야 합니다. 초순에 2 분 부 화 뒤 1 분에 100% 메탄올에서 막 품 어.</li>
	<li>단백질 전송 후 Coomassie 솔루션 3 h, 초순, 각 30 분 세척의 3 단계 다음에 대 한 SDS 페이지 젤을 품 어.</li>
	<li>단백질의 끝에, 건조 단계 4.5에서 1 헤 막 활성화 위해 PVDF 막 하자. 차단 막 1 x TTBS에 5 %BSA 1 시간.</li>
	<li>첫번째 항 체로 막 품 어: 허 또는 mesothelin, 모두 희석 4 h 실내 온도에 또는 하룻밤 4 ° c.에 대 한 1 x TTBS에 5 %BSA 1:1000</li>
	<li>1 x TTBS에 7 분에 대 한 세 번 막 세척 하 고 토끼 반대로 마우스 양 고추냉이 과산화 효소 (HRP)와 품 어-활용 된 이차 항 체 희석 5 %BSA, 1 x TTBS에에서 1:10,000.</li>
	<li>향상 된 화학 및 디지털 영상 장치를 사용 하 여 단백질을 시각화.</li>
</ol>

<ol>
	<li>Glisovic, T., Bachorik, J. L., Yong, J., Dreyfuss, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-binding+proteins+and+post-transcriptional+gene+regulation.">RNA-binding proteins and post-transcriptional gene regulation.</a> FEBS Letters. 582 (14), 1977-1986 (2008).</li><li>Mayr, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolution+and+biological+roles+of+alternative+3'UTRs.">Evolution and biological roles of alternative 3'UTRs.</a> Trends in Cell Biology. 26 (3), 227-237 (2016).</li><li>Matoulkova, E., Michalova, E., Vojtesek, B., Hrstka, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+the+3'+untranslated+region+in+post-transcriptional+regulation+of+protein+expression+in+mammalian+cells.">The role of the 3' untranslated region in post-transcriptional regulation of protein expression in mammalian cells.</a> RNA Biology. 9 (5), 563-576 (2012).</li><li>von Roretz, C., Di Marco, S., Mazroui, R., Gallouzi, I. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Turnover+of+AU-rich-containing+mRNAs+during+stress:+a+matter+of+survival.">Turnover of AU-rich-containing mRNAs during stress: a matter of survival.</a> Wiley Interdisciplinary Reviews: RNA. 2 (3), 336-347 (2011).</li><li>Fallmann, J., Sedlyarov, V., Tanzer, A., Kovarik, P., Hofacker, I. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=AREsite2:+An+enhanced+database+for+the+comprehensive+investigation+of+AU/GU/U-rich+elements.">AREsite2: An enhanced database for the comprehensive investigation of AU/GU/U-rich elements.</a> Nucleic Acids Research. 44, D90-D95 (2016).</li><li>Kresoja-Rakic, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Posttranscriptional+regulation+controls+calretinin+expression+in+malignant+pleural+mesothelioma.">Posttranscriptional regulation controls calretinin expression in malignant pleural mesothelioma.</a> Frontiers in Genetics. 8 (70), (2017).</li><li>Chu, C., Spitale, R. C., Chang, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Technologies+to+probe+functions+and+mechanisms+of+long+noncoding+RNAs.">Technologies to probe functions and mechanisms of long noncoding RNAs.</a> Nature Structural &amp; Molecular Biology. 22 (1), 29-35 (2015).</li><li>Diamandis, E. P., Christopoulos, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biotin-(strept)avidin+system:+principles+and+applications+in+biotechnology.">The biotin-(strept)avidin system: principles and applications in biotechnology.</a> Clinical Chemistry. 37 (5), 625-636 (1991).</li><li>Hirsch, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Easily+reversible+desthiobiotin+binding+to+streptavidin,+avidin,+and+other+biotin-binding+proteins:+Uses+for+protein+labeling,+detection,+and+isolation.">Easily reversible desthiobiotin binding to streptavidin, avidin, and other biotin-binding proteins: Uses for protein labeling, detection, and isolation.</a> Analytical Biochemistry. 308 (2), 343-357 (2002).</li><li>. Magnetic bead technology for better assay development Available from: <a target="_blank" href="https://assets.thermofisher.com/TFS-Assets/LSG/brochures/1602577-Magnetic-Bead-Technology-Brochure.pdf">https://assets.thermofisher.com/TFS-Assets/LSG/brochures/1602577-Magnetic-Bead-Technology-Brochure.pdf</a> (2013)</li><li>Usami, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+and+characterization+of+four+malignant+pleural+mesothelioma+cell+lines+from+Japanese+patients.">Establishment and characterization of four malignant pleural mesothelioma cell lines from Japanese patients.</a> Cancer Science. 97 (5), 387-394 (2006).</li><li>Laemmli, U. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cleavage+of+structural+proteins+during+the+assembly+of+the+head+of+bacteriophage+T4.">Cleavage of structural proteins during the assembly of the head of bacteriophage T4.</a> Nature. 227 (5259), 680-685 (1970).</li><li>Coulson, R. M., Cleveland, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ferritin+synthesis+is+controlled+by+iron-dependent+translational+derepression+and+by+changes+in+synthesis/transport+of+nuclear+ferritin+RNAs.">Ferritin synthesis is controlled by iron-dependent translational derepression and by changes in synthesis/transport of nuclear ferritin RNAs.</a> Proceedings of the National Academy of Sciences of the United States of America. 90 (16), 7613-7617 (1993).</li><li>Leibold, E. A., Munro, H. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytoplasmic+protein+binds+in+vitro+to+a+highly+conserved+sequence+in+the+5'+untranslated+region+of+ferritin+heavy-+and+light-subunit+mRNAs.">Cytoplasmic protein binds in vitro to a highly conserved sequence in the 5' untranslated region of ferritin heavy- and light-subunit mRNAs.</a> Proceedings of the National Academy of Sciences of the United States of America. 85 (7), 2171-2175 (1988).</li><li>Srikantan, S., Gorospe, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HuR+function+in+disease.">HuR function in disease.</a> Frontiers in Bioscience (Landmark Edition). 17, 189-205 (2012).</li><li>Morris, K. V., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+rise+of+regulatory+RNA.">The rise of regulatory RNA.</a> Nature Reviews: Genetics. 15 (6), 423-437 (2014).</li><li>Rinn, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+demarcation+of+active+and+silent+chromatin+domains+in+human+HOX+loci+by+noncoding+RNAs.">Functional demarcation of active and silent chromatin domains in human HOX loci by noncoding RNAs.</a> Cell. 129 (7), 1311-1323 (2007).</li><li>Zhao, J., Sun, B. K., Erwin, J. A., Song, J. J., Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polycomb+proteins+targeted+by+a+short+repeat+RNA+to+the+mouse+X+chromosome.">Polycomb proteins targeted by a short repeat RNA to the mouse X chromosome.</a> Science. 322 (5902), 750-756 (2008).</li><li>McHugh, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Xist+lncRNA+interacts+directly+with+SHARP+to+silence+transcription+through+HDAC3.">The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3.</a> Nature. 521 (7551), 232-236 (2015).</li></ol>

저자 들은 아무 경쟁 금융 관심사 선언 합니다.

