עבודה זו נתמכת בחלקה על ידי מענקים DA024558, DA30896, DA033892, ו DA021471 מן NIDA / NIH לתקליטור. אנחנו גם מכירים את G12MD007586 מענק RCMI, ואנדרבילט CTSA להעניק UL1RR024975, מרכז המחקר Translational Meharry (MeTRC) CTSA RR026140 U54 מענק מטעם NCRR / NIH, MD007593 מענק U54 מן NIMHD / NIH, ואת AI110527 P30 מענק טנסי וכפר.

הפקת וירוס 1. הערה: כדי ליצור כותרות גבוהות של HIV-1 זיהומיות, transfect כליה עוברית האנושי (HEK) שורת התאים 293T עם שיבוט מולקולרי זיהומיות HIV-1 באמצעות מגיב transfection מבוסס dendrimer מופעל. זה נצפה כי שיטת סידן פוספט transfection מניבה תוצאות דומות. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בתוך 2 רמת בטיחות ביולוגית (BSL2) במעבדה, זרע 3 x 10 6 293T תאים לכל 10 צלחת ס&quot;מ 8 מ&quot;ל של מדיום הנשר שונה של Dulbecco (DMEM) בתוספת 10% עוברית שור סרום (FBS), פניצילין, סטרפטומיצין. התרבות התאים להגדיר באינקובטור ב 37 מעלות צלזיוס, 5% CO 2 O / N. </li><li style=";text-align:right;direction:rtl"> למחרת, עבור transfecting תאים בכל צלחת 10 ס&quot;מ, לדלל 8 מיקרוגרם של ה- DNA פלסמיד pNL4-3 (ראה לוח חומרים) לנפח סופי של 300 μL של DMEM חסר בסרום ואנטיביוטיקה. הוסף 80 μL של מגיב transfection, ומערבבים היטב על ידי pipetting ו דגירה ב RT עבור5 - 10 דקות להיווצרות מורכבת transfection. </li><li style=";text-align:right;direction:rtl"> הוצא את המדיה המנות על ידי שאיפה ולהוסיף 7 מ&quot;ל לכל צלחת של DMEM טריים המכילה סרום ואנטיביוטיקה. </li><li style=";text-align:right;direction:rtl"> הוסף 1 מ&quot;ל של DMEM המכילה סרום ואנטיביוטיקה למתחם transfection, ומערבבים על ידי pipetting, ולהוסיף את התערובת אל התאים. מערבולת בעדינות את המנה כדי להקל חלוקה שווה של קומפלקסים transfection. </li><li style=";text-align:right;direction:rtl"> מיד להעביר את התאים במעבדה BSL3, מקום להגדיר באינקובטור ב 37 מעלות צלזיוס, 5% CO 2, והתרבות התאים למשך 48 שעות. </li><li style=";text-align:right;direction:rtl"> אסוף את supernatant תרבות רקמה המכילה וירוס בעזרת פיפטה ולאחר מכן להעביר אותו צינור צנטריפוגות. צנטריפוגה XG ב 300 במשך 5 דקות עד גלולה התאים ופסולת, ולאחר מכן לסנן את supernatant דרך פילטר מזרק 0.45 מיקרומטר נקבוביות בגודל. </li><li style=";text-align:right;direction:rtl"> על מנת להפחית את פלסמיד דנ&quot;א שריד כהכנה וירוס תא ללא זה, לטפל עם DNase 1 (20 מיקרוגרם / מ&quot;ל) ב 37 מעלות צלזיוס למשך 1 שעה. </li><li style=";text-align:right;direction:rtl"> כדי לכמת אתכייל HIV-1, השתמש Assay immunosorbent Enzyme-linked ספציפי-p24 (ELISA), כפי שהוא שיטה מהירה נוחה לשימוש שגרתי 22. הערה: יצוין כי p24 ELISA מודד את כייל הפיזי (מספר חלקיקי נגיף). לחלופין, מדידת פעילות RT הקשורים וירוס (assay RT אקסוגניים) או infectivity וירוס (TZM-bl תא מחוון קו מבוססי מבחני infectivity) תספק ההודעה הבלעדית של חלקיקי נגיף מדבק. </li></ol> 2. וירוסים זיהום של תאים Sup-T1 (Lab BSL3) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> במעבדה BSL2, לשמור על תאים Sup-T1 בין 1.0 x 10 6 ו 2.0 x 10 6 תאים / מ&quot;ל מכון הזיכרון רוזוול פארק (RPMI) בינוני בתוספת 10% חום מומת FBS, פניצילין, סטרפטומיצין (ביחס פיצול של 1 : 2 כל 2 - 3 ד). פינת התאים Sup-T1 מן צלוחיות תרבות, ומערבבים היטב על ידי pipetting, ולקבוע את ספירת תאי קיימא באמצעות hemocytometer ואת הרחקה כחול trypan staining שיטה. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן את המספר הדרוש של aliquots של 80 x 10 6 תאים (מחיר זיהום בנגיף) ב 50 מבחנות צנטריפוגה חרוטי מ&quot;ל. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה התאים ב הרוטור מתנדנד דלי XG ב 500 ו 25 מעלות צלזיוס למשך 5 דקות. מבלי להסיר את תרבית תאים הבינונית, להעביר את הצינורות המכילים תאי pelleted למעבדת BSL3 לעיבוד נוסף. בזהירות לשאוב את מדיום תרבית תאים מהצינור מבלי להפריע גלולת התא. </li></ol></li><li style=";text-align:right;direction:rtl"> הוספת כמות מתאימה של בידוד וירוס שטופל אני DNase אל התאים בצינור ומערבב היטב על ידי pipetting העדין. עבור 80 x 10 6 תאים, השתמש 30 מ&quot;ל של DNase וירוס אני שטופלו (50 מיקרוגרם של וירוס p24-שווה ערך). הערה: בידוד של תמונות פונקציונליות דורש הדבקה של תאי היעד עם multiplicities גבוהה מאוד של זיהום (משרד פנים). </li><li style=";text-align:right;direction:rtl"> פזר את התערובת באופן שווה בין שתי צלחות תרבית הרקמה 6-היטב (כלומר 12 x aliquots 2.5 מ&quot;ל; להשתמש 2 צלחות לכל להדביקיוֹן). </li><li style=";text-align:right;direction:rtl"> לקבלת spinoculation, במקום צלחות תרבות בנשאיות צלחת צנטריפוגות באמצעות הרוטור דלי מתנדנד ב 480 XG ו -25 מעלות צלזיוס למשך 2 שעות. </li><li style=";text-align:right;direction:rtl"> דגירת תאי spinoculated ב 37 מעלות צלזיוס, 5% CO 2 למשך 5 שעות. </li></ol> קציר 3. תמוגה של תאים נגועים (מעבדת BSL3) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לרכז את התאים המתאימים לכל זיהום מהצלחות תרבות לתוך צינור צנטריפוגות חרוטי 50 מ&quot;ל (~ 30 מ&quot;ל בסך הכל). </li><li style=";text-align:right;direction:rtl"> קציר התאים על ידי צנטריפוגה XG ב 300 ו 25 מעלות צלזיוס למשך 10 דקות. בזהירות לשאוב supernatant מהצינור (לחילופין, להשתמש פיפטה). </li><li style=";text-align:right;direction:rtl"> למען הסר חלקיקים נגיפיים שיורית, לשטוף כל גלולה התא על ידי הוספת 2 מ&quot;ל של חיץ K - / - (150 מ&quot;מ KCl, 20 HEPES מ&quot;מ, pH 7.6, 5 מ&quot;מ MgCl 2) ו צנטריפוגה מדגם XG ב 300 ו 25 מעלות צלזיוס למשך 10 דק. ואז, מבלי להפריע גלולה, להסיר בזהירות את supernatant על ידי שאיפה או באמצעות פיפטה. </li><li style=";text-align:right;direction:rtl"> Repeat צעד 3.3. </li><li style=";text-align:right;direction:rtl"> מוציאים בזהירות כל חיץ שיורית באמצעות micropipette. Resuspend כל גלולה תא 2 מ&quot;ל של K חיץ תמוגה קר כקרח + / + (Buffer K - / - השלימו עם digitonin 0.025%, 1 מ&quot;מ DTT, 20 מיקרוגרם / מ&quot;ל aprotinin), לערבב תוכן על ידי pipetting עדין, ומעבירים צינור 2 מ&quot;ל microcentrifuge. </li></ol> 4. הכנת תמונות cytoplasmic (מעבדת BSL3) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> רוק דגימות על שייקר רוטרי ב RT במשך 10 דקות. </li><li style=";text-align:right;direction:rtl"> צנטריפוגה דגימות, עם הרוטור precooled עד 4 מעלות צלזיוס, ב 1500 XG ו -4 מעלות צלזיוס למשך 4 דקות. </li><li style=";text-align:right;direction:rtl"> מבלי להפריע גלולה, בזהירות להעביר את supernatant לצינור צנטריפוגות microcentrifuge טריים XG 16,000 ו -4 מעלות צלזיוס במשך 1 דקות. </li><li style=";text-align:right;direction:rtl"> להעביר בזהירות את supernatant לצינור microcentrifuge טרי. הוסף RNase (20 מ&quot;ג / מ&quot;ל) לריכוז סופי של 20 מיקרוגרם / מ&quot;ל ​​(2 μL עבור 2 מ&quot;ל של התמונות) דגירה את התוכן ב RT במשך 30 דקות (לא נדנדה). &lt;/ Li&gt; <li style=";text-align:right;direction:rtl"> הוספת סוכרוז (60% w / v במאגר K - / -) לריכוז סופי של 7% ומערבבים היטב על ידי pipetting עדין. הכן aliquots (למשל, 200 μL) של התמונות צינורות microcentrifuge, פלאש להקפיא בחנקן נוזלי, ומניחים במקפיא -80 ° C עבור אחסון לטווח ארוך. </li></ol> 5. שילוב Vitro (IVI) מבחני שימוש HIV-1 תמונות <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן את ה- DNA היעד בשימוש assay IVI ידי הגברה אזור 2.0 kb מ- DNA פלסמיד phiX174 עם PCR באמצעות פריימרים מחוייט, phiX174-F ו phiX174-R. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הרכב את תערובת PCR כמתואר בטבלה 1. בצע PCR ב Cycler תרמית באמצעות תנאי רכיבת התרמית מומלצים בטבלה 2. ג&#39;ל לטהר את מוצר ה- PCR באמצעות ערכת ג&#39;ל לטיהור (בעקבות פרוטוקול יצרן מומלץ), ולאחסן את ה- DNA היעד המטוהר כמו aliquots ב -80 ° C עד שימוש. </li></ol></li><li style=";text-align:right;direction:rtl"> להוסיף 600 ננוגרם של DNA היעד ל -200 - &amp; #181; aliquot של תמונות L, לערבב היטב, דגירה על 37 מעלות צלזיוס למשך 45 דקות. הערה: תגובות IVI השמטת DNA היעד או כוללות מעכבי אינטגראז (למשל, Raltegravir) מומלצות תגובות שליטות. </li><li style=";text-align:right;direction:rtl"> עצור את התגובה IVI ידי הוספת SDS, EDTA, ו proteinase K לריכוזים סופי של 0.5%, 8 מ&quot;מ, ו -0.5 מ&quot;ג / מ&quot;ל, בהתאמה. מערבבים את התוכן תגובה ביסודיות דגירה לילה בשעה 56 ° C. </li><li style=";text-align:right;direction:rtl"> למחרת, לטהר את ה- DNA הכולל מן התגובה IVI על ידי מיצוי פנול / כלורופורם משקעים אתנול. לבצע את כל הפעולות צנטריפוגה ב XG 16,000 ו RT. </li><li style=";text-align:right;direction:rtl"> הוסף נפח שווה של פנול מדגם deproteinized, לערבב נמרצות על ידי vortexing, צנטריפוגות במשך 2 דקות. מוציא בזהירות את השלב מהימי העליון ולהעביר אותו צינור טרי. </li><li style=";text-align:right;direction:rtl"> חזור על שלב 5.5. מעביר את השלב מהימי העליון לצינור טרי. </li><li style=";text-align:right;direction:rtl"> הוסף נפח שווה של 1: פנול 1: תערובת כלורופורם, לערבב נמרצות על ידי vortexing, צנטריפוגות FO<html> r 2 דקות. מעביר את השלב מהימי העליון לצינור טרי. </li><li style=";text-align:right;direction:rtl"> הוסף נפח שווה של כלורופורם, לערבב נמרצות על ידי vortexing, צנטריפוגות במשך 2 דקות. מעביר את השלב מהימי העליון לצינור טרי. </li><li style=";text-align:right;direction:rtl"> כדי לזרז DNA, להוסיף גליקוגן לריכוז סופי של 0.1 מיקרוגרם / μL, 3 M של נתרן אצטט לריכוז סופי של 0.3 M, ו 2.5 כרכים של 100% אתנול (קרים כקרח). וורטקס לערבב, בקצרה צנטריפוגות כדי לאסוף את התוכן, ולמקם את הצינור ב -80 ° CO / N. </li><li style=";text-align:right;direction:rtl"> למחרת, צנטריפוגות מדגם למשך 30 דקות ב XG 16,000 ו -4 מעלות צלזיוס למשך 30 דקות. מוציאים בזהירות את supernatant מבלי להפריע גלולה. </li><li style=";text-align:right;direction:rtl"> הוספת 500 μL של 80% אתנול (קרים כקרח) על גלולה ו צנטריפוגות ב XG 16,000 ו -4 מעלות צלזיוס למשך 10 דקות. אוויר יבש גלולה DNA ב RT וביסודיות resuspend ב 50 μL של מים nuclease חינם. אחסן את דגימות ה- DNA ב -20 ° C. </li></ol> 6. מבחני PCR עבור פעילות כימות PIC = &quot;Jove_content&quot;&gt; הערה: העותק מספר HIV-1 DNA משולב לתוך ה- DNA היעד הוא לכימות על ידי אסטרטגיה מקוננת PCR המעסיקה 2 סטים של פריימרים ו -2 סיבובים רציפים של PCR. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בצעו את PCR קונבנציונאלי בסיבוב הראשון באמצעות פריימרים מיקוד LTR ויראלי והדנ&quot;א phiX174 (פריימרים LTR ו phiX174, בהתאמה) כדי להגביר את צמתים של דנ&quot;א HIV-1 משולב. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הרכב את התערובת בסיבוב הראשון PCR כמתואר בטבלה 3. להרכיב תערובת אמן של כל הרכיבים למעט ה- DNA תבנית, לוותר aliquots 45 μL לתוך צינורות PCR נפרד, ולהוסיף 5 μL של תבנית ה- DNA או מים חופשי nuclease (שליטה). </li><li style=";text-align:right;direction:rtl"> בצע PCR ב Cycler תרמית באמצעות תנאי רכיבת התרמית מומלצים בטבלה 4. </li></ol></li><li style=";text-align:right;direction:rtl"> בצע את הסיבוב השני qPCR באמצעות פריימרים כי האגף אזור קצר של LTR ויראלי (LTR-R ו- פריימרים LTR-U) כדי להגביר את רצפי vDNA משולב באופן סלקטיבי מן-ro הראשוןמוצרי und PCR. כדי לקבוע את vDNA משולבת להעתיק מספרים, ליצור עקומה רגילה באמצעות 10x דילולי סדרה של מספרי עותק ידועים (למשל, 10 10 - 0 8) של השיבוט המולקולרי HIV-1. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הרכב את התערובת בסיבוב השני qPCR כמתואר בטבלה 5. להרכיב תערובת אמן של כל הרכיבים למעט ה- DNA תבנית, לוותר בקפידה 25 aliquots μL לתוך המספר המתאים של בארות בצלחת התגובה 96-היטב PCR, ולאחר מכן להוסיף 5 μL של מוצרי ה- PCR בסיבוב הראשון unpurified או nuclease ללא מים (לִשְׁלוֹט). בצע את כל התגובות qPCR בשלושה עותקים. </li><li style=";text-align:right;direction:rtl"> טען את הצלחת ה- PCR לתוך מכשיר PCR בזמן אמת ולבצע qPCR באמצעות התנאים אופניים מומלץ בטבלה 6. </li><li style=";text-align:right;direction:rtl"> לנתח את הנתונים באמצעות תוכנה מתאימה. </li></ol></li></ol>

