Os autores agradecem o apoio do prémio FA9550-13-1-0108 da Força Aérea Instituto de Investigação Científica dos EUA. Os autores adicionalmente reconhecer o apoio da adjudicação N00014-15-1-2502 do Office of Naval Research dos EUA, o financiamento do Instituto de Tecnologia da Critical e Ciência Aplicada na Virginia Polytechnic Institute e State University, e da Science Foundation Graduate Research Nacional Programa de bolsas, concessão número 1.607.310.

<ol>
	<li>Zhang, R., Heyde, K. C., Scott, F. Y., Paek, S. -. H., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programming+Surface+Chemistry+with+Engineered+Cells.">Programming Surface Chemistry with Engineered Cells.</a> ACS Synth. Biol. , (2016).</li><li>Zhou, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reduced+graphene+oxide+films+used+as+matrix+of+MALDI-TOF-MS+for+detection+of+octachlorodibenzo-p-dioxin.">Reduced graphene oxide films used as matrix of MALDI-TOF-MS for detection of octachlorodibenzo-p-dioxin.</a> Chem. Commun. 46, 6974-6976 (2010).</li><li>Pardee, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Low-Cost+Detection+of+Zika+Virus+Using+Programmable+Biomolecular+Components.">Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components.</a> Cell. 165, 1255-1266 (2016).</li><li>B&#228;hring, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+Sensing+Properties+of+a+Self-Assembled+Supramolecular+Oligomer.">Design and Sensing Properties of a Self-Assembled Supramolecular Oligomer.</a> Chem. Eur. J. 22, 1958-1967 (2016).</li><li>Nicolau Jr, D. V., Armitage, J. P., Maini, P. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directional+persistence+and+the+optimality+of+run-and-tumble+chemotaxis.">Directional persistence and the optimality of run-and-tumble chemotaxis.</a> Comp. Biol. Chem. 33, 269-274 (2009).</li><li>Du, J., Shao, Z., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+microbial+factories+for+synthesis+of+value-added+products.">Engineering microbial factories for synthesis of value-added products.</a> J. Ind. Microbiol. Biotechnol. 38, 873-890 (2011).</li><li>Kim, H., Kim, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electric+Field+Control+of+Bacteria-Powered+Microrobots+Using+a+Static+Obstacle+Avoidance+Algorithm.">Electric Field Control of Bacteria-Powered Microrobots Using a Static Obstacle Avoidance Algorithm.</a> IEEE Trans. Rob. 32, 125-137 (2016).</li><li>Gardner, T. S., Cantor, C. R., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+a+genetic+toggle+switch+in+Escherichia+coli.">Construction of a genetic toggle switch in Escherichia coli.</a> Nature. 403, 339-342 (2000).</li><li>Heyde, K. C., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+Host-Microbiome+Interactions+using+an+in+Silico+Model+of+Biomimetic+Robots+and+Engineered+Living+Cells.">Exploring Host-Microbiome Interactions using an in Silico Model of Biomimetic Robots and Engineered Living Cells.</a> Sci. Rep. 5, 11988 (2015).</li><li>Rice, M. K., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Creating+biological+nanomaterials+using+synthetic+biology.">Creating biological nanomaterials using synthetic biology.</a> Sci. Tech. Adv. Mater. 15, 014401 (2014).</li><li>Green, N. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin.+3.+The+nature+of+the+biotin-binding+site.">Avidin. 3. The nature of the biotin-binding site.</a> Biochem. J. 89, 599-609 (1963).</li><li>Mesulam, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tetramethyl+benzidine+for+horseradish+peroxidase+neurohistochemistry:+a+non-carcinogenic+blue+reaction+product+with+superior+sensitivity+for+visualizing+neural+afferents+and+efferents.">Tetramethyl benzidine for horseradish peroxidase neurohistochemistry: a non-carcinogenic blue reaction product with superior sensitivity for visualizing neural afferents and efferents.</a> J Histochem. Cytochem. 26, 106-117 (1978).</li><li>Litcofsky, K. D., Afeyan, R. B., Krom, R. J., Khalil, A. S., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iterative+plug-and-play+methodology+for+constructing+and+modifying+synthetic+gene+networks.">Iterative plug-and-play methodology for constructing and modifying synthetic gene networks.</a> Nat. Meth. 9, 1077-1080 (2012).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+Chemical+Synthesis,+Assembly,+and+Cloning+of+a+Mycoplasma+genitalium+Genome.">Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome.</a> Science. 319, 1215-1220 (2008).</li><li>Diamandis, E. P., Christopoulos, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biotin-(strept)avidin+system:+principles+and+applications+in+biotechnology.">The biotin-(strept)avidin system: principles and applications in biotechnology.</a> Clin. Chem. 37, 625-636 (1991).</li><li>Nerurkar, L. S., Namba, M., Brashears, G., Jacob, A. J., Lee, Y. J., Sever, J., L, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+detection+of+herpes+simplex+virus+in+clinical+specimens+by+use+of+capture+biotin-streptavidin+enzyme-linked+immunosorbent+assay.">Rapid detection of herpes simplex virus in clinical specimens by use of capture biotin-streptavidin enzyme-linked immunosorbent assay.</a> J. Clin. Micro. 20, 109-114 (1984).</li><li>Cui, Y., Wei, Q., Park, H., Lieber, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanowire+Nanosensors+for+Highly+Sensitive+and+Selective+Detection+of+Biological+and+Chemical+Species.">Nanowire Nanosensors for Highly Sensitive and Selective Detection of Biological and Chemical Species.</a> Science. 293, 1289-1292 (2001).</li></ol>

Os autores não têm nada a revelar.