3' Utr는 비 코딩 게놈3에 속하고 모든 비 코딩 RNAs 단백질7그들의 기능 발휘 하기 위하여 작용할 수 있습니다. 포유류 게놈 복사할 퍼지 수를 발견 하 고 긴 noncoding RNAs16의 상당 부분을 생산,이 긴 noncoding RNAs로 상호 작용 하는 유전자 발현 조절에 작동 입증 증거를 신흥 개장 하는 chromatin 단지17. 이 정보는 RNA-풀 다운 분석 결과 이용 하 여 얻었다. 따라서, 특정 RNA의 인터 해독 하려면 첫 번째 단계 수 풀 다운 RNA 등 생체 외에서 생 화 확 적인 분석 수행 간단 있습니다.
메모의 시퀀스 모티브 뿐만 아니라 RNA의 이차 구조 역할을 중요 한 RNA 기능에 그들은 필수적인 단백질 상호 작용 도메인을 형성 한다. 이차 구조 생리에 다를 수 있습니다 하 고 생체 외에서 조건, 그리고 RNA-풀 다운 falsepositives의 id에 발생할 수 있습니다. 예를 들어 RNA-풀 다운 비활성 특정 대 본 X의 interactor로 EZH2, polycomb 억압 적인 복잡 한 2 (PRC2)의 구성 요소를 확인 (Xist)18, RNA 센스 정화를 사용 하는 최근 연구 질량으로 결합 하는 반면 분석 (랩-MS) 샤 프 등 다른 인터 식별 (SMRT와 HDAC 진압 단백질 관련), SAF-1 (비 계 첨부 파일 요소 A) 및 LBR (lamin B 수용 체)19. 따라서, 다른 기능 테스트는 RNA와 주어진된 단백질 간의 상호 작용을 지원 결과 보충 되어야 합니다 추가 immunoprecipitating 주어진된 단백질 추출에 의해 미행 등 상호 보완적인 단백질 중심 접근 및 바인딩된 RNA 특성
여기 제시 하는 프로토콜 CALB2에는 주제에 대 한 허 바인딩을 검색 3' UTR, pmiRGLO luciferase 분석 결과6기능 특징 이전 했다 하는 데 사용 되었습니다. 단백질의 작은 금액으로 인해이 프로토콜은 하지 질량 분석 등 다운스트림 분석에 적합 단백질 다량 필요 하다. 대신, RNA-인터 질량 분석으로 식별 하지만 단백질의 상당히 낮은 금액을 사용 하 여 유효성을 다시 검사 하는 프로토콜을 사용할 수 있습니다.
메서드 작업 저하 쉽습니다, RNA 포함 이후 RNase 실행 솔루션 표준 실험실 좋은 연습 뿐만 아니라 표면 작업을 청소 하는 것이 좋습니다. 만약에 가능 하다 면, 층 류에서 정화 RNA 라벨의 준비를 수행 합니다. RNA oligo의 순도 또한 영향을 미칠 수 있습니다 바인딩 조건; 따라서, 상업적으로 합성된 프로브 HPLC 정화 했다. 수정 하 고, 길고 매우 순수한 RNA oligos 필요한 경우 페이지 정화 메서드를 사용 합니다. 스냅 동결, 따라서 피하는 느린 냉동 접근 및 반복 중지 및 재개로 인해 단백질의 손상에 의해 네이티브 단백질의 aliquots를 준비 합니다.

유전자 발현과 유전자 제품의 최종 수준 mRNA 안정성과 mRNA 번역 속도1에 영향을 미치는 하 여 단단히 통제 수 있다. 이러한 post-transcriptional 규제 메커니즘은 타겟된 mRNA와 비 코딩 RNA 또는 RNA 바인딩 단백질 (RBPs)의 상호 작용을 통해 발휘 됩니다. 그것은 일반적으로 특정 cis을 포함 하는 (3' UTR-게놈2의 비 코딩 부분에 속하는) mRNA의 3' 번역된 영역- 트랜스에 의해 인정 되는 규제 요소 (CRE)-미르 등 RBPs 요인 행동 3. 최고의 공부 cis-3' UTR, 내의 요소는 차례에, 그리고 특정 AU-바인딩 단백질 (AUBP)에 의해 인식 되는 아데닌 부자 요소 (는) 모티브 유도 하거나 mRNA 저하/deadenylation (감퇴는 중재) 또는 mRNA의 안정화4.
크기는 3' UTR calretinin의 mRNA (CALB2)은 573 bp 긴 AREsite2, bioinformatic 도구5에의해 예측 상 상속 AUUUA pentamer 포함. Putative는 모티프의 존재와 일치, pmirGLO 벡터 기자 분석 결과 CALB2 mRNA6내에서이 요소의 안정화 역할을 설명 했다. 마지막으로,는 생체 외에서 RNA-풀 다운 사용 되었다 calretinin 안정화 AUBP를 식별 하는 모티브를 통해 mRNA.
모든 비 코딩 RNAs는 단백질7상호 작용에서 생체 외에서 RNA-풀 다운 이므로 좋은 방법과 선택의 첫 번째 분석 결과 RNA-인터 식별 분자 메커니즘을 해독에 도움. 이 RNA-풀 다운 방법에서는 상업적으로 합성된 RNA 프로브, RNA 가닥의 3' 말단에 biotin (desthiobiotin)의 수정 양식을 표시 했다 사용 되었다. RNA-desthiobiotin는 streptavidin 자석 구슬, 풀 다운 단백질 특히 관심의 바운드 RNA 상호 작용 하는 데 사용 되는에의 상호 작용을 통해 움직일 수 있습니다. Mesothelioma 셀의 cytosolic 분수에서 비 변성 및 활성 단백질은 단백질의 원본으로 사용 됩니다. 이러한 RNA 바인딩 단백질은 eluted 자석 구슬, 12 %SDS 페이지 젤 통해 실행 하 고, 막, 전송 하 고 다른 항 체와 조사에서.
표준 streptavidin biotin 선호도 정화 절차, 가혹한 변성 조건8바운드 단백질 elute 강한 돌이킬 수 없는 biotin streptavidin 본드를 방해 하는 데 필요한 어떤의 분리 발생할 수 있습니다. 단백질 복합물입니다. Biotin, 달리 desthiobiotin 역에 streptavidin 바인딩하고 biotin, 단백질의 부드러운 차입에 대 한 허용 하 고 피하는 자연스럽 게 biotinylated 분자9, 격리의 버퍼 솔루션 경쟁력 있 제안 기법 기본 조건에서 네이티브 단백질 복합물을 분리 하는 데 이상적입니다.
생체 외에서 바인딩 조건과 엄중, 소금 농도, 감소 시키는 대리인 및 세제 비율에 의해 결정 됩니다,이 진정한 vivo에서 상호 작용을 식별 하기 위해 그 세포질 문맥에 가까이 있어야 한다. 여기에 구현 된 바인딩 조건 있다 이전 증명 AU-바인딩 단백질10으로 허의 식별을 위해 적절 한. 이 이렇게 어렵고 도전적인 적절 한 바인딩 조건의 최적화 될 수 있으므로 시간을 절약할 수 있다. 또한,이 방법은 어떤 RNA-풀 다운 실험 시작 프로토콜로 사용 될 수 고 소금 및 세제의 농도 변경 하 고, 글리세롤 백분율을 변경 하 고 다른 소금 추가 여 점차적으로 최적화할 수 있습니다. 또한, 우리는 심지어 짧은 25-뉴클레오티드 RNA-조사는 pentamer 은닉는 모티브 사용할 수 특정 AUBP와의 상호 작용을 보여 시연.

