ويدعم هذا العمل جزئيا من خلال منح DA024558، DA30896، DA033892، وDA021471 من المعهد الوطني / المعاهد الوطنية للصحة لمؤتمر نزع السلاح. ونحن نعترف أيضا منحة G12MD007586 RCMI، فاندربيلت CTSA منح UL1RR024975، مركز بحوث بالحركة ميهاري (MeTRC) CTSA منحة U54 RR026140 من NCRR / المعاهد الوطنية للصحة، وMD007593 منحة U54 من NIMHD / المعاهد الوطنية للصحة، وتينيسي CFAR منحة P30 AI110527.

الإنتاج 1. الفيروسات ملاحظة: لتوليد التتر عالية من العدوى بفيروس نقص المناعة البشرية 1، transfect خط الخلية الجنينية البشرية الكلى (كلوة) 293T مع المعدية HIV-1 استنساخ الجزيئي باستخدام تنشيط القائمة على dendrimer ترنسفكأيشن الكاشف. وقد لوحظ أن الأسلوب فوسفات الكالسيوم ترنسفكأيشن تؤدي إلى نتائج مماثلة. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> في مختبر السلامة الأحيائية المستوى 2 (BSL2)، والبذور 3 × 10 6 293T الخلايا في صحن 10 سم في 8 مل من Dulbecco لتعديل النسر متوسطة (DMEM) تستكمل مع 10٪ مصل بقري جنيني (FBS) والبنسلين، والستربتومايسين. ثقافة الخلايا في مجموعة حاضنة عند 37 درجة مئوية و 5٪ CO 2 O / N. </li><li style=";text-align:right;direction:rtl"> في اليوم التالي، لtransfecting الخلايا في كل طبق 10 سم، وتمييع 8 ميكروغرام من pNL4-3 DNA البلازميد (انظر المواد الجدول) إلى الحجم النهائي من 300 ميكرولتر من DMEM تفتقر الدم والمضادات الحيوية. إضافة 80 ميكرولتر من كاشف ترنسفكأيشن، وتخلط جيدا من قبل pipetting، واحتضانها في RT ل5-10 دقيقة لترنسفكأيشن تشكيل تعقيدا. </li><li style=";text-align:right;direction:rtl"> إزالة المتوسطة من الأطباق التي كتبها طموح وإضافة 7 مل لكل طبق من DMEM الطازجة التي تحتوي على مصل الدم والمضادات الحيوية. </li><li style=";text-align:right;direction:rtl"> إضافة 1 مل من DMEM تحتوي على مصل الدم والمضادات الحيوية لمجمع ترنسفكأيشن، مزيج من قبل pipetting، وإضافة هذا الخليط إلى الخلايا. دوامة بلطف الطبق لتسهيل حتى توزيع المجمعات ترنسفكأيشن. </li><li style=";text-align:right;direction:rtl"> على الفور نقل الخلايا إلى المختبر BSL3، مكان في مجموعة حاضنة عند 37 درجة مئوية و 5٪ CO 2، وثقافة الخلايا لمدة 48 ساعة. </li><li style=";text-align:right;direction:rtl"> جمع زراعة الأنسجة طاف التي تحتوي على الفيروس باستخدام ماصة ومن ثم نقلها إلى أنبوب الطرد المركزي. أجهزة الطرد المركزي في 300 x ج لمدة 5 دقائق لخلايا بيليه والحطام، ومن ثم تصفية طاف من خلال مرشح حقنة 0.45 ميكرون مسام الحجم. </li><li style=";text-align:right;direction:rtl"> للقضاء على أي DNA البلازميد المرحل في هذا الإعداد الفيروس خالية من الخلايا، وعلاج مع الدناز 1 (20 ميكروغرام / مل) عند 37 درجة مئوية لمدة 1 ساعة. </li><li style=";text-align:right;direction:rtl"> لتحديدHIV-1 عيار، استخدم-P24 محددة انزيم مرتبط المناعي فحص (ELISA)، كما هو طريقة سريعة وقابلة للاستخدام الروتيني 22. ملاحظة: تجدر الإشارة إلى أن P24 ELISA يقيس عيار البدني (عدد جزيئات الفيروس). بدلا من ذلك، وقياس النشاط المرتبط بفيروس RT (خارجي RT فحص) أو العدوى بفيروس (المقايسات العدوى على أساس خط خلايا مؤشر تزم BL) ستقدم قراءات حصرية من جزيئات الفيروس المعدية. </li></ol> 2. عدوى فيروس من الخلايا سوب-T1 (BSL3 مختبر) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> في المختبر BSL2، والحفاظ على خلايا سوب-T1 بين 1.0 × 10 6 و 2.0 × 10 6 خلية / مل في معهد روزويل بارك التذكاري (RPMI) متوسطة تستكمل مع 10٪ الحرارة المعطل FBS والبنسلين، والستربتومايسين (نسبة الانقسام من 1 : 2 كل 2-3 د). تجميع الخلايا سوب-T1 من قوارير الثقافة، وتخلط جيدا من قبل pipetting، وتحديد عدد خلايا قابلة للحياة باستخدام عدادة الكريات والأزرق الاستبعاد التريبان الواحدaining الأسلوب. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إعداد العدد المطلوب من aliquots من 80 × 10 6 خلايا (لكل عدوى فيروس) في 50 مل أنابيب مخروطية أجهزة الطرد المركزي. </li><li style=";text-align:right;direction:rtl"> الطرد المركزي الخلايا في الدوار يتأرجح دلو في 500 x ج و 25 درجة مئوية لمدة 5 دقائق. دون إزالة مستنبت الخلية، ونقل الأنابيب التي تحتوي على الخلايا مكعبات إلى المختبر BSL3 لمزيد من المعالجة. بعناية نضح مستنبت خلية من الأنبوب من دون إزعاج بيليه الخلية. </li></ol></li><li style=";text-align:right;direction:rtl"> إضافة كمية مناسبة من اللقاح فيروس تعامل I-الدناز إلى الخلايا في الأنبوب وتخلط جيدا من قبل pipetting لطيف. 80 × 10 6 خلايا، استخدم 30 مل من فيروس تعامل I-الدناز (50 ميكروغرام من فيروس P24 ما يعادلها). ملاحظة: عزل بلدان جزر المحيط الهادئ وظيفية يتطلب يصيب الخلايا المستهدفة مع مولتيبليكيتييس عالية جدا من العدوى (وزارة الداخلية). </li><li style=";text-align:right;direction:rtl"> توزيع الخليط بالتساوي بين اثنين من لوحات زراعة الأنسجة 6-جيدا (أي 12 قسامات × 2.5 مل، واستخدام لوحات 2 في تصيبأيون). </li><li style=";text-align:right;direction:rtl"> لspinoculation، ووضع لوحات ثقافة في ناقلات لوحة وأجهزة الطرد المركزي باستخدام الدوار دلو يتأرجح في 480 x ج و 25 درجة مئوية لمدة 2 ساعة. </li><li style=";text-align:right;direction:rtl"> احتضان الخلايا spinoculated عند 37 درجة مئوية و 5٪ CO 2 لمدة 5 ساعات. </li></ol> 3. حصاد وتحلل الخلايا المصابة (BSL3 مختبر) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تجميع الخلايا المقابلة لكل العدوى من لوحات الثقافة في مل أنبوب مخروطي 50 أجهزة الطرد المركزي (~ 30 مل في المجموع). </li><li style=";text-align:right;direction:rtl"> حصاد الخلايا بواسطة الطرد المركزي في 300 x ج و 25 درجة مئوية لمدة 10 دقيقة. نضح بعناية طاف من الأنبوب (بدلا من ذلك، استخدم ماصة). </li><li style=";text-align:right;direction:rtl"> لإزالة أي جزيئات فيروسية المتبقية، ويغسل كل بيليه الخلية بإضافة 2 مل من العازلة K - / - (150 ملي بوكل، 20 ملي HEPES، ودرجة الحموضة 7.6 و 5 ملي MgCl 2) والطرد المركزي العينة في 300 x ج و 25 درجة مئوية لمدة 10 دقائق. ثم، من دون إزعاج بيليه، وإزالة بعناية طاف بواسطة الشفط أو باستخدام ماصة. </li><li style=";text-align:right;direction:rtl"> Repeaر خطوة 3.3. </li><li style=";text-align:right;direction:rtl"> بعناية إزالة أي العازلة المتبقية التي كتبها باستخدام micropipette. resuspend كل بيليه خلية في 2 مل من الجليد الباردة العازلة تحلل K + / + (الاحتياطي K - / - تستكمل مع 0.025٪ ديجيتونين، 1 ملم DTT و 20 ميكروغرام / مل أبروتينين)، خلط محتويات طيف من قبل pipetting، ونقل إلى 2 مل أنبوب microcentrifuge. </li></ol> 4. إعداد بلدان جزر المحيط الهادئ حشوية (BSL3 مختبر) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> صخرة العينات على شاكر دوارة في RT لمدة 10 دقيقة. </li><li style=";text-align:right;direction:rtl"> الطرد المركزي العينات، مع الدوار precooled إلى 4 درجات مئوية، في 1500 x ج و 4 درجات مئوية لمدة 4 دقائق. </li><li style=";text-align:right;direction:rtl"> من دون إزعاج بيليه، ونقل بعناية طاف لأنبوب microcentrifuge الطازجة وأجهزة الطرد المركزي في 16000 x ج و 4 درجات مئوية لمدة 1 دقيقة. </li><li style=";text-align:right;direction:rtl"> نقل بعناية طاف لأنبوب microcentrifuge الطازجة. إضافة ريبونوكلياز ألف (20 ملغ / مل) إلى تركيز النهائي من 20 ميكروغرام / مل (2 ميكرولتر لمدة 2 مل من بلدان جزر المحيط الهادئ)، واحتضان