<ol>
	<li>Sattentau, Q. J., Weiss, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CD4+antigen:+physiological+ligand+and+HIV+receptor.">The CD4 antigen: physiological ligand and HIV receptor.</a> Cell. 52 (5), 631-633 (1988).</li><li>Wilen, C. B., Tilton, J. C., Doms, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanisms+of+HIV+entry.">Molecular mechanisms of HIV entry.</a> Adv Exp Med Biol. 726, 223-242 (2012).</li><li>Bowerman, B., Brown, P. O., Bishop, J. M., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nucleoprotein+complex+mediates+the+integration+of+retroviral+DNA.">A nucleoprotein complex mediates the integration of retroviral DNA.</a> Genes Dev. 3 (4), 469-478 (1989).</li><li>Bukrinsky, M. I., Sharova, N., Dempsey, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Active+nuclear+import+of+human+immunodeficiency+virus+type+1+preintegration+complexes.">Active nuclear import of human immunodeficiency virus type 1 preintegration complexes.</a> Proc Natl Acad Sci. 9 (14), 6580-6584 (1992).</li><li>Hansen, M. S., Smith, G. J., Kafri, T., Molteni, V., Siegel, J. S., Bushman, F. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+complexes+derived+from+HIV+vectors+for+rapid+assays+in+vitro.">Integration complexes derived from HIV vectors for rapid assays in vitro.</a> Nature biotechnol. 17 (6), 578-582 (1999).</li><li>Farnet, C. M., Haseltine, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+of+human+immunodeficiency+virus+type+1+DNA+in+vitro.">Integration of human immunodeficiency virus type 1 DNA in vitro.</a> Proc Natl Acad Sci. 87 (11), 4164-4168 (1990).</li><li>Fujiwara, T., Mizuuchi, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+DNA+integration:+structure+of+an+integration+intermediate.">Retroviral DNA integration: structure of an integration intermediate.</a> Cell. 54 (4), 497-504 (1988).</li><li>Brown, P. O., Bowerman, B., Varmus, H. E., Bishop, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Correct+integration+of+retroviral+DNA+in+vitro.">Correct integration of retroviral DNA in vitro.</a> Cell. 49 (3), 347-356 (1987).</li><li>Lewinski, M. K., Bushman, F. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+DNA+integration--mechanism+and+consequences.">Retroviral DNA integration--mechanism and consequences.</a> Adv Genet. 55, 147-181 (2005).</li><li>Engelman, A., Mizuuchi, K., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV-1+DNA+integration:+mechanism+of+viral+DNA+cleavage+and+DNA+strand+transfer.">HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer.</a> Cell. 67 (6), 1211-1221 (1991).</li><li>Goff, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetics+of+retroviral+integration.">Genetics of retroviral integration.</a> Ann rev gen. 26, 527-544 (1992).</li><li>Panganiban, A. T., Temin, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+terminal+nucleotides+of+retrovirus+DNA+are+required+for+integration+but+not+virus+production.">The terminal nucleotides of retrovirus DNA are required for integration but not virus production.</a> Nature. 306 (5939), 155-160 (1983).</li><li>Bieniasz, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cell+biology+of+HIV-1+virion+genesis.">The cell biology of HIV-1 virion genesis.</a> Cell host microbe. 5 (6), 550-558 (2009).</li><li>Sherman, P. A., Fyfe, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+immunodeficiency+virus+integration+protein+expressed+in+Escherichia+coli+possesses+selective+DNA+cleaving+activity.">Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity.</a> Proc Natl Acad Sci. 87 (13), 5119-5123 (1990).</li><li>Katzman, M., Katz, R. A., Skalka, A. M., Leis, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+avian+retroviral+integration+protein+cleaves+the+terminal+sequences+of+linear+viral+DNA+at+the+in+vivo+sites+of+integration.">The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration.</a> J Virol. 63 (12), 5319-5327 (1989).</li><li>Craigie, R., Mizuuchi, K., Bushman, F. D., Engelman, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+in+vitro+assay+for+HIV+DNA+integration.">A rapid in vitro assay for HIV DNA integration.</a> Nucl acid res. 19 (10), 2729-2734 (1991).</li><li>Bushman, F. D., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activities+of+human+immunodeficiency+virus+(HIV)+integration+protein+in+vitro:+specific+cleavage+and+integration+of+HIV+DNA.">Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA.</a> Proc Natl Acad Sci. 88 (4), 1339-1343 (1991).</li><li>Pauza, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+bases+are+deleted+from+the+termini+of+HIV-1+linear+DNA+during+integrative+recombination.">Two bases are deleted from the termini of HIV-1 linear DNA during integrative recombination.</a> Virology. 179 (2), 886-889 (1990).</li><li>Engelman, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+analysis+of+HIV-1+preintegration+complexes.">Isolation and analysis of HIV-1 preintegration complexes.</a> Meth Mol Biol. 485, 135-149 (2009).</li><li>Engelman, A., Oztop, I., Vandegraaff, N., Raghavendra, N. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+HIV-1+preintegration+complexes.">Quantitative analysis of HIV-1 preintegration complexes.</a> Methods. 47 (4), 283-290 (2009).</li><li>Addai, A. B., Pandhare, J., Paromov, V., Mantri, C. K., Pratap, S., Dash, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cocaine+modulates+HIV-1+integration+in+primary+CD4++T+cells:+implications+in+HIV-1+pathogenesis+in+drug-abusing+patients.">Cocaine modulates HIV-1 integration in primary CD4+ T cells: implications in HIV-1 pathogenesis in drug-abusing patients.</a> J Leuk Biol. 97 (4), 779-790 (2015).</li><li>Wehrly, K., Chesebro, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=p24+antigen+capture+assay+for+quantification+of+human+immunodeficiency+virus+using+readily+available+inexpensive+reagents.">p24 antigen capture assay for quantification of human immunodeficiency virus using readily available inexpensive reagents.</a> Methods. 12 (4), 288-293 (1997).</li></ol>