<table><tbody><tr><td>NE-PER Nuclear and cytoplasmic extraction kit</td><td>Thermo Fisher Scientific&amp;nbsp;</td><td>78833</td><td></td></tr><tr><td>Pierce Protease Inhibitor Tablets, EDTA-free</td><td>Thermo Fisher Scientific</td><td>A32965</td><td></td></tr><tr><td>Pierce BCA Protein Assay Kit</td><td>Thermo Fisher Scientific</td><td>23225</td><td></td></tr><tr><td>Pierce Magnetic RNA-protein Pull-Down Kit&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>20164</td><td>Includes magnetic beads and therefore the kit need to be stored at 4 &amp;deg;C</td></tr><tr><td>Pierce RNA 3&amp;rsquo; End Desthiobiotinylation Kit&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>20163</td><td>The kit is a part of the &quot;Pierce Magnetic RNA-protein Pull-Down Kit&quot;, and needs to be stored at -20 &amp;deg;C unlike the pull-down kit (4 &amp;deg;C).</td></tr><tr><td>DynaMag-2,&amp;nbsp; magnetic stand</td><td>Thermo Fisher Scientific</td><td>12321D</td><td></td></tr><tr><td>Anti - HuR (MOUSE) monoclonal antibody</td><td>Thermo Fisher Scientific</td><td>-</td><td>The antibody is included in the Pierce Magnetic RNA-protein Pull-Down Kit&amp;nbsp; - 1:1000 in 5% BSA 1x TTBS - rabbit anti-mouse secondary antibody 1:10,000 in 5% BSA 1x TTBS</td></tr><tr><td>Anti - &amp;alpha; - tubulin (MOUSE) monoclonal antibody</td><td>Santa Cruz</td><td>8035</td><td>1:1000 in 5% BSA 1x TTBS - rabbit anti-mouse secondary antibody 1:10,000 in 5% BSA 1x TTBS</td></tr><tr><td>Anti - PARP (RABBIT) Polyclonal antibody</td><td>Cell Signaling</td><td>9542</td><td>1:1000 in 5% BSA 1x TTBS - goat anti-rabbit secondary antibody 1:10,000 in 5% BSA 1x TTBS</td></tr><tr><td>Anti - Mesothelin (MOUSE) Monoclonal Antibody&amp;nbsp;</td><td>Rockland</td><td>200-301-A87</td><td></td></tr><tr><td>Secondary goat anti-rabbit antibody</td><td>Cell Signaling</td><td>7074</td><td></td></tr><tr><td>Secondary rabbit anti-mouse antibody</td><td>Sigma-Aldrich</td><td>A-9044</td><td></td></tr><tr><td>RPMI - 1640 medium</td><td>Sigma-Aldrich</td><td>R8758</td><td></td></tr><tr><td>FBS - Filtrated Bovine Serum</td><td>Pan Biotech&amp;nbsp;</td><td>P40-37500</td><td></td></tr><tr><td>Penicillin - streptomycin (100x)</td><td>Sigma-Aldrich&amp;nbsp;</td><td>P4333</td><td></td></tr><tr><td>L-Glutamine solution (200 mM)</td><td>Sigma-Aldrich&amp;nbsp;</td><td>G7513</td><td></td></tr><tr><td>0.25% Trypsin-EDTA (1x)</td><td>Gibco by Life technologies&amp;nbsp;</td><td>25200-056</td><td></td></tr><tr><td>Mini-PROTEAN 3 Cell</td><td>Bio-Rad</td><td>1653301</td><td></td></tr><tr><td>Mini Protean System Glass Plates&amp;nbsp;</td><td>Bio-Rad</td><td>1653308</td><td></td></tr><tr><td>Mini-PROTEAN Spacer Plates with 1.5 mm integrated spacer</td><td>Bio-Rad</td><td>1653312</td><td></td></tr><tr><td>Mini-PROTEAN Comb, 10-well, 1.5 mm, 66 &amp;micro;L</td><td>Bio-Rad</td><td>1653365</td><td></td></tr><tr><td>Mini-PROTEAN Tetra Cell Casting Modules</td><td>Bio-Rad</td><td>1658050</td><td></td></tr><tr><td>RNaseZap RNase Decontamination Solution</td><td>Thermo Fisher Scientific</td><td>AM9780</td><td></td></tr><tr><td>Rotiphorese gel 30 - aqueous 30% acrylamide and bisacrylamide stock solution at a ration of 37.5:1</td><td>Roth</td><td>3029</td><td></td></tr><tr><td>20% SDS&amp;nbsp;</td><td>PanReac AppliChem</td><td>A3942</td><td></td></tr><tr><td>PVDF transfer membrane&amp;nbsp;</td><td>Perkin Elmer</td><td>NEF1002</td><td>Need to be activated by incubating in pure methanol for 1 min followed by washing in water for 2 min&amp;nbsp;</td></tr><tr><td>Trans-Blot SD semi-dry transfer cell&amp;nbsp;</td><td>Bio-Rad</td><td>1703940</td><td></td></tr><tr><td>Clarity Western ECL Substrate</td><td>Bio-Rad</td><td>1705061</td><td></td></tr><tr><td>FusionFX&amp;nbsp; Digital Imager</td><td>Vilber</td><td>-</td><td></td></tr><tr><td>RNA oligo synthesis</td><td>Mycrosynth AG, Switzerland</td><td>-</td><td>the synthesis scale - 0.04 &amp;micro;mol - HPLC purified</td></tr><tr><td>Bovine serum albumin</td><td>Sigma-Aldrich</td><td>A7030</td><td></td></tr><tr><td>Hydrochloric Acid (HCl) 6 M</td><td>PanReac AppliChem</td><td>182883.1211</td><td></td></tr><tr><td>Ultra Pure 1 M Tris, pH 7.5&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>15567027</td><td></td></tr><tr><td>Glycerol&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>17904</td><td>50% sterile aliquots to be stored at -20&amp;deg;C</td></tr><tr><td>Pierce Streptavidin magnetic beads&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>88817</td><td>Please note that these magnetic beads have an average diameter of 1 &amp;micro;m (range from 0.5 - 1.5 &amp;micro;m). Furthermore, Dynabeads-M280 Streptavidin, which are beads of homogenouse size 2.8 &amp;micro;m, are also used in RNA-pulldown but be aware that this may affect purification process.</td></tr><tr><td>TEMED</td><td>Sigma-Aldrich</td><td>T9281</td><td></td></tr><tr><td>Ammonium persulfate&amp;nbsp;</td><td>Sigma-Aldrich</td><td>A3678</td><td></td></tr><tr><td>Coomassie G-250</td><td>Applichem</td><td>A3480</td><td></td></tr><tr><td>Aluminiumsulfate-(14-18)-hydrate&amp;nbsp;</td><td>Sigma-Aldrich</td><td>368458</td><td></td></tr><tr><td>ortho-phosphoric acid&amp;nbsp;</td><td>Applichem</td><td>A0637</td><td></td></tr></tbody></table>

