Name: desthiobiotin-streptavidin-affinity mediated purification of rna-interacting proteins in mesothelioma cells
Uploaded: 2018-04-25T15:00:00.000+00:00
Duration: 11 min 11 s
Description: Watch this Scientific Journal Video about Desthiobiotin-Streptavidin-Affinity Mediated Purification of RNA-Interacting Proteins in Mesothelioma Cells at JoVE.com

Questo lavoro è stato supportato dalla sovvenzione Swiss National Science Foundation Sinergia CRSII3 147697, Stiftung für Angewandte Krebsforschung e Zürich Krebsliga.

1. preparazione di frazione delle proteine citosoliche e nucleari
<ol><li>Piatto 4 x 106 ACC-MESO-4 cellule in un matraccio di cultura cellulare T150 coltivate in RPMI - 1640 medio completati con 10% FBS, 1 x penicillina/streptomicina (100x) e 2 mM L-Glutammina (200 mM). Quando le cellule raggiungono una confluenza di 80-90% (~5-5.5 x 106 cellule), procedere con estrazione della proteina della frazione citosolica e nucleare. Nota: ACC-MESO-4 linea cellulare è stata ottenuta dal RIKEN BioResource centro11.</li>
	<li>Medio di aspirare, lavare le cellule con l'aggiunta di 15 mL di PBS 1X, inclinare il piatto delicatamente un paio di volte e aspirare il PBS 1X. Aggiungere 3 mL di 0,25% tripsina-EDTA e incubare la beuta di coltura a 37 ° C per 3 min. Nota: Esaminare le cellule sotto il microscopio per distacco; Se ancora attaccato tocca il pallone contro il palmo di una mano 3 volte.</li>
	<li>Aggiungere 7 mL di RPMI-1640 supplementato con 10% FBS, 1x penicillina/streptomicina (100x) e 2 mM L-Glutammina (200 mM), raccogliere le cellule in una provetta da 15 mL e spin giù a 200 x g per 5 min.</li>
	<li>Aspirare il medio e risospendere il pellet cellulare con 1,5 mL di 1X PBS, quindi trasferire le cellule in una provetta da microcentrifuga da 1,5 mL. Rotazione verso il basso a 500 x g e a 4 ° C per 5 min, scartare il surnatante. Nota: Da questo punto in poi, eseguire tutte le fasi di centrifugazione a 4 ° C e mantenere tutti i reagenti sul ghiaccio.</li>
	<li>Risospendere il pellet cellulare con gelida 1,5 mL di 1X PBS e spin-down le cellule a 500 x g e a 4 ° C per 3 min. scartare il surnatante. Nota: Le quantità necessarie di CER I, CER II e reagenti NER sono 10, 0.55 e 5 volumi di pellet cellulare stimato pranzo volume, rispettivamente; il seguente protocollo presuppone un volume di 20 µ l. Si consiglia di preparare solo la quantità necessaria di reagente CER io.</li>
	<li>Aggiungere 200 µ l di reagente di estrazione citoplasmico ghiacciata (CER mi) completati con 2 µ l di 1x inibitore della proteinasi, ad es., diluire 1 compressa dell'inibitore di proteasi (privo di EDTA) in 500 µ l di acqua per ottenere stock x 100. Questa quantità di reagente CER basterà lisare 20 µ l di un pellet cellulare imballato volume.<ol>
<li>Per stimare il volume di pellet imballato delle cellule, confrontare la provetta contenente il pellet cellulare con un tubo di 1,5 mL riempito con 10, 20, 50 o 100 µ l di PBS 1X.</li>
	</ol>
</li>
	<li>Risospendere il pellet cellulare vigorosamente nel Vortex il tubo per 15 s e incubare la provetta in ghiaccio per 10 min aggiungere 11 µ l di reagente di estrazione citoplasmico ghiacciata II (CER II) al tubo, vigorosamente vortex per 5 s e incubare 1 min sul ghiaccio.</li>
	<li>Agitare vigorosamente per 5 s e centrifugare la provetta a 16.000 x g e 4 ° C per 5 min. trasferire il surnatante nella provetta pre-refrigerata pulita sul ghiaccio. Il supernatante è la frazione citoplasmatica che è ulteriormente utilizzato nell'esperimento RNA-pulldown.</li>
	<li>Risospendere in 100 µ l di reagente di estrazione nucleare ghiacciata (NER) completati con 1 µ l di inibitore della proteinasi (100x) e vigorosamente vortex per 15 s. Si consiglia di preparare solo la quantità necessaria di reagente NER completati con inibitori della proteasi.</li>
	<li>Incubare il campione in ghiaccio per 40 min con occasionali su vortex per 15 s (ogni 10 min).</li>
	<li>Centrifugare la provetta a 16.000 x g per 10 min trasferimento il surnatante (questa è la frazione di proteina nucleare) in una provetta pulita pre-refrigerata.</li>
	<li>Procedere immediatamente misurando la concentrazione di proteine mediante il metodo bicinconinico (BCA) (Vedi Tabella materiali). Per controllare per la purezza della proteina di ogni frazione, eseguire immunoblotting (Figura 1) contro Poli ADP-ribosio polimerasi - PARP (rilevamento positivo solo nella frazione nucleare) e α-tubulina (rilevamento positivo solo nella frazione citosolica). Per la visualizzazione di proteine, fare riferimento alla sezione 4.</li>
	<li>Al fine di mantenere l'attività della proteina e loro stato nativo, preparare 25 µ l di aliquote di estratti citosolici e nucleari. Snap-congelare queste aliquote ponendoli in azoto liquido per 5 s e direttamente a-80 ° C.</li>
</ol>2. etichettatura di RNA con Desthiobiotin
<ol><li>Le sonde del RNA sintetizzato commercialmente e HPLC purificato. Risospendere con acqua priva di nucleasi a 10 µM. Nota: La sonda sequenze sono elencati nella tabella 1.</li>
	<li>Utilizzare 50 pmoli di RNA per reazione di RNA-pulldown. Scongelare e conservare tutti i reagenti su ghiaccio tranne per PEG 30%, utilizzato con etichetta 3' capolinea del RNA oligo.</li>
	<li>Trasferire 5 µ l di 10 µM le sonde del RNA, etichettato come CALB2 3' UTR (ARE), CALB2 3' UTR (mtARE) e nessuna relazione-RNA (IRE), in 0,5 mL a parete sottile microcentrifuga tubi e procedere all'incubazione in una macchina PCR a 85 ° C per 5 min. Posizionare i tubi immediatamente sul ghiaccio. Nota: Questo passaggio è importante, in quanto favorisce il rilassamento e l'accessibilità della sonda RNA per l'etichettatura.</li>
	<li>Per una singola reazione di 30 µ l, aggiungere alla provetta contenente RNA la seguente miscela di 10 µ l: 3 µ l di acqua libera nucleasi, 3 µ l di tampone di reazione ligasi di RNA, 1 µ l di RNAsi inibitore 10x (40 U / µ l), 1 µ l di Desthiobiotinylated citidina bisfosfato (1 mM) e 2 µ l di ligasi T4 RNA (20 U / µ l). Nota: Per preparare mix master A 3 campioni in eccesso (3.2), mescolare acqua gratuita, 9,6 µ l di tampone di reazione ligasi di RNA, 3,2 µ l di RNAsi inibitore 10x 9.6 µ l di nucleasi (40 U / µ l), 3,2 µ l di Desthiobiotinylated citidina bisfosfato (1 mM) e 6,4 µ l della ligasi T4 RNA (20 U / µ l).</li>
	<li>Aggiungere attentamente 15 µ l di PEG 30% alla reazione. Utilizzare un altro suggerimento per mescolare la reazione. Incubare la reazione durante la notte a 16 ° C.</li>
	<li>Il giorno successivo, preparare quanto segue: 5 M di NaCl (fresco/nucleasi-free), cloroformio: alcool isoamilico in rapporto 24:1 (ad esempio, per reazione - 96 µ l cloroformio e 4 µ l di alcool isoamilico), ghiacciata 100% etanolo e ghiacciata etanolo al 70%.</li>
	<li>Aggiungere 70 µ l di acqua priva di nucleasi per le provette di reazione RNA-etichettatura. Aggiungere 100 µ l di cloroformio: isoamil alcool e agitare brevemente. Rallentamento a 13.000 x g per 3 minuti, rimuovere con attenzione solo la fase superiore e il trasferimento ad un nuovo tubo privo di nucleasi 1,5 mL; evitare di toccare la fase inferiore.</li>
	<li>Aggiungere 10 µ l di 5m NaCl, 1 µ l di glicogeno e 300 µ l di etanolo al 100% ghiacciata. Posizionare il tubo a-20 ° C per 2 h. Nota: In questa fase, l'esperimento può essere continuato il giorno seguente.</li>
	<li>Centrifugare a 13.000 x g e a 4 ° C per 15 min., attentamente, scartare il sopranatante senza disturbare il pellet. Aggiungere 300 µ l di etanolo al 70% ghiacciata e centrifugare nuovamente a 13.000 x g e a 4 ° C per 5 min.</li>
	<li>Scartare il surnatante completamente e asciugare il pellet (15 min). Risospendere il pellet in 20 µ l di acqua priva di nucleasi. Nota: Procedere con RNA-pulldown nello stesso giorno.</li>
	<li>Incubare il RNA a 90 ° C per 2 min e metterli su ghiaccio. Mettere il RNA etichettati sul ghiaccio durante il passaggio seguente di prelavaggio dei branelli magnetici streptavidina. Nota: Un tempo di incubazione più lungo potrebbe danneggiare la sonda RNA.</li>
</ol>3. RNA-proteina Pulldown
<ol><li>
Prelavaggio biglie streptavidin-magnetiche e incubazione con desthiobiotin-RNA
	<ol>
<li>Utilizzare 50 µ l di streptavidina perline magnetico per 50 pmol RNA. Tuttavia, questo dovrebbe essere ottimizzato a seconda dell'esperimento.</li>
		<li>Vortice il tubo con perline streptavidina-magnetiche per 15 s e rapidamente rimuovere 200 µ l (mix master; abbastanza per reazioni di 3 + 1) in un tubo di sicurezza bloccaggio pulito 1,5 mL utilizzando taglia punte di pipetta. Posizionare il tubo su un supporto magnetico in modo che le perline raccolgono sul lato del tubo e attendere 1 minuto Rimuovi il liquido di risospensione.</li>
		<li>Lavare le perle, togliere il tubo dal supporto magnetico, aggiungere 400 µ l di 0.1 M NaOH 0,05 M NaCl soluzione e delicatamente dispensare su e giù più volte. Riposizionare il tubo sul supporto magnetico. Attendere 1 minuto e raccogliere il surnatante. Ripetere questo passaggio.</li>
		<li>Lavare le perle con 200 µ l di NaCl 100 mM. Eliminare il surnatante.</li>
		<li>Aggiungere 200 µ l di 20 mM Tris (pH 7.5), risospendere perline pipettando, posizionare il tubo sul supporto magnetico, attendere per 1 min e rimuovere il surnatante. Ripetere il passaggio.</li>
		<li>Togliere il tubo dal supporto magnetico, aggiungere 200 µ l di buffer di acquisizione di RNA: 1x e risospendere le microsfere magnetiche streptavidina brevemente nel Vortex. Rimuovere 50 µ l di biglie magnetiche streptavidina e aggiungere ad ogni provetta etichettata-RNA utilizzando un puntale di taglio. Incubare le provette per 30 min a temperatura ambiente su un rullo.</li>
	</ol>
</li>
	<li>
Grippaggio della proteina al RNA
	<ol>
<li>Disporre le provette in un supporto magnetico, attendere 1 min e rimuovere il surnatante.</li>
		<li>Aggiungere 50 µ l di 20 mM Tris (pH 7,5) ai talloni e risospendere pipettando. Disporre le provette in un supporto magnetico, attendere 1 min e rimuovere il surnatante. Ripetere questo passaggio.</li>
		<li>Aggiungere 100 µ l di tampone di legame proteina-RNA 1x ai talloni e risospendere pipettando.</li>
		<li>Nel frattempo, preparare la seguente miscela: 10 µ l di 10x buffer obbligatorio della proteina-RNA, 30 µ l di glicerolo al 50%, 50 µ g di proteine citoplasmatiche e nucleasi-free fino a 100 µ l di acqua. Nota: Preparare mix master B per 3 campioni in eccesso (3.3) come segue: 33 µ l di tampone di legame proteina-RNA 10x, 99 µ l di glicerolo al 50%, 165 µ g di proteine citoplasmatiche e acqua priva di nucleasi fino a 330 µ l. tenere il tubo di mix master B sul ghiaccio.</li>
		<li>Inserire i tubi di supporto magnetico, attendere 1 minuto e raccogliere il surnatante. Aggiungere 100 µ l di master mix B, risospendere pipettando delicatamente su e giù ed evitare di creare bolle. Incubare le provette di reazione per 60 min a 4 ° C su un rullo.</li>
	</ol>
</li>
	<li>
Lavaggio ed eluizione
	<ol>
<li>Disporre le provette in un supporto magnetico, raccogliere il surnatante (che è il flusso attraverso - FT) e trasferire in una nuova provetta. Nota: Mantenere questa FT sul ghiaccio per un'analisi successiva.</li>
		<li>Pipettare 100 µ l di tampone di lavaggio sui branelli: 1x, Risospendere delicatamente, rimettere il supporto magnetico, attendere 1 minuto e scartare il surnatante. Ripetere questo passaggio 2 volte.</li>
		<li>Aggiungere 40 µ l di tampone di eluizione ai branelli magnetici, Miscelare pipettando su e giù e incubare a 37 ° C in un agitatore di tubo (950 giri/min) per 30 min.</li>
		<li>Posizionare i tubi in un supporto magnetico, attendere 1 minuto e raccogliere eluito campione (che è eluito - E). Posizionare sul ghiaccio e utilizzare per analisi a valle. Nota: In questa fase, ogni testata sonda RNA consiste di un flusso continuo (FT) e campione eluito (E).</li>
	</ol>
</li>
</ol>4. analisi della macchia occidentale e poliacrilammide elettroforesi
Nota: Vedere la tabella 2 per le ricette per i buffer utilizzati in questa sezione. Eseguire un Western blot secondo il metodo di Laemmli12.
<ol><li>Handcast 12% gel di SDS-PAGE (10-pozzi, spessore 1,5 mm., 66 µ l). Preparare una miscela di gel in esecuzione: 4 mL di soluzione madre di 30% acrilammide-bisacrylamide, 2,4 mL di Tris più basso del buffer, 3,2 mL di dH2O, 9,6 µ l di TEMED, 96 µ l di soluzione di 10% ammonio persolfato (APS). Preparare la miscela di gel di impilamento: 3,25 mL di dH2O, 0,5 mL di 30% acrilammide - soluzione bisacrylamide, 1,3 mL di tampone Tris superiore, 10 µ l di TEMED, 20 µ l di 10% di APS.</li>
	<li>Aggiungere 16,6 µ l di tampone x Laemmli 6 (ad esempio, 14 mL a pH 6.8 Tris/HCl/SDS (tampone Tris superiore), 2 g di SDS, 1,86 g di DTT, 6 mL di glicerolo e 0.012% bromofenolo; conservati a-20 ° C) nel campione FT e 6,6 µ l del 6 x Laemmli buffer nel campione E. Incubare i campioni per 5 min a 95 ° C.</li>
	<li>Caricare i campioni (20 µ l di FT e intera eluire ~ 40 µ l) ed eseguirli per 30 min a 60 V, continuando con 20 V durante la notte.</li>
	<li>Utilizzando un sistema semi-secco electroblotting, trasferire proteine su una membrana PVDF per 80 minuti a 15 V. Nota: La membrana PVDF deve essere attivata prima di eseguire il trasferimento di proteine. Incubare la membrana in metanolo al 100% per 1 min, seguita da un'incubazione di 2 min in acqua ultrapura.</li>
	<li>Dopo il trasferimento di proteine, incubare il gel di SDS-PAGE con Coomassie soluzione per 3 h, seguito da tre fasi di lavaggio con acqua ultrapura, ogni 30 min.</li>
	<li>Alla fine del trasferimento di proteina, lasciate la membrana PVDF asciugare per 1 h. riattivare la membrana come indicato al punto 4.5. Bloccare la membrana 1 h con 5% BSA in 1 x TTBS.</li>
	<li>Incubare la membrana con il primo anticorpo: HuR o mesotelina, entrambi diluiti 1: 1000 in 5% BSA in 1 x TTBS per 4 h a temperatura ambiente o durante la notte a 4 ° C.</li>
	<li>Lavare la membrana tre volte per 7 min in 1 x TTBS e incubare coniglio anti-topo alla perossidasi di rafano (HRP)-anticorpo secondario coniugato diluito 1: 10.000 in 5% BSA, 1 x TTBS.</li>
	<li>Visualizzare le proteine usando chemiluminescenza e un dispositivo di imaging digitale.</li>
</ol>