Nós apresentamos uma nova estratégia para a interface células manipuladas viver com uma superfície do material funcionalizado. Isto foi conseguido através do desenvolvimento de uma linha de células capazes de sintetizar níveis elevados de biotina quando induzido com IPTG. Os níveis elevados de biotina pode então ser utilizado para modificar a superfície funcionalizada. Os protocolos detalhados como engenheiro da linha de células E. coli e como criar duas superfícies funcionalizadas diferentes. passos críticos neste protocolo ocorrer durante toda a construção da linha de células de engenharia. Para evitar problemas de jusante, que caracterizam as estirpes celulares manipuladas com ambas as curvas de crescimento (Figura 2) e de resposta fluorescente (Figura 3) é encorajada. Caso surjam questões processuais, outras estratégias de clonagem molecular, tais como extração de PCR e montagem Gibson 14, pode ser substituída por medidas, quando apropriado. Para otimizar o Yie biotinaLD da linha de células de engenharia, é crucial para assegurar que uma quantidade suficiente de DTB é fornecida às células. Nos nossos estudos, encontramos que 200 ng / mL DTB causou um aumento substancial e estatisticamente significativo na produção de biotina quando as células foram induzidas com IPTG. Além disso, a conjugação bem sucedida da BSA-biotina, SA-HRP, e biotina-HRP é crucial para a realização e acompanhamento dos regimes de controlo directo e indirecto de forma eficaz. Tomar cuidado para evitar a exposição desnecessária a luz e permitem que os conjugados a incubar durante a noite a 4 ° C para assegurar uma eficaz conjugado é formado. Nosso protocolo oferece vantagens sobre os métodos alternativos 15, devido à sua capacidade para detectar pequenas quantidades de biotina que são biologicamente relevante (escala pg / ml) em comparação com kits de detecção de biotina comercialmente disponíveis, tais como aqueles baseados em ácido 4&#39;-hydroxyazobenzene-2-carboxílico estratégias de ligação competitiva. Embora a utilização do estreptavidina-biosistema de estanho é comum em biotecnologia 16, 17, a capacidade do nosso sistema para responder a pequenas quantidades de biotina nos permite ligar diretamente a nossa linha de células geneticamente modificadas com a superfície funcionalizada. Uma limitação potencial do nosso protocolo é a faixa dinâmica resultante da detecção de biotina. Nos esquemas de controle diretos e indiretos, que são capazes de detectar a biotina entre 10 2 -10 3 e 10 4 -10 6 pg / mL, respectivamente (Figura 4). Felizmente, a gama baixa do esquema de controle indireto nos permite detectar prontamente a produção de biotina a partir de células modificadas. No entanto, a banda apertado da gama dinâmica de controlo indirecto limita a sua capacidade de detectar grandes mudanças (100 vezes) em concentrações de biotina. Alterando a faixa dinâmica para ambos os esquemas de controlo directo e indirecto exigiria engenharia adicional. No entanto, se a detecção de células-produzird biotina é um problema, a preparação de diluições do sobrenadante biotina no passo 4.6 deve permitir que o investigador para alvejar a gama dinâmica do sistema de controlo indirecto (Figura 5). Descobrimos que uma diluição 1: 5 de sobrenadante nos permitiu atingir o intervalo dinâmico do esquema de controle indireto eficaz. Esta estratégia de diluição deve aliviar a necessidade de modificar a gama dinâmica directamente. A de duas partes, o sistema de célula-material aqui apresentado permite que as células manipuladas para modificar a composição de uma superfície funcionalizada. células dinâmicos, vivos podem interpretar seus arredores químicos para produzir uma resposta genética. Por engenharia genética essa resposta para aumentar a produção de biotina, que pode dotar células vivas modificadas com a capacidade de controlar e manipular uma superfície funcionalizada. Ao seguir os protocolos apresentados, as células modificadas são capazes de agir como sensores dinâmicos, capazes de leitura, processamento e gravação as condições em torno them meio de interfaces funcionalizados. Esta tecnologia pode impactar áreas que vão desde a medicina molecular para a detecção de analitos para a remediação ambiental.

Aqui, relatamos os procedimentos para o desenvolvimento de um substrato programável capaz de responder a um sinal químico a partir de uma linha celular de engenharia. 1 Fazemos isso através da criação de uma interface de biotina-estreptavidina que responde a biotina produzida pelas células Escherichia coli sinteticamente engenharia (E. coli). Anteriormente, superfícies programáveis foram projetados para uma ampla gama de aplicações de detecção de toxina 2 e point-of-care diagnóstico 3 a defesa e segurança. 4 Enquanto superfícies programáveis podem ser úteis como sensores e atuadores, eles podem ser feitos &quot;mais inteligentes&quot;, dotando-os com a capacidade de se adaptar a diferentes desafios ambientais. Em contraste, mesmo microorganismos simples, tais como E. coli, têm adaptabilidade inerente e são capazes de responder aos desafios com soluções sofisticadas e muitas vezes inesperados. Esta adaptação tem permitido E.populações coli, controladas por suas redes de genes complexos, de forma rentável para buscar recursos, 5 criar produtos de valor acrescentado, 6 e até robótica micro-escala de energia. 7, por acoplamento das vantagens adaptativas de células vivas com o uso de superfícies programáveis, podemos criar um substrato inteligente capaz de responder às diferentes condições ambientais. A biologia sintética tem dado aos pesquisadores novas habilidades para programar o comportamento de organismos vivos. Pela engenharia células para conter redes reguladoras novo gene, os pesquisadores podem criar células que exibem uma gama de comportamentos programados. 8, 9 Além pesquisa básica, esses comportamentos podem ser usados para aplicações como controle de montagem de material e biologicamente a produção de produtos de valor agregado. 10 Nisto, nós detalhe como usamos as ferramentas da biologia sintética para engenheiro uma estirpe de E. coli que sintetiza biotina após indução. Esta estirpe foi desenvolvida utilizando métodos de clonagem da enzima de restrição para montar um plasmídeo, pKE1-LACI-BIOB. Este plasmídeo, quando usado para transformar a estirpe de E. coli K-12 MG1655, dota células com a capacidade para expressar níveis elevados de BIOB, uma enzima essencial para a síntese de biotina. Quando as células transformadas foram induzidas com isopropil β-D-1-tiogalactopiranósido (IPTG) e fornecido com um precursor de biotina, destiobiotina (DTB), níveis elevados de biotina foram produzidos. interacção de ligação da biotina com estreptavidina é um dos mais fortes ligações não covalentes encontrados na natureza. Como tal, a interacção biotina-estreptavidina é tanto bem caracterizados e altamente utilizado em biotecnologia. 11 Dentro deste manuscrito, apresentamos duas estratégias que empregam a interacção biotina-estreptavidina para detectar e detectar a biotina produzidos em células com uma superfície funcionalizada. Nósreferem-se a estas superfícies contrastantes como esquemas de controle &quot;diretos&quot; &quot;indiretas&quot; e. No esquema de controlo indirecto, biotina produzidos em células compete com biotina que foi conjugado e imobilizados numa superfície de poliestireno para locais de ligação a estreptavidina. Além disso, a estreptavidina é conjugado com peroxidase de rábano (HRP). HRP modifica 3, 3 &#39;, 5, 5&#39;-tetrametilbenzidina (TMB), para produzir um sinal óptico, 12, a qual pode ser monitorizada por quantificação da absorvância espectral (ou seja, a densidade óptica) a 450 nm (OD 450). Assim, o esquema de controle indireto permite aos pesquisadores para medir biotina produzida por células monitorando a attentuation do sinal de OD 450. O esquema de controlo directo explora o evento estreptavidina-biotina estreptavidina imobilizando directamente para uma superfície do material e permitindo biotina produzidos por células e de HRP biotinilada para competir por sítios de ligação a estreptavidina. Mais uma vez, oníveis relativos de biotina produzidos de células são monitorizados pela medição de uma sinal de OD 450. Tomadas em conjunto, as células manipuladas e superfícies funcionalizadas permitem controlar as propriedades de uma superfície programável através da indução de redes em células vivas. Em outras palavras, nós criamos um sistema que aproveita a capacidade de adaptação dos organismos vivos e a confiabilidade ea especificação de uma interface de material de engenharia, ligando estes sistemas juntos.