desthiobiotin-streptavidin-affinity mediated purification of rna-interacting proteins in mesothelioma cells

생체 외에서 RNA-풀 다운 특정 RNA 구조와 주제를 인식 하는 RNA 의무적인 단백질을 식별 하기 위한 프로토콜의 첫 번째 단계에서 아직도 크게 사용 된다. 이 RNA-풀 다운 프로토콜에서 상업적으로 합성된 RNA 프로브 biotin, desthiobiotin는 역에 streptavidin 바인딩하고 따라서 더에서 단백질의 차입을 허용 한다 RNA 가닥의 3' 말단에서의 수정 된 형태로 표시 됩니다 생리 조건입니다. RNA-desthiobiotin는 streptavidin 자석 구슬, 풀 다운 단백질 특히 관심의 RNA와 상호 작용 하는 데 사용 되는에의 상호 작용을 통해 움직일 수 있습니다. Mesothelioma 셀의 cytosolic 분수에서 비 변성 및 활성 단백질은 단백질의 원본으로 사용 됩니다. 여기 설명 하는 방법은 알려진된 RNA 의무적인 단백질 25-뉴클레오티드 (nt) 긴 RNA 프로브를 포함 하는 관심사의 순서 사이 상호 작용을 검출 하기 위하여 적용할 수 있습니다. 안정 또는 불안정 기자 벡터 분석 결과 사용 하 여 달성 하는 RNA 분자에 존재 하는 성분의 기능 특성을 완료 하는 데 유용 합니다.