<ol>
	<li>Glisovic, T., Bachorik, J. L., Yong, J., Dreyfuss, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-binding+proteins+and+post-transcriptional+gene+regulation.">RNA-binding proteins and post-transcriptional gene regulation.</a> FEBS Letters. 582 (14), 1977-1986 (2008).</li><li>Mayr, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolution+and+biological+roles+of+alternative+3'UTRs.">Evolution and biological roles of alternative 3'UTRs.</a> Trends in Cell Biology. 26 (3), 227-237 (2016).</li><li>Matoulkova, E., Michalova, E., Vojtesek, B., Hrstka, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+the+3'+untranslated+region+in+post-transcriptional+regulation+of+protein+expression+in+mammalian+cells.">The role of the 3' untranslated region in post-transcriptional regulation of protein expression in mammalian cells.</a> RNA Biology. 9 (5), 563-576 (2012).</li><li>von Roretz, C., Di Marco, S., Mazroui, R., Gallouzi, I. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Turnover+of+AU-rich-containing+mRNAs+during+stress:+a+matter+of+survival.">Turnover of AU-rich-containing mRNAs during stress: a matter of survival.</a> Wiley Interdisciplinary Reviews: RNA. 2 (3), 336-347 (2011).</li><li>Fallmann, J., Sedlyarov, V., Tanzer, A., Kovarik, P., Hofacker, I. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=AREsite2:+An+enhanced+database+for+the+comprehensive+investigation+of+AU/GU/U-rich+elements.">AREsite2: An enhanced database for the comprehensive investigation of AU/GU/U-rich elements.</a> Nucleic Acids Research. 44, D90-D95 (2016).</li><li>Kresoja-Rakic, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Posttranscriptional+regulation+controls+calretinin+expression+in+malignant+pleural+mesothelioma.">Posttranscriptional regulation controls calretinin expression in malignant pleural mesothelioma.</a> Frontiers in Genetics. 8 (70), (2017).</li><li>Chu, C., Spitale, R. C., Chang, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Technologies+to+probe+functions+and+mechanisms+of+long+noncoding+RNAs.">Technologies to probe functions and mechanisms of long noncoding RNAs.</a> Nature Structural &amp; Molecular Biology. 22 (1), 29-35 (2015).</li><li>Diamandis, E. P., Christopoulos, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biotin-(strept)avidin+system:+principles+and+applications+in+biotechnology.">The biotin-(strept)avidin system: principles and applications in biotechnology.</a> Clinical Chemistry. 37 (5), 625-636 (1991).</li><li>Hirsch, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Easily+reversible+desthiobiotin+binding+to+streptavidin,+avidin,+and+other+biotin-binding+proteins:+Uses+for+protein+labeling,+detection,+and+isolation.">Easily reversible desthiobiotin binding to streptavidin, avidin, and other biotin-binding proteins: Uses for protein labeling, detection, and isolation.</a> Analytical Biochemistry. 308 (2), 343-357 (2002).</li><li>. Magnetic bead technology for better assay development Available from: <a target="_blank" href="https://assets.thermofisher.com/TFS-Assets/LSG/brochures/1602577-Magnetic-Bead-Technology-Brochure.pdf">https://assets.thermofisher.com/TFS-Assets/LSG/brochures/1602577-Magnetic-Bead-Technology-Brochure.pdf</a> (2013)</li><li>Usami, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+and+characterization+of+four+malignant+pleural+mesothelioma+cell+lines+from+Japanese+patients.">Establishment and characterization of four malignant pleural mesothelioma cell lines from Japanese patients.</a> Cancer Science. 97 (5), 387-394 (2006).</li><li>Laemmli, U. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cleavage+of+structural+proteins+during+the+assembly+of+the+head+of+bacteriophage+T4.">Cleavage of structural proteins during the assembly of the head of bacteriophage T4.</a> Nature. 227 (5259), 680-685 (1970).</li><li>Coulson, R. M., Cleveland, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ferritin+synthesis+is+controlled+by+iron-dependent+translational+derepression+and+by+changes+in+synthesis/transport+of+nuclear+ferritin+RNAs.">Ferritin synthesis is controlled by iron-dependent translational derepression and by changes in synthesis/transport of nuclear ferritin RNAs.</a> Proceedings of the National Academy of Sciences of the United States of America. 90 (16), 7613-7617 (1993).</li><li>Leibold, E. A., Munro, H. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytoplasmic+protein+binds+in+vitro+to+a+highly+conserved+sequence+in+the+5'+untranslated+region+of+ferritin+heavy-+and+light-subunit+mRNAs.">Cytoplasmic protein binds in vitro to a highly conserved sequence in the 5' untranslated region of ferritin heavy- and light-subunit mRNAs.</a> Proceedings of the National Academy of Sciences of the United States of America. 85 (7), 2171-2175 (1988).</li><li>Srikantan, S., Gorospe, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HuR+function+in+disease.">HuR function in disease.</a> Frontiers in Bioscience (Landmark Edition). 17, 189-205 (2012).</li><li>Morris, K. V., Mattick, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+rise+of+regulatory+RNA.">The rise of regulatory RNA.</a> Nature Reviews: Genetics. 15 (6), 423-437 (2014).</li><li>Rinn, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+demarcation+of+active+and+silent+chromatin+domains+in+human+HOX+loci+by+noncoding+RNAs.">Functional demarcation of active and silent chromatin domains in human HOX loci by noncoding RNAs.</a> Cell. 129 (7), 1311-1323 (2007).</li><li>Zhao, J., Sun, B. K., Erwin, J. A., Song, J. J., Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polycomb+proteins+targeted+by+a+short+repeat+RNA+to+the+mouse+X+chromosome.">Polycomb proteins targeted by a short repeat RNA to the mouse X chromosome.</a> Science. 322 (5902), 750-756 (2008).</li><li>McHugh, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Xist+lncRNA+interacts+directly+with+SHARP+to+silence+transcription+through+HDAC3.">The Xist lncRNA interacts directly with SHARP to silence transcription through HDAC3.</a> Nature. 521 (7551), 232-236 (2015).</li></ol>

