Este trabalho é parcialmente apoiada por doações DA024558, DA30896, DA033892 e DA021471 do NIDA / NIH para CD. Reconhecemos também o G12MD007586 concessão RCMI, o Vanderbilt CTSA conceder UL1RR024975, o Meharry Translational Research Center (MeTRC) CTSA U54 concessão RR026140 do NCRR / NIH, o MD007593 concessão U54 do NIMHD / NIH, eo Tennessee CFAR P30 concessão AI110527.

Produção 1. Vírus NOTA: Para gerar títulos elevados de VIH-1 infeccioso, transfectar a linha celular de rim embrionário humano (HEK) 293T com um clone molecular infeccioso do HIV-1 usando um reagente de transfecção à base de dendrímero activado. Tem sido observado que o método de transfecção com fosfato de cálcio produz resultados comparáveis. <ol><li> Em um laboratório de Segurança Biológica Nível 2 (BSL2), semente de 3 x 10 6 293T células por placa de 10 cm em 8 ml de Dulbecco Modified Eagle Médium (DMEM) suplementado com 10% de Soro Fetal Bovino (FBS), penicilina e estreptomicina. Cultura das células numa incubadora a 37 ° C e 5% de CO 2 O / N. </li><li> No dia seguinte, as células para transfecção em cada placa de 10 cm, dilui-se 8 ug de DNA do plasmídeo pNL4-3 (ver Materiais Tabela) a um volume final de 300 ul de DMEM sem soro e antibióticos. Adicionar 80 ul de reagente de transfecção, misturar bem por pipetagem, e incubar à TA durante5 - 10 min para a formação do complexo de transfecção. </li><li> Remover o meio das placas por aspiração e adiciona 7 ml por placa de meio DMEM fresco contendo soro e antibióticos. </li><li> Adicionar 1 ml de DMEM contendo soro e antibióticos para o complexo de transfecção, misturar por pipetagem, e adicionar esta mistura para as células. Agite suavemente o prato para facilitar a distribuição uniforme dos complexos de transfecção. </li><li> Imediatamente transferir as células para o laboratório BSL3, lugar numa incubadora a 37 ° C e 5% de CO 2, e a cultura das células durante 48 h. </li><li> Recolhe-se o sobrenadante da cultura de tecido contendo vírus, utilizando uma pipeta e, em seguida, transferi-lo para um tubo de centrífuga. Centrifuga-se a 300 xg durante 5 min para sedimentar as células e detritos, e, em seguida, filtrar o sobrenadante através de um filtro de seringa de 0,45 um tamanho de poro. </li><li> Para eliminar qualquer ADN plasmídico transição nesta preparação de vírus livre de células, trata-se com ADNase 1 (20 ug / ml) a 37 ° C durante 1 h. </li><li> Para quantificar aHIV-1 título, utilizar o enzyme-linked Immunosorbent Assay específicos de p24 (ELISA), como é um método rápido e propícios para uso rotineiro 22. NOTA: Deve-se notar que o ensaio ELISA de p24 mede o título física (número de partículas de vírus). Alternativamente, a medição da actividade associada ao vírus RT (ensaio de RT exógeno) ou de infecciosidade do vírus (ensaios de infecciosidade baseados em linha de célula indicadora TZM-bl) irá fornecer leitura exclusiva de partículas de vírus infecciosas. </li></ol> 2. Infecção do vírus de células Sup-T1 (BSL3 Lab) <ol><li> Num laboratório BSL2, manter as células SUP-T1 entre 1,0 x 10 6 e 2,0 x 10 6 células / ml em Roswell Park Memorial Institute (RPMI) meio suplementado com 10% de FBS inactivado pelo calor, penicilina e estreptomicina (razão de divisão de 1 : 2 a cada 2-3 d). Reunir as células SUP-T1 a partir dos frascos de cultura, misturar bem por pipetagem, e determinar a contagem de células viáveis ​​utilizando um hemacitómetro e a exclusão de azul de tripano rMétodo aining. <ol><li> Prepara-se o número necessário de partes alíquotas de 80 x 10 6 células (por infecção pelo vírus) em 50 ml de tubos de centrífuga cónico. </li><li> Centrifugar as células em um rotor de balde a 500 xg e 25 ° C durante 5 min. Sem remover o meio de cultura celular, transferir os tubos contendo as células peletizadas para o laboratório BSL3 para processamento adicional. Aspirar cuidadosamente o meio de cultura de células a partir do tubo, sem perturbar o sedimento celular. </li></ol></li><li> Adicionar uma quantidade apropriada de inoculo de vírus tratada com ADNase I para as células no tubo e misturar bem por pipetagem suave. Durante 80 x 10 6 células, utilizar 30 ml de vírus tratada com ADNase I (50 ug de p24-vírus equivalente). NOTA: Isolamento de PICs funcional requer infectar as células-alvo com muito altas multiplicidades de infecção (MOI). </li><li> Distribua a mistura uniformemente entre duas placas de cultura de tecidos de 6 poços (ou seja, 12 alíquotas x 2,5 ml; usar 2 placas por infectaríon). </li><li> Para spinoculation, colocar as placas de cultura em suportes de pratos, e centrífuga utilizando um rotor basculante a 480 xg e 25 ° C durante 2 h. </li><li> Incubar as células a 37 spinoculated ° C e 5% de CO 2 durante 5 h. </li></ol> 3. colheita e lise de células infectadas (laboratório BSL3) <ol><li> Reunir as células correspondentes a cada infecção a partir das placas de cultura para um tubo de 50 mL cónico de centrifugação (~ 30 mL no total). </li><li> Colher as células por centrifugação a 300 xg e 25 ° C durante 10 min. Aspirar cuidadosamente o sobrenadante do tubo (em alternativa, usar uma pipeta). </li><li> Para remover todas as partículas virais residuais, lavar cada pelete de células por adição de 2 ml de tampão de K - / - (KCl 150 mM, HEPES 20 mM, pH 7,6, 5 mM de MgCl2) e centrifugando a amostra a 300 xg e 25 ° C durante 10 min. Em seguida, sem perturbar o sedimento, remover cuidadosamente o sobrenadante por aspiração ou usando uma pipeta. </li><li> REPEAt passo 3.3. </li><li> Cuidadosamente remover qualquer tampão residual, utilizando uma micropipeta. Ressuspender cada pelete de células em 2 ml de gelo-frio de tampão de lise de K + / + (tampão de K - / - suplementado com 0,025% de digitonina, DTT 1 mM, 20 ug / ml de aprotinina), misturar o conteúdo por pipetagem suave, e transferir para um 2 mL tubo de microcentrífuga. </li></ol> 4. Preparação de PICs Citoplasmáticas (laboratório BSL3) <ol><li> Balançar as amostras num agitador rotativo à temperatura ambiente durante 10 min. </li><li> Centrifugar as amostras, com o rotor pré-arref ecido a 4 ° C, a 1.500 xg e 4 ° C durante 4 min. </li><li> Sem perturbar o sedimento, transferir cuidadosamente o sobrenadante para um tubo de microcentrífuga fresco e centrifuga-se a 16.000 xg e 4 ° C durante 1 min. </li><li> Transferir cuidadosamente o sobrenadante para um tubo de microcentrifugação fresco. Adicionar RNase A (20 mg / ml) para uma concentração final de 20 ug / mL (2 mL para 2 mL de PICs) e incuba-se o conteúdo à TA durante 30 minutos (sem balanço). &lt;/ Li&gt; <li> Adicionar sacarose (60% w / v em tampão de K - / -) para uma concentração final de 7% e misturar bem por pipetagem suave. Preparar alíquotas (por exemplo, 200? L) de PICs em tubos de microcentrífuga, de flash por congelação em azoto líquido, e colocar num congelador de -80 ° C para armazenamento a longo prazo. </li></ol> 5. In Vitro Integração (IVI) Ensaios Usando HIV-1 PICs <ol><li> Prepara-se o ADN alvo utilizado no ensaio IVI por amplificação de uma região de 2,0 kb do DNA de plasmídeo com phiX174 PCR utilizando iniciadores feitos por medida, phiX174-F e phiX174-R. <ol><li> Montar a mistura de PCR como descrito na Tabela 1. Executar PCR num termociclador utilizando as condições de ciclos térmicos recomendadas na Tabela 2. Gel-purificar o produto de PCR utilizando um kit de purificação em gel (seguindo o protocolo recomendado pelo fabricante), e armazenar o ADN alvo purificado como alíquotas a -80 ° C até à sua utilização. </li></ol></li><li> Adicionar 600 ng de ADN alvo de 200 - &amp; #181; L alíquota de PICs, misturar bem e incubar a 37 ° C durante 45 min. Nota: As reacções IVI omitindo ADN alvo ou incluindo um inibidor de integrase (por exemplo, raltegravir) são recomendados reacções de controlo. </li><li> Parar a reacção por adição de IVI de SDS, EDTA e proteinase K para concentrações finais de 0,5%, 8 mM e 0,5 mg / mL, respectivamente. Misturar os conteúdos da reacção bem e incubar durante a noite a 56 ° C. </li><li> No dia seguinte, purificar o ADN total a partir da reacção IVI por extracção com fenol / clorofórmio e precipitação com etanol. Realizar todas as etapas de centrifugação a 16.000 xg e RT. </li><li> Adicionar um volume igual de fenol com a amostra desproteinizado, mistura-se vigorosamente por vortex e centrifugação durante 2 min. Cuidadosamente remover a fase aquosa superior e transferi-lo para um tubo fresco. </li><li> Repita o passo 5.5. Transferir a fase aquosa superior para um tubo fresco. </li><li> Adicionar um volume igual de 1: 1 fenol: mistura de clorofórmio, mistura-se vigorosamente por vortex, centrifugação e foR 2 min. Transferir a fase aquosa superior para um tubo fresco. </li><li> Adicionar um volume igual de clorofórmio, mistura-se vigorosamente em vortex, e centrifuga-se durante 2 min. Transferir a fase aquosa superior para um tubo fresco. </li><li> Para precipitar o DNA, adicionar glicogénio a uma concentração final de 0,1 mg / mL, 3 M de acetato de sódio a uma concentração final de 0,3 M e 2,5 volumes de etanol a 100% (arrefecido com gelo). Vortex para misturar, brevemente centrífuga para recolher o conteúdo, e colocar o tubo à temperatura de -80 ° CO / N. </li><li> No dia seguinte, centrifugar a amostra durante 30 min a 16000 xg e 4 ° C durante 30 min. Remova cuidadosamente o sobrenadante sem perturbar o sedimento. </li><li> Adicionar 500 ul de etanol a 80% (arrefecido com gelo) ao sedimento e centrifuga-se a 16.000 xg e 4 ° C durante 10 min. Secar o sedimento de DNA à TA e ressuspender completamente em 50 ul de água isenta de nuclease. Armazenar as amostras de ADN a -20 ° C. </li></ol> 6. Os ensaios de PCR para quantificar PIC Atividade <p class= &quot;Jove_content&quot;&gt; NOTA: O número de cópias de ADN de HIV-1 integrado no ADN alvo é quantificada por uma estratégia de PCR aninhada que emprega 2 conjuntos de iniciadores e 2 rondas sequenciais de PCR. <ol><li> Realizar a primeira ronda de PCR convencional utilizando iniciadores de segmentação da LTR viral e o ADN phiX174 (iniciadores LTR e phiX174, respectivamente) para amplificar as junções do ADN integrado de HIV-1. <ol><li> Monte da mistura de PCR da primeira rodada tal como descrito na Tabela 3. Montar uma mistura principal de todos os componentes, excluindo o ADN molde, dispensar-se alíquotas de 45 uL para dentro de tubos de PCR separadas, e adicionam-se 5 ul de DNA molde ou água livre de nuclease (controlo). </li><li> Executar PCR num termociclador utilizando as condições de ciclos térmicos recomendadas na Tabela 4. </li></ol></li><li> Realizar a segunda rodada qPCR utilizando iniciadores que ladeiam uma pequena região do LTR viral (LTR-R e primers LTR-U) para amplificar seletivamente as sequências vDNA integrados do primeiro-round produtos de PCR. Para determinar os números de cópias integradas vDNA, gerar uma curva padrão, utilizando 10x diluições em série de números de cópias conhecidos (por exemplo, 10 0 - 10 8) do clone molecular de VIH-1. <ol><li> Montar a mistura qPCR segunda rodada, conforme descrito na Tabela 5. Montar uma mistura principal de todos os componentes, excluindo o ADN molde, cuidadosamente dispensar 25 mL alíquotas para um número adequado de poços em um de 96 poços de PCR placa de reacção, e, em seguida, adicionam-se 5 mL da primeira ronda não purificada produtos de PCR ou água livre de nuclease (ao controle). Executar todas as reações de qPCR em triplicado. </li><li> Carregar a placa de PCR para o equipamento de PCR em tempo real e efectuar qPCR utilizando as condições de ciclização recomendadas na Tabela 6. </li><li> Analisar os dados utilizando um software adequado. </li></ol></li></ol>