محتويات في RT لمدة 30 دقيقة (أي هزاز). &lt;/ لى&gt; <li style=";text-align:right;direction:rtl"> إضافة السكروز (60٪ ث / ت في المخزن K - / -) لتركيز النهائي من 7٪ وتخلط جيدا من قبل pipetting لطيف. إعداد قسامات (على سبيل المثال، 200 ميكرولتر) من بلدان جزر المحيط الهادئ في أنابيب microcentrifuge، ومضة التجميد في النيتروجين السائل، ومكان في الفريزر -80 درجة مئوية للتخزين على المدى الطويل. </li></ol> 5. في المختبر التكامل (IVI) فحوصات عن طريق HIV-1 بلدان جزر المحيط الهادئ <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تحضير الحمض النووي الهدف المستخدمة في فحص IVI عن طريق تضخيم منطقة 2.0 كيلو بايت من DNA البلازميد phiX174 مع PCR باستخدام بادئات حسب الطلب، phiX174-F وphiX174-R. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تجميع خليط PCR كما هو موضح في الجدول رقم 1. أداء PCR في cycler الحرارية باستخدام الظروف الدراجات الحرارية الموصى بها في الجدول 2. هلام تنقية المنتج PCR باستخدام طقم تنقية هلام (بعد بروتوكول الموصى بها من الشركة المصنعة)، وتخزين الحمض النووي الهدف النقي كما aliquots في -80 درجة مئوية حتى الاستخدام. </li></ol></li><li style=";text-align:right;direction:rtl"> إضافة 600 نانوغرام من الحمض النووي المستهدف إلى 200 - &amp; #181، L قسامة من بلدان جزر المحيط الهادئ، وتخلط جيدا، واحتضان عند 37 درجة مئوية لمدة 45 دقيقة. ملاحظة: ينصح ردود الفعل IVI حذف الحمض النووي الهدف أو بما في ذلك مثبطات إنزيم مدمج (على سبيل المثال، Raltegravir) ردود الفعل السيطرة. </li><li style=";text-align:right;direction:rtl"> وقف رد فعل IVI بإضافة SDS، EDTA، وبروتين كاف لتركيزات النهائي من 0.5٪ و 8 ملم، و 0.5 ملغ / مل على التوالي. خلط محتويات رد فعل جيدا واحتضان بين عشية وضحاها في 56 درجة مئوية. </li><li style=";text-align:right;direction:rtl"> في اليوم التالي، وتنقية الحمض النووي الكلي من رد فعل IVI من الفينول استخراج / الكلوروفورم وهطول الأمطار الايثانول. تنفيذ جميع الخطوات الطرد المركزي في 16000 x ج وRT. </li><li style=";text-align:right;direction:rtl"> إضافة حجم مساو من الفينول على عينة deproteinized، مزيج بقوة من قبل vortexing، وأجهزة الطرد المركزي لمدة 2 دقيقة. إزالة بعناية المرحلة المائية العليا وتحويلها إلى أنبوب جديد. </li><li style=";text-align:right;direction:rtl"> كرر الخطوة 5.5. نقل المرحلة المائية العليا لأنبوب جديد. </li><li style=";text-align:right;direction:rtl"> إضافة حجم مساو من 1: 1 الفينول: مزيج الكلوروفورم، ومزيج بقوة من قبل vortexing، وأجهزة الطرد المركزي FO<html> ص 2 دقيقة. نقل المرحلة المائية العليا لأنبوب جديد. </li><li style=";text-align:right;direction:rtl"> إضافة حجم مساو من كلوروفورم، مزيج بقوة من قبل vortexing، وأجهزة الطرد المركزي لمدة 2 دقيقة. نقل المرحلة المائية العليا لأنبوب جديد. </li><li style=";text-align:right;direction:rtl"> لترسيب الحمض النووي، إضافة الجليكوجين إلى تركيز النهائي من 0.1 ميكروغرام / ميكرولتر و 3 M من خلات الصوديوم إلى تركيز النهائي من 0.3 م و 2.5 مجلدات من الإيثانول بنسبة 100٪ (كريم الباردة). دوامة لخلط، لفترة وجيزة أجهزة الطرد المركزي لجمع محتويات، ووضع أنبوب في -80 درجة CO / N. </li><li style=";text-align:right;direction:rtl"> في اليوم التالي، الطرد المركزي العينة لمدة 30 دقيقة في 16000 x ج و 4 درجات مئوية لمدة 30 دقيقة. إزالة بعناية طاف دون الإخلال بيليه. </li><li style=";text-align:right;direction:rtl"> إضافة 500 ميكرولتر من 80٪ من الإيثانول (المثلج) لبيليه وأجهزة الطرد المركزي في 16000 x ج و 4 درجات مئوية لمدة 10 دقيقة. الهواء الجاف بيليه الحمض النووي في RT و resuspend بدقة في 50 ميكرولتر من nuclease خالية من المياه. تخزين عينات من الحمض النووي في -20 درجة مئوية. </li></ol> 6. PCR فحوصات لقياس الموافقة المسبقة عن علم آخر = &quot;jove_content&quot;&gt; ملاحظة: عدد نسخة من HIV-1 الحمض النووي دمجها في الحمض النووي الهدف وكميا من خلال استراتيجية PCR المتداخلة التي توظف 2 مجموعات من الاشعال و2 جولات متتابعة من PCR. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إجراء الجولة الأولى PCR التقليدية باستخدام بادئات استهداف LTR الفيروسي وphiX174 الحمض النووي (LTR وphiX174 الاشعال، على التوالي) لتضخيم تقاطعات من HIV-1 الحمض النووي المتكاملة. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تجميع الجولة الأولى-PCR خليط كما هو موضح في الجدول رقم 3. تجميع مزيج الرئيسي لجميع المكونات باستثناء قالب الحمض النووي، الاستغناء قسامات 45 ميكرولتر في أنابيب PCR منفصلة، ​​وإضافة 5 ميكرولتر من الحمض النووي القالب أو nuclease خالية من المياه (السيطرة). </li><li style=";text-align:right;direction:rtl"> أداء PCR في cycler الحرارية باستخدام الظروف الدراجات الحرارية الموصى بها في الجدول 4. </li></ol></li><li style=";text-align:right;direction:rtl"> إجراء الجولة الثانية QPCR باستخدام بادئات التي تكتنف المنطقة قصيرة من LTR الفيروسي (LTR-R والاشعال LTR-U) لتضخيم انتقائي تسلسل vDNA متكاملة من رو الأولمنتجات اوند PCR. لتحديد vDNA متكاملة نسخ الأرقام، وتوليد منحنى قياسي باستخدام 10X التخفيفات المسلسل من الأرقام نسخة المعروف (على سبيل المثال، 10 0-10 8) من استنساخ الجزيئي HIV-1. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تجميع الجولة الثانية QPCR خليط كما هو موضح في الجدول رقم 5. تجميع مزيج الرئيسي لجميع المكونات باستثناء قالب الحمض النووي، بعناية الاستغناء عن 25 مكل إلى العدد المناسب من الآبار في جيدا 96 PCR لوحة رد فعل، ثم قم بإضافة 5 ميكرولتر من الدور الاول غير المكرر، المنتجات PCR أو nuclease خالية من المياه (مراقبة). أداء جميع ردود الفعل QPCR في ثلاث نسخ. </li><li style=";text-align:right;direction:rtl"> تحميل لوحة PCR في الوقت الحقيقي PCR الصك وأداء QPCR باستخدام الظروف الدراجات الموصى بها في الجدول 6. </li><li style=";text-align:right;direction:rtl"> تحليل البيانات باستخدام البرمجيات المناسبة. </li></ol></li></ol>

<ol>
	<li>Sattentau, Q. J., Weiss, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CD4+antigen:+physiological+ligand+and+HIV+receptor.">The CD4 antigen: physiological ligand and HIV receptor.</a> Cell. 52 (5), 631-633 (1988).</li><li>Wilen, C. B., Tilton, J. C., Doms, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanisms+of+HIV+entry.">Molecular mechanisms of HIV entry.</a> Adv Exp Med Biol. 726, 223-242 (2012).</li><li>Bowerman, B., Brown, P. O., Bishop, J. M., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nucleoprotein+complex+mediates+the+integration+of+retroviral+DNA.">A nucleoprotein complex mediates the integration of retroviral DNA.</a> Genes Dev. 3 (4), 469-478 (1989).</li><li>Bukrinsky, M. I., Sharova, N., Dempsey, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Active+nuclear+import+of+human+immunodeficiency+virus+type+1+preintegration+complexes.">Active nuclear import of human immunodeficiency virus type 1 preintegration complexes.</a> Proc Natl Acad Sci. 9 (14), 6580-6584 (1992).</li><li>Hansen, M. S., Smith, G. J., Kafri, T., Molteni, V., Siegel, J. S., Bushman, F. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+complexes+derived+from+HIV+vectors+for+rapid+assays+in+vitro.">Integration complexes derived from HIV vectors for rapid assays in vitro.</a> Nature biotechnol. 17 (6), 578-582 (1999).</li><li>Farnet, C. M., Haseltine, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+of+human+immunodeficiency+virus+type+1+DNA+in+vitro.">Integration of human immunodeficiency virus type 1 DNA in vitro.</a> Proc Natl Acad Sci. 87 (11), 4164-4168 (1990).</li><li>Fujiwara, T., Mizuuchi, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+DNA+integration:+structure+of+an+integration+intermediate.">Retroviral DNA integration: structure of an integration intermediate.</a> Cell. 54 (4), 497-504 (1988).</li><li>Brown, P. O., Bowerman, B., Varmus, H. E., Bishop, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Correct+integration+of+retroviral+DNA+in+vitro.">Correct integration of retroviral DNA in vitro.</a> Cell. 49 (3), 347-356 (1987).</li><li>Lewinski, M. K., Bushman, F. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+DNA+integration--mechanism+and+consequences.">Retroviral DNA integration--mechanism and consequences.</a> Adv Genet. 55, 147-181 (2005).</li><li>Engelman, A., Mizuuchi, K., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV-1+DNA+integration:+mechanism+of+viral+DNA+cleavage+and+DNA+strand+transfer.">HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer.</a> Cell. 67 (6), 1211-1221 (1991).</li><li>Goff, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetics+of+retroviral+integration.">Genetics of retroviral integration.</a> Ann rev gen. 26, 527-544 (1992).</li><li>Panganiban, A. T., Temin, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+terminal+nucleotides+of+retrovirus+DNA+are+required+for+integration+but+not+virus+production.">The terminal nucleotides of retrovirus DNA are required for integration but not virus production.</a> Nature. 306 (5939), 155-160 (1983).</li><li>Bieniasz, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cell+biology+of+HIV-1+virion+genesis.">The cell biology of HIV-1 virion genesis.</a> Cell host microbe. 5 (6), 550-558 (2009).</li><li>Sherman, P. A., Fyfe, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+immunodeficiency+virus+integration+protein+expressed+in+Escherichia+coli+possesses+selective+DNA+cleaving+activity.">Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity.</a> Proc Natl Acad Sci. 87 (13), 5119-5123 (1990).</li><li>Katzman, M., Katz, R. A., Skalka, A. M., Leis, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+avian+retroviral+integration+protein+cleaves+the+terminal+sequences+of+linear+viral+DNA+at+the+in+vivo+sites+of+integration.">The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration.</a> J Virol. 63 (12), 5319-5327 (1989).</li><li>Craigie, R., Mizuuchi, K., Bushman, F. D., Engelman, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+in+vitro+assay+for+HIV+DNA+integration.">A rapid in vitro assay for HIV DNA integration.</a> Nucl acid res. 19 (10), 2729-2734 (1991).</li><li>Bushman, F. D., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activities+of+human+immunodeficiency+virus+(HIV)+integration+protein+in+vitro:+specific+cleavage+and+integration+of+HIV+DNA.">Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA.</a> Proc Natl Acad Sci. 88 (4), 1339-1343 (1991).</li><li>Pauza, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+bases+are+deleted+from+the+termini+of+HIV-1+linear+DNA+during+integrative+recombination.">Two bases are deleted from the termini of HIV-1 linear DNA during integrative recombination.</a> Virology. 179 (2), 886-889 (1990).</li><li>Engelman, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+analysis+of+HIV-1+preintegration+complexes.">Isolation and analysis of HIV-1 preintegration complexes.</a> Meth Mol Biol. 485, 135-149 (2009).</li><li>Engelman, A., Oztop, I., Vandegraaff, N., Raghavendra, N. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+HIV-1+preintegration+complexes.">Quantitative analysis of HIV-1 preintegration complexes.</a> Methods. 47 (4), 283-290 (2009).</li><li>Addai, A. B., Pandhare, J., Paromov, V., Mantri, C. K., Pratap, S., Dash, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cocaine+modulates+HIV-1+integration+in+primary+CD4++T+cells:+implications+in+HIV-1+pathogenesis+in+drug-abusing+patients.">Cocaine modulates HIV-1 integration in primary CD4+ T cells: implications in HIV-1 pathogenesis in drug-abusing patients.</a> J Leuk Biol. 97 (4), 779-790 (2015).</li><li>Wehrly, K., Chesebro, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=p24+antigen+capture+assay+for+quantification+of+human+immunodeficiency+virus+using+readily+available+inexpensive+reagents.">p24 antigen capture assay for quantification of human immunodeficiency virus using readily available inexpensive reagents.</a> Methods. 12 (4), 288-293 (1997).</li></ol>

الكتاب تعلن أي المصالح المالية وغير المالية المتنافسة.

وقد وفرت التحليلات الكيميائية الحيوية من بلدان جزر المحيط الهادئ فيروسات الأفكار الهامة في آلية التكامل الحمض النووي للفيروسات. قياس النشاط التكامل بين بلدان جزر المحيط الهادئ فيروسات يمكن تحقيق ذلك عن طريق فحص اللوحة تشكيل، تحليل الجنوبي لطخة، ومتداخلة QPCR. الاستراتيجية التجريبية لفحص اللوحة هي شاقة وتستخدم وسيلة غير مباشرة لقياس التكامل 6 و 7 و 18. جنوب القائم على لطخة التكامل فحوصات قياس تتطلب مباشرة ولكن كميات عالية نسبيا من بلدان جزر المحيط الهادئ 6 و 7 و 18. تفاصيل هذا التقرير استراتيجية QPCR المتداخلة لقياس HIV-1-الموافقة المسبقة عن علم يرتبط النشاط التكامل في المختبر. والميزة الرئيسية وأهمية هذا الأسلوب هو شرط كميات قليلة نسبيا من إعداد الموافقة المسبقة عن علم في رد فعل 4و 5 و 19. الخطوات الأكثر أهمية في هذه الطريقة هي جيل من فيروس ارتفاع عيار العدوى والتعامل مع إعداد الموافقة المسبقة عن علم. وتجدر الإشارة هنا إلى أن الجولة الأولى من PCR ينطوي التضخيم الهائل من التقاطعات التكامل. وبالتالي، فإن الأرقام نسخة متكاملة vDNA تحدد في الجولة QPCR الثاني هي شبه الكمية، وبالتالي، فإن الحد من عدم إعطاء قدر من نسخ vDNA المرتبطة الموافقة المسبقة عن علم. ومع ذلك، فإن vDNA المرتبطة PIC يمكن تحديد QPCR من الحمض النووي تنقيته من بلدان جزر المحيط الهادئ مع الاشعال LTR محددة. نسبة vDNA متكاملة نسخ الأرقام إلى vDNA المقابلة المرتبطة الموافقة المسبقة عن علم يمكن أن توفر معلومات عن كفاءة تكامل في المختبر رد فعل التكامل. هذه الطريقة يمكن تعديلها من خلال دمج غيرها من الحمض النووي الهدف مغاير الاختيار وغيرها من الاشعال للكشف عن التكامل في كل الاتجاهات. وباختصار، فإن طريقةوصفت هنا يقيس النشاط دمج HIV-1 بلدان جزر المحيط الهادئ كميا ويمكن اعتمادها للبحث تطوير فهم من التفاصيل الحيوية التكامل فيروسات.