Gli autori dichiarano di non avere nessun concorrenti interessi finanziari.

3' UTR appartengono al genoma non codificante3e tutti gli RNA non codificanti possa interagire con proteine al fine di esercitare la loro funzione7. Quando il genoma dei mammiferi è stato trovato per essere trascritto pervasively e prodotto una porzione significativa di lunghi non codificanti RNA16, emergenti evidenze hanno dimostrato che questi RNA non codificante lungo funzionano nella regolazione dell'espressione genica come essi interagiscono con complessi di rimodellamento della cromatina17. Questa conoscenza è stata acquisita utilizzando l'analisi di RNA-pulldown. Così, per iniziare a decifrare gli Interactiani di un RNA specifico, il primo passo potrebbe essere saggi biochimici in vitro come RNA-pulldown, come è semplice da eseguire.
Di nota, non solo motivi di sequenza, ma anche la struttura secondaria del RNA svolge un ruolo critico nella funzionalità di RNA come formano domini essenziali per l'interazione con le proteine. La struttura secondaria può variare in fisiologico e condizioni in vitro e RNA-pulldown possono condurre all'identificazione di falsepositives. Ad esempio, RNA-pulldown identificato EZH2, un componente di polycomb repressive complex 2 (PRC2), come un interactor di X inattivo trascrizione specifici (Xist)18, considerando che un recente studio che ha usato purificazione del RNA antisenso con massa la spettrometria (RAP-MS) identificato altri Interactiani come SHARP (SMRT e HDAC associata proteina repressore), SAF-1 (fattore di fissaggio ponteggio A) e LBR (recettore lamin B)19. Pertanto, se nessun altro test funzionale supporta l'interazione tra un RNA e una data proteina, i risultati dovrebbero essere ulteriormente completati con un approccio basato su proteina complementare, quali immunoprecipitating la proteina data, seguita da estrazione e caratterizzazione del RNA associato.
Il presente protocollo presentato è stato utilizzato per rilevare HuR associazione al motivo sono in CALB2 3' UTR, che precedentemente era stato funzionalmente caratterizzato da pmiRGLO-luciferase assay6. A causa della piccola quantità di proteine, questo protocollo non è adatto per l'analisi a valle come la spettrometria di massa dove sono necessarie grandi quantità di proteine. Invece, il protocollo utilizzabile per riconvalidare il RNA-interattori identificati mediante spettrometria di massa, ma utilizzando una quantità significativamente inferiore di proteine.
Poiché il metodo include il lavoro con RNA, che è suscettibile di degradazione, si consiglia di pulire le superfici di lavoro con una soluzione di decontaminazione di RNAsi oltre alle buone prassi di laboratorio standard. Se possibile, eseguire la preparazione di RNA di etichettatura e di purificazione sotto flusso laminare. La purezza dell'oligo RNA può anche influenzare le condizioni di associazione; così, le sonde commercialmente sintetizzate erano HPLC purificato. Se modificato, più a lungo ed estremamente puro RNA oligos sono necessari, utilizzare il metodo di purificazione di pagina. Preparare aliquote di proteine native da congelamento, evitando così danni delle proteine a causa del metodo di congelamento lento e ripetuti di congelamento e di scongelamento a scatto.