המחברים מצהירים שום אינטרסים כלכליים והן לא מתחרים.

ניתוחים ביוכימיים של התמונות retroviral סיפקו תובנות קריטיות לתוך מנגנון של אינטגרציה DNA retroviral. מדידה של פעילות האינטגרציה של תמונות retroviral יכולה להיות מושגת על ידי assay היווצרות הפלאק, ניתוח כתם דרום המקונן qPCR. האסטרטגיה ניסיון של assay פלאק היא מייגע מנצלת שיטה עקיפה למדידת אינטגרציה 6, 7, 18. אינטגרצית מידת מבחני דרום מבוסס כתם ישירות אך דורשת כמויות גבוהות יחסי של תמונות 6, 7, 18. דו&quot;ח זה מפרט אסטרטגיה qPCR מקוננות למדידת פעילות האינטגרציה HIV-1-associated PIC במבחנה. היתרון העיקרי ואת המשמעות של שיטה זו היא הדרישה של כמויות נמוכות יחסית של הכנה PIC לכל תגובה 4, 5, 19. השלבים הקריטיים ביותר של שיטה זו הם הדור של וירוס גבוה כייל לזיהום והטיפול כנה PIC. יצוין כאן כי בסיבוב הראשון של ה- PCR כרוך הגברת מעריכי צומת האינטגרציה. כתוצאה מכך, את המספרים עותק של משולבת vDNA שנקבע qPCR בסיבוב השני הם חצי כמותית, ולכן, יש הגבלה של לא נותן מידה של עותקים vDNA הקשורים PIC. עם זאת, vDNA הקשורים PIC יכול להיקבע על ידי qPCR של DNA מטוהרים מן התמונות עם פריימרים LTR ספציפי. היחס בין vDNA משולבת להעתיק מספרים על vDNA PIC הקשורים המקבילה יכול לספק מידע על יעילות השילוב של תגובה אינטגרציה חוץ גופית. שיטה זו יכולה להיות שונה על ידי שילוב ה- DNA יעד Heterologous האחר של פריימרים בחירה ואחרים כדי לזהות השתלבות בבית האוריינטציות שניהם. לסיכום, השיטההמתואר כאן מודד את פעילות האינטגרציה של HIV-1 pics כמותית ניתן לאמץ למחקר פיתוח הבנה של הפרטים ביוכימיים של אינטגרציה retroviral.