HIV-1 تكرارها في الخلية المستهدفة ينطوي على خطوات متعددة، مجمعة على نطاق واسع إلى مرحلتين: الأحداث المبكرة والمتأخرة. تبدأ الأحداث في وقت مبكر عندما يتحد HIV-1 بالتتابع لمستقبلات سطح الخلية المستهدفة CD4 واحد من اثنين شارك في مستقبلات (CCR5 أو CXCR4) 1. وبالتالي، فإن الأغشية فتيل الفيروس الخلية، وقفيصة الفيروسية يتم تحريرها (CA) الأساسية في سيتوبلازم 2. يحتوي لب CA الحمض النووي الريبي الفيروسي الجيني واحد الذين تقطعت بهم السبل (ssRNA) والعديد من البروتينات، سواء الفيروسية والخلوية في الأصل. وتشمل البروتينات الفيروسية المرتبطة CA الناسخ العكسي (RT) وإنزيم مدمج (IN)، اثنين من الانزيمات التي تتوسط خطوات حاسمة خلال الأحداث في وقت مبكر في تكاثر الفيروس. وRT وفي وظيفة في إطار مجمعات البروتين النووي، وهي عكس النسخ مجمع (RTC) ومجمع ما قبل الاندماج (PIC)، على التوالي 3، 4، 5 &lt;سوب&gt;، 6. نهايات الفيروسي ssRNA الجينوم محطة ميناء تكرار (R) عناصر المتاخمة للتسلسل U5 فريد (في 5 &#39;النهاية) و U3 (في 3&#39; نهاية). وRTC يحول الجينوم الفيروسي ssRNA إلى المزدوج تقطعت بهم السبل (س) والحمض النووي نسخة (vDNA). النتائج هذه العملية النسخ العكسي أيضا في ازدواجية U5 وU3 متواليات، وبالتالي توليد يكرر محطة الطويلة (LTR) في كلا طرفي vDNA 7 و 8. وفي وقت لاحق، وفي المصاحب الموافقة المسبقة عن علم يحفز اثنين من التفاعلات الكيميائية الحيوية متسلسلة التي تمكن من دمج vDNA في كروموسوم المضيف 9 و 10 و 11. أولا، في السيتوبلازم، في multimers إشراك كلا لتر 12 و يلتصق على ثنائي النوكليوتيد من كل من طرفي 3&#39;-الطرفية. هذه المعالجة 3&#39;نهاية يولد مجموعة الهيدروكسيل في كل نهاية 3&#39;(CA OH) من vDNA.بعد ذلك، الموافقة المسبقة عن علم بالاتجار إلى النواة، حيث يستخدم في vDNA CA OH كما نيوكليوفيل لخفض كل من خيوط من الحمض النووي الصبغي بطريقة متداخلة. في وقت واحد، في التوصيلات coordinately طرفي vDNA لينتج عن ذلك من السندات phosphodiester على مسارات المقابل من الحمض النووي الصبغي. وبعد هذه الخطوة نقل حبلا، آلية الخلية المضيفة يزيل اثنين من النيوكليوتيدات المفردة في نهايات 5 &#39;من vDNA وإصلاح الثغرات واحدة الذين تقطعت بهم السبل التي تلت ذلك عند تقاطع للموقع التكامل. وبالتالي بداية أحداث ذروتها مع إنشاء نسخة الحمض النووي المتكاملة (طليعة الفيروس) للجينوم HIV-1. تقدم طليعة الفيروس بيئة مناسبة للتعبير الجين الفيروسي كفاءة، الذي يبدأ أحداث لاحقة، بما في ذلك التعبير من البروتينات المشفرة فيروس. التجمع من