이 실험에서 calretinin 3' UTR 은닉은 모티브의 (CALB2 3' UTR (은) 25-nt) 25-nt 긴 조각 인간 항 R (허) 단백질, 알려진된 mRNA 안정제에 특히 바인딩 되었는지 테스트 하려면 사용 되었습니다. 테스트는 요소, 25 nt RNA의 특이성 조사 CALB2 3' UTR (mtARE)는 모티브의 안정화 효과 폐지 이전 보였다는 모티브는 돌연변이 포함 하 이었다 사용된6. 3 RNA 프로브 28 nt 부정적인 제어 없는 요소를 포함 하는 잘 정의 된 철 반응 (없는 RNA (분노)), 철 응답 cytosolic 단백질13,14바인딩할 알려진 RNA를 나타냅니다. 허 cytosol15mRNA 안정제로는 핵 함수 내에서 지역화 주로 이기 때문에, 핵/cytosolic 추출은 cytosol에서 활성 단백질을 얻기 위해 수행 되었습니다.
설명 하기 위해 핵/cytosolic 분수의 순도, 단백질 PARP 단백질 예상된 ( 로 핵 분수에만 감지 했다 반면 그 α-tubulin cytosolic 분수에 감지만 보여준 서쪽 오 점 분석 했다 그림 1). CALB2 3' UTR에서에서 eluate는 프로브 시연 허의 바인딩 허 결 석 했다 반면 돌연변이에서 eluate CALB 조사 3' UTR (mtARE). 허는도 eluate 철 반응 단백질 (그림 2A)를 바인딩하는 없는 RNA 조사에서 결 석. 더 설명 하기 위해 CALB 3' UTR ()와 허 사이 특이성, 막이이 단백질 RNA 상호 작용 하지 않습니다로 또한 안티-mesothelin (MSLN) 항 체로 조사 되었다. 모든 3 개의 샘플에서 있다 mesothelin의 아무 존재를 했다. 함께 찍은, CALB2 내에서 안정화는 모티브 3' UTR 특히 허 단백질을 묶는 수 있습니다 나타냅니다.
젤 (그림 2B) Coomassie 얼룩 같은 양의 단백질 3 다른 RNA 프로브로 품 어 하는 데 사용 했다 보여줍니다. Cytosolic 추출 사용의 낮은 금액 및 막에 전송,이 얼룩 허용 하지 않았다는 eluate에 단백질의 검출에 대 한 (E) 차선, 서쪽 오 점 분석에 의해 그렇지 않으면 감지 했다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57516/57516fig1.jpg"> 그림 1: cytosolic 핵 단백질 분수의 5 µ g의 서쪽 오 점 분석. PARP 단백질은 핵 분수 (N)에 있지만 cytosolic (C) 분수에서 결 석. Α-tubulin cytosolic 분수 (C)에 존재 하지만 핵 분수 (N)에서 결 석. <a href="/files/ftp_upload/57516/57516fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57516/57516fig2.jpg"> 그림 2: 서쪽 오 점 허 25 nt CALB2 3' UTR (는)에 의해 캡처 되었는지 보여줍니다. A) 피트: RNA 프로브; 부 화 후 통과 E: 외피에 eluted 단백질 그리고 RNA에 바인딩 프로브. 프로브: CALB2 3' UTR (mtARE)-25 nt calretinin 3' UTR는 모티브; 내 3 돌연변이 뉴클레오티드를 포함 하는 조각 통해 UR RNA (분노)-철-반응 단백질 바인딩 정의 철 반응 요소와 28-nt RNA 프로브. 막은 mesothelin (MSLN), 단백질 RNA 상호 작용 하지 않습니다에 대 한 추가 조사 했다. B) 프로브 Coomassie 단백질 이동, RNA와 같은 양의 단백질 incubated 했다 시연 후 젤의 얼룩. <a href="/files/ftp_upload/57516/57516fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>RNA 프로브</td>
			<td>시퀀스</td>
			<td>농도</td>
		</tr>
<tr>
<td>25nt CALB2 3' UTR (은)</td>
			<td>UCGCUGUAUGAUUUAGGCUUCUAUG</td>
			<td>10 Μ M</td>
		</tr>
<tr>
<td>25nt CALB2 3' UTR (mtARE)</td>
			<td>UCGCUGUAUGGUCUGGGCUUCUAUG</td>
			<td>10 Μ M</td>
		</tr>
<tr>
<td>RNA-없는 분노 28nt</td>
			<td>UCCUGCUUCAACAGUGCUUGGACGGAAC</td>
			<td>10 Μ M</td>
		</tr>
</tbody></table>표 1 : 시퀀스 RNA의 프로브
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>젤을 실행 하기 위한 낮은 Tris 버퍼</td>
			<td></td>
		</tr>
<tr>
<td>1.5 M</td>
			<td>트리 스 베이스</td>
		</tr>
<tr>
<td>0.40%</td>
			<td>SDS 솔루션</td>
		</tr>
<tr>
<td>HCL을 사용 하 여 8.8 addjust pH (6 mol/L)</td>
			<td></td>
		</tr>
<tr>
<td>채우기</td>
			<td>dH2O</td>
		</tr>
<tr>
<td>위 트리 스 스태킹에 대 한 SDS 페이지 젤</td>
			<td></td>
		</tr>
<tr>
<td>500 mM</td>
			<td>트리 스 베이스</td>
		</tr>
<tr>
<td>0.4%</td>
			<td>SDS 솔루션</td>
		</tr>
<tr>
<td>PH를 6.8 HCL을 사용 하 여 조정 (6 mol/L)</td>
			<td></td>
		</tr>
<tr>
<td>채우기</td>
			<td>dH2O</td>
		</tr>
<tr>
<td>실행 버퍼 X 10</td>
			<td></td>
		</tr>
<tr>
<td>250 m m</td>
			<td>트리 스 베이스</td>
		</tr>
<tr>
<td>1.92 M</td>
			<td>글리신</td>
		</tr>
<tr>
<td>PH를 8.3 HCL을 사용 하 여 조정 (6 mol/L)</td>
			<td></td>
		</tr>
<tr>
<td>채우기</td>
			<td>dH2O</td>
		</tr>
<tr>
<td>필터 또는 오토 클레이 브 및 4 ° C에서 저장</td>
			<td></td>
		</tr>
<tr>
<td>1 X 실행 버퍼</td>
			<td></td>
		</tr>
<tr>
<td>100 mL</td>
			<td>실행 버퍼 X 10</td>
		</tr>
<tr>
<td>0.05%</td>
			<td>SDS 솔루션</td>
		</tr>
<tr>
<td>채우기 최대 1 L</td>
			<td>dH2O</td>
		</tr>
<tr>
<td>전송 버퍼 X 10</td>
			<td></td>
		</tr>
<tr>
<td>480 m m</td>
			<td>트리 스 베이스</td>
		</tr>
<tr>
<td>390 mM</td>
			<td>글리신</td>
		</tr>
<tr>
<td>0.38%</td>
			<td>SDS 솔루션</td>
		</tr>
<tr>
<td>채우기</td>
			<td>dH2O</td>
		</tr>
<tr>
<td>참고: 0.22를 um 필터링 및 4 ° C에서 저장</td>
			<td></td>
		</tr>
<tr>
<td>1 X 전송 버퍼 (반 건조 시스템)</td>
			<td></td>
		</tr>
<tr>
<td>20 mL</td>
			<td>전송 버퍼 X 10</td>
		</tr>
<tr>
<td>40 mL</td>
			<td>메탄올</td>
		</tr>
<tr>
<td>채우기 최대 200 mL</td>
			<td>dH20</td>
		</tr>
<tr>
<td>10 X TBS (Tris 버퍼 염 분)</td>
			<td></td>
		</tr>
<tr>
<td>250 m m</td>
			<td>트리 스 베이스</td>
		</tr>
<tr>
<td>1.36 M</td>
			<td>NaCl</td>
		</tr>
<tr>
<td>27 mM</td>
			<td>KCl</td>
		</tr>
<tr>
<td>PH 7.4에 조정</td>
			<td></td>
		</tr>
<tr>
<td>채우기</td>
			<td>dH2O</td>
		</tr>
<tr>
<td>필터</td>
			<td></td>
		</tr>
<tr>
<td>1 X TTBS (Tris 버퍼 염 0.1 트윈-20)</td>
			<td></td>
		</tr>
<tr>
<td>1 X</td>
			<td>10 X TBS</td>
		</tr>
<tr>
<td>0.10%</td>
			<td>트윈-20</td>
		</tr>
<tr>
<td>채우기</td>
			<td>dH2O</td>
		</tr>
<tr>
<td>RNA 캡처 버퍼 (1 X)</td>
			<td></td>
		</tr>
<tr>
<td>20 mM</td>
			<td>트리 스 (pH 7.5)</td>
		</tr>
<tr>
<td>1 M</td>
			<td>NaCl</td>
		</tr>
<tr>
<td>1mm</td>
			<td>EDTA</td>
		</tr>
<tr>
<td>단백질-RNA 바인딩 버퍼 (10 배)</td>
			<td></td>
		</tr>
<tr>
<td>200 mM</td>
			<td>트리 스 (pH 7.5)</td>
		</tr>
<tr>
<td>500 mM</td>
			<td>NaCl</td>
		</tr>
<tr>
<td>20 mM</td>
			<td>MgCl2</td>
		</tr>
<tr>
<td>1%</td>
			<td>트윈-20</td>
		</tr>
<tr>
<td>워시 버퍼 (1x)</td>
			<td></td>
		</tr>
<tr>
<td>20 mM</td>
			<td>트리 스 (pH 7.5)</td>
		</tr>
<tr>
<td>10 m m</td>
			<td>NaCl</td>
		</tr>
<tr>
<td>0.1%</td>
			<td>트윈-20</td>
		</tr>
<tr>
<td>차입 버퍼</td>
			<td></td>
		</tr>
<tr>
<td>4 m m</td>
			<td>비타민 b 복합체</td>
		</tr>
<tr>
<td>20 mM</td>
			<td>트리 스 (pH 7.5)</td>
		</tr>
<tr>
<td>50 mM</td>
			<td>NaCl</td>
		</tr>
<tr>
<td>Coomassie 솔루션</td>
			<td></td>
		</tr>
<tr>
<td>0.02%</td>
			<td>Coomassie G-250</td>
		</tr>
<tr>
<td>5%</td>
			<td>Aluminiumsulfate-(14-18)-하이드 레이트</td>
		</tr>
<tr>
<td>10%</td>
			<td>EtOH</td>
		</tr>
<tr>
<td>2%</td>
			<td>직교 인 산</td>
		</tr>
</tbody></table>표 2: 조리법

Watch this Scientific Journal Video about Desthiobiotin-Streptavidin-Affinity Mediated Purification of RNA-Interacting Proteins in Mesothelioma Cells at JoVE.com

Desthiobiotin-Streptavidin-Affinity Mediated Purification of RNA-Interacting Proteins in Mesothelioma Cells

Desthiobiotin Streptavidin 선호도 중재 Mesothelioma 세포에서 RNA 상호 작용 단백질의 정화

Desthiobiotin 라벨 아데닌 부자 요소 (는) 주제를 포함 하는 합성 25-뉴클레오티드 RNA oligo의 cytosolic는 바인딩 단백질의 특정 바인딩 수 있습니다.