HIV-1 שכפול בתא היעד כרוך שלבים מרובים, מקובצים באופן כללי לשתי שלבים: אירועים מוקדמים ומאוחרים. האירועים מוקדם להתחיל כאשר ברצף HIV-1 נקשר לקולטן תא המטרה CD4 ואחד משני הקולטנים-שיתוף (CCR5 או CXCR4) 1. כתוצאה מכך, את פתיל ממברנות תאי וירוס, ואת קפסיד ויראלי (CA) ליבה הוא שוחרר לתוך הציטופלסמה 2. ליבת CA מכיל את רנ&quot;א חד-גדילי גנומית ויראלי (ssRNA) וכמה חלבונים, הן ויראליות הסלולר במקורם. החלבונים ויראלי קשורים CA כוללים transcriptase ההפוכה (RT) ואת אינטגראז (IN), שני אנזימים אשר מתווכים שלבים קריטיים במהלך אירועים מוקדם בשכפול נגיף. קל RT ו בתפקוד בהקשר של מתחמי nucleoprotein, כלומר מורכבים שעתוק לאחור (RTC) ואת מורכבות מראש אינטגרציה (PIC), בהתאמה 3, 4, 5 &lt;sup&gt;, 6. הקצות חוזרות מסוף נמל הגנום הנגיפי ssRNA (R) אלמנטים סמוכים אל U5 הרצפים הייחודי (ב 5 &#39;בסוף) ו- U3 (על 3&#39; בסוף). RTC ממיר את הגנום ssRNA ויראלי לתעתיק פעמיים גדילי דנ&quot;א (DS) (vDNA). תהליך השעתוק לאחור זה גם גרם שכפול של רצפי U5 ו- U3, ובכך לייצר חוזר מהסוף ארוך (LTR) בשני הקצוות של vDNA 7, 8. כתוצאה מכך, לפי קשור PIC מזרז שתי תגובות ביוכימיות רציפות המאפשרות את האינטגרציה של vDNA לתוך כרומוזום מארח 9, 10, 11. ראשית, בציטופלסמה, לפי multimers לעסוק הן Ltrs 12 וידבק dinucleotide מכל הקצוות 3&#39;-סופנית. עיבוד 3&#39;-סוף זה מפיק קבוצת הידרוקסיל בכל 3&#39;-end (CA OH) של vDNA.לאחר מכן, PIC traffics לגרעין, שבו לפי משתמשת CA vDNA OH בתור נוקלאופיל לחתוך שני הגדילים של ה- DNA כרומוזומלי בצורה מדורגת. במקביל, מתואם שזור בשני הקצוות של vDNA אל קשר פוספודיאסטרי וכתוצאה מכך על גדילים השניים של דנ&quot;א כרומוזומלי. בעקבות צעד העברת גדיל זה, מנגנון תא המארח מסיר את שני נוקלאוטידים מזווגים בקץ &#39;5 של vDNA ומתקן את הפערים חד גדילים שהתפתחו בצומת של אתר האינטגרציה. האירועים מוקדם ובכך לשיאה עם הקמת עותק דנ&quot;א משולב (provirus) של הגנום HIV-1. Provirus מספק סביבה מתאימה עבור ביטוי גנים ויראלי יעיל, אשר יוזם אירועים מאוחרים יותר, כולל את הביטוי של חלבונים המקודדים וירוס; הרכבה של וירוס לא בשלה; ניצנים, שחרור, והתבגרות לתוך virions זיהומיות 13. לפי retroviral רקומביננטי מזוכך מוסמךלבצע, במבחנה, פעילויות 3&#39;-end עיבוד גדיל העברה הן מסופקות אקסוגני DNA מצע LTR דמוי. מחקרים ביוכימיים באמצעות IN רקומביננטי מזוכך כגון חשפו היבטים קריטיים של אינטגרציה vDNA 14, 15, 16, 17. עם זאת, שלא כמו זיהום טבעי, תגובה ביוכימית במבחנה זה אינו תומך אינטגרציה מתואמת של שני הקצוות של DNA המצע לתוך ה- DNA היעד. לעומת זאת, התמונות retroviral מבודד תאים נגועים בחריפות המטפלים יחדיו לשלב את שני הקצוות של vDNA אנדוגני לתוך ה- DNA היעד Heterologous. זה הוביל את האימוץ הנרחב והחידודים הבאים של לי n אינטגרצית Vitro (IVI) מבחנים באמצעות תמונות יליד מבודדות. בחודש הראשון דיווח assay IVI retroviral, תמציות ציטופלסמית מתאים נגועים Murine רקומביננטיוירוס לוקמיה (MLV) מחסה הגן coli supF א ב LTR שלה ששימשו כמקור הפעילות, ואת ה- DNA של הפאג למבדה מוטציה פגום בצמיחה ממס סופק אקסוגני כמו ה- DNA היעד. השתלבות מוצלחת של ה- DNA MLV רקומביננטי להעתיק לתוך ה- DNA הפאג והביטוי supF שהתפתח הוביל לשיקום היכולת להרכיב פלאק של לפאגים רקומביננטי. עם זאת, אסטרטגיה זו ניסיוני הוא שילוב מייגע צעדים בדרך עקיפה. כדי לטפל אזהרות כאלה, assay תיוג-הסוף עקיף דרום מבוסס כתם, אשר מכמת את פעילות IVI הקשורים PIC כאמצעי של vDNA אנדוגני משולב DNA phiX174 בקטריופאג לינארית אקסוגניים, פותח 6, 7, 18. למרות בשיטה זו מספקת מדידה ישירה של אירועי אינטגרציה, כמויות גבוהות יחסי של הכנת PIC נדרשות, אשר נשארה מאתגר מבחינה טכניתמַאֲמָץ. כדי לעקוף זאת, מבחני PCR מבוססי מקוננות המחייב רק כמויות צנועות של תמונות פותחו 4, 5, 19. בדו&quot;ח זה, אנו מתארים גרסה מעודכנת של PCR מבוסס מקוננות שיטה במבחנה המציאה כדי לשחזר את פעילות אינטגרצית HIV-1 PIC בתיווך המתרחשת בזמן הדבקה טבעית. שיטה זו משתמשת תמציות cytoplasmic של תאי יעד HIV-1-נגועים כמקור פעילות PIC האנדוג&#39;ינוס נמדד עם תגובת שרשרת פולימראז כמותיים בזמן אמת (qPCR). הנהלים לבידוד תמונות מדידים פעילויות האינטגרציה שלהם מותאמים, עם שינויים, מתוך פרוטוקולים שפורסמו על ידי מעבדת אנגלמן 20. בשיטה זו, פעילות האינטגרציה הקשורים PIC היא שיזמה מתן DNA היעד ליניארי אקסוגניים 21, ואת מוצרי DNA הנובעיםתגובת שילוב הזה הוא מטוהר ושמשה החומר המוצא של כימותים מבוססים PCR הבא. בשנות ה PCR קונבנציונאלי בסיבוב הראשון, הצמתים DNA הנגיפי-היעד הם מוגבר באמצעות פריימרים מתאימים. ב-הסיבוב השני qPCR, פריימרים ספציפיים LTR משמשים להעשרת האוכלוסייה vDNA במיוחד מן המוצרים PCR-בסיבוב הראשון. נא עיין בסעיף פרוטוקול תיאור מפורט של שיטה זו. במחקרים במבחנה עם התמונות retroviral הובילו להתקדמות משמעותית להבנתנו את מנגנון האינטגרציה DNA retroviral ו בפיתוח מעכבי IN. בהתבסס על ההתמקדות ההולכת וגוברת לאחרונה באתרי אינטגרציה HIV-1 מיפוי, בקביעת התפקיד של גורמים נגיפיים המארח אינטגרצית HIV-1, ופיתוח תרופות אנטי חדשות כלפי במאבק עמיד לתרופות, אנחנו מדמיינים התעניינות מוגברת ואת שימוש נרחב של מבחני IVI , כמו זה המתואר בדו&quot;ח זה. זה, בתורו, יביאחידודים בעתיד בשיטה, ובכך לגוון את טווח היישומים שלה.

<table align="left" border="1" cellpadding="0" cellspacing="0" style="width:679px;" width="679">
	<tbody>
		<tr>
			<td style="width:312px;">
			Fetal bovine serum (FBS)
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			10437-028
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:34px;">
			Heat-inactivated Fetal bovine serum (Hi-FBS)
			</td>
			<td style="width:198px;height:34px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;height:34px;">
			10438-026
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:42px;">
			Dulbecco&#8217;s modified Eagle&#8217;s medium (DMEM)
			
			</td>
			<td style="width:198px;height:42px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;height:42px;">
			11995-065
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Roswell Park Memorial Institute (RPMI) 1640 medium
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			11875-093
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Phosphate buffered saline (PBS) (1X)
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			20012-027
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Trypsin-EDTA (0.25%)
			
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			25200-056
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Penicillin-Streptomycin solution (100x)
			</td>
			<td style="width:198px;">
			Cellgro/Mediatech
			</td>
			<td style="width:138px;">
			30-002-CI
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HEK293T cells (293T)
			</td>
			<td style="width:198px;">
			American Type Culture Collection (ATCC)
			</td>
			<td style="width:138px;">
			CRL-3216
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HIV-1 proviral molecular clone pNL4-3
			</td>
			<td style="width:198px;">
			NIH AIDS Research and Reference Reagent Program
			
			</td>
			<td style="width:138px;">
			114
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			PolyFect transfection reagent
			</td>
			<td style="width:198px;">
			Qiagen
			</td>
			<td style="width:138px;">
			301107
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			DNase
			
			</td>
			<td style="width:198px;">
			Calbiochem/Merckmillipore
			</td>
			<td style="width:138px;">
			260913
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Immulon 2HB 96-well plates
			
			</td>
			<td style="width:198px;">
			Thermo Scientific
			
			</td>
			<td style="width:138px;">
			3455
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Triton X-100
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			T9284
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			ELISA coating antibody: anti-CA-183-H12-5C monoclonal antibody
			</td>
			<td style="width:198px;">
			NIH AIDS Research and Reference Reagent Program
			
			</td>
			<td style="width:138px;">
			1513
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			ELISA wash solution (0.2% Tween-20 in PBS)
			</td>
			<td style="width:198px;">
			---
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Donor bovine serum
			</td>
			<td style="width:198px;">
			&#160;Gibco/Invitrogen
			</td>
			<td style="width:138px;">
			16030074
			
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:78px;">
			Blocking Buffer (5% donor bovine serum in PBS) - Prepare fresh before use.
			