<ol>
	<li>Sattentau, Q. J., Weiss, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CD4+antigen:+physiological+ligand+and+HIV+receptor.">The CD4 antigen: physiological ligand and HIV receptor.</a> Cell. 52 (5), 631-633 (1988).</li><li>Wilen, C. B., Tilton, J. C., Doms, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanisms+of+HIV+entry.">Molecular mechanisms of HIV entry.</a> Adv Exp Med Biol. 726, 223-242 (2012).</li><li>Bowerman, B., Brown, P. O., Bishop, J. M., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nucleoprotein+complex+mediates+the+integration+of+retroviral+DNA.">A nucleoprotein complex mediates the integration of retroviral DNA.</a> Genes Dev. 3 (4), 469-478 (1989).</li><li>Bukrinsky, M. I., Sharova, N., Dempsey, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Active+nuclear+import+of+human+immunodeficiency+virus+type+1+preintegration+complexes.">Active nuclear import of human immunodeficiency virus type 1 preintegration complexes.</a> Proc Natl Acad Sci. 9 (14), 6580-6584 (1992).</li><li>Hansen, M. S., Smith, G. J., Kafri, T., Molteni, V., Siegel, J. S., Bushman, F. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+complexes+derived+from+HIV+vectors+for+rapid+assays+in+vitro.">Integration complexes derived from HIV vectors for rapid assays in vitro.</a> Nature biotechnol. 17 (6), 578-582 (1999).</li><li>Farnet, C. M., Haseltine, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+of+human+immunodeficiency+virus+type+1+DNA+in+vitro.">Integration of human immunodeficiency virus type 1 DNA in vitro.</a> Proc Natl Acad Sci. 87 (11), 4164-4168 (1990).</li><li>Fujiwara, T., Mizuuchi, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+DNA+integration:+structure+of+an+integration+intermediate.">Retroviral DNA integration: structure of an integration intermediate.</a> Cell. 54 (4), 497-504 (1988).</li><li>Brown, P. O., Bowerman, B., Varmus, H. E., Bishop, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Correct+integration+of+retroviral+DNA+in+vitro.">Correct integration of retroviral DNA in vitro.</a> Cell. 49 (3), 347-356 (1987).</li><li>Lewinski, M. K., Bushman, F. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+DNA+integration--mechanism+and+consequences.">Retroviral DNA integration--mechanism and consequences.</a> Adv Genet. 55, 147-181 (2005).</li><li>Engelman, A., Mizuuchi, K., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV-1+DNA+integration:+mechanism+of+viral+DNA+cleavage+and+DNA+strand+transfer.">HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer.</a> Cell. 67 (6), 1211-1221 (1991).</li><li>Goff, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetics+of+retroviral+integration.">Genetics of retroviral integration.</a> Ann rev gen. 26, 527-544 (1992).</li><li>Panganiban, A. T., Temin, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+terminal+nucleotides+of+retrovirus+DNA+are+required+for+integration+but+not+virus+production.">The terminal nucleotides of retrovirus DNA are required for integration but not virus production.</a> Nature. 306 (5939), 155-160 (1983).</li><li>Bieniasz, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cell+biology+of+HIV-1+virion+genesis.">The cell biology of HIV-1 virion genesis.</a> Cell host microbe. 5 (6), 550-558 (2009).</li><li>Sherman, P. A., Fyfe, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+immunodeficiency+virus+integration+protein+expressed+in+Escherichia+coli+possesses+selective+DNA+cleaving+activity.">Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity.</a> Proc Natl Acad Sci. 87 (13), 5119-5123 (1990).</li><li>Katzman, M., Katz, R. A., Skalka, A. M., Leis, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+avian+retroviral+integration+protein+cleaves+the+terminal+sequences+of+linear+viral+DNA+at+the+in+vivo+sites+of+integration.">The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration.</a> J Virol. 63 (12), 5319-5327 (1989).</li><li>Craigie, R., Mizuuchi, K., Bushman, F. D., Engelman, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+in+vitro+assay+for+HIV+DNA+integration.">A rapid in vitro assay for HIV DNA integration.</a> Nucl acid res. 19 (10), 2729-2734 (1991).</li><li>Bushman, F. D., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activities+of+human+immunodeficiency+virus+(HIV)+integration+protein+in+vitro:+specific+cleavage+and+integration+of+HIV+DNA.">Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA.</a> Proc Natl Acad Sci. 88 (4), 1339-1343 (1991).</li><li>Pauza, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+bases+are+deleted+from+the+termini+of+HIV-1+linear+DNA+during+integrative+recombination.">Two bases are deleted from the termini of HIV-1 linear DNA during integrative recombination.</a> Virology. 179 (2), 886-889 (1990).</li><li>Engelman, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+analysis+of+HIV-1+preintegration+complexes.">Isolation and analysis of HIV-1 preintegration complexes.</a> Meth Mol Biol. 485, 135-149 (2009).</li><li>Engelman, A., Oztop, I., Vandegraaff, N., Raghavendra, N. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+HIV-1+preintegration+complexes.">Quantitative analysis of HIV-1 preintegration complexes.</a> Methods. 47 (4), 283-290 (2009).</li><li>Addai, A. B., Pandhare, J., Paromov, V., Mantri, C. K., Pratap, S., Dash, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cocaine+modulates+HIV-1+integration+in+primary+CD4++T+cells:+implications+in+HIV-1+pathogenesis+in+drug-abusing+patients.">Cocaine modulates HIV-1 integration in primary CD4+ T cells: implications in HIV-1 pathogenesis in drug-abusing patients.</a> J Leuk Biol. 97 (4), 779-790 (2015).</li><li>Wehrly, K., Chesebro, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=p24+antigen+capture+assay+for+quantification+of+human+immunodeficiency+virus+using+readily+available+inexpensive+reagents.">p24 antigen capture assay for quantification of human immunodeficiency virus using readily available inexpensive reagents.</a> Methods. 12 (4), 288-293 (1997).</li></ol>