Espressione genica e il livello finale del prodotto del gene può essere strettamente regolate che interessano la stabilità del mRNA e mRNA traduzione tasso1. Questi meccanismi di regolazione post-trascrizionali sono esercitati attraverso le interazioni di non codificanti proteine RNA e/o RNA-binding (RBPs) con mRNA mirati. È solitamente la regione non tradotta 3' del mRNA (3' UTR - appartenendo alla parte non codificante del genoma2) che contiene specifiche cis-elementi regolatori (CRE), che sono riconosciuti da trans-in qualità di fattori quali miRNA o RBPs 3. la migliore studiati cis-elemento all'interno di 3' UTR, è il motivo di elemento ricco di adenina (ARE), che è riconosciuto da specifiche proteine che legano il AU (AUBP) e, a sua volta, induce la degradazione sia mRNA/deadenylation (decadimento sono-mediata) o mRNA stabilizzazione4.
La dimensione del 3' UTR di calretinina mRNA (CALB2) è 573 bp lungo e contiene un pentamero AUUUA putativo, come predetto da AREsite2, un tool di bioinformatic5. Coerente con la presenza di un motivo sono presunto, l'analisi di vettore-reporter di pmirGLO ha dimostrato un ruolo di stabilizzazione di questo elemento all'interno di mRNA di CALB26. Infine, l' in vitro RNA-pulldown è stato utilizzato per identificare il AUBP che stabilizza calretinina mRNA attraverso il motivo sono.
Poiché tutti gli RNA non codificanti interagisce con proteine7, lo in vitro RNA-pulldown è un buon modo e analisi prima della scelta per l'identificazione di interattori di RNA per aiutare a decifrare i meccanismi molecolari. In questo metodo di RNA-pulldown, commercialmente sintetizzato le sonde del RNA, che sono state etichettate con una forma modificata di biotina (desthiobiotin) all'estremità 3' del filamento di RNA, sono state utilizzate. il RNA-desthiobiotin è immobilizzato tramite interazione con streptavidina su biglie magnetiche, che vengono utilizzati per abbattere le proteine che interagiscono specificamente con l'associazione-RNA di interesse. Proteine non denaturate e attive da frazione citosolica delle cellule di mesotelioma sono utilizzate come fonte di proteine. Tali RNA-proteine vengono eluite dai branelli magnetici, eseguire attraverso un gel di SDS-PAGE 12%, trasferito ad una membrana e sondato con anticorpi differenti.
Nella procedura di purificazione di affinità standard streptavidina-biotina, denaturazione dura condizioni sono necessarie per interrompere il legame biotina-streptavidina irreversibile forte per eluire le proteine rilegate8, che potrebbe portare alla dissociazione di complessi proteici. A differenza di biotina, desthiobiotin reversibilmente si lega alla streptavidina e competitivo è spostata con una soluzione tamponata di biotina, consentendo per la delicata eluizione delle proteine ed evitando l'isolamento di naturalmente biotinilati molecole9, suggerendo che la tecnica è ideale per isolare i complessi della proteina nativa in condizioni native.
In vitro condizioni vincolanti e rigore, che sono determinate dalla concentrazione salina, agenti riducenti e percentuale di detergente, dovrebbe essere vicine a quelle presenti nel contesto del cellulare al fine di identificare le interazioni vere in vivo . Le condizioni di associazione implementate nel presente documento sono state dimostrate in precedenza come appropriato per l'identificazione del HuR come un AU-binding protein10. Questo approccio potrebbe risparmiare tempo, poiché l'ottimizzazione delle condizioni di associazione corretto può essere lungo e impegnativo. Inoltre, questo metodo potrebbe essere usato come un protocollo di partenza per qualsiasi esperimento di RNA-pulldown e può essere ottimizzato gradualmente cambiando la concentrazione di sali e detergenti, modificando la percentuale di glicerolo, e aggiungendo altri sali. Inoltre, abbiamo dimostrato che anche una breve 25 nucleotidi RNA-sonda che harboring un pentamero sono-motivo poteva essere utilizzato per dimostrare l'interazione con un AUBP specifico.

<table><tbody><tr><td>NE-PER Nuclear and cytoplasmic extraction kit</td><td>Thermo Fisher Scientific&amp;nbsp;</td><td>78833</td><td></td></tr><tr><td>Pierce Protease Inhibitor Tablets, EDTA-free</td><td>Thermo Fisher Scientific</td><td>A32965</td><td></td></tr><tr><td>Pierce BCA Protein Assay Kit</td><td>Thermo Fisher Scientific</td><td>23225</td><td></td></tr><tr><td>Pierce Magnetic RNA-protein Pull-Down Kit&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>20164</td><td>Includes magnetic beads and therefore the kit need to be stored at 4 &amp;deg;C</td></tr><tr><td>Pierce RNA 3&amp;rsquo; End Desthiobiotinylation Kit&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>20163</td><td>The kit is a part of the &quot;Pierce Magnetic RNA-protein Pull-Down Kit&quot;, and needs to be stored at -20 &amp;deg;C unlike the pull-down kit (4 &amp;deg;C).</td></tr><tr><td>DynaMag-2,&amp;nbsp; magnetic stand</td><td>Thermo Fisher Scientific</td><td>12321D</td><td></td></tr><tr><td>Anti - HuR (MOUSE) monoclonal antibody</td><td>Thermo Fisher Scientific</td><td>-</td><td>The antibody is included in the Pierce Magnetic RNA-protein Pull-Down Kit&amp;nbsp; - 1:1000 in 5% BSA 1x TTBS - rabbit anti-mouse secondary antibody 1:10,000 in 5% BSA 1x TTBS</td></tr><tr><td>Anti - &amp;alpha; - tubulin (MOUSE) monoclonal antibody</td><td>Santa Cruz</td><td>8035</td><td>1:1000 in 5% BSA 1x TTBS - rabbit anti-mouse secondary antibody 1:10,000 in 5% BSA 1x TTBS</td></tr><tr><td>Anti - PARP (RABBIT) Polyclonal antibody</td><td>Cell Signaling</td><td>9542</td><td>1:1000 in 5% BSA 1x TTBS - goat anti-rabbit secondary antibody 1:10,000 in 5% BSA 1x TTBS</td></tr><tr><td>Anti - Mesothelin (MOUSE) Monoclonal Antibody&amp;nbsp;</td><td>Rockland</td><td>200-301-A87</td><td></td></tr><tr><td>Secondary goat anti-rabbit antibody</td><td>Cell Signaling</td><td>7074</td><td></td></tr><tr><td>Secondary rabbit anti-mouse antibody</td><td>Sigma-Aldrich</td><td>A-9044</td><td></td></tr><tr><td>RPMI - 1640 medium</td><td>Sigma-Aldrich</td><td>R8758</td><td></td></tr><tr><td>FBS - Filtrated Bovine Serum</td><td>Pan Biotech&amp;nbsp;</td><td>P40-37500</td><td></td></tr><tr><td>Penicillin - streptomycin (100x)</td><td>Sigma-Aldrich&amp;nbsp;</td><td>P4333</td><td></td></tr><tr><td>L-Glutamine solution (200 mM)</td><td>Sigma-Aldrich&amp;nbsp;</td><td>G7513</td><td></td></tr><tr><td>0.25% Trypsin-EDTA (1x)</td><td>Gibco by Life technologies&amp;nbsp;</td><td>25200-056</td><td></td></tr><tr><td>Mini-PROTEAN 3 Cell</td><td>Bio-Rad</td><td>1653301</td><td></td></tr><tr><td>Mini Protean System Glass Plates&amp;nbsp;</td><td>Bio-Rad</td><td>1653308</td><td></td></tr><tr><td>Mini-PROTEAN Spacer Plates with 1.5 mm integrated spacer</td><td>Bio-Rad</td><td>1653312</td><td></td></tr><tr><td>Mini-PROTEAN Comb, 10-well, 1.5 mm, 66 &amp;micro;L</td><td>Bio-Rad</td><td>1653365</td><td></td></tr><tr><td>Mini-PROTEAN Tetra Cell Casting Modules</td><td>Bio-Rad</td><td>1658050</td><td></td></tr><tr><td>RNaseZap RNase Decontamination Solution</td><td>Thermo Fisher Scientific</td><td>AM9780</td><td></td></tr><tr><td>Rotiphorese gel 30 - aqueous 30% acrylamide and bisacrylamide stock solution at a ration of 37.5:1</td><td>Roth</td><td>3029</td><td></td></tr><tr><td>20% SDS&amp;nbsp;</td><td>PanReac AppliChem</td><td>A3942</td><td></td></tr><tr><td>PVDF transfer membrane&amp;nbsp;</td><td>Perkin Elmer</td><td>NEF1002</td><td>Need to be activated by incubating in pure methanol for 1 min followed by washing in water for 2 min&amp;nbsp;</td></tr><tr><td>Trans-Blot SD semi-dry transfer cell&amp;nbsp;</td><td>Bio-Rad</td><td>1703940</td><td></td></tr><tr><td>Clarity Western ECL Substrate</td><td>Bio-Rad</td><td>1705061</td><td></td></tr><tr><td>FusionFX&amp;nbsp; Digital Imager</td><td>Vilber</td><td>-</td><td></td></tr><tr><td>RNA oligo synthesis</td><td>Mycrosynth AG, Switzerland</td><td>-</td><td>the synthesis scale - 0.04 &amp;micro;mol - HPLC purified</td></tr><tr><td>Bovine serum albumin</td><td>Sigma-Aldrich</td><td>A7030</td><td></td></tr><tr><td>Hydrochloric Acid (HCl) 6 M</td><td>PanReac AppliChem</td><td>182883.1211</td><td></td></tr><tr><td>Ultra Pure 1 M Tris, pH 7.5&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>15567027</td><td></td></tr><tr><td>Glycerol&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>17904</td><td>50% sterile aliquots to be stored at -20&amp;deg;C</td></tr><tr><td>Pierce Streptavidin magnetic beads&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>88817</td><td>Please note that these magnetic beads have an average diameter of 1 &amp;micro;m (range from 0.5 - 1.5 &amp;micro;m). Furthermore, Dynabeads-M280 Streptavidin, which are beads of homogenouse size 2.8 &amp;micro;m, are also used in RNA-pulldown but be aware that this may affect purification process.</td></tr><tr><td>TEMED</td><td>Sigma-Aldrich</td><td>T9281</td><td></td></tr><tr><td>Ammonium persulfate&amp;nbsp;</td><td>Sigma-Aldrich</td><td>A3678</td><td></td></tr><tr><td>Coomassie G-250</td><td>Applichem</td><td>A3480</td><td></td></tr><tr><td>Aluminiumsulfate-(14-18)-hydrate&amp;nbsp;</td><td>Sigma-Aldrich</td><td>368458</td><td></td></tr><tr><td>ortho-phosphoric acid&amp;nbsp;</td><td>Applichem</td><td>A0637</td><td></td></tr></tbody></table>

desthiobiotin-streptavidin-affinity mediated purification of rna-interacting proteins in mesothelioma cells