			</td>
			<td style="width:198px;height:78px;">
			---
			</td>
			<td style="width:138px;height:78px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Sample diluent (SD) buffer (10% donor bovine serum and 0.5% Triton X-100 in PBS) - Sterilize using 0.22 micron pore-size syringe filter and store aliquots at 4&#176;C.
			
			</td>
			<td style="width:198px;">
			---
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Recombinant p24 protein
			(Full-length CA protein was expressed from pET21a-CA plasmid in E. coli BL21-DE3 and purified as described in Ref # ----)
			</td>
			<td style="width:198px;">
			Dr. Wesley Sundquist
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HIV IgG
			</td>
			<td style="width:198px;">
			NIH AIDS Research and Reference Reagent Program
			
			</td>
			<td style="width:138px;">
			3957
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Goat anti-human IgG (H+L) cross-adsorbed secondary antibody, HRP conjugate
			</td>
			<td style="width:198px;">
			Pierce/ThermoFisher
			
			</td>
			<td style="width:138px;">
			31412
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			TMB Microwell Peroxidase substrate system
			</td>
			<td style="width:198px;">
			KPL, Inc.
			</td>
			<td style="width:138px;">
			50-76-00
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			SupT1 cells
			</td>
			<td style="width:198px;">
			American Type Culture Collection (ATCC)
			</td>
			<td style="width:138px;">
			CRL-1942
			
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HEPES pH 7.2-7.5
			(ready-to-use solution)
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			15630-080
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Potassium chloride (KCl) solution
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			60142
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Magnesium chloride (MgCl2) solution
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			M1028
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Dithiothreitol (DTT)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			43815
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Aprotinin
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			A6106
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Digitonin
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			D141
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			RNase A
			</td>
			<td style="width:198px;">
			Invitrogen
			</td>
			<td style="width:138px;">
			12091-021
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:29px;">
			Sucrose
			</td>
			<td style="width:198px;height:29px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;height:29px;">
			S0389
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			phiX174 Replicative Form 1 DNA
			</td>
			<td style="width:198px;">
			Promega
			</td>
			<td style="width:138px;">
			D1531
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			PhiX174-F primer:
			5&#8217;-CGCTTCCATGACGCAGAAGTT-3&#8217;
			
			PhiX174-R primer:
			5&#8217;-CACTGACCCTCAGCAATCTTA-3&#8217;
			
			
			</td>
			<td style="width:198px;">
			Invitrogen and/or IDT-DNA
			</td>
			<td style="width:138px;">
			
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			dNTP mix
			</td>
			<td style="width:198px;">
			Promega
			</td>
			<td style="width:138px;">
			U1515
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Go Taq DNA Polymerase
			</td>
			<td style="width:198px;">
			Promega
			</td>
			<td style="width:138px;">
			M3005
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Qiaquick gel extraction kit
			</td>
			<td style="width:198px;">
			Qiagen
			</td>
			<td style="width:138px;">
			28706
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Ultrapure distilled water
			</td>
			<td style="width:198px;">
			Invitrogen
			</td>
			<td style="width:138px;">
			10977-015
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Tris-EDTA (TE) buffer (100X)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			T9285
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Sodium dodecyl sulphate (SDS)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			L3771
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:50px;">
			Ethylenediamine tetraacetic acid, disodium salt (EDTA) solution, 0.5 M, pH 8.0
			</td>
			<td style="width:198px;height:50px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;height:50px;">
			E7889
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Proteinase K (20 mg/ml ready-to-use solution)
			</td>
			<td style="width:198px;">
			Qiagen
			</td>
			<td style="width:138px;">
			19131
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Phenol (equilibrated with 10&#160;mM Tris HCl, pH&#160;8.0 and 1&#160;mM EDTA)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			P4557
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Chloroform
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			288306
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Glycogen (5 mg/ml solution)
			</td>
			<td style="width:198px;">
			Ambion/Invitrogen
			</td>
			<td style="width:138px;">
			AM9510
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Sodium acetate (3M, pH 5.2)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			57899
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Ethanol
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			E7023
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			First round LTR primer:
			5&#8217;-GTGCGCGCTTCAGCAAG-3&#8217;)
			First round phiX174 primer:
			5&#8217;-CACTGACCCTCAGCAATCTTA-3&#8217;
			</td>
			<td style="width:198px;">
			Invitrogen and/or IDT-DNA
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Second round LTR-R primer:
			5&#8217;-TCTGGCTAACTAGGGAACCCA-3&#8217;
			Second round LTR-U primer:
			5&#8217;-CTGACTAAAAGGGTCTGAGG-3&#8217;;
			
			Second round Taqman probe:
			&#160;5&#8217;-56- FAM/TTAAGCCTCAATAAAGCTTGC
			CTTGAGTGC/36-TAMRA/-3&#8217;
			</td>
			<td style="width:198px;">
			Invitrogen and/or IDT-DNA
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			iQ Supermix
			</td>
			<td style="width:198px;">
			Bio-Rad
			</td>
			<td style="width:138px;">
			170-8862
			</td>
		</tr>
	</tbody>
</table>

measurement of in vitro integration activity of hiv-1 preintegration complexes

חלבוני מעטפת HIV-1 לעסוק קולטנים מאותו מקור על פני תא היעד, מה שמוביל היתוך קרום ויראלי תאים ואחריו שחרורו של קפסיד ויראלי (CA) הליבה לתוך הציטופלסמה. בהמשך לכך, transcriptase ההפוכה ויראלי (RT), כחלק ממכלול nucleoprotein שם כינתה את השעתוק לאחור המורכב (RTC), ממיר את גנום RNA חד-גדילי ויראלי לתעתיק פעמי גדילי דנ&quot;א (vDNA). זה מוביל biogenesis של אחר מורכבי nucleoprotein, כינה את המורכבות ואינטגרציה-מראש (PIC), מורכבת vDNA וחלבוני הווירוס קשור וגרם מארח. Integrase ויראלי הקשורים PIC (IN) מנצח על אינטגרציה של vDNA לתוך דנ&quot;א כרומוזומלי המארח תהליך בן שני שלבים מוסדר temporally מרחבית. ראשית, בתהליכים הקצוות &quot;3 של vDNA בציטופלסמה, ושנית, לאחר PIC traffics לגרעין, שהוא מתווך אינטגרציה של vDNA מעובד לתוך ה- DNA כרומוזומלי. התמונות מבודדותמתאי היעד נגועים בחריפות עם HIV-1 הם פונקציונליים במבחנה, כפי שהם המוסמכות לשלב את vDNA הקשורים לתוך ה- DNA היעד אקסוגני הוסיף Heterologous. PIC מבוסס כאלה מבחני אינטגרציה במבחנה תרם תרומה משמעותית לתחום את הפרטים מכניסטית של אינטגרצית retroviral וכדי לגלות לפי מעכבים. בדו&quot;ח זה, אנו לפרט על ב assay עודכן HIV-1 PIC המעסיקה תגובת שרשרת פולימראז כמותיים מקוננת בזמן אמת (qPCR) אסטרטגיה מבוססת למדידת פעילות האינטגרציה חוץ גופייה של תמונות יליד מבודדות.