Os autores declaram não competindo interesses financeiros e não financeiros.

análises bioquímicas de PICs retrovirais têm proporcionado uma visão crítica sobre o mecanismo de integração do DNA retroviral. Medição da actividade de integração de PICs retrovirais pode ser conseguida por ensaio de placas de formação, a análise de mancha de Southern, e nested qPCR. A estratégia experimental do ensaio de placa é trabalhoso e utiliza um método indirecto para medir a integração 6, 7, 18. Integração ensaios medida baseada Southern blot diretamente, mas exigem quantidades relativamente altas de PICs 6, 7, 18. Este relatório detalha uma estratégia qPCR aninhada para medir a atividade de integração do HIV-1 associada a PIC in vitro. A grande vantagem e significado deste método é a exigência de quantidades relativamente baixas de preparação PIC por reacção de 4, 5, 19. Os passos mais importantes do método são a geração de um vírus de título elevado de infecção e o manuseamento de preparação PIC. Deve notar-se aqui que o primeiro ciclo de PCR envolve a amplificação exponencial das junções de integração. Consequentemente, os números de cópias de integrada vDNA determinados na segunda rodada qPCR são semi-quantitativa e, portanto, têm a limitação de não dar uma medida de cópias vDNA associada à PIC. No entanto, o vDNA associada-PIC pode ser determinada por qPCR do ADN purificado a partir de PICs com primers específicos de LTR. A razão entre os números de cópias integradas vDNA ao vDNA associada-PIC correspondente pode fornecer informações sobre a eficiência da integração de uma reacção in vitro na integração. Este método pode ser modificado através da incorporação de outro ADN heteróloga alvo de escolha e outros iniciadores para detectar a integração em ambas as orientações. Em resumo, o métododescrito aqui mede a actividade de integração de PICs do VIH-1 quantitativamente e pode ser adoptado para a investigação desenvolvimento de uma compreensão dos detalhes bioquímicos da integração retroviral.