Lo in vitro RNA-pulldown è ancora largamente utilizzato nei primi passi di protocolli volti ad identificare RNA-binding proteins che riconoscere specifici RNA strutture e motivi. In questo protocollo RNA-pulldown, commercialmente sintetizzato le sonde del RNA sono etichettate con una forma modificata di biotina, desthiobiotin, all'estremità 3' del filamento di RNA, che si lega reversibilmente al streptavidina e permette così di eluizione delle proteine sotto più fisiologico condizioni. il RNA-desthiobiotin è immobilizzato tramite interazione con streptavidina su biglie magnetiche, che vengono utilizzati per abbattere le proteine che interagiscono specificamente con il RNA di interesse. Proteine non denaturate e attive da frazione citosolica delle cellule di mesotelioma sono utilizzate come fonte di proteine. Il metodo qui descritto può essere applicato per rilevare l'interazione tra proteine RNA associazione di note e una sonda 25 nucleotidi (nt) lunga RNA contenente una sequenza di interesse. Questo è utile per completare la caratterizzazione funzionale di stabilizzare o destabilizzare gli elementi presenti nelle molecole di RNA ottenute utilizzando un'analisi di vettore reporter.

In questo esperimento, un frammento lungo 25-nt di calretinin 3' UTR harboring sono motivo (CALB2 3' UTR (ARE) 25-nt) è stato utilizzato per verificare se si lega specificamente alla proteina umana-antigene R (HuR), un noto stabilizzatore di mRNA. Per verificare la specificità dell'elemento sono, un RNA 25-nt sonda CALB2 3' UTR (mtARE) contenente una mutazione sono-motivo, che precedentemente è stata indicata ad abolire l'effetto di stabilizzazione del motivo sono, era usato6. il RNA terzo sonda rappresenta il controllo negativo, che è un 28-nt estranei RNA che contiene l'elemento ferro-reattivo ben definito (non correlati RNA (IRE)), conosciuto per legare la proteina ferro-reattiva citosolica13,14. Poiché HuR è prevalentemente localizzata all'interno del nucleo ma funzioni come mRNA-stabilizzatore nel cytosol15, estrazione citosolica/nucleare è stato effettuato per ottenere proteine attive dal cytosol.
Per dimostrare la purezza delle frazioni citosolica/nucleare, proteine sono state analizzate mediante Western blot, che ha mostrato che quello α-tubulina è stato rilevato solo nella frazione citosolica, mentre la proteina PARP è stata rilevata solo nella frazione nucleare, come anticipato ( Figura 1). L'eluato dal CALB2 3' UTR sono-sonda hanno dimostrato associazione di HuR mentre HuR era assente nell'eluito dal mutante sonda CALB 3' UTR (mtARE). HuR era anche assente nell'eluito dalla sonda RNA estraneo che lega la proteina ferro-sensible a reagire (Figura 2A). Per illustrare ulteriormente la specificità tra la CALB 3' UTR (ARE) e HuR, la membrana è stata inoltre sondata con anticorpo anti-mesotelina (MSLN), come questa proteina non interagire con il RNA. Eluati da tutti e tre i campioni hanno mostrato nessuna presenza di mesotelina. Presi insieme, questo indica che lo stabilizzazione sono motivo all'interno di CALB2 3' UTR può legano specificamente HuR proteina.
Coomassie macchiatura del gel (Figura 2B) dimostra che uguali quantità di proteine sono stati utilizzati per incubare con le tre diverse sonde di RNA. A causa della bassa quantità di Estratto citosolico utilizzato e trasferimento alla membrana, questa colorazione non ha consentito per la rilevazione delle proteine nell'eluito corsie (E), che altrimenti sono state rilevate dall'analisi Western blot.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57516/57516fig1.jpg"> Figura 1: analisi di Western blot di 5 µ g di proteine citosoliche e nucleari. La proteina PARP è presente nella frazione nucleare (N), ma assente dalla frazione citosolica (C). Α-tubulina è presente nella frazione citosolica (C), ma assente nella frazione nucleare (N). <a href="/files/ftp_upload/57516/57516fig1large.jpg" target="_blank">Clicca qui per visualizzare una versione più grande di questa figura.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57516/57516fig2.jpg"> Figura 2: Western blot viene illustrato che HuR è catturato da 25-nt CALB2 3' UTR (ARE). A) FT: fluire attraverso dopo incubazione con sonda RNA; E: proteine eluite sopra incubazione e sonde di legame al RNA. Sonde: CALB2 3' UTR (mtARE) - frammento 25-nt di calretinin 3' UTR che contiene 3 nucleotidi mutati all'interno del motivo sono; UR RNA (IRE) - sonda RNA 28-nt con un ben definito elemento ferro-sensible a reagire che lega le proteine ferro-sensible a reagire. La membrana è stata ulteriormente sondata per mesotelina (MSLN), una proteina che non interagisce con RNA. B) sonde di Coomassie macchiatura del gel dopo il trasferimento della proteina, dimostrando che la stessa quantità di proteine sono state incubate con RNA. <a href="/files/ftp_upload/57516/57516fig2large.jpg" target="_blank">Clicca qui per visualizzare una versione più grande di questa figura.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Sonda del RNA</td>
			<td>Sequenza</td>
			<td>Concentrazione</td>
		</tr>
<tr>
<td>CALB2 3' UTR (ARE) 25nt</td>
			<td>UCGCUGUAUGAUUUAGGCUUCUAUG</td>
			<td>10 ΜM</td>
		</tr>
<tr>
<td>CALB2 3' UTR (mtARE) 25nt</td>
			<td>UCGCUGUAUGGUCUGGGCUUCUAUG</td>
			<td>10 ΜM</td>
		</tr>
<tr>
<td>Indipendenti di RNA - IRE 28nt</td>
			<td>UCCUGCUUCAACAGUGCUUGGACGGAAC</td>
			<td>10 ΜM</td>
		</tr>
</tbody></table>Tabella 1 : Sonde di sequenze di RNA
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Tampone Tris inferiore per l'esecuzione di gel</td>
			<td></td>
		</tr>
<tr>
<td>1.5 M</td>
			<td>Tris Base</td>
		</tr>
<tr>
<td>0,40%</td>
			<td>Soluzione di SDS</td>
		</tr>
<tr>
<td>addjust pH a 8,8 utilizzando HCL (6 mol/L)</td>
			<td></td>
		</tr>
<tr>
<td>riempire con</td>
			<td>dH2O</td>
		</tr>
<tr>
<td>Tris superiore per l'impilamento del gel SDS-PAGE</td>
			<td></td>
		</tr>
<tr>
<td>500 mM</td>
			<td>Tris base</td>
		</tr>
<tr>
<td>0,4%</td>
			<td>Soluzione di SDS</td>
		</tr>
<tr>
<td>Aggiustare il pH a 6,8 utilizzando HCL (6 mol/L)</td>
			<td></td>
		</tr>
<tr>
<td>riempire con</td>
			<td>dH2O</td>
		</tr>
<tr>
<td>10 x Running buffer</td>
			<td></td>
		</tr>
<tr>
<td>250 mM</td>
			<td>Tris base</td>
		</tr>
<tr>
<td>1,92 M</td>
			<td>Glicina</td>
		</tr>
<tr>
<td>Regolare il pH a 8,3 utilizzando HCL (6 mol/L)</td>
			<td></td>
		</tr>
<tr>
<td>riempire con</td>
			<td>dH2O</td>
		</tr>
<tr>
<td>Filtro o autoclave e conservare a 4° C</td>
			<td></td>
		</tr>
<tr>
<td>1 tampone di X in esecuzione</td>
			<td></td>
		</tr>
<tr>
<td>100 mL</td>
			<td>10 x Running buffer</td>
		</tr>
<tr>
<td>0.05%</td>
			<td>Soluzione di SDS</td>
		</tr>
<tr>
<td>Riempire fino a 1 L con</td>
			<td>dH2O</td>
		</tr>
<tr>
<td>10X tampone di trasferimento</td>
			<td></td>
		</tr>
<tr>
<td>480 mM</td>
			<td>Tris base</td>
		</tr>
<tr>
<td>390 mM</td>
			<td>Glicina</td>
		</tr>
<tr>
<td>0,38%</td>
			<td>Soluzione di SDS</td>
		</tr>
<tr>
<td>riempire con</td>
			<td>dH2O</td>
		</tr>
<tr>
<td>Nota: Filtro 0.22 um e conservare a 4 ° C</td>
			<td></td>
		</tr>
<tr>
<td>1 X trasferimento buffer (per sistema semi-secco)</td>
			<td></td>
		</tr>
<tr>
<td>20 mL</td>
			<td>10X tampone di trasferimento</td>
		</tr>
<tr>
<td>40 mL</td>
			<td>metanolo</td>
		</tr>
<tr>
<td>riempire fino a 200 mL</td>
			<td>dH20</td>
		</tr>
<tr>
<td>10 X TBS (soluzione fisiologica tamponata)</td>
			<td></td>
		</tr>
<tr>
<td>250 mM</td>
			<td>Tris base</td>
		</tr>
<tr>
<td>1.36 M</td>
			<td>NaCl</td>
		</tr>
<tr>
<td>27 mM</td>
			<td>KCl</td>
		</tr>
<tr>
<td>Regolare il pH a 7,4</td>
			<td></td>
		</tr>
<tr>
<td>riempire con</td>
			<td>dH2O</td>
		</tr>
<tr>
<td>Filtro</td>
			<td></td>
		</tr>
<tr>
<td>1 X Immunotyping (soluzione salina tampone Tris con 0.1 Tween-20)</td>
			<td></td>
		</tr>
<tr>
<td>1 X</td>
			<td>10 X TBS</td>
		</tr>
<tr>
<td>0,10%</td>
			<td>Tween-20</td>
		</tr>
<tr>
<td>riempire con</td>
			<td>dH2O</td>
		</tr>
<tr>
<td>Buffer di acquisizione di RNA (1 X)</td>
			<td></td>
		</tr>
<tr>
<td>20 mM</td>
			<td>Tris (pH 7,5)</td>
		</tr>
<tr>
<td>2.</td>
			<td>NaCl</td>
		</tr>
<tr>
<td>1 mM</td>
			<td>EDTA</td>
		</tr>
<tr>
<td>Proteina-RNA Binding Buffer (10x)</td>
			<td></td>
		</tr>
<tr>
<td>200 mM</td>
			<td>Tris (pH 7,5)</td>
		</tr>
<tr>
<td>500 mM</td>
			<td>NaCl</td>
		</tr>
<tr>
<td>20 mM</td>
			<td>MgCl2</td>
		</tr>
<tr>
<td>1%</td>
			<td>Tween-20</td>
		</tr>
<tr>
<td>Tampone di lavaggio (1x)</td>
			<td></td>
		</tr>
<tr>
<td>20 mM</td>
			<td>Tris (pH 7,5)</td>
		</tr>
<tr>
<td>10 mM</td>
			<td>NaCl</td>
		</tr>
<tr>
<td>0,1%</td>
			<td>Tween-20</td>
		</tr>
<tr>
<td>Tampone di eluizione</td>
			<td></td>
		</tr>
<tr>
<td>4 mM</td>
			<td>biotina</td>
		</tr>
<tr>
<td>20 mM</td>
			<td>Tris (pH 7,5)</td>
		</tr>
<tr>
<td>50 mM</td>
			<td>NaCl</td>
		</tr>
<tr>
<td>Soluzione di Coomassie</td>
			<td></td>
		</tr>
<tr>
<td>0,02%</td>
			<td>G-250 di Coomassie</td>
		</tr>
<tr>
<td>5%</td>
			<td>Aluminiumsulfate-(14-18)-idrato</td>
		</tr>
<tr>
<td>10%</td>
			<td>EtOH</td>
		</tr>
<tr>
<td>2%</td>
			<td>acido ortofosforico</td>
		</tr>
</tbody></table>Tabella 2: Ricette