<table border="0" cellpadding="0" cellspacing="0" width="1072">
	<tbody>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">LB Broth, Miller&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">12-795-027</td>
			<td style="width:219px;"></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Agar</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP9744500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Carbenicillin&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP26481</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">M9, Minimimal Salts, 5X</td>
			<td style="width:209px;">Sigma-Aldrich</td>
			<td style="width:119px;">M6030</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Casamino Acids&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP1424-100</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Magnesium Sulfate, Anhydrous</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">M65-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Calcium Chloride, Dihydrate</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">C79-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Dextrose (D-Glucose), Anhydrous</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">D16-1</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">NEB Turbo Cell Line</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">C2984l</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Oligonucleotide Primers</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">N/A</td>
			<td>25N synthesis, DSL purification</td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Q5 High-Fidelity Polymerase</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">M0491S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Q5 Reaction Buffer</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">B9027S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">dNTP Solution Mix</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">N0447S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Agarose</td>
			<td style="width:209px;">Bioexpress</td>
			<td style="width:119px;">E-3120-125</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Ethidium Bromide, 1%</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP1302-10</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Gel Extraction Kits</td>
			<td style="width:209px;">Epoch Biolabs</td>
			<td style="width:119px;">2260250</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">GenCatch Plasmid DNA Miniprep Kit</td>
			<td style="width:209px;">Epoch Biolabs</td>
			<td style="width:119px;">2160250</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">AatII</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">R0117S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">SacII</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">R0157S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">HindIII-HF</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">R3104S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">EcoRI-HF</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">R3101S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Cutsmart Buffer</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">B7204S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">T4 DNA Ligase</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">M0202S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">T4 DNA Ligase Reaction Buffer</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">B0202S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">ColiRolle Glass Plating Beads&#160;</td>
			<td style="width:209px;">EMD Millipore</td>
			<td style="width:119px;">7101-3</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Glycerol</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP229-1</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Isopropyl &#946;-D-1-thiogalactopyranoside (IPTG)</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP1755-10</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">NHS-Desthiobiotin (DTB)</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">16129</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Succinimidyl Trans-4-(maleimidylmethyl) Cyclohexane-1-Carboxylate (SMCC)&#160;</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">S1534</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Dimethyl Sulfoxide (DMSO)&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP231-100</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Succinimidyl 3-(2-pyridyldithio) Propionate (SPDP)&#160;</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">S1531</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">NHS-LC-LC-biotin</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">21343</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Horseradish Peroxidase (HRP)&#160;</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">31490</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Phosphate Buffered Saline (PBS), 10X Solution</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP399500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Streptavidin (SA)&#160;</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">21145</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Bovine Serum Albumin (BSA)</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP1600-100</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Dithiothreitol (DTT)</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP172-5</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Ethylenediaminetetaacetic acid (EDTA)&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">S311-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Tween 80&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">T164-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Hydrogen Peroxide</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">H325-4</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">3, 3&#39;, 5, 5&#39;-tetramethylbenzidine (TMB)</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">AC229280050</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Vivaspin 500 Centrifugal Concentrators&#160;</td>
			<td style="width:209px;">Viva Products</td>
			<td style="width:119px;">VS0192</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Sodium Acetate, Anhydrous</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP333-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">96-Well Polystyrene Plates</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">266120</td>
			<td></td>
		</tr>
	</tbody>
</table>

using synthetic biology to engineer living cells that interface with programmable materials

Nós desenvolvemos uma interface abiótico-bióticos que permite que as células manipuladas para controlar as propriedades do material de uma superfície funcionalizada. Este sistema é feito através da criação de dois módulos: um sinteticamente estirpe de células de E. coli e uma interface de material funcionalizado. Dentro deste artigo, detalhamos um protocolo para a engenharia genética de comportamentos selecionados dentro de uma estirpe de E. coli utilizando estratégias de clonagem molecular. Uma vez desenvolvidas, esta estirpe produz níveis elevados de biotina quando exposta a um indutor químico. Adicionalmente, protocolos para a criação de detalhe duas superfícies funcionalizadas diferentes, cada um dos quais é capaz de responder a biotina sintetizado por células. Tomados em conjunto, apresentamos uma metodologia para a criação de um sistema ligado, abiótico-biótico que permite que as células para controlar a composição do material e montagem em substratos inanimados engenharia.