Replicação de HIV-1 na célula alvo envolve vários passos, agrupadas em duas fases: eventos precoces e tardias. Os eventos iniciais começam quando o HIV-1 liga-se a sequência do receptor de superfície da célula alvo CD4 e um dos dois co-receptores (CCR5 ou CXCR4) 1. Por conseguinte, o fusível membranas de células com vírus, e a cápside virai (CA) do núcleo é libertado para o citoplasma 2. O núcleo CA contenha o ARN virai genómico de cadeia simples (ssRNA) e várias proteínas, tanto virais e celulares na origem. As proteínas virais associadas-CA incluem Transcriptase Reversa (RT) e da integrase (IN), duas enzimas que medeiam passos críticos durante eventos precoces da replicação viral. A RT e IN função no contexto de complexos nucleoproteicos, nomeadamente a transcrição reversa Complexo (RTC) e o complexo de pré-integração (PIC), respectivamente 3, 4, 5 &lt;sup&gt;, 6. As extremidades do genoma viral ssRNA terminal do porto de repetição (R) elementos adjacentes às sequências U5 única (na extremidade 5 &#39;) e U3 (na extremidade 3&#39;). O RTC converte o genoma viral num ssRNA (DS) de cópia de ADN de cadeia dupla (vDNA). Este processo de transcrição reversa também resulta na duplicação das sequências U5 e U3, gerando, assim, repetições terminais longas (LTR) em ambas as extremidades do vDNA 7, 8. Subsequentemente, o EM-associado PIC catalisa duas reacções bioquímicas sequenciais que permitem a integração do vDNA no cromossoma do hospedeiro 9, 10, 11. Em primeiro lugar, no citoplasma, EM multímeros envolver ambas as LTRs 12 e clivar um dinucleótido de cada uma das extremidades 3 &#39;-terminal. Este processamento de extremidade 3 &#39;gera um grupo hidroxilo em cada extremidade 3&#39; (CA OH) do vDNA.Em seguida, o PIC trafica para o núcleo, em que utiliza o vDNA CA OH como um nucleófilo para cortar ambas as cadeias do ADN cromossómico de forma escalonada. Simultaneamente, EM coordenadamente emendas de ambas as extremidades do vDNA para as ligações fosfodiéster que resultam em cadeias opostas do ADN cromossómico. Após este passo de transferência de cadeia, a maquinaria da célula hospedeira remove os dois nucleótidos desemparelhados nas extremidades 5 &#39;do vDNA e repara as consequentes lacunas de cadeia simples na junção do local de integração. Os eventos iniciais, assim, culminar com a criação de uma cópia de DNA integrado (provírus) do HIV-1 genoma. O provírus proporciona um ambiente apropriado para a expressão do gene virai eficiente, o que inicia os eventos posteriores, incluindo a expressão das proteínas codificadas por vírus; montagem do vírus imaturo; e brotação, release, e maturação em viriões infecciosos 13. Purificada IN retroviral recombinante é competente pararealizar, in vitro, ambas as atividades de processamento e transferência de cadeia 3&#39;-end em exogenamente fornecido DNA substrato LTR-like. Os estudos bioquímicos usando tais IN recombinante purificada revelaram aspectos críticos da integração vDNA 14, 15, 16, 17. No entanto, ao contrário da infecção natural, esta reacção bioquímica in vitro não suporta integração combinada de ambas as extremidades do ADN substrato para a DNA-alvo. Em contraste, os PICs retrovirais isolados a partir de células infectadas de forma aguda concertadamente integrar ambas as extremidades do vDNA endógena no ADN alvo heterólogo. Isto levou à adopção generalizada e refinamentos subsequentes de ensaios in vitro Integração (IVI) I n usando PICs nativas isoladas. No primeiro ensaio relatado retroviral IVI, extractos citoplasmáticos de células infectadas com um recombinante de murinoVírus da Leucemia (MLV) que alberga o gene de E. coli supF na sua LTR serviu como fonte de actividade em, e o ADN de um fago lambda mutante defeituoso no crescimento lítico foi fornecido exogenamente como o ADN alvo. A integração bem sucedida do ADN recombinante MLV copiar para o ADN de fago e a expressão consequente supF levou a restauração da capacidade de formação de placas de fagos recombinantes. No entanto, esta estratégia experimental é a integração trabalhoso e medidas de forma indireta. Para lidar com estas advertências, um ensaio de marcação terminal indirecta à base de Southern blot, que quantifica a actividade associada IVI-PIC como uma medida da vDNA endógena exógeno integrado no bacteriófago linearizado phiX174 ADN, foi desenvolvido 6, 7, 18. Embora este método proporciona uma medida directa de eventos de integração, quantidades relativamente elevadas de preparação PIC são necessários, o que continua a ser um desafio técnicoesforço. Para contornar isso, aninhados ensaios baseados em PCR que exigem apenas quantidades modestas de PICs foram desenvolvidos 4, 5, 19. Neste relatório, nós descrevemos uma versão atualizada de um nested PCR baseado no método in vitro concebido para recapitular a atividade de integração do HIV-1 PIC-mediada que ocorrem durante a infecção natural. Este método utiliza os extractos citoplasmáticos de células alvo de HIV-1-infectadas como uma fonte de actividade PIC endógena, que é medido com um tempo real Polimerase Chain Reaction quantitativa (qPCR). Os procedimentos para isolar PICs e medir suas atividades de integração são adaptados, com modificações, a partir de protocolos publicados pelo laboratório Engelman 20. Neste método, a actividade de integração associada-PIC é iniciado, fornecendo um ADN alvo exógeno linear 21, e os produtos de DNA resultantesesta reacção integração são purificados e utilizados como material de partida para a quantificação baseado no PCR subsequente. Na primeira ronda de PCR convencional, as junções de ADN viral-alvo são amplificados utilizando iniciadores apropriados. Na segunda rodada qPCR, primers específicos de LTR são usadas para enriquecer especificamente a população vDNA do primeiro turno produtos de PCR. Por favor, consulte a seção de protocolo para uma descrição detalhada deste método. Estudos in vitro com PICs retrovirais têm conduzido a avanços significativos na compreensão do mecanismo de integração de ADN retroviral e no desenvolvimento de inibidores de NOS. Com base na recente foco maior sobre mapeamento de HIV-1 sites de integração, determinar o papel dos fatores virais e do hospedeiro na HIV-1 integração e desenvolvimento de novas drogas antivirais para o combate à resistência aos medicamentos, prevemos um aumento do interesse e uso generalizado de ensaios IVI , como o descrito no presente relatório. Este, por sua vez, levará afuturos aperfeiçoamentos no método, diversificando assim o alcance de suas aplicações.

<table align="left" border="1" cellpadding="0" cellspacing="0" style="width:679px;" width="679">
	<tbody>
		<tr>
			<td style="width:312px;">
			Fetal bovine serum (FBS)
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			10437-028
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:34px;">
			Heat-inactivated Fetal bovine serum (Hi-FBS)
			</td>
			<td style="width:198px;height:34px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;height:34px;">
			10438-026
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:42px;">
			Dulbecco&#8217;s modified Eagle&#8217;s medium (DMEM)
			
			</td>
			<td style="width:198px;height:42px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;height:42px;">
			11995-065
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Roswell Park Memorial Institute (RPMI) 1640 medium
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			11875-093
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Phosphate buffered saline (PBS) (1X)
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			20012-027
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Trypsin-EDTA (0.25%)
			
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			25200-056
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Penicillin-Streptomycin solution (100x)
			</td>
			<td style="width:198px;">
			Cellgro/Mediatech
			</td>
			<td style="width:138px;">
			30-002-CI
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HEK293T cells (293T)
			</td>
			<td style="width:198px;">
			American Type Culture Collection (ATCC)
			</td>
			<td style="width:138px;">
			CRL-3216
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HIV-1 proviral molecular clone pNL4-3
			</td>
			<td style="width:198px;">
			NIH AIDS Research and Reference Reagent Program
			
			</td>
			<td style="width:138px;">
			114
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			PolyFect transfection reagent
			</td>
			<td style="width:198px;">
			Qiagen
			</td>
			<td style="width:138px;">
			301107
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			DNase
			
			</td>
			<td style="width:198px;">
			Calbiochem/Merckmillipore
			</td>
			<td style="width:138px;">
			260913
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Immulon 2HB 96-well plates
			
			</td>
			<td style="width:198px;">
			Thermo Scientific
			
			</td>
			<td style="width:138px;">
			3455
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Triton X-100
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			T9284
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			ELISA coating antibody: anti-CA-183-H12-5C monoclonal antibody
			</td>
			<td style="width:198px;">
			NIH AIDS Research and Reference Reagent Program
			
			</td>
			<td style="width:138px;">
			1513
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			ELISA wash solution (0.2% Tween-20 in PBS)
			</td>
			<td style="width:198px;">
			---
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Donor bovine serum
			</td>
			<td style="width:198px;">
			&#160;Gibco/Invitrogen
			</td>
			<td style="width:138px;">
			16030074
			
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:78px;">
			Blocking Buffer (5% donor bovine serum in PBS) - Prepare fresh before use.
			
			</td>
			<td style="width:198px;height:78px;">
			---
			</td>
			<td style="width:138px;height:78px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Sample diluent (SD) buffer (10% donor bovine serum and 0.5% Triton X-100 in PBS) - Sterilize using 0.22 micron pore-size syringe filter and store aliquots at 4&#176;C.
			
			</td>
			<td style="width:198px;">
			---
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Recombinant p24 protein
			(Full-length CA protein was expressed from pET21a-CA plasmid in E. coli BL21-DE3 and purified as described in Ref # ----)
			</td>
			<td style="width:198px;">
			Dr. Wesley Sundquist
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HIV IgG
			</td>
			<td style="width:198px;">
			NIH AIDS Research and Reference Reagent Program
			
			</td>
			<td style="width:138px;">
			3957
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Goat anti-human IgG (H+L) cross-adsorbed secondary antibody, HRP conjugate
			</td>
			<td style="width:198px;">
			Pierce/ThermoFisher
			
			</td>
			<td style="width:138px;">
			31412
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			TMB Microwell Peroxidase substrate system
			</td>
			<td style="width:198px;">
			KPL, Inc.
			</td>
			<td style="width:138px;">
			50-76-00
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			SupT1 cells
			</td>
			<td style="width:198px;">
			American Type Culture Collection (ATCC)
			</td>
			<td style="width:138px;">
			CRL-1942
			