Watch this Scientific Journal Video about Desthiobiotin-Streptavidin-Affinity Mediated Purification of RNA-Interacting Proteins in Mesothelioma Cells at JoVE.com

Desthiobiotin-Streptavidin-Affinity Mediated Purification of RNA-Interacting Proteins in Mesothelioma Cells

Desthiobiotin-streptavidina-affinità mediata purificazione delle proteine che interagiscono con RNA nelle cellule di mesotelioma

Desthiobiotin etichettatura di un sintetico oligo RNA 25 nucleotidi, che contiene un motivo di elemento ricco di adenina (ARE), permette di grippaggio specifico di proteina citosolica sono vincolanti.

The in vitro RNA-pulldown is still largely used in the first steps of protocols aimed at identifying RNA-binding proteins that recognize specific RNA ...

desthiobiotin-streptavidin-affinity-mediated-purification-rna

Nanyang Technological University

Research

JoVE Journal

Cancer Research

7.9K Views.  University Hospital Zurich. Desthiobiotin etichettatura di un sintetico oligo RNA 25 nucleotidi, che contiene un motivo di elemento ricco di adenina (ARE), permette di grippaggio specifico di proteina citosolica sono vincolanti.

Video: Desthiobiotin-Streptavidin-Affinity Mediated Purification of RNA-Interacting Proteins in Mesothelioma Cells

Novel RNA-Binding Proteins Isolation by the RaPID Methodology

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern biology. Only a few in vitro and in vivo methods enable the identification of RBPs associated with a particular target mRNA. However, their main limitations are the identification of RBPs in a non-cellular environment (in vitro) or the low efficiency isolation of RNA of interest (in vivo). An RNA-binding protein purification and identification (RaPID) methodology was designed to overcome these limitations in yeast and enable efficient isolation of proteins that are associated in vivo. To achieve this, the RNA of interest is tagged with MS2 loops, and co-expressed with a fusion protein of an MS2-binding protein and a streptavidin-binding protein (SBP). Cells are then subjected to crosslinking and lysed, and complexes are isolated through streptavidin beads. The proteins that co-purify with the tagged RNA can then be determined by mass spectrometry. We recently used this protocol to identify novel proteins associated with the ER-associated PMP1 mRNA. Here, we provide a detailed protocol of RaPID, and discuss some of its limitations and advantages.

RNA-protein interactions lie at the heart of many cellular processes. Here, we describe an in vivo method to isolate specific RNA and identify novel proteins that are associated with it. This could shed new light on how RNAs are regulated in the cell.

Novel RNA-Proteine ​​leganti isolamento dalla rapida Metodologia

RNA-binding proteins (RBPs) play important roles in every aspect of RNA metabolism and regulation. Their identification is a major challenge in modern ...

Ricerca

Genetica

Biotin-based Pulldown Assay to Validate mRNA Targets of Cellular miRNAs

MicroRNAs (miRNAs) are a class of small noncoding RNAs that post-transcriptionally regulate cellular gene expression. MiRNAs bind to the 3&#39; untranslated region (UTR) of target mRNA to inhibit protein translation or in some instances cause mRNA degradation. The binding of the miRNA to the 3&#39; UTR of the target mRNA is mediated by a 2&#8211;8 nucleotide seed sequence at the 5&#39; end of miRNA. While the role of miRNAs as cellular regulatory molecules is well established, identification of the target mRNAs with functional relevance remains a challenge. Bioinformatic tools have been employed to predict sequences within the 3&#39; UTR of mRNAs as potential targets for miRNA binding. These tools have also been utilized to determine the evolutionary conservation of such sequences among related species in an attempt to predict functional role. However, these computational methods often generate false positive results and are limited to predicting canonical interaction between miRNA and mRNA. Therefore, experimental procedures that measure direct binding of miRNA to its mRNA target are necessary to establish functional interaction. In this report, we describe a sensitive method for validating direct interaction between the cellular miRNA miR-125b and the 3&#39; UTR of PARP-1 mRNA. We elaborate a protocol in which synthetic biotinylated-miRNA mimics were transfected into mammalian cells and the miRNA-mRNA complex in the cellular lysate was pulled down with streptavidin-coated magnetic beads. Finally, the target mRNA in the pulled-down nucleic acid complex was quantified using a qPCR-based strategy.

This report describes a fast and reliable method for validating mRNA targets of cellular miRNAs. The method uses synthetic biotinylated Locked Nucleic Acid (LNA)-based miRNA mimics to capture target mRNA. Subsequently, streptavidin-coated magnetic beads are employed to pulldown the target mRNA for quantification by qPCR polymerase chain reaction.

Biotina-based Pulldown Assay Validate mRNA Mirna obiettivi del cellulare

MicroRNAs (miRNAs) are a class of small noncoding RNAs that post-transcriptionally regulate cellular gene expression. MiRNAs bind to the 3&#39; ...

An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes

RNA-binding proteins (RBPs) play key roles in the post-transcriptional control of gene expression. Therefore, biochemical characterization of mRNA-protein complexes is essential to understanding mRNA regulation inferred by interacting proteins or non-coding RNAs. Herein, we describe a tandem RNA isolation procedure (TRIP) that enables the purification of endogenously formed mRNA-protein complexes from cellular extracts. The two-step protocol involves the isolation of polyadenylated mRNAs with antisense oligo(dT) beads and subsequent capture of an mRNA of interest with 3&#39;-biotinylated 2&#39;-O-methylated antisense RNA oligonucleotides, which can then be isolated with streptavidin beads. TRIP was used to recover in vivo crosslinked mRNA-ribonucleoprotein (mRNP) complexes from yeast, nematodes and human cells for further RNA and protein analysis. Thus, TRIP is a versatile approach that can be adapted to all types of polyadenylated RNAs across organisms to study the dynamic re-arrangement of mRNPs imposed by intracellular or environmental cues.