Os resultados representativos são apresentados nas figuras em anexo cinco. Em primeiro lugar, é apresentado o processo de clonagem graficamente (Figura 1), de modo que o leitor pode acompanhar visualmente os passos críticos para criar a estirpe de E. coli sinteticamente. A fim de caracterizar a dinâmica das populações de células, que proporcionam uma curva de crescimento (Figura 2) gerado pela medição da densidade óptica a 600 nm (DO600) da população. Em seguida, mostra-se como a rede de genes reguladores é verificado, usando mCherry como um proxy para BIOB (Figura 3), o que nos permite medir opticamente a quantidade relativa de BIOB que seria produzido pela célula após indução com IPTG. A seguir, apresentamos os dados de resposta para a indireta de controle e superfícies funcionalizadas de controle direto. Estes gráficos de dados (Figura 4) foram desenvolvidos usando soluções de medição de livrebiotina para caracterizar perfis de resposta das superfícies funcionalizadas. Por último, apresenta-se os dados característicos que mostram como as células manipuladas são induzidas a produzir a biotina (Figura 5), modificando deste modo as superfícies funcionalizadas. <img alt="figura 1" src="/files/ftp_upload/55300/55300fig1.jpg" /> Figura 1: Projeto e Construção de induzíveis, células manipuladas. Os iniciadores (A) foram concebidos para isolar o gene BIOB a partir do genoma de E. coli, que codifica uma enzima crucial na via de síntese de biotina. (B) A P G, sequências tetO trc-2-1 -lacI e P pode ser isolado a partir de um plasmídeo contendo um interruptor genético com iniciadores correspondentes. (C) O gene BIOB extraído e os dois fragmentos a partir do interruptor de alavanca pode então ser utilizado para criar o circuito de gene. A adição de IPTG pode então indUCE a expressão de BIOB síntese e, assim, quando a biotina DTB é adicionado como um substrato para BIOB. (D) O plasmídeo foi transformado em montado K-12 de E. coli MG1655. Isto causou a presença de IPTG para induzir a expressão de BIOB e, assim, a síntese da biotina pela linha celular de engenharia quando DTB foi fornecida como um substrato. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig1large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 2" src="/files/ftp_upload/55300/55300fig2.jpg" /> Figura 2: curvas de crescimento para as células manipuladas. As células, do tipo selvagem MG1655 indutíveis modificadas foram cultivadas e monitorizados em meio mínimo (isto é, livre de biotina meios M9), bem como meio mínimo suplementado com DTB (200 ng / mL) e / ou de IPTG (0,5 mM). Os gráficos mostram a leitura de DO a 600, medido a cada 5 mi<html> N, durante 24 h. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig2large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 3" src="/files/ftp_upload/55300/55300fig3.jpg" /> Figura 3: Testando o Gene Rede Engineered. A proteína fluorescente mCherry foi usado em lugar do gene BIOB para que pudéssemos opticamente medir o perfil de indução quando as células modificadas foram induzidos com IPTG. Nós contrastar as células induzidas com IPTG (diamantes vermelhos) com as células não induzidas com IPTG (diamantes azuis). Estes resultados demonstram a eficácia da rede de gene indutível. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig3large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> /55300/55300fig4.jpg &quot;/&gt; Figura 4: Verificação da funcionalizados material de interface. Ao expor a superfície funcionalizada em diferentes concentrações de biotina, que são capazes de medir a resposta óptica medindo a OD 450 absorvância. Estes resultados permitem gerar uma curva de calibração, que liga a concentração de biotina com a intensidade óptica da resposta. Aqui, apresentamos a biotina vs. curvas de sinais ópticos para ambos os esquemas de superfície indireta (à esquerda) e direto (direita) funcionalizados. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig4large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 5" src="/files/ftp_upload/55300/55300fig5.jpg" /> Figura 5: Projetado células controle material de interface. Ao utilizar seções de protocolo 5 ou 6, somos capazes de usar os produtos de induzido, c engenhariaells para modificar quimicamente a superfície funcionalizada. Podemos monitorar essas respostas opticamente medindo OD 450. Além disso, usando a curva de calibração desenvolvido na Figura 4, pode-se ligar a intensidade óptica da resposta à biotina na concentração. Apresentamos aqui as diferentes concentrações de biotina, medida pelo nosso esquema funcionalizado superfície de controle indireto, por células do tipo selvagem (branco), células não induzidas contendo o plasmídeo pKE1-LACI-BIOB (laranja), e células induzidas contendo o pKE1-LACI-BIOB plasmídeo (cinza). <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig5large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Químico </td><td> concentração final </td><td> Montante </td></tr><tr><td> sais de 5x M9 </td><td> 1x </td><td> 20 ml </td></tr><tr><td> 1 H MgSO4 </td><td> 2 mM </td><td> 200 uL </td></tr><tr><td> 1 M de CaCl2 </td><td> 0,1 mM </td><td> 10 ul </td></tr><tr><td> 20% de glucose </td><td> 0,40% </td><td> 2 ml </td></tr><tr><td> casaminoácido livre de biotina a 2% </td><td> 0,02% </td><td> 1 mL </td></tr><tr><td> DI água </td><td> N / D </td><td> 76,8 mL </td></tr></tbody></table> Tabela 1: M9 mídia Receita. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Nome </td><td colspan="2"> sequência iniciadora </td><td> Uso </td></tr><tr><td> 1-f </td><td colspan="2"> CCGCCGGAATTCTCCCTATCAGTGATAGAGATT </td><td> extração cassete lacl </td></tr><tr><td> 1-r </td><td colspan="2"> CCGACGTCTCACTGCCCGCTTTCCAGTC </td><td> extração cassete lacl </td></tr><tr><td> nBioB1-f </td><td colspan="2"> CCCAAGCTTCTGAAATGAGCTGTTGACAATTAATCAT </td><td> P trc-extracção 2 </td></tr><tr><td> nBioB1-r </td><td colspan="2"> GGGGGGTTCTTTTAATAAAGGTACCGTGTGAAATTGTT </td><td> P trc-extracção 2 </td></tr><tr><td> nBioB2-f1 </td><td colspan="2"> ACCCCCCTAAGGAGGTCATCATGGCTCACCGCCCACG </td><td> extração BIOB </td></tr><tr><td> nBioB2-r </td><td colspan="2"> TCCCCGCGGTCATAATGCTGCCGCGTTGTAATATTC </td><td> extração BIOB </td></tr><tr><td> nBioB2-F2 </td><td colspan="2"> ACGGTACCTTTATTAAAAGAACCCCCCTAAGGAGGTCATC </td><td> Além RBS sintético </td></tr></tbody></table> Tabela 2: Lista de iniciadores. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td&gt; Passo 1 </td><td> Passo 2 </td><td> etapa 3 </td><td> passo 4 </td><td> passo 5 </td><td> passo 6 </td><td> etapa 7 </td><td> passo 8 </td><td> passo 9 </td></tr><tr><td> 98 ° C </td><td> 98 ° C </td><td> 70 ° C </td><td> 72 ° C </td><td> 98 ° C </td><td> 60 ° C </td><td> 72 ° C </td><td> 72 ° C </td><td> 4 ° C </td></tr><tr><td> 00:30 </td><td> 00:10 </td><td> 00:30 </td><td> 01: 00 / kb </td><td> 00:10 </td><td> 00:30 </td><td> 01: 00 / kb </td><td> 02:00 </td><td> ∞ </td></tr><tr><td rowspan="2"></td><td colspan="3"> Repetir 12 vezes </td><td colspan="3" rowspan="2"> Repetir 25 vezes </td><td colspan="2" rowspan="2"></td></tr><tr><td colspan="3"> -1 ° C / ciclo </td></tr></tbody></table>Tabela 3: Programa PCR. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Nome </td><td> Volume </td></tr><tr><td> Lisado celular (modelo) </td><td> 10 ul </td></tr><tr><td> Primer (cada) </td><td> 0,625 mL (cada) </td></tr><tr><td> tampão Q5 5x </td><td> 5 uL </td></tr><tr><td> Polymerase Q5 </td><td> 0,25 mL </td></tr><tr><td> dNTP Mix </td><td> 0,5 ul </td></tr><tr><td> DI água </td><td> 6,75 mL </td></tr></tbody></table> Tabela 4: células inteiras reacção de PCR (25 uL). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Nome </td><td> Volume </td></tr><tr><td> 10x tampão de reacção </td><td> 5 uL </td></tr><tr><td> enzima 1 </td><td> 1 uL </td></tr><tr><td> enzima 2 </td><td> 1 uL </td></tr><tr><td> ADN molde </td><td> 1 ug </td></tr><tr><td> DI água </td><td> 43 ul - volume de DNA </td></tr></tbody></table> Tabela 5: Enzima de Restrição A digestão de reacção (50 ul). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Nome </td><td> Volume </td></tr><tr><td> DNA </td><td> 50 ug do vetor + X inserção ug </td></tr><tr><td> De tampão ligase 10x </td><td> 1 uL </td></tr><tr><td> ligase de T4 </td><td> 1 uL </td></tr><tr><td> DI água </td><td> 8 mL - volume de DNA </td></tr></tbody></table>Tabela 6: reacção de ligação (10 mL). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Nome </td><td> Concentração </td><td> Notas </td></tr><tr><td> CaCl2 </td><td> 100 mM </td><td></td></tr><tr><td> Carbeniccilin </td><td> 50 mg / mL (1000x) </td><td></td></tr><tr><td> DTB </td><td> 50 ug / mL </td><td></td></tr><tr><td> IPTG </td><td> 0,5 M </td><td></td></tr><tr><td> SMCC </td><td> 20 mg / mL </td><td> 2 mg em 100 ul DMSO </td></tr><tr><td> SPDP </td><td> 20 mg / mL </td><td> 2 mg em 100 ul DMSO </td></tr><tr><td> LC-LC-biotina </td><td> 20 mg / mL </td><td> 2 mg em 100 ul DMSO </td></tr><tr><td> HRP </td><td> 10 mg / mL </td><td> em PBS </td></tr><tr><td> SA (indireta) </td><td> 10 mg / mL </td><td> em PBS </td></tr><tr><td> SA (directa) </td><td> 0,17 ug / ml </td><td> em PBS </td></tr><tr><td> BSA </td><td> 20 mg / mL </td><td> em PBS </td></tr><tr><td> DTT </td><td> 100 mM </td><td> Em água Dl </td></tr><tr><td> EDTA </td><td> 5 mM </td><td> 18.6 mg em 10 ml de PBS </td></tr><tr><td> Caseína </td><td> 0,50% </td><td> em PBS </td></tr><tr><td> Tween 80 </td><td> 20% </td><td> Em água Dl </td></tr><tr><td> Tween 80 em PBS </td><td> 0,05% </td><td></td></tr><tr><td> Acetato de sódio </td><td> 50 mM </td><td> Em água DI, Ajuste para 5,1 pH usando HCl 3 M </td></tr><tr><td> TMB </td><td> 1% </td><td> em DMSO </td></tr><tr><td> H 2 O 2 </td><td> 3% </td><td> Em água Dl </td></tr><tr><td> H 2 SO 4 </td><td> 2 M </td><td> Em água Dl </td></tr></tbody></table>Tabela 7: Lista de reagente Solutions.