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HEPES pH 7.2-7.5
			(ready-to-use solution)
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			15630-080
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Potassium chloride (KCl) solution
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			60142
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Magnesium chloride (MgCl2) solution
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			M1028
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Dithiothreitol (DTT)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			43815
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Aprotinin
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			A6106
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Digitonin
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			D141
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			RNase A
			</td>
			<td style="width:198px;">
			Invitrogen
			</td>
			<td style="width:138px;">
			12091-021
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:29px;">
			Sucrose
			</td>
			<td style="width:198px;height:29px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;height:29px;">
			S0389
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			phiX174 Replicative Form 1 DNA
			</td>
			<td style="width:198px;">
			Promega
			</td>
			<td style="width:138px;">
			D1531
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			PhiX174-F primer:
			5&#8217;-CGCTTCCATGACGCAGAAGTT-3&#8217;
			
			PhiX174-R primer:
			5&#8217;-CACTGACCCTCAGCAATCTTA-3&#8217;
			
			
			</td>
			<td style="width:198px;">
			Invitrogen and/or IDT-DNA
			</td>
			<td style="width:138px;">
			
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			dNTP mix
			</td>
			<td style="width:198px;">
			Promega
			</td>
			<td style="width:138px;">
			U1515
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Go Taq DNA Polymerase
			</td>
			<td style="width:198px;">
			Promega
			</td>
			<td style="width:138px;">
			M3005
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Qiaquick gel extraction kit
			</td>
			<td style="width:198px;">
			Qiagen
			</td>
			<td style="width:138px;">
			28706
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Ultrapure distilled water
			</td>
			<td style="width:198px;">
			Invitrogen
			</td>
			<td style="width:138px;">
			10977-015
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Tris-EDTA (TE) buffer (100X)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			T9285
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Sodium dodecyl sulphate (SDS)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			L3771
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:50px;">
			Ethylenediamine tetraacetic acid, disodium salt (EDTA) solution, 0.5 M, pH 8.0
			</td>
			<td style="width:198px;height:50px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;height:50px;">
			E7889
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Proteinase K (20 mg/ml ready-to-use solution)
			</td>
			<td style="width:198px;">
			Qiagen
			</td>
			<td style="width:138px;">
			19131
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Phenol (equilibrated with 10&#160;mM Tris HCl, pH&#160;8.0 and 1&#160;mM EDTA)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			P4557
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Chloroform
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			288306
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Glycogen (5 mg/ml solution)
			</td>
			<td style="width:198px;">
			Ambion/Invitrogen
			</td>
			<td style="width:138px;">
			AM9510
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Sodium acetate (3M, pH 5.2)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			57899
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Ethanol
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			E7023
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			First round LTR primer:
			5&#8217;-GTGCGCGCTTCAGCAAG-3&#8217;)
			First round phiX174 primer:
			5&#8217;-CACTGACCCTCAGCAATCTTA-3&#8217;
			</td>
			<td style="width:198px;">
			Invitrogen and/or IDT-DNA
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Second round LTR-R primer:
			5&#8217;-TCTGGCTAACTAGGGAACCCA-3&#8217;
			Second round LTR-U primer:
			5&#8217;-CTGACTAAAAGGGTCTGAGG-3&#8217;;
			
			Second round Taqman probe:
			&#160;5&#8217;-56- FAM/TTAAGCCTCAATAAAGCTTGC
			CTTGAGTGC/36-TAMRA/-3&#8217;
			</td>
			<td style="width:198px;">
			Invitrogen and/or IDT-DNA
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			iQ Supermix
			</td>
			<td style="width:198px;">
			Bio-Rad
			</td>
			<td style="width:138px;">
			170-8862
			</td>
		</tr>
	</tbody>
</table>

measurement of in vitro integration activity of hiv-1 preintegration complexes

proteínas de HIV-1 envelope envolver receptores cognatos na superfície da célula-alvo, o que leva a fusão da membrana da célula virai seguida pela libertação do núcleo da cápside virai (CA) para o citoplasma. Subsequentemente, a transcriptase reversa virai (RT), como parte de um complexo homónimo nucleoproteína denominado o complexo Transcrição Reversa (RTC), converte o genoma de ARN viral de cadeia simples em uma cópia de ADN de cadeia dupla (vDNA). Isto leva a biogénese de outro complexo de nucleoproteínas, denominado o complexo de pré-integração (PIC), composto do vDNA e proteínas de vírus associados e factores do hospedeiro. A integrase viral associada-PIC (EM) orquestra a integração do vDNA no ADN cromossómico do hospedeiro em um processo de duas etapas espacialmente e temporalmente regulado. Em primeiro lugar, o nos processos de extremidades 3 &#39;do vDNA no citoplasma e, em segundo lugar, após o PIC trafica para o núcleo, que medeia a integração do vDNA processado no ADN cromossómico. Os PICs isoladoa partir de células-alvo infectados de forma aguda com HIV-1 são funcionais in vitro, uma vez que são competentes para integrar o vDNA associado num ADN alvo heterólogo adicionado exogenamente. Tal-PIC com base em ensaios in vitro de integração têm contribuído significativamente para delinear os detalhes mecanicistas de integração retroviral e descobrindo em inibidores. Neste relatório, nós elaboramos sobre um ensaio PIC HIV-1 actualizado que emprega uma estratégia baseada aninhada em tempo real Polymerase Chain Reaction quantitativa (qPCR) para medir a atividade de integração in vitro de PICs nativas isoladas.