A tandem RNA isolation procedure (TRIP) for recovery of endogenously formed mRNA-protein complexes is described. Specifically, RNA-protein complexes are crosslinked in vivo, polyadenylated RNAs are isolated from extracts with oligo(dT) beads, and particular mRNAs are captured with modified RNA antisense oligonucleotides. Proteins bound to mRNAs are detected by immunoblot analysis.

Una procedura di isolamento del RNA basati su Oligonucleotide Tandem recuperare mRNA-proteina eucariotica complessi

RNA-binding proteins (RBPs) play key roles in the post-transcriptional control of gene expression. Therefore, biochemical characterization of mRNA-protein ...

Biochimica

In Vitro Biochemical Assays using Biotin Labels to Study Protein-Nucleic Acid Interactions

Protein-nucleic acid interactions play important roles in biological processes such as transcription, recombination, and RNA metabolism. Experimental methods to study protein-nucleic acid interactions require the use of fluorescent tags, radioactive isotopes, or other labels to detect and analyze specific target molecules. Biotin, a non-radioactive nucleic acid label, is commonly used in electrophoretic mobility shift assays (EMSA) but has not been regularly employed to monitor protein activity during nucleic acid processes. This protocol illustrates the utility of biotin labeling during in vitro enzymatic reactions, demonstrating that this label works well with a range of different biochemical assays. Specifically, in alignment with previous findings using radioisotope 32P-labeled substrates, it is confirmed via biotin-labeled EMSA that MEIOB (a protein specifically involved in the meiotic recombination) is a DNA-binding protein, that MOV10 (an RNA helicase) resolves biotin-labeled RNA duplex structures, and that MEIOB cleaves biotin-labeled single-stranded DNA. This study demonstrates that biotin is capable of substituting 32P in various nucleic acid-related biochemical assays in vitro.&#160;

Presented here are protocols for in vitro biochemical assays using biotin labels that may be widely&#160;applicable for studying protein-nucleic acid interactions.

Analisi biochimiche in Vitro che utilizzano etichette di biotina per studiare le interazioni proteina-nucleica dell'acido

Protein-nucleic acid interactions play important roles in biological processes such as transcription, recombination, and RNA metabolism. Experimental ...

Single-step Purification of Macromolecular Complexes Using RNA Attached to Biotin and a Photo-cleavable Linker

For many years, the exceptionally strong and rapidly formed interaction between biotin and streptavidin has been successfully utilized for partial purification of biologically important RNA/protein complexes. However, this strategy suffers from one major disadvantage that limits its broader utilization: the biotin/streptavidin interaction can be broken only under denaturing conditions that also disrupt the integrity of the eluted complexes, hence precluding their subsequent functional analysis and/or further purification by other methods. In addition, the eluted samples are frequently contaminated with the background proteins that nonspecifically associate with streptavidin beads, complicating the analysis of the purified complexes by silver staining and mass spectrometry. To overcome these limitations, we developed a variant of the biotin/streptavidin strategy in which biotin is attached to an RNA substrate via a photo-cleavable linker and the complexes immobilized on streptavidin beads are selectively eluted to solution in a native form by long wave UV, leaving the background proteins on the beads. Shorter RNA binding substrates can be synthesized chemically with biotin and the photo-cleavable linker covalently attached to the 5&#39; end of the RNA, whereas longer RNA substrates can be provided with the two groups by a complementary oligonucleotide. These two variants of the UV-elution method were tested for purification of the U7 snRNP-dependent processing complexes that cleave histone pre-mRNAs at the 3&#39; end and they both proved to compare favorably to other previously developed purification methods. The UV-eluted samples contained readily detectable amounts of the U7 snRNP that was free of major protein contaminants and suitable for direct analysis by mass spectrometry and functional assays. The described method can be readily adapted for purification of other RNA binding complexes and used in conjunction with single- and double-stranded DNA binding sites to purify DNA-specific proteins and macromolecular complexes.

RNA/protein complexes purified using botin-streptavidin strategy are eluted to solution under denaturing conditions in a form unsuitable for further purification and functional analysis. Here, we describe a modification of this strategy that utilizes a photo-cleavable linker in RNA and a gentle UV-elution step, yielding native and fully functional RNA/protein complexes.

Single-step purificazione di complessi macromolecolari usando RNA attaccato alla biotina e un Linker foto-spaccabili

For many years, the exceptionally strong and rapidly formed interaction between biotin and streptavidin has been successfully utilized for partial ...

Transcriptome-Wide Profiling of Protein-RNA Interactions by Cross-Linking and Immunoprecipitation Mediated by FLAG-Biotin Tandem Purification

RNA and RNA-binding proteins (RBPs) control multiple biological processes. The spatial and temporal arrangement of RNAs and RBPs underlies the delicate regulation of these processes. A strategy called CLIP-seq (cross-linking and immunoprecipitation) has been developed to capture endogenous protein-RNA interactions with UV cross-linking followed by immunoprecipitation. Despite the wide use of conventional CLIP-seq method in RBP study, the CLIP method is limited by the availability of high-quality antibodies, potential contaminants from the copurified RBPs, requirement of isotope manipulation, and potential loss of information during a tedious experimental procedure. Here we describe a modified CLIP-seq method called FbioCLIP-seq using the FLAG-biotin tag tandem purification. Through tandem purification and stringent wash conditions, almost all the interacting RNA-binding proteins are removed. Thus, the RNAs interacting indirectly mediated by these copurified RBPs are also reduced. Our FbioCLIP-seq method allows efficient detection of direct protein-bound RNAs without SDS-PAGE and membrane transfer procedures in an isotope-free and protein-specific antibody-free manner.

Here we present a modified CLIP-seq protocol called FbioCLIP-seq with FLAG-biotin tandem purification to determine the RNA targets of RNA-binding proteins (RBPs) in mammalian cells.

Profilazione a livello di trascrizione delle interazioni proteina-RNA attraverso il cross-linking e l'immunoprecipitazione mediata dalla purificazione tandem FLAG-Biotina

RNA and RNA-binding proteins (RBPs) control multiple biological processes. The spatial and temporal arrangement of RNAs and RBPs underlies the delicate ...

An Optimized Quantitative Pull-Down Analysis of RNA-Binding Proteins Using Short Biotinylated RNA

Protein-RNA interactions regulate gene expression and cellular functions at transcriptional and post-transcriptional levels. For this reason, identifying the binding partners of an RNA of interest remains of high importance to unveil the mechanisms behind many cellular processes. However, RNA molecules might interact transiently and dynamically with some RNA-binding proteins (RBPs), especially with non-canonical ones. Hence, improved methods to isolate and identify such RBPs are greatly needed.
To identify the protein partners of a known RNA sequence efficiently and quantitatively, we developed a method based on the pull-down and characterization of all interacting proteins, starting from cellular total protein extract. We optimized the protein pull-down using biotinylated RNA pre-loaded on streptavidin-coated beads. As a proof of concept, we employed a short RNA sequence known to bind the neurodegeneration-associated protein TDP-43 and a negative control of a different nucleotide composition but the same length. After blocking the beads with yeast tRNA, we loaded the biotinylated RNA sequences on the streptavidin beads and incubated them with the total protein extract from HEK 293T cells. After incubation and several washing steps to remove nonspecific binders, we eluted the interacting proteins with a high-salt solution, compatible with the most commonly used protein quantification reagents and with sample preparation for mass spectrometry. We quantified the enrichment of TDP-43 in the pull-down performed with the known RNA binder compared to the negative control by mass spectrometry. We used the same technique to verify the selective interactions of other proteins computationally predicted to be unique binders of our RNA of interest or of the control. Finally, we validated the protocol by western blot via the detection of TDP-43 with an appropriate antibody. 
This protocol will allow the study of the protein partners of an RNA of interest in near-to-physiological conditions, helping uncover unique and unpredicted protein-RNA interactions.

Here, we present an optimized in vitro method to uncover, quantify, and validate protein interactors of specific RNA sequences, using total protein extract from human cells, streptavidin beads coated with biotinylated RNA, and mass spectrometry analysis.

Un'analisi pull-down quantitativa ottimizzata delle proteine leganti l'RNA utilizzando RNA biotinilato corto

Protein-RNA interactions regulate gene expression and cellular functions at transcriptional and post-transcriptional levels. For this reason, identifying ...