The in vitro RNA-pulldown is still largely used in the first steps of protocols aimed at identifying RNA-binding proteins that recognize specific RNA ...

desthiobiotin-streptavidin-affinity-mediated-purification-rna

Nanyang Technological University

Research

JoVE Journal

Cancer Research

7.9K 조회수.  University Hospital Zurich. Desthiobiotin 라벨 아데닌 부자 요소 (는) 주제를 포함 하는 합성 25-뉴클레오티드 RNA oligo의 cytosolic는 바인딩 단백질의 특정 바인딩 수 있습니다.

비디오: Desthiobiotin-Streptavidin-Affinity Mediated Purification of RNA-Interacting Proteins in Mesothelioma Cells

Novel RNA-Binding Proteins Isolation by the RaPID Methodology

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern biology. Only a few in vitro and in vivo methods enable the identification of RBPs associated with a particular target mRNA. However, their main limitations are the identification of RBPs in a non-cellular environment (in vitro) or the low efficiency isolation of RNA of interest (in vivo). An RNA-binding protein purification and identification (RaPID) methodology was designed to overcome these limitations in yeast and enable efficient isolation of proteins that are associated in vivo. To achieve this, the RNA of interest is tagged with MS2 loops, and co-expressed with a fusion protein of an MS2-binding protein and a streptavidin-binding protein (SBP). Cells are then subjected to crosslinking and lysed, and complexes are isolated through streptavidin beads. The proteins that co-purify with the tagged RNA can then be determined by mass spectrometry. We recently used this protocol to identify novel proteins associated with the ER-associated PMP1 mRNA. Here, we provide a detailed protocol of RaPID, and discuss some of its limitations and advantages.

RNA-protein interactions lie at the heart of many cellular processes. Here, we describe an in vivo method to isolate specific RNA and identify novel proteins that are associated with it. This could shed new light on how RNAs are regulated in the cell.

빠른 방법론에 의해 소설 RNA 결합 단백질 분리

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern ...

연구

유전학

Biotin-based Pulldown Assay to Validate mRNA Targets of Cellular miRNAs

MicroRNAs (miRNAs) are a class of small noncoding RNAs that post-transcriptionally regulate cellular gene expression. MiRNAs bind to the 3&#39; untranslated region (UTR) of target mRNA to inhibit protein translation or in some instances cause mRNA degradation. The binding of the miRNA to the 3&#39; UTR of the target mRNA is mediated by a 2&#8211;8 nucleotide seed sequence at the 5&#39; end of miRNA. While the role of miRNAs as cellular regulatory molecules is well established, identification of the target mRNAs with functional relevance remains a challenge. Bioinformatic tools have been employed to predict sequences within the 3&#39; UTR of mRNAs as potential targets for miRNA binding. These tools have also been utilized to determine the evolutionary conservation of such sequences among related species in an attempt to predict functional role. However, these computational methods often generate false positive results and are limited to predicting canonical interaction between miRNA and mRNA. Therefore, experimental procedures that measure direct binding of miRNA to its mRNA target are necessary to establish functional interaction. In this report, we describe a sensitive method for validating direct interaction between the cellular miRNA miR-125b and the 3&#39; UTR of PARP-1 mRNA. We elaborate a protocol in which synthetic biotinylated-miRNA mimics were transfected into mammalian cells and the miRNA-mRNA complex in the cellular lysate was pulled down with streptavidin-coated magnetic beads. Finally, the target mRNA in the pulled-down nucleic acid complex was quantified using a qPCR-based strategy.

This report describes a fast and reliable method for validating mRNA targets of cellular miRNAs. The method uses synthetic biotinylated Locked Nucleic Acid (LNA)-based miRNA mimics to capture target mRNA. Subsequently, streptavidin-coated magnetic beads are employed to pulldown the target mRNA for quantification by qPCR polymerase chain reaction.

Biotin 기반 풀 다운 유효성 검사 mRNA를 표적 세포 miRNAs 분석 결과

MicroRNAs (miRNAs) are a class of small noncoding RNAs that post-transcriptionally regulate cellular gene expression. MiRNAs bind to the 3&#39; ...

An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes

RNA-binding proteins (RBPs) play key roles in the post-transcriptional control of gene expression. Therefore, biochemical characterization of mRNA-protein complexes is essential to understanding mRNA regulation inferred by interacting proteins or non-coding RNAs. Herein, we describe a tandem RNA isolation procedure (TRIP) that enables the purification of endogenously formed mRNA-protein complexes from cellular extracts. The two-step protocol involves the isolation of polyadenylated mRNAs with antisense oligo(dT) beads and subsequent capture of an mRNA of interest with 3&#39;-biotinylated 2&#39;-O-methylated antisense RNA oligonucleotides, which can then be isolated with streptavidin beads. TRIP was used to recover in vivo crosslinked mRNA-ribonucleoprotein (mRNP) complexes from yeast, nematodes and human cells for further RNA and protein analysis. Thus, TRIP is a versatile approach that can be adapted to all types of polyadenylated RNAs across organisms to study the dynamic re-arrangement of mRNPs imposed by intracellular or environmental cues.

A tandem RNA isolation procedure (TRIP) for recovery of endogenously formed mRNA-protein complexes is described. Specifically, RNA-protein complexes are crosslinked in vivo, polyadenylated RNAs are isolated from extracts with oligo(dT) beads, and particular mRNAs are captured with modified RNA antisense oligonucleotides. Proteins bound to mRNAs are detected by immunoblot analysis.

진 핵 세포 mRNA 단백질 복합물을 복구 하는 Oligonucleotide 기반 협동 RNA 격리 절차

RNA-binding proteins (RBPs) play key roles in the post-transcriptional control of gene expression. Therefore, biochemical characterization of mRNA-protein ...

생화학

In Vitro Biochemical Assays using Biotin Labels to Study Protein-Nucleic Acid Interactions

Protein-nucleic acid interactions play important roles in biological processes such as transcription, recombination, and RNA metabolism. Experimental methods to study protein-nucleic acid interactions require the use of fluorescent tags, radioactive isotopes, or other labels to detect and analyze specific target molecules. Biotin, a non-radioactive nucleic acid label, is commonly used in electrophoretic mobility shift assays (EMSA) but has not been regularly employed to monitor protein activity during nucleic acid processes. This protocol illustrates the utility of biotin labeling during in vitro enzymatic reactions, demonstrating that this label works well with a range of different biochemical assays. Specifically, in alignment with previous findings using radioisotope 32P-labeled substrates, it is confirmed via biotin-labeled EMSA that MEIOB (a protein specifically involved in the meiotic recombination) is a DNA-binding protein, that MOV10 (an RNA helicase) resolves biotin-labeled RNA duplex structures, and that MEIOB cleaves biotin-labeled single-stranded DNA. This study demonstrates that biotin is capable of substituting 32P in various nucleic acid-related biochemical assays in vitro.&#160;

Presented here are protocols for in vitro biochemical assays using biotin labels that may be widely&#160;applicable for studying protein-nucleic acid interactions.