O isolamento do VIH-1 PICs Um esquema do protocolo usado para o isolamento de PICs do VIH-1 a partir de células SUP-T1 infectados de forma aguda é representada na Figura 1. Este protocolo é derivado a partir dos métodos descritos por Engelman et ai. 19, 20. PICs do VIH-1 são complexos nucleoproteicos que são montados em células infectadas e são compostos da vDNA transcrito reversamente, proteínas virais e factores celulares 19, 20. O método descrito neste relatório utiliza os extractos citoplasmáticos de células HIV-1 infectadas como fonte de actividade de integração associada-PIC. Em integração actividade in vitro de PICs do VIH-1 Figura 2. Este método utiliza uma estratégia baseada-qPCR aninhada para medir a actividade associada IVI-PIC, e os procedimentos são adaptados, com modificações, a partir de protocolos publicados pelo laboratório Engelman 19, 20, 21. Neste método, a actividade de integração associada-PIC é iniciado, fornecendo um ADN alvo heterólogo linear 21, e os produtos de DNA resultantes desta reacção de integração são purificadas e utilizadas como material de partida para a quantificação baseado no PCR subsequente. Na primeira ronda de PCR convencional, as junções de ADN viral-alvo são amplificados utilizando iniciadores apropriados. Na segunda rodada qPCR, primers específicos de LTR são usadas para enriquecer especificamente a população vDNA do primeiro turno produtos de PCR. Por favor, veja o protocolo sexão para uma descrição detalhada deste método. Os resultados representativos de um ensaio IVI realizada utilizando o HIV-1 PICs são mostrados na Figura 3. As células SUP-T1 (80 x 10 6 células / infecção) foram spinoculated com 30 ml de DNase 1 tratadas com VIH-1 (~ 50 ug de p24 equivalente) na ausência ou na presença de 1 uM de HIV-1 EM inibidor raltegravir em 480 xg e 25 ° C durante 2 h. As células foram subsequentemente cultivadas durante 5 h a 37 ° C e 5% de CO 2. PICs foram isolados como descrito na secção de protocolo. As reacções foram realizadas IVI, cada uma usando 200 ul de PICs e 600 ng de ADN alvo (um fragmento de DNA de 2 kb amplificado a partir de ADN phiX174 por PCR), a 37 ° C durante 45 min. As reacções foram desproteinizadas por tratamento com proteinase K na presença de SDS e EDTA a 56 ° CO / N. Os produtos da reacção foram extraídos duas vezes com fenol, uma vez com um fenol: clorofórmio (1: 1) mistura, e uma vezcom clorofórmio. Subsequentemente, o DNA foi precipitado de etanol na presença de sal e o glicogénio co-precipitante, e o sedimento de DNA foi lavado uma vez com etanol a 80%. O ADN purificado foi ressuspenso em 50 ul de água isenta de nuclease. Uma estratégia qPCR aninhado foi usada para determinar o número de vDNA integrado no ADN phiX174. Na primeira ronda de PCR convencional, os iniciadores complementares das sequências de DNA alvo e phiX174 região LTR virais foram usadas para amplificar as junções de ADN viral-alvo integrados a partir de 5 ul dos produtos de reacção de ADN integração. Na segunda rodada qPCR, primers LTR-abrangendo foram utilizados para amplificar exclusivamente as sequências de DNA específicas para o HIV a partir de 5 mL da primeira rodada produtos amplicon e de 10 diluições em série de números de cópias conhecidas (10 8 -10 0) do clone molecular de HIV-1 (Padrões). Todas as reacções de qPCR foram realizadas em triplicado e os dados WERe analisados ​​utilizando software comercial. Os valores determinados a partir dos padrões foram representadas graficamente para gerar uma curva padrão, a partir dos quais os números de cópias integradas vDNA foram interpolados. As barras de erro representam os desvios padrão. Como mostrado na Figura 3, os PICs do VIH-1 integrar robustamente o vDNA associado ao ADN alvo (pista 5). Importante, a eficiência de PICs IVI foi grandemente reduzida em reacções suplementadas com o inibidor EM raltegravir (Pista 6). Isto atribui fortemente a actividade de integração medido neste ensaio anti-HIV-1 EM. Além disso, as reacções de controlo contendo lisados ​​citoplasmáticos de células não infectadas (pista 1), pics sozinho (pista 2), o ADN alvo sozinha (pista 3), e o tampão sozinho (pista 4) não mostrou qualquer actividade de integração. Além disso, o controle que excluídos Taq polimerase no primeiro ciclo de PCR (pista 7) não amplificam produtos de integração. Nomeadamente, os dados do PICs-alone controlo (pista 2) indicou que a estratégia aninhada específi qPCRcamente mede a vDNA integrada, mas não o vDNA associada à PIC. Colectivamente, estes dados demonstram a medição da actividade de integração associada-PIC. <img alt="figura 1" src="/files/ftp_upload/54581/54581fig1.jpg" /> Figura 1: Representação esquemática do protocolo para a preparação de HIV-1 PICs. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54581/54581fig1large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> extractos citoplasmáticos contendo PICs são isolados a partir de células SUP-T1 HIV-1 infectadas. Estes PICs são utilizados como fonte de actividade de integração no ensaio de integração in vitro. <img alt="Figura 2" src="/files/ftp_upload/54581/54581fig2.jpg" /> Figura 2: Representação esquemática da In Vitro </e<html> m&gt; Ensaio de Integração de PICs do VIH-1. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54581/54581fig2large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> Os ensaios de integração foram realizados in vitro, utilizando HIV-1 PICs e o alvo de ADN heterólogo phiX174. O ADN de VIH-1 integrado foi medida através de uma estratégia de PCR aninhada, em que o primeiro ciclo de PCR convencional amplifica as junções de integração a partir dos quais as sequências específicas-vDNA são preferencialmente amplificados numa segunda ronda qPCR. <img alt="Figura 3" src="/files/ftp_upload/54581/54581fig3.jpg" /> Figura 3: HIV-1 PIC-associado atividade de integração vDNA. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54581/54581fig3large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> &quot;FO: manter-together.within-page =&quot; 1 &quot;&gt; Os resultados representativos do ensaio de actividade de integração do HIV-1 PIC-associados Os vDNA integrados copiar números foram determinados traçando os valores derivados de uma curva padrão gerada utilizando diluições em série de 10x. números de cópias conhecidos de um clone molecular de HIV-1. Todas as reacções foram realizadas em triplicado e os dados foram analisados ​​utilizando o software comercial. as barras de erro representam os desvios padrão. <table fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Componente </td><td> estoque </td><td> O volume final de reacção de 50 ul </td></tr><tr><td> DNA de plasmídeo phiX174 </td><td> 10 ng / mL </td><td> 5,0 mL </td></tr><tr><td> tampão de reacção GoTaq </td><td> 5x </td><td> 10,0 mL </td></tr><tr><td> mix de nucleotídeos dNTP </td><td> 10 mm em cada </td&gt; <td> 1,0 mL </td></tr><tr><td> phiX174-F iniciador </td><td> 10 μm </td><td> 2,5 mL </td></tr><tr><td> phiX174-R iniciador </td><td> 10 μm </td><td> 2,5 mL </td></tr><tr><td> GoTaq ADN Polimerase </td><td> (5 U / uL) </td><td> 0,25 mL </td></tr><tr><td> água destilada livre de nuclease </td><td> - </td><td> 28.75 mL </td></tr></tbody></table> Tabela 1. <table fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 95 ° C = 2 min </td></tr><tr><td> Ciclo 34 repetições de: 95 ° C = 30 s 53 ° C = 30 s 72 ° C = 2 min </td></tr><tr><td> 72 ° C = 10 min </td></tr><tr><td> 4 ° C = Reter </td></tr></tbody></table> Mesa 2. <table fo: manter-together.within-page = &quot;1&quot; fo: manter-com-next.within-page = &quot;always&quot;&gt; <tbody><tr><td> Componente </td><td> estoque </td><td> O volume final de reacção de 50 ul </td></tr><tr><td> produto de DNA reacção IVI </td><td> - </td><td> 5,0 mL </td></tr><tr><td> tampão de reacção GoTaq </td><td> 5x </td><td> 10,0 mL </td></tr><tr><td> mix de nucleotídeos dNTP </td><td> 10 mm em cada </td><td> 1,0 mL </td></tr><tr><td> LTR iniciador </td><td> 10 μm </td><td> 2,5 mL </td></tr><tr><td> phiX174 iniciador </td><td> 10 μm </td><td> 2,5 mL </td></tr><tr><td> GoTaq ADN Polimerase </td><td> (5 U / uL) </td><td> 0,25 mL </td></tr><tr><td> água destilada livre de nuclease </td><td> - </td><td> 28.75 mL </td></tr></tbody></table> Tabela 3. <table fo:keep-together.within-page = &quot;1&quot; fo: manter-com-next.within-page = &quot;always&quot;&gt; <tbody><tr><td> 95 ° C = 5 min </td></tr><tr><td> Ciclo 23 repetições de: 94 ° C = 30 s 55 ° C = 30 s 72 ° C = 4 min </td></tr><tr><td> 72 ° C = 10 min </td></tr><tr><td> 4 ° C = Reter </td></tr></tbody></table> Tabela 4. <table fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Componente </td><td> estoque </td><td> O volume final de reacção de 30 ul </td></tr><tr><td> 1 produtos de PCR rodada st </td><td> - </td><td> 5,0 mL </td></tr><tr><td> LTR-R iniciador </td><td> 10 μm </td><td> 0,9 mL </td></tr><tr><td> LTR-L iniciador </td><td> 10 μm </td><td> 0,9 mL </td></tr><tr> &lt;td&gt; Probe Taqman </td><td> 10 μm </td><td> 0,3 mL </td></tr><tr><td> iQ Supermix </td><td> 2x </td><td> 15,0 mL </td></tr><tr><td> água destilada livre de nuclease </td><td> - </td><td> 7,9 mL </td></tr></tbody></table> Tabela 5. <table fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 95 ° C = 3 min </td></tr><tr><td> Ciclo 39 repetições de: 94 ° C = 15 s 58 ° C = 30 s 72 ° C = 30 s placa Leia </td></tr></tbody></table> Tabela 6.

Watch this Scientific Journal Video about Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes at JoVE.com

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

This report describes an in vitro assay for measuring the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC)-associated integration activity in the cytoplasmic extracts of acutely infected cells. The integration of PIC-associated HIV-1 DNA into heterologous target DNA is quantified by using a nested real-time polymerase chain reaction strategy.