Watch this Scientific Journal Video about Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials at JoVE.com

Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials

Este artigo apresenta uma série de protocolos para o desenvolvimento de células manipuladas e superfícies funcionalizadas que permitem sinteticamente engenharia E. coli para controlar e manipular superfícies de materiais programáveis.

Usando biologia sintética para manipular células vivas que fazem interface com materiais programáveis

We have developed an abiotic-biotic interface that allows engineered cells to control the material properties of a functionalized surface. This system is ...

using-synthetic-biology-to-engineer-living-cells-that-interface-with

Nanyang Technological University

Research

JoVE Journal

Bioengineering

8.8K visualizações.  Carnegie Mellon University.  Este artigo apresenta uma série de protocolos para o desenvolvimento de células manipuladas e superfícies funcionalizadas que permitem sinteticamente engenharia E. coli para controlar e manipular superfícies de materiais programáveis. 

Vídeo: Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials

Bridging the Bio-Electronic Interface with Biofabrication

Advancements in lab-on-a-chip technology promise to revolutionize both research and medicine through lower costs, better sensitivity, portability, and higher throughput. The incorporation of biological components onto biological microelectromechanical systems (bioMEMS) has shown great potential for achieving these goals. Microfabricated electronic chips allow for micrometer-scale features as well as an electrical connection for sensing and actuation. Functional biological components give the system the capacity for specific detection of analytes, enzymatic functions, and whole-cell capabilities. Standard microfabrication processes and bio-analytical techniques have been successfully utilized for decades in the computer and biological industries, respectively. Their combination and interfacing in a lab-on-a-chip environment, however, brings forth new challenges. There is a call for techniques that can build an interface between the electrode and biological component that is mild and is easy to fabricate and pattern.
Biofabrication, described here, is one such approach that has shown great promise for its easy-to-assemble incorporation of biological components with versatility in the on-chip functions that are enabled. Biofabrication uses biological materials and biological mechanisms (self-assembly, enzymatic assembly) for bottom-up hierarchical assembly. While our labs have demonstrated these concepts in many formats 1,2,3, here we demonstrate the assembly process based on electrodeposition followed by multiple applications of signal-based interactions. The assembly process consists of the electrodeposition of biocompatible stimuli-responsive polymer films on electrodes and their subsequent functionalization with biological components such as DNA, enzymes, or live cells 4,5. Electrodeposition takes advantage of the pH gradient created at the surface of a biased electrode from the electrolysis of water 6,7,. Chitosan and alginate are stimuli-responsive biological polymers that can be triggered to self-assemble into hydrogel films in response to imposed electrical signals 8. The thickness of these hydrogels is determined by the extent to which the pH gradient extends from the electrode. This can be modified using varying current densities and deposition times 6,7. This protocol will describe how chitosan films are deposited and functionalized by covalently attaching biological components to the abundant primary amine groups present on the film through either enzymatic or electrochemical methods 9,10. Alginate films and their entrapment of live cells will also be addressed 11. Finally, the utility of biofabrication is demonstrated through examples of signal-based interaction, including chemical-to-electrical, cell-to-cell, and also enzyme-to-cell signal transmission. 
Both the electrodeposition and functionalization can be performed under near-physiological conditions without the need for reagents and thus spare labile biological components from harsh conditions. Additionally, both chitosan and alginate have long been used for biologically-relevant purposes 12,13. Overall, biofabrication, a rapid technique that can be simply performed on a benchtop, can be used for creating micron scale patterns of functional biological components on electrodes and can be used for a variety of lab-on-a-chip applications.

This article describes a biofabrication approach: deposition of stimuli-responsive polysaccharides in the presence of biased electrodes to create biocompatible films which can be functionalized with cells or proteins. We demonstrate a bench-top strategy for the generation of the films as well as their basic uses for creating interactive biofunctionalized surfaces for lab-on-a-chip applications.

Colmatar a interface Bio-eletrônico com Biofabrication

Advancements in lab-on-a-chip technology promise to revolutionize both research and medicine through lower costs, better sensitivity, portability, and ...

Bioengenharia

Measuring the Mechanical Properties of Living Cells Using Atomic Force Microscopy

Mechanical properties of cells and extracellular matrix (ECM) play important roles in many biological processes including stem cell differentiation, tumor formation, and wound healing. Changes in stiffness of cells and ECM are often signs of changes in cell physiology or diseases in tissues. Hence, cell stiffness is an index to evaluate the status of cell cultures. Among the multitude of methods applied to measure the stiffness of cells and tissues, micro-indentation using an Atomic Force Microscope (AFM) provides a way to reliably measure the stiffness of living cells. This method has been widely applied to characterize the micro-scale stiffness for a variety of materials ranging from metal surfaces to soft biological tissues and cells. The basic principle of this method is to indent a cell with an AFM tip of selected geometry and measure the applied force from the bending of the AFM cantilever. Fitting the force-indentation curve to the Hertz model for the corresponding tip geometry can give quantitative measurements of material stiffness. This paper demonstrates the procedure to characterize the stiffness of living cells using AFM. Key steps including the process of AFM calibration, force-curve acquisition, and data analysis using a MATLAB routine are demonstrated. Limitations of this method are also discussed.

This paper demonstrates a protocol to characterize the mechanical properties of living cells by means of microindentation using an Atomic Force Microscope (AFM).

Medir as propriedades mecânicas das células vivas Usando Microscopia de Força Atômica

Mechanical  properties of cells and extracellular matrix (ECM) play important roles in many  biological processes including stem cell differentiation, ...

Ratiometric Biosensors that Measure Mitochondrial Redox State and ATP in Living Yeast Cells

Mitochondria have roles in many cellular processes, from energy metabolism and calcium homeostasis to control of cellular lifespan and programmed cell death. These processes affect and are affected by the redox status of and ATP production by mitochondria. Here, we describe the use of two ratiometric, genetically encoded biosensors that can detect mitochondrial redox state and ATP levels at subcellular resolution in living yeast cells. Mitochondrial redox state is measured using redox-sensitive Green Fluorescent Protein (roGFP) that is targeted to the mitochondrial matrix. Mito-roGFP contains cysteines at positions 147 and 204 of GFP, which undergo reversible and environment-dependent oxidation and reduction, which in turn alter the excitation spectrum of the protein. MitGO-ATeam is a F&ouml;rster resonance energy transfer (FRET) probe in which the &epsilon; subunit of the FoF1-ATP synthase is sandwiched between FRET donor and acceptor fluorescent proteins. Binding of ATP to the &epsilon; subunit results in conformation changes in the protein that bring the FRET donor and acceptor in close proximity and allow for fluorescence resonance energy transfer from the donor to acceptor.

We describe the use of two ratiometric, genetically encoded biosensors, which are based on GFP, to monitor mitochondrial redox state and ATP levels at subcellular resolution in living yeast cells.