비오틴 라벨을 사용하여 단백질-핵산 상호 작용을 연구하는 생체외 생화학 적 분석을 통해

Protein-nucleic acid interactions play important roles in biological processes such as transcription, recombination, and RNA metabolism. Experimental ...

Single-step Purification of Macromolecular Complexes Using RNA Attached to Biotin and a Photo-cleavable Linker

For many years, the exceptionally strong and rapidly formed interaction between biotin and streptavidin has been successfully utilized for partial purification of biologically important RNA/protein complexes. However, this strategy suffers from one major disadvantage that limits its broader utilization: the biotin/streptavidin interaction can be broken only under denaturing conditions that also disrupt the integrity of the eluted complexes, hence precluding their subsequent functional analysis and/or further purification by other methods. In addition, the eluted samples are frequently contaminated with the background proteins that nonspecifically associate with streptavidin beads, complicating the analysis of the purified complexes by silver staining and mass spectrometry. To overcome these limitations, we developed a variant of the biotin/streptavidin strategy in which biotin is attached to an RNA substrate via a photo-cleavable linker and the complexes immobilized on streptavidin beads are selectively eluted to solution in a native form by long wave UV, leaving the background proteins on the beads. Shorter RNA binding substrates can be synthesized chemically with biotin and the photo-cleavable linker covalently attached to the 5&#39; end of the RNA, whereas longer RNA substrates can be provided with the two groups by a complementary oligonucleotide. These two variants of the UV-elution method were tested for purification of the U7 snRNP-dependent processing complexes that cleave histone pre-mRNAs at the 3&#39; end and they both proved to compare favorably to other previously developed purification methods. The UV-eluted samples contained readily detectable amounts of the U7 snRNP that was free of major protein contaminants and suitable for direct analysis by mass spectrometry and functional assays. The described method can be readily adapted for purification of other RNA binding complexes and used in conjunction with single- and double-stranded DNA binding sites to purify DNA-specific proteins and macromolecular complexes.

RNA/protein complexes purified using botin-streptavidin strategy are eluted to solution under denaturing conditions in a form unsuitable for further purification and functional analysis. Here, we describe a modification of this strategy that utilizes a photo-cleavable linker in RNA and a gentle UV-elution step, yielding native and fully functional RNA/protein complexes.

단일 단계 정화 RNA Biotin 및 사진 쪼갤 링커를 사용 하 여 고분자 복합물의

For many years, the exceptionally strong and rapidly formed interaction between biotin and streptavidin has been successfully utilized for partial ...

Transcriptome-Wide Profiling of Protein-RNA Interactions by Cross-Linking and Immunoprecipitation Mediated by FLAG-Biotin Tandem Purification

RNA and RNA-binding proteins (RBPs) control multiple biological processes. The spatial and temporal arrangement of RNAs and RBPs underlies the delicate regulation of these processes. A strategy called CLIP-seq (cross-linking and immunoprecipitation) has been developed to capture endogenous protein-RNA interactions with UV cross-linking followed by immunoprecipitation. Despite the wide use of conventional CLIP-seq method in RBP study, the CLIP method is limited by the availability of high-quality antibodies, potential contaminants from the copurified RBPs, requirement of isotope manipulation, and potential loss of information during a tedious experimental procedure. Here we describe a modified CLIP-seq method called FbioCLIP-seq using the FLAG-biotin tag tandem purification. Through tandem purification and stringent wash conditions, almost all the interacting RNA-binding proteins are removed. Thus, the RNAs interacting indirectly mediated by these copurified RBPs are also reduced. Our FbioCLIP-seq method allows efficient detection of direct protein-bound RNAs without SDS-PAGE and membrane transfer procedures in an isotope-free and protein-specific antibody-free manner.

Here we present a modified CLIP-seq protocol called FbioCLIP-seq with FLAG-biotin tandem purification to determine the RNA targets of RNA-binding proteins (RBPs) in mammalian cells.

플래그-비오틴 탠덤 정화에 의해 중재된 상호 연결 및 면역 침전을 통해 단백질-RNA 상호 작용의 전사-전체 프로파일링

RNA and RNA-binding proteins (RBPs) control multiple biological processes. The spatial and temporal arrangement of RNAs and RBPs underlies the delicate ...

An Optimized Quantitative Pull-Down Analysis of RNA-Binding Proteins Using Short Biotinylated RNA

Protein-RNA interactions regulate gene expression and cellular functions at transcriptional and post-transcriptional levels. For this reason, identifying the binding partners of an RNA of interest remains of high importance to unveil the mechanisms behind many cellular processes. However, RNA molecules might interact transiently and dynamically with some RNA-binding proteins (RBPs), especially with non-canonical ones. Hence, improved methods to isolate and identify such RBPs are greatly needed.
To identify the protein partners of a known RNA sequence efficiently and quantitatively, we developed a method based on the pull-down and characterization of all interacting proteins, starting from cellular total protein extract. We optimized the protein pull-down using biotinylated RNA pre-loaded on streptavidin-coated beads. As a proof of concept, we employed a short RNA sequence known to bind the neurodegeneration-associated protein TDP-43 and a negative control of a different nucleotide composition but the same length. After blocking the beads with yeast tRNA, we loaded the biotinylated RNA sequences on the streptavidin beads and incubated them with the total protein extract from HEK 293T cells. After incubation and several washing steps to remove nonspecific binders, we eluted the interacting proteins with a high-salt solution, compatible with the most commonly used protein quantification reagents and with sample preparation for mass spectrometry. We quantified the enrichment of TDP-43 in the pull-down performed with the known RNA binder compared to the negative control by mass spectrometry. We used the same technique to verify the selective interactions of other proteins computationally predicted to be unique binders of our RNA of interest or of the control. Finally, we validated the protocol by western blot via the detection of TDP-43 with an appropriate antibody. 
This protocol will allow the study of the protein partners of an RNA of interest in near-to-physiological conditions, helping uncover unique and unpredicted protein-RNA interactions.

Here, we present an optimized in vitro method to uncover, quantify, and validate protein interactors of specific RNA sequences, using total protein extract from human cells, streptavidin beads coated with biotinylated RNA, and mass spectrometry analysis.