<html> בידוד של HIV-1 תמונות סכמטי של הפרוטוקול המשמש לבידוד של תמונות HIV-1 מ בחריפות נגוע בתאי Sup-T1 מתואר באיור 1. פרוטוקול זה נגזר השיטות שתוארו על ידי אנגלמן et al. 19, 20. תמונות HIV-1 הן מתחמי nucleoprotein כי הם התאספו בתאים נגועים והם מורכבים של vDNA-עבד ההפוך, חלבונים נגיפיים, וגרם הסלולר 19, 20. השיטה המתוארת בדוח זה משתמשת תמציות cytoplasmic של תאים HIV-1-נגועים כמקור פעילות האינטגרציה הקשורים PIC. בפעילות אינטגרציה במבחנה של HIV-1 תמונות EP-together.within-page = &quot;1&quot;&gt; סכמטי של שיטת מדידת פעילות IVI של תמונות HIV-1 מוצג באיור 2. בשיטה זו משתמשת באסטרטגית qPCR מבוססת מקוננות למדידת פעילות IVI הקשורים PIC, ואת הנהלים מותאמים, עם שינויים, מתוך פרוטוקולים שפורסמו על ידי מעבדת אנגלמן 19, 20, 21. בשיטה זו, פעילות האינטגרציה הקשורים PIC היא שיזמה מתן DNA היעד ליניארי Heterologous 21, ואת מוצרי DNA נובע תגובת שילוב הזה הם מטוהרים המשמשים כחומר המוצא כימותים מבוססים PCR הבא. בשנות ה PCR קונבנציונאלי בסיבוב הראשון, הצמתים DNA הנגיפי-היעד הם מוגבר באמצעות פריימרים מתאימים. ב-הסיבוב השני qPCR, פריימרים ספציפיים LTR משמשים להעשרת האוכלוסייה vDNA במיוחד מן המוצרים PCR-בסיבוב הראשון. עיין של הפרוטוקולשיקוף עבור תיאור מפורט של שיטה זו. תוצאות נציגה ב assay IVI בוצעו באמצעות תמונות HIV-1 מוצגות באיור 3. SUP-T1 תאים (80 x 10 6 תאים / זיהום) היו spinoculated עם 30 מ&quot;ל של DNase 1 שטופלו HIV-1 (~ 50 מיקרוגרם של שווה ערך p24) בהעדר או נוכחות של 1 מיקרומטר HIV-1 IN מעכב Raltegravir ב 480 XG ו -25 מעלות צלזיוס למשך 2 שעות. התאים היו ובהמשך בתרבית למשך 5 שעות ב 37 מעלות צלזיוס, 5% CO 2. תמונות היו מבודדות כפי שתוארו בסעיף בפרוטוקול. תגובות IVI בוצעו, כל שימוש 200 μL של תמונות 600 ng של DNA היעד (קטע DNA 2 kb המוגבר מ- DNA phiX174 ידי PCR), על 37 מעלות צלזיוס למשך 45 דקות. התגובות היו deproteinized ידי טיפול proteinase K בנוכחות SDS ו EDTA ב 56 מעלות CO / N. מוצרי התגובה חולצו פעמים עם פנול, פעם עם פנול: כלורופורם (1: 1) תערובת, ופעםעם כלורופורם. בהמשך לכך, ה- DNA היה אתנול זרז בנוכחות מלח ואת גליקוגן שיתוף הנמהר, לבין גלולת DNA נשטפה פעם עם 80% אתנול. ה- DNA המטוהר היה resuspended ב 50 μL של מי nuclease חינם. אסטרטגית qPCR מקוננות שמשה כדי לקבוע את מספר vDNA השתלב DNA phiX174. בשנתי ה PCR הקונבנציונלי בסיבוב הראשון, תחל משלימה רצפים על ה- DNA יעד phiX174 ואזור LTR ויראלי שמשה כדי להגביר את צומת DNA נגיפי-יעד המשולב בין 5 μL של מוצרי ה- DNA תגובת אינטגרציה. ב-הסיבוב השני qPCR, LTR-פורש פריימרים שימשו אך ורק להגביר את רצפי DNA ספציפיות ל- HIV מ 5 μL של מוצרי amplicon בסיבוב הראשון והחל מה -10 דילולים סדרתי של מספרים עותק ידוע (10 8 -10 0) של שיבוט מולקולרי HIV-1 (התקנים). כל התגובות qPCR בוצעו בשלושה עותקים והנתונים werהדואר נותח באמצעות תוכנה מסחרית. הערכים הנגזרים הסטנדרטים היו זממו ליצור עקומת סטנדרט, שממנה vDNA משולבת להעתיק מספרים היו אינטרפולציה. ברי שגיאה מייצגים את סטיית התקן. כפי שניתן לראות באיור 3, התמונות HIV-1 וחסונה לשלב את vDNA הקשורים לתוך ה- DNA היעד (Lane 5). חשוב לציין, את היעילות IVI של התמונות היתה פחותה בהרבה בתגובות השלימו עם מעכב לפי Raltegravir (ליין 6). זה מאוד מייחס את פעילות האינטגרציה נמדדת assay זה כדי HIV-1. יתר על כן, התגובות המלאות המכילות lysates ציטופלסמית מתאים נגועים (הליין 1), התמונות לבד (ליין 2), למקד DNA בלבד (מסלול 3), ו חוצצים לבד (מסלול 4) לא הראו שום פעילות אינטגרציה. בנוסף, השליטה שהדירה פולימראז תקי בסיבוב הראשון PCR (Lane 7) לא להגביר מוצרי אינטגרציה. יצוין, כי הנתונים משלט pics-לבד (ליין 2) עולים כי ספציפי האסטרטגיה qPCR מקוננתקאלי מודד את vDNA המשולב אבל לא vDNA הקשורים PIC. ביחד, נתונים אלה מדגימים את מדידת פעילות האינטגרציה קשור PIC. <img alt="איור 1" src="/files/ftp_upload/54581/54581fig1.jpg" /> איור 1: ייצוג סכמטי של הפרוטוקול לעריכת תמונות HIV-1. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54581/54581fig1large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> תמציות cytoplasmic המכילות תמונות מבודדות מתאי Sup-T1 HIV-1-נגועים. התמונות האלה משמשים כמקור פעילות האינטגרציה ב assay אינטגרציה חוץ גופית. <img alt="איור 2" src="/files/ftp_upload/54581/54581fig2.jpg" /> איור 2: ייצוג סכמטי של במבחנה </e<html> m&gt; Assay האינטגרציה של HIV-1 תמונות. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54581/54581fig2large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> מבחני אינטגרציה בוצעו במבחנה באמצעות תמונות HIV-1 ואת היעד Heterologous DNA phiX174. הדנ&quot;א HIV-1 המשולב נמדד על ידי אסטרטגית PCR מקוננת, שבה PCR הקונבנציונלי בסיבוב הראשון מגביר צומת האינטגרציה שממנו הרצפים vDNA הספציפיים הם מוגברים מועדף א-סיבוב שני qPCR. <img alt="איור 3" src="/files/ftp_upload/54581/54581fig3.jpg" /> איור 3: HIV-1 PIC הקשורים vDNA שילוב פעילות. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54581/54581fig3large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> &quot;FO: keep-together.within-page =&quot; 1 &quot;&gt; תוצאות נציג של assay HIV-1 PIC הקשורים בפעילות אינטגרציה vDNA משולבת להעתיק מספרים נקבעו על ידי התוויית ערכי הנגזרות עקומת סטנדרט שנוצר באמצעות 10x דילולים סדרתי של. מספרי עותק ידועים של שיבוט מולקולרי HIV-1. כל התגובות בוצעו בשלושת עותקים ואת הנתונים נותחו באמצעות תוכנה מסחרית. ברי שגיאה מייצגים את סטיית התקן. <table fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> רְכִיב </td><td> המניה </td><td> נפח סופי עבור 50 תגובה μL </td></tr><tr><td> phiX174 פלסמיד דנ&quot;א </td><td> 10 ng / μL </td><td> 5.0 μL </td></tr><tr><td> מאגר התגובה GoTaq </td><td> 5x </td><td> 10.0 μL </td></tr><tr><td> תמהיל נוקלאוטיד dNTP </td><td> 10 מ&quot;מ כל </td&gt; <td> 1.0 מיקרוליטר </td></tr><tr><td> פריימר phiX174-F </td><td> 10 מיקרומטר </td><td> 2.5 μL </td></tr><tr><td> פריימר phiX174-R </td><td> 10 מיקרומטר </td><td> 2.5 μL </td></tr><tr><td> GoTaq DNA פולימראז </td><td> (5 U / μL) </td><td> 0.25 μL </td></tr><tr><td> nuclease ללא מים מזוקקים </td><td> - </td><td> 28.75 μL </td></tr></tbody></table> שולחן 1. <table fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> 95 ° C = 2 דקות </td></tr><tr><td> מחזור 34 חזרות של: 95 ° C = 30 s 53 ° C = 30 s 72 ° C = 2 דקות </td></tr><tr><td> 72 ° C = 10 דק &#39; </td></tr><tr><td> 4 ° C = Hold </td></tr></tbody></table> שולחן 2. <tab<html> le FO: keep-together.within-page = &quot;1&quot; FO: keep-עם-next.within-page = &quot;תמיד&quot;&gt; <tbody><tr><td> רְכִיב </td><td> המניה </td><td> נפח סופי עבור 50 תגובה μL </td></tr><tr><td> מוצר ה- DNA התגובה IVI </td><td> - </td><td> 5.0 μL </td></tr><tr><td> מאגר התגובה GoTaq </td><td> 5x </td><td> 10.0 μL </td></tr><tr><td> תמהיל נוקלאוטיד dNTP </td><td> 10 מ&quot;מ כל </td><td> 1.0 מיקרוליטר </td></tr><tr><td> פריימר LTR </td><td> 10 מיקרומטר </td><td> 2.5 μL </td></tr><tr><td> פריימר phiX174 </td><td> 10 מיקרומטר </td><td> 2.5 μL </td></tr><tr><td> GoTaq DNA פולימראז </td><td> (5 U / μL) </td><td> 0.25 μL </td></tr><tr><td> nuclease ללא מים מזוקקים </td><td> - </td><td> 28.75 μL </td></tr></tbody></table> טבלה 3. <table fo:k</html style=";text-align:right;direction:rtl">יפ-together.within-page = &quot;1&quot; FO: keep-עם-next.within-page = &quot;תמיד&quot;&gt; <tbody><tr><td> 95 ° C = 5 דקות </td></tr><tr><td> מחזור 23 חזרות של: 94 ° C = 30 s 55 ° C = 30 s 72 ° C = 4 דקות </td></tr><tr><td> 72 ° C = 10 דק &#39; </td></tr><tr><td> 4 ° C = Hold </td></tr></tbody></table> לוח 4. <table fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> רְכִיב </td><td> המניה </td><td> נפח סופי במשך 30 תגובה μL </td></tr><tr><td> 1 מוצרי PCR העגול st </td><td> - </td><td> 5.0 μL </td></tr><tr><td> פריימר LTR-R </td><td> 10 מיקרומטר </td><td> 0.9 μL </td></tr><tr><td> פריימר LTR-U </td><td> 10 מיקרומטר </td><td> 0.9 μL </td></tr><tr> &lt;td&gt; Probe TaqMan </td><td> 10 מיקרומטר </td><td> 0.3 μL </td></tr><tr><td> iQ Supermix </td><td> 2x </td><td> 15.0 μL </td></tr><tr><td> nuclease ללא מים מזוקקים </td><td> - </td><td> 7.9 μL </td></tr></tbody></table> לוח 5. <table fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> 95 ° C = 3 דקות </td></tr><tr><td> מחזור 39 חזרות של: 94 ° C = 15 שניות 58 ° C = 30 s 72 ° C = 30 s פלייט קרא </td></tr></tbody></table> לוח 6.