Biossensores raciométrica que medem estado redox mitocondrial e ATP em células vivas de levedura

Mitochondria have roles in many cellular processes, from energy metabolism and calcium homeostasis to control of cellular lifespan and programmed cell ...

Generation of Shear Adhesion Map Using SynVivo Synthetic Microvascular Networks

Cell/particle adhesion assays are critical to understanding the biochemical interactions involved in disease pathophysiology and have important applications in the quest for the development of novel therapeutics. Assays using static conditions fail to capture the dependence of adhesion on shear, limiting their correlation with in vivo environment. Parallel plate flow chambers that quantify adhesion under physiological fluid flow need multiple experiments for the generation of a shear adhesion map. In addition, they do not represent the in vivo scale and morphology and require large volumes (~ml) of reagents for experiments. In this study, we demonstrate the generation of shear adhesion map from a single experiment using a microvascular network based microfluidic device, SynVivo-SMN. This device recreates the complex in vivo vasculature including geometric scale, morphological elements, flow features and cellular interactions in an in vitro format, thereby providing a biologically realistic environment for basic and applied research in cellular behavior, drug delivery, and drug discovery. The assay was demonstrated by studying the interaction of the 2 &#181;m biotin-coated particles with avidin-coated surfaces of the microchip. The entire range of shear observed in the microvasculature is obtained in a single assay enabling adhesion vs. shear map for the particles under physiological conditions.

Flow chambers used in adhesion experiments typically consist of linear flow paths and require multiple experiments at different flow rates to generate a shear adhesion map. SynVivo-SMN enables the generation of shear adhesion map using a single experiment utilizing microliter volumes resulting in significant savings in time and consumables.

Geração de cisalhamento Adesão Mapa Usando SynVivo Networks microvasculares sintético

Cell/particle adhesion assays are critical to understanding the biochemical interactions involved in disease pathophysiology and have important ...

Characterization Of Multi-layered Fish Scales (Atractosteus spatula) Using Nanoindentation, X-ray CT, FTIR, and SEM

The hierarchical architecture of protective biological materials such as mineralized fish scales, gastropod shells, ram&#8217;s horn, antlers, and turtle shells provides unique design principles with potentials for guiding the design of protective materials and systems in the future. Understanding the structure-property relationships for these material systems at the microscale and nanoscale where failure initiates is essential. Currently, experimental techniques such as nanoindentation, X-ray CT, and SEM provide researchers with a way to correlate the mechanical behavior with hierarchical microstructures of these material systems1-6. However, a well-defined standard procedure for specimen preparation of mineralized biomaterials is not currently available. In this study, the methods for probing spatially correlated chemical, structural, and mechanical properties of the multilayered scale of A. spatula using nanoindentation, FTIR, SEM, with energy-dispersive X-ray (EDX) microanalysis, and X-ray CT are presented.

Characterization Of Multi-layered Fish Scales Atractosteus spatula Using Nanoindentation, X-ray CT, FTIR, and SEM

This paper presents the methods used for probing spatially correlated chemical, structural, and mechanical properties of the multilayered scale of Atractosteus spatula (A. spatula) using nanoindentation, Fourier transform infrared (FTIR) spectroscopy, scanning electron microscopy (SEM), and X-ray computed tomography (X-ray CT). The experimental results have been used to investigate the design principles of protective biological materials.

Caracterização de escamas de peixe multi-camadas (<em&gt; Atractosteus espátula</em&gt;) Usando Nanoindentação, X-ray CT, FTIR, e SEM

The hierarchical architecture of protective biological materials such as mineralized fish scales, gastropod shells, ram&#8217;s horn, antlers, and turtle ...

Development of Amelogenin-chitosan Hydrogel for In Vitro Enamel Regrowth with a Dense Interface

Biomimetic enamel reconstruction is a significant topic in material science and dentistry as a novel approach for the treatment of dental caries or erosion. Amelogenin has been proven to be a critical protein for controlling the organized growth of apatite crystals. In this paper, we present a detailed protocol for superficial enamel reconstruction by using a novel amelogenin-chitosan hydrogel. Compared to other conventional treatments, such as topical fluoride and mouthwash, this method not only has the potential to prevent the development of dental caries but also promotes significant and durable enamel restoration. The organized enamel-like microstructure regulated by amelogenin assemblies can significantly improve the mechanical properties of etched enamel, while the dense enamel-restoration interface formed by an in situ regrowth of apatite crystals can improve the effectiveness and durability of restorations. Furthermore, chitosan hydrogel is easy to use and can suppress bacterial infection, which is the major risk factor for the occurrence of dental caries. Therefore, this biocompatible and biodegradable amelogenin-chitosan hydrogel shows promise as a biomaterial for the prevention, restoration, and treatment of defective enamel.

Development of Amelogenin-chitosan Hydrogel for In Vitro Enamel Regrowth with a Dense Interface

In this article, we describe a protocol for fabricating an amelogenin-chitosan hydrogel for superficial enamel reconstruction. Organized in situ growth of apatite crystals in the hydrogel formed a dense enamel-restoration interface, which will improve the effectiveness and durability of restorations.

Desenvolvimento de Amelogenina-quitosana Hidrogel para<em&gt; In Vitro</em&gt; Esmalte Regrowth Com uma interface Densa

Biomimetic enamel reconstruction is a significant topic in material science and dentistry as a novel approach for the treatment of dental caries or ...

Sealable Femtoliter Chamber Arrays for Cell-free Biology

Cell-free systems provide a flexible platform for probing specific networks of biological reactions isolated from the complex resource sharing (e.g., global gene expression, cell division) encountered within living cells. However, such systems, used in conventional macro-scale bulk reactors, often fail to exhibit the dynamic behaviors and efficiencies characteristic of their living micro-scale counterparts. Understanding the impact of internal cell structure and scale on reaction dynamics is crucial to understanding complex gene networks. Here we report a microfabricated device that confines cell-free reactions in cellular scale volumes while allowing flexible characterization of the enclosed molecular system. This multilayered poly(dimethylsiloxane) (PDMS) device contains femtoliter-scale reaction chambers on an elastomeric membrane which can be actuated (open and closed). When actuated, the chambers confine Cell-Free Protein Synthesis (CFPS) reactions expressing a fluorescent protein, allowing for the visualization of the reaction kinetics over time using time-lapse fluorescent microscopy. Here we demonstrate how this device may be used to measure the noise structure of CFPS reactions in a manner that is directly analogous to those used to characterize cellular systems, thereby enabling the use of noise biology techniques used in cellular systems to characterize CFPS gene circuits and their interactions with the cell-free environment.