Orthotopic Implantation and Peripheral Immune Cell Monitoring in the II-45 Syngeneic Rat Mesothelioma Model

The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of the role of the tumor microenvironment in treatment response, collectively point to the need for immune-competent orthotopic models for pre-clinical testing of these new therapies. This paper demonstrates how to establish an orthotopic immune-competent rat model of pleural malignant mesothelioma. Monitoring disease progression in orthotopic models is confounded by the internal location of the tumors. To longitudinally monitor disease progression and its effect on circulating immune cells in this and other rat models of cancer, a single tube flow cytometry assay requiring only 25 &#181;l whole blood is described. This provides accurate quantification of seven immune parameters: total lymphocytes, monocytes and neutrophils, as well as the T-cell subsets CD4 and CD8, B-cells and Natural Killer cells. Different subsets of these parameters are useful in different circumstances and models, with the neutrophil to lymphocyte ratio having the greatest utility for monitoring disease progression in the mesothelioma model. Analyzing circulating immune cell levels using this single tube method may also assist in monitoring the response to immune-based treatments and understanding the underlying mechanisms leading to success or failure of treatment.

The generation of an orthotopic rat model of pleural malignant mesothelioma by implantation of II-45 mesothelioma cells into the pleural cavity of immune competent rats is presented. A flow cytometric method to analyze seven immune cell subsets in these animals from a 25 &#181;l&#160;blood sample is also described.

Ortotopico impianto e periferico immunitario monitoraggio cellulare nel Modello II-45 Singenico Rat mesotelioma

The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of ...

Medicina

Isolation of Translating Ribosomes Containing Peptidyl-tRNAs for Functional and Structural Analyses

Recently, structural and biochemical studies have detailed many of the molecular events that occur in the ribosome during inhibition of protein synthesis by antibiotics and during nascent polypeptide synthesis. Some of these antibiotics, and regulatory nascent polypeptides mostly in the form of peptidyl-tRNAs, inhibit either peptide bond formation or translation termination1-7. These inhibitory events can stop the movement of the ribosome, a phenomenon termed "translational arrest". Translation arrest induced by either an antibiotic or a nascent polypeptide has been shown to regulate the expression of genes involved in diverse cellular functions such as cell growth, antibiotic resistance, protein translocation and cell metabolism8-13. Knowledge of how antibiotics and regulatory nascent polypeptides alter ribosome function is essential if we are to understand the complete role of the ribosome in translation, in every organism.
Here, we describe a simple methodology that can be used to purify, exclusively, for analysis, those ribosomes translating a specific mRNA and containing a specific peptidyl-tRNA14. This procedure is based on selective isolation of translating ribosomes bound to a biotin-labeled mRNA. These translational complexes are separated from other ribosomes in the same mixture, using streptavidin paramagnetic beads (SMB) and a magnetic field (MF). Biotin-labeled mRNAs are synthesized by run-off transcription assays using as templates PCR-generated DNA fragments that contain T7 transcriptional promoters. T7 RNA polymerase incorporates biotin-16-UMP from biotin-UTP; under our conditions approximately ten biotin-16-UMP molecules are incorporated in a 600 nt mRNA with a 25% UMP content. These biotin-labeled mRNAs are then isolated, and used in in vitro translation assays performed with release factor 2 (RF2)-depleted cell-free extracts obtained from Escherichia coli strains containing wild type or mutant ribosomes. Ribosomes translating the biotin-labeled mRNA sequences are stalled at the stop codon region, due to the absence of the RF2 protein, which normally accomplishes translation termination. Stalled ribosomes containing the newly synthesized peptidyl-tRNA are isolated and removed from the translation reactions using SMB and an MF. These beads only bind biotin-containing messages.
The isolated, translational complexes, can be used to analyze the structural and functional features of wild type or mutant ribosomal components, or peptidyl-tRNA sequences, as well as determining ribosome interaction with antibiotics or other molecular factors 1,14-16. To examine the function of these isolated ribosome complexes, peptidyl-transferase assays can be performed in the presence of the antibiotic puromycin1. To study structural changes in translational complexes, well established procedures can be used, such as i) crosslinking to specific amino acids14 and/or ii) alkylation protection assays1,14,17.

A major impediment to biochemical analyses of ribosomes containing nascent peptidyl-tRNAs has been the presence of other ribosomes in the same samples, ribosomes not involved in the translation of the specific mRNA sequence being analyzed. We developed a simple methodology to purify, exclusively, the ribosomes containing the nascent peptidyl-tRNA of interest.

Isolamento dei ribosomi Tradurre contenenti peptidil-tRNA per le analisi funzionali e strutturali

Recently, structural and biochemical studies have detailed many of the molecular events that occur in the ribosome during inhibition of protein synthesis ...

Biologia

<meta charset="utf8"></head><body>Analisi quantitativa della cinetica di legame RPA-ssDNA utilizzando metodi label-free

Analyzing DNA-Protein Interactions with Streptavidin-Based Biolayer Interferometry

Protein-DNA interactions underpin essential cellular processes. Understanding these interactions is critical for elucidating the molecular mechanisms of various pathways. Key factors such as the structure, sequence, and length of a DNA molecule can significantly influence protein binding. Bio-layer interferometry (BLI) is a label-free technique that measures binding kinetics between molecules, offering a straightforward and precise approach to quantitatively study protein-DNA interactions. A major advantage of BLI over traditional gel-based methods is its ability to provide real-time data on binding kinetics, enabling accurate measurement of the equilibrium dissociation constant (KD) for dynamic protein-DNA interactions. This article presents a basic protocol for determining the KD value of the interaction between a DNA replication protein, replication protein A (RPA), and a single-stranded DNA (ssDNA) substrate. RPA binds ssDNA with high affinity but must also be easily displaced to facilitate subsequent protein interactions within biological pathways. In the described BLI assay, biotinylated ssDNA is immobilized on a streptavidin-coated biosensor. The binding kinetics (association and dissociation) of RPA to the biosensor-bound DNA are then measured. The resulting data are analyzed to derive precise values for the association rate constant (ka), dissociation rate constant (kd), and equilibrium binding constant (KD) using system software.

<meta charset="utf8"></head><body>Analisi delle interazioni DNA-proteina con l'interferometria a biostrato basata su streptavidina

This article describes a protocol for studying DNA-protein interactions using a streptavidin-based biolayer interferometry (BLI) system. It outlines the essential steps and considerations for utilizing either basic or advanced binding kinetics to determine the equilibrium binding affinity (KD) of the interaction.

Analisi delle interazioni DNA-proteina con l'interferometria a biostrato basata su streptavidina

Protein-DNA interactions underpin essential cellular processes. Understanding these interactions is critical for elucidating the molecular mechanisms of ...

Desthiobiotin-streptavidina-affinità mediata purificazione delle proteine che interagiscono con RNA nelle cellule di mesotelioma

Riepilogo

Esplora Altri Video

Capitoli in questo video

Novel RNA-Proteine leganti isolamento dalla rapida Metodologia

Biotina-based Pulldown Assay Validate mRNA Mirna obiettivi del cellulare

Una procedura di isolamento del RNA basati su Oligonucleotide Tandem recuperare mRNA-proteina eucariotica complessi

Analisi biochimiche in Vitro che utilizzano etichette di biotina per studiare le interazioni proteina-nucleica dell'acido

Single-step purificazione di complessi macromolecolari usando RNA attaccato alla biotina e un Linker foto-spaccabili

Profilazione a livello di trascrizione delle interazioni proteina-RNA attraverso il cross-linking e l'immunoprecipitazione mediata dalla purificazione tandem FLAG-Biotina

Un'analisi pull-down quantitativa ottimizzata delle proteine leganti l'RNA utilizzando RNA biotinilato corto

Ortotopico impianto e periferico immunitario monitoraggio cellulare nel Modello II-45 Singenico Rat mesotelioma

Isolamento dei ribosomi Tradurre contenenti peptidil-tRNA per le analisi funzionali e strutturali

Analisi delle interazioni DNA-proteina con l'interferometria a biostrato basata su streptavidina

Desthiobiotin-streptavidina-affinità mediata purificazione delle proteine che interagiscono con RNA nelle cellule di mesotelioma

Riepilogo

Esplora Altri Video

Capitoli in questo video

Novel RNA-Proteine ​​leganti isolamento dalla rapida Metodologia

Biotina-based Pulldown Assay Validate mRNA Mirna obiettivi del cellulare

Una procedura di isolamento del RNA basati su Oligonucleotide Tandem recuperare mRNA-proteina eucariotica complessi

Analisi biochimiche in Vitro che utilizzano etichette di biotina per studiare le interazioni proteina-nucleica dell'acido

Single-step purificazione di complessi macromolecolari usando RNA attaccato alla biotina e un Linker foto-spaccabili

Profilazione a livello di trascrizione delle interazioni proteina-RNA attraverso il cross-linking e l'immunoprecipitazione mediata dalla purificazione tandem FLAG-Biotina

Un'analisi pull-down quantitativa ottimizzata delle proteine leganti l'RNA utilizzando RNA biotinilato corto

Ortotopico impianto e periferico immunitario monitoraggio cellulare nel Modello II-45 Singenico Rat mesotelioma

Isolamento dei ribosomi Tradurre contenenti peptidil-tRNA per le analisi funzionali e strutturali

Analisi delle interazioni DNA-proteina con l'interferometria a biostrato basata su streptavidina

Novel RNA-Proteine leganti isolamento dalla rapida Metodologia