Watch this Scientific Journal Video about Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes at JoVE.com

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

This report describes an in vitro assay for measuring the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC)-associated integration activity in the cytoplasmic extracts of acutely infected cells. The integration of PIC-associated HIV-1 DNA into heterologous target DNA is quantified by using a nested real-time polymerase chain reaction strategy.

מדידה<em&gt; במבחנה</em&gt; פעילות האינטגרציה של HIV-1 Preintegration מכלולים

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the ...

measurement-vitro-integration-activity-hiv-1-preintegration

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

7.4K Views.  Meharry Medical College. This report describes an in vitro assay for measuring the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC)-associated integration activity in the cytoplasmic extracts of acutely infected cells. The integration of PIC-associated HIV-1 DNA into heterologous target DNA is quantified by using a nested real-time polymerase chain reaction strategy. 

Video: Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her viral population uses the CCR5 coreceptor for cellular entry, and not an alternative coreceptor. One approach to tropism testing is to examine the sequence of the V3 region of the HIV envelope, which interacts with the coreceptor.
Methods: Viral RNA is extracted from blood plasma. The V3 region is amplified in triplicate with nested reverse transcriptase-PCR. The amplifications are then sequenced and analyzed using the software, RE_Call. Sequences are then submitted to a bioinformatic algorithm such as geno2pheno to infer viral tropism from the V3 region. Sequences are inferred to be non-R5 if their geno2pheno false positive rate falls below 5.75%. If any one of the three sequences from a sample is inferred to be non-R5, the patient is unlikely to respond to a CCR5-antagonist.

HIV tropism can be inferred from the V3 region of the viral envelope. V3 is PCR amplified in triplicate using nested RT-PCR, sequenced, and interpreted using bioinformatic software. Samples with with 1 or more sequence(s) with low g2P scores are classified as non-R5 virus.

הסקה Genotypic של כמיהות HIV-1 שימוש אוכלוסייה מבוססת רצף של V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

In vitro Uncoating of HIV-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is composed of CA protein arranged as a lattice of hexagon. The capsid is closed by 7 pentamers at the broad end and 5 at the narrow end of the cone1, 2. Encased in this capsid shell is the viral ribonucleoprotein complex, and together they comprise the core.
Following fusion of the viral membrane with the target cell membrane, the HIV-1 is released into the cytoplasm. The capsid then disassembles releasing free CA in the soluble form3 in a process referred to as uncoating. The intracellular location and timing of HIV-1 uncoating are poorly understood. Single amino-acid substitutions in CA that alter the stability of the capsid also impair the ability of HIV-1 to infect cells4. This indicates that the stability of the capsid is critical for HIV-1 infection.
HIV-1 uncoating has been difficult to study due to lack of availability of sensitive and reliable assays for this process. Here we describe a quantitative method for studying uncoating in vitro using cores isolated from infectious HIV-1 particles. The approach involves isolation of cores by sedimentation of concentrated virions through a layer of detergent and into a linear sucrose gradient, in the cold. To quantify uncoating, the isolated cores are incubated at 37&deg;C for various timed intervals and subsequently pelleted by ultracentrifugation. The extent of uncoating is analyzed by quantifying the fraction of CA in the supernatant. This approach has been employed to analyze effects of viral mutations on HIV-1 capsid stability4, 5, 6. It should also be useful for studying the role of cellular factors in HIV-1 uncoating.

In vitro Uncoating of HIV-1 Cores

Uncoating is an essential step in the early phase of the HIV-1 life cycle and is defined as the disassembly of the capsid shell and the release of the viral ribonucleoprotein complex (vRNP). Here, we demonstrate techniques for isolating intact cores from HIV-1 virions and for quantifying their uncoating in vitro.

ב Uncoating במבחנה של HIV-1 ליבות

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is ...

Imaging of HIV-1 Envelope-induced Virological Synapse and Signaling on Synthetic Lipid Bilayers

Human immunodeficiency virus type 1 (HIV-1) infection occurs most efficiently via cell to cell transmission2,10,11. This cell to cell transfer between CD4+ T cells involves the formation of a virological synapse (VS), which is an F-actin-dependent cell-cell junction formed upon the engagement of HIV-1 envelope gp120 on the infected cell with CD4 and the chemokine receptor (CKR) CCR5 or CXCR4 on the target cell 8. In addition to gp120 and its receptors, other membrane proteins, particularly the adhesion molecule LFA-1 and its ligands, the ICAM family, play a major role in VS formation and virus transmission as they are present on the surface of virus-infected donor cells and target cells, as well as on the envelope of HIV-1 virions1,4,5,6,7,13. VS formation is also accompanied by intracellular signaling events that are transduced as a result of gp120-engagement of its receptors. Indeed, we have recently showed that CD4+ T cell interaction with gp120 induces recruitment and phosphorylation of signaling molecules associated with the TCR signalosome including Lck, CD3&zeta;, ZAP70, LAT, SLP-76, Itk, and PLC&gamma;15.
In this article, we present a method to visualize supramolecular arrangement and membrane-proximal signaling events taking place during VS formation. We take advantage of the glass-supported planar bi-layer system as a reductionist model to represent the surface of HIV-infected cells bearing the viral envelope gp120 and the cellular adhesion molecule ICAM-1. The protocol describes general procedures for monitoring HIV-1 gp120-induced VS assembly and signal activation events that include i) bi-layer preparation and assembly in a flow cell, ii) injection of cells and immunofluorescence staining to detect intracellular signaling molecules on cells interacting with HIV-1 gp120 and ICAM-1 on bi-layers, iii) image acquisition by TIRF microscopy, and iv) data analysis. This system generates high-resolution images of VS interface beyond that achieved with the conventional cell-cell system as it allows detection of distinct clusters of individual molecular components of VS along with specific signaling molecules recruited to these sub-domains.

This article describes a method to visualize formation of an HIV-1 envelope-induced virological synapse on glass supported planar bilayers by total internal reflection fluorescence (TIRF) microscopy. The method can also be combined with immunofluorescence staining to detect activation and redistribution of signaling molecules that occur during HIV-1 envelope-induced virological synapse formation.

הדמיה של HIV-1 מעטפה הנגרמת סינפסה Virological והאיתות על bilayers שומנים סינתטי

Human immunodeficiency virus type 1 (HIV-1) infection occurs most efficiently via cell to cell transmission2,10,11. This cell to cell transfer between ...

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

Plasmodium falciparum, the causative agent of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important health problems worldwide, being responsible for a total of 4 million deaths annually1. Due to their extensive overlap in developing regions, especially Sub-Saharan Africa, co-infections with malaria and HIV-1 are common, but the interplay between the two diseases is poorly understood. Epidemiological reports have suggested that malarial infection transiently enhances HIV-1 replication and increases HIV-1 viral load in co-infected individuals2,3. Because this viremia stays high for several weeks after treatment with antimalarials, this phenomenon could have an impact on disease progression and transmission.
The cellular immunological mechanisms behind these observations have been studied only scarcely. The few in vitro studies investigating the impact of malaria on HIV-1 have demonstrated that exposure to soluble malarial antigens can increase HIV-1 infection and reactivation in immune cells. However, these studies used whole cell extracts of P. falciparum schizont stage parasites and peripheral blood mononuclear cells (PBMC), making it hard to decipher which malarial component(s) was responsible for the observed effects and what the target host cells were4,5. Recent work has demonstrated that exposure of immature monocyte-derived dendritic cells to the malarial pigment hemozoin increased their ability to transfer HIV-1 to CD4+ T cells6,7, but that it decreased HIV-1 infection of macrophages8. To shed light on this complex process, a systematic analysis of the interactions between the malaria parasite and HIV-1 in different relevant human primary cell populations is critically needed.
Several techniques for investigating the impact of HIV-1 on the phagocytosis of micro-organisms and the effect of such pathogens on HIV-1 replication have been described. We here present a method to investigate the effects of P. falciparum-infected erythrocytes on the replication of HIV-1 in human primary monocyte-derived macrophages. The impact of parasite exposure on HIV-1 transcriptional/translational events is monitored by using single cycle pseudotyped viruses in which a luciferase reporter gene has replaced the Env gene while the effect on the quantity of virus released by the infected macrophages is determined by measuring the HIV-1 capsid protein p24 by ELISA in cell supernatants.