짧은 비오티닐화 RNA를 사용한 RNA 결합 단백질의 최적화된 정량적 풀다운 분석

Protein-RNA interactions regulate gene expression and cellular functions at transcriptional and post-transcriptional levels. For this reason, identifying ...

Orthotopic Implantation and Peripheral Immune Cell Monitoring in the II-45 Syngeneic Rat Mesothelioma Model

The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of the role of the tumor microenvironment in treatment response, collectively point to the need for immune-competent orthotopic models for pre-clinical testing of these new therapies. This paper demonstrates how to establish an orthotopic immune-competent rat model of pleural malignant mesothelioma. Monitoring disease progression in orthotopic models is confounded by the internal location of the tumors. To longitudinally monitor disease progression and its effect on circulating immune cells in this and other rat models of cancer, a single tube flow cytometry assay requiring only 25 &#181;l whole blood is described. This provides accurate quantification of seven immune parameters: total lymphocytes, monocytes and neutrophils, as well as the T-cell subsets CD4 and CD8, B-cells and Natural Killer cells. Different subsets of these parameters are useful in different circumstances and models, with the neutrophil to lymphocyte ratio having the greatest utility for monitoring disease progression in the mesothelioma model. Analyzing circulating immune cell levels using this single tube method may also assist in monitoring the response to immune-based treatments and understanding the underlying mechanisms leading to success or failure of treatment.

The generation of an orthotopic rat model of pleural malignant mesothelioma by implantation of II-45 mesothelioma cells into the pleural cavity of immune competent rats is presented. A flow cytometric method to analyze seven immune cell subsets in these animals from a 25 &#181;l&#160;blood sample is also described.

II-45 동계 쥐의 Mesothelioma 모델에서 소성을 주입 및 주변 면역 세포 모니터링

The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of ...

의학

Isolation of Translating Ribosomes Containing Peptidyl-tRNAs for Functional and Structural Analyses

Recently, structural and biochemical studies have detailed many of the molecular events that occur in the ribosome during inhibition of protein synthesis by antibiotics and during nascent polypeptide synthesis. Some of these antibiotics, and regulatory nascent polypeptides mostly in the form of peptidyl-tRNAs, inhibit either peptide bond formation or translation termination1-7. These inhibitory events can stop the movement of the ribosome, a phenomenon termed "translational arrest". Translation arrest induced by either an antibiotic or a nascent polypeptide has been shown to regulate the expression of genes involved in diverse cellular functions such as cell growth, antibiotic resistance, protein translocation and cell metabolism8-13. Knowledge of how antibiotics and regulatory nascent polypeptides alter ribosome function is essential if we are to understand the complete role of the ribosome in translation, in every organism.
Here, we describe a simple methodology that can be used to purify, exclusively, for analysis, those ribosomes translating a specific mRNA and containing a specific peptidyl-tRNA14. This procedure is based on selective isolation of translating ribosomes bound to a biotin-labeled mRNA. These translational complexes are separated from other ribosomes in the same mixture, using streptavidin paramagnetic beads (SMB) and a magnetic field (MF). Biotin-labeled mRNAs are synthesized by run-off transcription assays using as templates PCR-generated DNA fragments that contain T7 transcriptional promoters. T7 RNA polymerase incorporates biotin-16-UMP from biotin-UTP; under our conditions approximately ten biotin-16-UMP molecules are incorporated in a 600 nt mRNA with a 25% UMP content. These biotin-labeled mRNAs are then isolated, and used in in vitro translation assays performed with release factor 2 (RF2)-depleted cell-free extracts obtained from Escherichia coli strains containing wild type or mutant ribosomes. Ribosomes translating the biotin-labeled mRNA sequences are stalled at the stop codon region, due to the absence of the RF2 protein, which normally accomplishes translation termination. Stalled ribosomes containing the newly synthesized peptidyl-tRNA are isolated and removed from the translation reactions using SMB and an MF. These beads only bind biotin-containing messages.
The isolated, translational complexes, can be used to analyze the structural and functional features of wild type or mutant ribosomal components, or peptidyl-tRNA sequences, as well as determining ribosome interaction with antibiotics or other molecular factors 1,14-16. To examine the function of these isolated ribosome complexes, peptidyl-transferase assays can be performed in the presence of the antibiotic puromycin1. To study structural changes in translational complexes, well established procedures can be used, such as i) crosslinking to specific amino acids14 and/or ii) alkylation protection assays1,14,17.

A major impediment to biochemical analyses of ribosomes containing nascent peptidyl-tRNAs has been the presence of other ribosomes in the same samples, ribosomes not involved in the translation of the specific mRNA sequence being analyzed. We developed a simple methodology to purify, exclusively, the ribosomes containing the nascent peptidyl-tRNA of interest.

기능 및 구조 분석을위한 Peptidyl - tRNAs를 포함 번역 리보솜의 분리

Recently, structural and biochemical studies have detailed many of the molecular events that occur in the ribosome during inhibition of protein synthesis ...

생물학

<meta charset="utf8"></head><body>Label-Free 방법을 사용한 RPA-ssDNA 결합 동역학의 정량 분석

Analyzing DNA-Protein Interactions with Streptavidin-Based Biolayer Interferometry

Protein-DNA interactions underpin essential cellular processes. Understanding these interactions is critical for elucidating the molecular mechanisms of various pathways. Key factors such as the structure, sequence, and length of a DNA molecule can significantly influence protein binding. Bio-layer interferometry (BLI) is a label-free technique that measures binding kinetics between molecules, offering a straightforward and precise approach to quantitatively study protein-DNA interactions. A major advantage of BLI over traditional gel-based methods is its ability to provide real-time data on binding kinetics, enabling accurate measurement of the equilibrium dissociation constant (KD) for dynamic protein-DNA interactions. This article presents a basic protocol for determining the KD value of the interaction between a DNA replication protein, replication protein A (RPA), and a single-stranded DNA (ssDNA) substrate. RPA binds ssDNA with high affinity but must also be easily displaced to facilitate subsequent protein interactions within biological pathways. In the described BLI assay, biotinylated ssDNA is immobilized on a streptavidin-coated biosensor. The binding kinetics (association and dissociation) of RPA to the biosensor-bound DNA are then measured. The resulting data are analyzed to derive precise values for the association rate constant (ka), dissociation rate constant (kd), and equilibrium binding constant (KD) using system software.

<meta charset="utf8"></head><body>스트렙타비딘 기반 생물층 간섭계를 사용한 DNA-단백질 상호작용 분석

This article describes a protocol for studying DNA-protein interactions using a streptavidin-based biolayer interferometry (BLI) system. It outlines the essential steps and considerations for utilizing either basic or advanced binding kinetics to determine the equilibrium binding affinity (KD) of the interaction.

스트렙타비딘 기반 생물층 간섭계를 사용한 DNA-단백질 상호작용 분석

Protein-DNA interactions underpin essential cellular processes. Understanding these interactions is critical for elucidating the molecular mechanisms of ...