A microfabricated device with sealable femtoliter-volume reaction chambers is described. This report includes a protocol for sealing cell-free protein synthesis reactants inside these chambers for the purpose of understanding the role of crowding and confinement in gene expression.

Arrays Sealable Femtoliter Câmara de Biologia livre-Cell

Cell-free systems provide a flexible platform for probing specific networks of biological reactions isolated from the complex resource sharing (e.g., ...

Creating a Structurally Realistic Finite Element Geometric Model of a Cardiomyocyte to Study the Role of Cellular Architecture in Cardiomyocyte Systems Biology

With the advent of three-dimensional (3D) imaging technologies such as electron tomography, serial-block-face scanning electron microscopy and confocal microscopy, the scientific community has unprecedented access to large datasets at sub-micrometer resolution that characterize the architectural remodeling that accompanies changes in cardiomyocyte function in health and disease. However, these datasets have been under-utilized for&#160;investigating the role of cellular architecture remodeling in cardiomyocyte function. The purpose of this protocol is to outline how to create an accurate finite element model of a cardiomyocyte using high resolution electron microscopy and confocal microscopy images. A detailed and accurate model of cellular architecture has significant potential to provide new insights into cardiomyocyte biology, more than experiments alone can garner. The power of this method lies in its ability to computationally fuse information from two disparate imaging modalities of cardiomyocyte ultrastructure to develop one unified and detailed model of the cardiomyocyte. This protocol outlines steps to integrate electron tomography and confocal microscopy images of adult male Wistar (name for a specific breed of albino rat) rat cardiomyocytes to develop a half-sarcomere finite element model of the cardiomyocyte. The procedure generates a 3D finite element model that contains an accurate, high-resolution depiction (on the order of ~35 nm) of the distribution of mitochondria, myofibrils and ryanodine receptor clusters that release the necessary calcium for cardiomyocyte contraction from the sarcoplasmic reticular network (SR) into the myofibril and cytosolic compartment. The model generated here as an illustration does not incorporate details of the transverse-tubule architecture or the sarcoplasmic reticular network and is therefore a minimal model of the cardiomyocyte. Nevertheless, the model can already be applied in simulation-based investigations into the role of cell structure in calcium signaling and mitochondrial bioenergetics, which is illustrated and discussed using two case studies that are presented following the detailed protocol.

This protocol outlines a novel method to create a spatially detailed finite element model of the intracellular architecture of cardiomyocytes from electron microscopy and confocal microscopy images. The power of this spatially detailed model is demonstrated using case studies in calcium signaling and bioenergetics.

Criando um modelo geométrico de elementos finitos estruturalmente realista de um casos para estudar o papel da arquitetura celular em casos de biologia de sistemas

With the advent of three-dimensional (3D) imaging technologies such as electron tomography, serial-block-face scanning electron microscopy and confocal ...

Measurement of Force-Sensitive Protein Dynamics in Living Cells Using a Combination of Fluorescent Techniques

Cells sense and respond to physical cues in their environment by converting mechanical stimuli into biochemically-detectable signals in a process called mechanotransduction. A crucial step in mechanotransduction is the transmission of forces between the external and internal environments. To transmit forces, there must be a sustained, unbroken physical linkage created by a series of protein-protein interactions. For a given protein-protein interaction, mechanical load can either have no effect on the interaction, lead to faster disassociation of the interaction, or even stabilize the interaction. Understanding how molecular load dictates protein turnover in living cells can provide valuable information about the mechanical state of a protein, in turn elucidating its role in mechanotransduction. Existing techniques for measuring force-sensitive protein dynamics either lack direct measurements of protein load or rely on the measurements performed outside of the cellular context. Here, we describe a protocol for the F&#246;rster resonance energy transfer-fluorescence recovery after photobleaching (FRET-FRAP) technique, which enables the measurement of force-sensitive protein dynamics within living cells. This technique is potentially applicable to any FRET-based tension sensor, facilitating the study of force-sensitive protein dynamics in variety of subcellular structures and in different cell types.

Here, we present a protocol for the simultaneous use of F&#246;rster resonance energy transfer-based tension sensors to measure protein load and fluorescence recovery after photobleaching to measure protein dynamics enabling the measurement of force-sensitive protein dynamics within living cells.

Medição da dinâmica de força-sensível da proteína em células vivas, usando uma combinação de técnicas fluorescentes

Cells sense and respond to physical cues in their environment by converting mechanical stimuli into biochemically-detectable signals in a process called ...

A Microfluidic Platform for Stimulating Chondrocytes with Dynamic Compression

Mechanical stimuli are known to modulate biological functions of cells and tissues. Recent studies have suggested that compressive stress alters growth plate cartilage architecture and results in growth modulation of long bones of children. To determine the role of compressive stress in bone growth, we created a microfluidic device actuated by pneumatic pressure, to dynamically (or statically) compress growth plate chondrocytes embedded in alginate hydrogel cylinders. In this article, we describe detailed methods for fabricating and characterizing this device. The advantages of our protocol are: 1) Five different magnitudes of compressive stress can be generated on five technical replicates in a single platform, 2) It is easy to visualize cell morphology via a conventional light microscope, 3) Cells can be rapidly isolated from the device after compression to facilitate downstream assays, and 4) The platform can be applied to study mechanobiology of any cell type that can grow in hydrogels.

This article provides detailed methods for fabricating and characterizing a pneumatically actuating microfluidic device for chondrocyte compression.

Uma plataforma Microfluídico para estimular condrócitos com compressão dinâmica

Mechanical stimuli are known to modulate biological functions of cells and tissues. Recent studies have suggested that compressive stress alters growth ...