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

We have developed an in vitro malaria-HIV-1 co-infection model to study the impact of Plasmodium falciparum on the HIV-1 replicative cycle in human primary monocyte-derived macrophages. This versatile system can easily be adapted to other primary cell types susceptible to HIV-1 infection.

<em&gt; במבחנה</em&gt; שיתוף זיהום דגם ללמוד<em&gt; Plasmodium falciparum</em&gt;-HIV-1 אינטראקציות אדם מונוציטים הנגזרות תאים ראשוניים החיסון

Plasmodium falciparum, the causative agent  of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important ...

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.

הגבלת אנזים מבוסס שיבוט שיטה להערכה<em&gt; במבחנה</em&gt; יכולת שכפול של HIV-1 Gag-MJ4 וירוסי כימרי C סוג משנה

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target ...

Conformational Evaluation of HIV-1 Trimeric Envelope Glycoproteins Using a Cell-based ELISA Assay

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins are able to fuel the fusion process through their conformational changes could lead to the design of better, more effective immunogens for vaccine strategies. Here we describe a cell-based ELISA assay that allows studying the recognition of trimeric HIV-1 Env by monoclonal antibodies. Following expression of HIV-1 trimeric Env at the surface of transfected cells, conformation specific anti-Env antibodies are incubated with the cells. A horseradish peroxidase-conjugated secondary antibody and a simple chemiluminescence reaction are then used to detect bound antibodies. This system is highly flexible and can detect Env conformational changes induced by soluble CD4 or cellular proteins. It requires minimal amount of material and no highly-specialized equipment or know-how. Thus, this technique can be established for medium to high throughput screening of antigens and antibodies, such as newly-isolated antibodies.

Understanding viral surface antigens conformations is required to evaluate antibody neutralization and guide the design of effective vaccine immunogens. Here we describe a cell-based ELISA assay that allows the study of the recognition of trimeric HIV-1 Env expressed at the surface of transfected cells by specific anti-Env antibodies.

הערכת קונפורמציה של HIV-1 trimeric מעטפת גליקופרוטאינים שימוש ELISA Assay מבוסס Cell

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins ...

Isolation of Exosomes from the Plasma of HIV-1 Positive Individuals

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. They are found in a number of biological fluids and are known to carry a variety of proteins, lipids, and nucleic acid molecules. Originally thought to be little more than reservoirs for cellular debris, the roles of exosomes regulating biological processes and in diseases are increasingly appreciated.
Several methods have been described for isolating exosomes from cellular culture media and biological fluids. Due to their small size and low density, differential ultracentrifugation and/or ultrafiltration are the most commonly used techniques for exosome isolation. However, plasma of HIV-1 infected individuals contains both exosomes and HIV viral particles, which are similar in size and density. Thus, efficient separation of exosomes from HIV viral particles in human plasma has been a challenge.
To address this limitation, we developed a procedure modified from Cantin et. al., 2008 for purification of exosomes from HIV particles in human plasma. Iodixanol velocity gradients were used to separate exosomes from HIV-1 particles in the plasma of HIV-1 positive individuals. Virus particles were identified by p24 ELISA. Exosomes were identified on the basis of exosome markers acetylcholinesterase (AChE), and the CD9, CD63, and CD45 antigens. Our gradient procedure yielded exosome preparations free of virus particles. The efficient purification of exosomes from human plasma enabled us to examine the content of plasma-derived exosomes and to investigate their immune modulatory potential and other biological functions.

Techniques describing a gradient procedure to separate exosomes from human immunodeficiency virus (HIV) particles are described. This procedure was used to isolate exosomes away from HIV particles in human plasma from HIV-infected individuals. The isolated exosomes were analyzed for cytokine/chemokine content.

בידוד של Exosomes מהפלזמה של HIV-1 אנשים חיוביים

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. ...

Visualization of HIV-1 Gag Binding to Giant Unilamellar Vesicle (GUV) Membranes

The structural protein of HIV-1, Pr55Gag (or Gag), binds to the plasma membrane in cells during the virus assembly process. Membrane binding of Gag is an essential step for virus particle formation, since a defect in Gag membrane binding results in severe impairment of viral particle production. To gain mechanistic details of Gag-lipid membrane interactions, in vitro methods based on NMR, protein footprinting, surface plasmon resonance, liposome flotation centrifugation, or fluorescence lipid bead binding have been developed thus far. However, each of these in vitro methods has its limitations. To overcome some of these limitations and provide a complementary approach to the previously established methods, we developed an in vitro assay in which interactions between HIV-1 Gag and lipid membranes take place in a &#34;cell-like&#34; environment. In this assay, Gag binding to lipid membranes is visually analyzed using YFP-tagged Gag synthesized in a wheat germ-based in vitro translation system and GUVs prepared by an electroformation technique. Here we describe the background and the protocols to obtain myristoylated full-length Gag proteins and GUV membranes necessary for the assay and to detect Gag-GUV binding by microscopy.

Visualization of HIV-1 Gag Binding to Giant Unilamellar Vesicle GUV Membranes

We illustrate here an in vitro membrane binding assay in which interactions between HIV-1 Gag and lipid membranes are visually analyzed using YFP-tagged Gag synthesized in a wheat germ-based in vitro translation system and GUVs prepared by an electroformation technique.

ויזואליזציה של HIV-1 Gag מחייב את הענק Unilamellar שלפוחיות (בוס) ממברנות

The structural protein of HIV-1, Pr55Gag (or Gag), binds to the plasma membrane in cells during the virus assembly process. Membrane binding of Gag is an ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential to be used as drug therapies for HIV-1 infection. Post-integration inhibitors include ribozymes, short hairpin (sh) RNAs, small interfering (si) RNAs, U1 interference (U1i) RNAs and RNA aptamers. Many of these have been identified using transient co-transfection assays with an HIV-1 expression plasmid and some have advanced to clinical trials. In addition to measures of efficacy, small RNAs have been evaluated for their potential to affect the expression of human RNAs, alter cell growth and/or differentiation, and elicit innate immune responses. In the protocols described here, a set of transient transfection assays designed to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps in the HIV-1 replication cycle are described. We have used these assays to identify new ribozymes and optimize the format of shRNAs and siRNAs targeting HIV-1 RNA. The methods provide a quick set of assays that are useful for screening new anti-HIV-1 RNAs and could be adapted to screen other post-integration inhibitors of HIV-1 replication.

Methods to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps of the HIV-1 replication cycle are described. These methods are useful for screening new molecules and optimizing the format of existing ones.

הערכת היעילות והרעילות של RNAs מיקוד ייצור HIV-1 לשימוש ב ג&#39;ין או טיפול תרופתי

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

SILAC Based Proteomic Characterization of Exosomes from HIV-1 Infected Cells

Proteomics is the large-scale analysis of proteins. Proteomic techniques, such as liquid chromatography tandem mass spectroscopy (LC-MS/MS), can characterize thousands of proteins at a time. These powerful techniques allow us to have a systemic understanding of cellular changes, especially when cells are subjected to various stimuli, such as infections, stresses, and specific test conditions. Even with recent developments, analyzing the exosomal proteome is time-consuming and often involves complex methodologies. In addition, the resultant large dataset often needs robust and streamlined analysis in order for researchers to perform further downstream studies. Here, we describe a SILAC-based protocol for characterizing the exosomal proteome when cells are infected with HIV-1. The method is based on simple isotope labeling, isolation of exosomes from differentially labeled cells, and mass spectrometry analysis. This is followed by detailed data mining and bioinformatics analysis of the proteomic hits. The resultant datasets and candidates are easy to understand and often offer a wealth of information that is useful for downstream analysis. This protocol is applicable to other subcellular compartments and a wide range of test conditions.

Here, we describe a quantitative proteomics method using the technique of stable isotope labeling by amino acids in cell culture (SILAC) to analyze the effects of HIV-1 infection on host exosomal proteomes. This protocol can be easily adapted to cells under different stress or infection conditions.