Medição de<em&gt; In Vitro</em&gt; Actividade integração do HIV-1 de pré-integração Complexos

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the ...

measurement-vitro-integration-activity-hiv-1-preintegration

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

7.4K visualizações.  Meharry Medical College. This report describes an in vitro assay for measuring the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC)-associated integration activity in the cytoplasmic extracts of acutely infected cells. The integration of PIC-associated HIV-1 DNA into heterologous target DNA is quantified by using a nested real-time polymerase chain reaction strategy. 

Vídeo: Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her viral population uses the CCR5 coreceptor for cellular entry, and not an alternative coreceptor. One approach to tropism testing is to examine the sequence of the V3 region of the HIV envelope, which interacts with the coreceptor.
Methods: Viral RNA is extracted from blood plasma. The V3 region is amplified in triplicate with nested reverse transcriptase-PCR. The amplifications are then sequenced and analyzed using the software, RE_Call. Sequences are then submitted to a bioinformatic algorithm such as geno2pheno to infer viral tropism from the V3 region. Sequences are inferred to be non-R5 if their geno2pheno false positive rate falls below 5.75%. If any one of the three sequences from a sample is inferred to be non-R5, the patient is unlikely to respond to a CCR5-antagonist.

HIV tropism can be inferred from the V3 region of the viral envelope. V3 is PCR amplified in triplicate using nested RT-PCR, sequenced, and interpreted using bioinformatic software. Samples with with 1 or more sequence(s) with low g2P scores are classified as non-R5 virus.

Inferência genotípica do HIV-1 Tropismo Usando de base populacional de Seqüenciamento V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

Imunologia e Infecção

In vitro Uncoating of HIV-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is composed of CA protein arranged as a lattice of hexagon. The capsid is closed by 7 pentamers at the broad end and 5 at the narrow end of the cone1, 2. Encased in this capsid shell is the viral ribonucleoprotein complex, and together they comprise the core.
Following fusion of the viral membrane with the target cell membrane, the HIV-1 is released into the cytoplasm. The capsid then disassembles releasing free CA in the soluble form3 in a process referred to as uncoating. The intracellular location and timing of HIV-1 uncoating are poorly understood. Single amino-acid substitutions in CA that alter the stability of the capsid also impair the ability of HIV-1 to infect cells4. This indicates that the stability of the capsid is critical for HIV-1 infection.
HIV-1 uncoating has been difficult to study due to lack of availability of sensitive and reliable assays for this process. Here we describe a quantitative method for studying uncoating in vitro using cores isolated from infectious HIV-1 particles. The approach involves isolation of cores by sedimentation of concentrated virions through a layer of detergent and into a linear sucrose gradient, in the cold. To quantify uncoating, the isolated cores are incubated at 37&deg;C for various timed intervals and subsequently pelleted by ultracentrifugation. The extent of uncoating is analyzed by quantifying the fraction of CA in the supernatant. This approach has been employed to analyze effects of viral mutations on HIV-1 capsid stability4, 5, 6. It should also be useful for studying the role of cellular factors in HIV-1 uncoating.

In vitro Uncoating of HIV-1 Cores

Uncoating is an essential step in the early phase of the HIV-1 life cycle and is defined as the disassembly of the capsid shell and the release of the viral ribonucleoprotein complex (vRNP). Here, we demonstrate techniques for isolating intact cores from HIV-1 virions and for quantifying their uncoating in vitro.

Em desencapsulamento vitro do HIV-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is ...

Imaging of HIV-1 Envelope-induced Virological Synapse and Signaling on Synthetic Lipid Bilayers

Human immunodeficiency virus type 1 (HIV-1) infection occurs most efficiently via cell to cell transmission2,10,11. This cell to cell transfer between CD4+ T cells involves the formation of a virological synapse (VS), which is an F-actin-dependent cell-cell junction formed upon the engagement of HIV-1 envelope gp120 on the infected cell with CD4 and the chemokine receptor (CKR) CCR5 or CXCR4 on the target cell 8. In addition to gp120 and its receptors, other membrane proteins, particularly the adhesion molecule LFA-1 and its ligands, the ICAM family, play a major role in VS formation and virus transmission as they are present on the surface of virus-infected donor cells and target cells, as well as on the envelope of HIV-1 virions1,4,5,6,7,13. VS formation is also accompanied by intracellular signaling events that are transduced as a result of gp120-engagement of its receptors. Indeed, we have recently showed that CD4+ T cell interaction with gp120 induces recruitment and phosphorylation of signaling molecules associated with the TCR signalosome including Lck, CD3&zeta;, ZAP70, LAT, SLP-76, Itk, and PLC&gamma;15.
In this article, we present a method to visualize supramolecular arrangement and membrane-proximal signaling events taking place during VS formation. We take advantage of the glass-supported planar bi-layer system as a reductionist model to represent the surface of HIV-infected cells bearing the viral envelope gp120 and the cellular adhesion molecule ICAM-1. The protocol describes general procedures for monitoring HIV-1 gp120-induced VS assembly and signal activation events that include i) bi-layer preparation and assembly in a flow cell, ii) injection of cells and immunofluorescence staining to detect intracellular signaling molecules on cells interacting with HIV-1 gp120 and ICAM-1 on bi-layers, iii) image acquisition by TIRF microscopy, and iv) data analysis. This system generates high-resolution images of VS interface beyond that achieved with the conventional cell-cell system as it allows detection of distinct clusters of individual molecular components of VS along with specific signaling molecules recruited to these sub-domains.

This article describes a method to visualize formation of an HIV-1 envelope-induced virological synapse on glass supported planar bilayers by total internal reflection fluorescence (TIRF) microscopy. The method can also be combined with immunofluorescence staining to detect activation and redistribution of signaling molecules that occur during HIV-1 envelope-induced virological synapse formation.

Imagem do HIV-1 Synapse Envelope induzida virológica e Sinalização em bicamadas lipídicas sintéticas

Human immunodeficiency virus type 1 (HIV-1) infection occurs most efficiently via cell to cell transmission2,10,11. This cell to cell transfer between ...

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

Plasmodium falciparum, the causative agent of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important health problems worldwide, being responsible for a total of 4 million deaths annually1. Due to their extensive overlap in developing regions, especially Sub-Saharan Africa, co-infections with malaria and HIV-1 are common, but the interplay between the two diseases is poorly understood. Epidemiological reports have suggested that malarial infection transiently enhances HIV-1 replication and increases HIV-1 viral load in co-infected individuals2,3. Because this viremia stays high for several weeks after treatment with antimalarials, this phenomenon could have an impact on disease progression and transmission.
The cellular immunological mechanisms behind these observations have been studied only scarcely. The few in vitro studies investigating the impact of malaria on HIV-1 have demonstrated that exposure to soluble malarial antigens can increase HIV-1 infection and reactivation in immune cells. However, these studies used whole cell extracts of P. falciparum schizont stage parasites and peripheral blood mononuclear cells (PBMC), making it hard to decipher which malarial component(s) was responsible for the observed effects and what the target host cells were4,5. Recent work has demonstrated that exposure of immature monocyte-derived dendritic cells to the malarial pigment hemozoin increased their ability to transfer HIV-1 to CD4+ T cells6,7, but that it decreased HIV-1 infection of macrophages8. To shed light on this complex process, a systematic analysis of the interactions between the malaria parasite and HIV-1 in different relevant human primary cell populations is critically needed.
Several techniques for investigating the impact of HIV-1 on the phagocytosis of micro-organisms and the effect of such pathogens on HIV-1 replication have been described. We here present a method to investigate the effects of P. falciparum-infected erythrocytes on the replication of HIV-1 in human primary monocyte-derived macrophages. The impact of parasite exposure on HIV-1 transcriptional/translational events is monitored by using single cycle pseudotyped viruses in which a luciferase reporter gene has replaced the Env gene while the effect on the quantity of virus released by the infected macrophages is determined by measuring the HIV-1 capsid protein p24 by ELISA in cell supernatants.

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

We have developed an in vitro malaria-HIV-1 co-infection model to study the impact of Plasmodium falciparum on the HIV-1 replicative cycle in human primary monocyte-derived macrophages. This versatile system can easily be adapted to other primary cell types susceptible to HIV-1 infection.

Um<em&gt; In vitro</em&gt; Modelo de Co-infecção para Estudar<em&gt; Plasmodium falciparum</em&gt;-HIV-1 Interacções em monócitos humanos primários derivados de células imunes

Plasmodium falciparum, the causative agent  of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important ...

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.

A Enzima de Restrição método baseado Clonagem para avaliar a<em&gt; In vitro</em&gt; Replicação Capacidade de HIV-1 do subtipo C gag-MJ4 quiméricos Vírus

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target ...

Conformational Evaluation of HIV-1 Trimeric Envelope Glycoproteins Using a Cell-based ELISA Assay

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins are able to fuel the fusion process through their conformational changes could lead to the design of better, more effective immunogens for vaccine strategies. Here we describe a cell-based ELISA assay that allows studying the recognition of trimeric HIV-1 Env by monoclonal antibodies. Following expression of HIV-1 trimeric Env at the surface of transfected cells, conformation specific anti-Env antibodies are incubated with the cells. A horseradish peroxidase-conjugated secondary antibody and a simple chemiluminescence reaction are then used to detect bound antibodies. This system is highly flexible and can detect Env conformational changes induced by soluble CD4 or cellular proteins. It requires minimal amount of material and no highly-specialized equipment or know-how. Thus, this technique can be established for medium to high throughput screening of antigens and antibodies, such as newly-isolated antibodies.

Understanding viral surface antigens conformations is required to evaluate antibody neutralization and guide the design of effective vaccine immunogens. Here we describe a cell-based ELISA assay that allows the study of the recognition of trimeric HIV-1 Env expressed at the surface of transfected cells by specific anti-Env antibodies.

Avaliação conformacional do HIV-1 trimérico glicoproteínas do envelope Usando um ELISA Ensaio Celular

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins ...

Isolation of Exosomes from the Plasma of HIV-1 Positive Individuals

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. They are found in a number of biological fluids and are known to carry a variety of proteins, lipids, and nucleic acid molecules. Originally thought to be little more than reservoirs for cellular debris, the roles of exosomes regulating biological processes and in diseases are increasingly appreciated.
Several methods have been described for isolating exosomes from cellular culture media and biological fluids. Due to their small size and low density, differential ultracentrifugation and/or ultrafiltration are the most commonly used techniques for exosome isolation. However, plasma of HIV-1 infected individuals contains both exosomes and HIV viral particles, which are similar in size and density. Thus, efficient separation of exosomes from HIV viral particles in human plasma has been a challenge.
To address this limitation, we developed a procedure modified from Cantin et. al., 2008 for purification of exosomes from HIV particles in human plasma. Iodixanol velocity gradients were used to separate exosomes from HIV-1 particles in the plasma of HIV-1 positive individuals. Virus particles were identified by p24 ELISA. Exosomes were identified on the basis of exosome markers acetylcholinesterase (AChE), and the CD9, CD63, and CD45 antigens. Our gradient procedure yielded exosome preparations free of virus particles. The efficient purification of exosomes from human plasma enabled us to examine the content of plasma-derived exosomes and to investigate their immune modulatory potential and other biological functions.

Techniques describing a gradient procedure to separate exosomes from human immunodeficiency virus (HIV) particles are described. This procedure was used to isolate exosomes away from HIV particles in human plasma from HIV-infected individuals. The isolated exosomes were analyzed for cytokine/chemokine content.

Isolamento de exossomas a partir do plasma de indivíduos HIV-1 positivos

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. ...

Visualization of HIV-1 Gag Binding to Giant Unilamellar Vesicle (GUV) Membranes

The structural protein of HIV-1, Pr55Gag (or Gag), binds to the plasma membrane in cells during the virus assembly process. Membrane binding of Gag is an essential step for virus particle formation, since a defect in Gag membrane binding results in severe impairment of viral particle production. To gain mechanistic details of Gag-lipid membrane interactions, in vitro methods based on NMR, protein footprinting, surface plasmon resonance, liposome flotation centrifugation, or fluorescence lipid bead binding have been developed thus far. However, each of these in vitro methods has its limitations. To overcome some of these limitations and provide a complementary approach to the previously established methods, we developed an in vitro assay in which interactions between HIV-1 Gag and lipid membranes take place in a &#34;cell-like&#34; environment. In this assay, Gag binding to lipid membranes is visually analyzed using YFP-tagged Gag synthesized in a wheat germ-based in vitro translation system and GUVs prepared by an electroformation technique. Here we describe the background and the protocols to obtain myristoylated full-length Gag proteins and GUV membranes necessary for the assay and to detect Gag-GUV binding by microscopy.

Visualization of HIV-1 Gag Binding to Giant Unilamellar Vesicle GUV Membranes

We illustrate here an in vitro membrane binding assay in which interactions between HIV-1 Gag and lipid membranes are visually analyzed using YFP-tagged Gag synthesized in a wheat germ-based in vitro translation system and GUVs prepared by an electroformation technique.

Visualização de HIV-1 Gag vinculação a gigante Unilamelares vesículas (GUV) Membranas

The structural protein of HIV-1, Pr55Gag (or Gag), binds to the plasma membrane in cells during the virus assembly process. Membrane binding of Gag is an ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential to be used as drug therapies for HIV-1 infection. Post-integration inhibitors include ribozymes, short hairpin (sh) RNAs, small interfering (si) RNAs, U1 interference (U1i) RNAs and RNA aptamers. Many of these have been identified using transient co-transfection assays with an HIV-1 expression plasmid and some have advanced to clinical trials. In addition to measures of efficacy, small RNAs have been evaluated for their potential to affect the expression of human RNAs, alter cell growth and/or differentiation, and elicit innate immune responses. In the protocols described here, a set of transient transfection assays designed to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps in the HIV-1 replication cycle are described. We have used these assays to identify new ribozymes and optimize the format of shRNAs and siRNAs targeting HIV-1 RNA. The methods provide a quick set of assays that are useful for screening new anti-HIV-1 RNAs and could be adapted to screen other post-integration inhibitors of HIV-1 replication.

Methods to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps of the HIV-1 replication cycle are described. These methods are useful for screening new molecules and optimizing the format of existing ones.

Avaliação da eficácia e toxicidade de RNAs Segmentação HIV-1 Produção para uso em Gene ou Quimioterapia

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

SILAC Based Proteomic Characterization of Exosomes from HIV-1 Infected Cells

Proteomics is the large-scale analysis of proteins. Proteomic techniques, such as liquid chromatography tandem mass spectroscopy (LC-MS/MS), can characterize thousands of proteins at a time. These powerful techniques allow us to have a systemic understanding of cellular changes, especially when cells are subjected to various stimuli, such as infections, stresses, and specific test conditions. Even with recent developments, analyzing the exosomal proteome is time-consuming and often involves complex methodologies. In addition, the resultant large dataset often needs robust and streamlined analysis in order for researchers to perform further downstream studies. Here, we describe a SILAC-based protocol for characterizing the exosomal proteome when cells are infected with HIV-1. The method is based on simple isotope labeling, isolation of exosomes from differentially labeled cells, and mass spectrometry analysis. This is followed by detailed data mining and bioinformatics analysis of the proteomic hits. The resultant datasets and candidates are easy to understand and often offer a wealth of information that is useful for downstream analysis. This protocol is applicable to other subcellular compartments and a wide range of test conditions.

Here, we describe a quantitative proteomics method using the technique of stable isotope labeling by amino acids in cell culture (SILAC) to analyze the effects of HIV-1 infection on host exosomal proteomes. This protocol can be easily adapted to cells under different stress or infection conditions.