الفيروس غير ناضجة. ومهدها، وإطلاق سراح، والنضج في virions المعدية (13). المنقى المؤتلف في فيروسات هو المختص لتنفيذ، في المختبر، كلا تجهيز ونقل حبلا الأنشطة 3&#39;نهاية يوم خارجيا تزويد LTR مثل الركيزة الحمض النووي. وقد كشفت الدراسات البيوكيميائية باستخدام هذا في المؤتلف النقي الجوانب الهامة من vDNA التكامل 14، 15، 16، 17. ومع ذلك، خلافا لما حدث في العدوى الطبيعية، وهذا في المختبر رد فعل كيميائي حيوي لا يدعم التكامل متضافرة من طرفي DNA الركيزة في الحمض النووي الهدف. في المقابل، بلدان جزر المحيط الهادئ فيروسات المعزولة من الخلايا المصابة تماما تدمج بشكل منسق طرفي vDNA الذاتية إلى مغاير DNA الهدف. وأدى ذلك إلى اعتماد واسع النطاق والتحسينات اللاحقة من أنا ن المختبر التكامل (IVI) فحوصات باستخدام بلدان جزر المحيط الهادئ الأم معزولة. في أول ذكرت فيروسات IVI فحص وعصائر هيولية من الخلايا المصابة مع الفئران المؤتلففيروس ابيضاض الدم (MLV) ايواء الجين كولاي supF في LTR لها بمثابة مصدر النشاط في، والحمض النووي لفج امدا متحولة تم تزويد خلل في النمو التحللي خارجيا كما الحمض النووي الهدف. التكامل الناجح لالمؤتلف MLV الحمض النووي نسخ في الحمض النووي فج وأدى التعبير التي تلت ذلك supF لاستعادة القدرة على تشكيل اللوحة التذكارية للفاجات المؤتلف. ومع ذلك، فإن هذه الاستراتيجية التجريبية هو التكامل شاقة والتدابير بطريقة غير مباشرة. لمعالجة مثل هذه المحاذير، وضعت على أساس صمة عار الجنوبي غير مباشر نهاية الوسم الفحص، التي تحدد حجم النشاط IVI المرتبطة الموافقة المسبقة عن علم كإجراء من vDNA الذاتية دمجها الخارجية الجراثيم خطي phiX174 الحمض النووي، 6، 7، 18. رغم أن هذا الأسلوب يوفر مقياسا مباشرا لأحداث التكامل، هناك حاجة إلى كميات عالية نسبيا من إعداد الموافقة المسبقة عن علم، التي ما زالت تشكل تحديا تقنياتسعى. للتحايل على هذا، وقد وضعت المتداخلة المقايسات PCR القائم تتطلب كميات محدودة فقط من بلدان جزر المحيط الهادئ 4 و 5 و 19. في هذا التقرير، وصفنا نسخة محدثة من مقرها-PCR متداخلة في طريقة المختبر وضعت لتلخيص النشاط التكامل بوساطة PIC-HIV-1 التي تحدث أثناء العدوى الطبيعية. يستخدم هذا الأسلوب مقتطفات هيولية من الخلايا المستهدفة المصابة HIV-1 كمصدر من النشاط الذاتية الموافقة المسبقة عن علم، التي تقاس في الوقت الحقيقي البلمرة الكمية سلسلة من ردود الفعل (QPCR). يتم تكييفها إجراءات عزل بلدان جزر المحيط الهادئ وقياس الأنشطة إدماجهم، مع بعض التعديلات، من البروتوكولات نشرت من قبل المختبر Engelman 20. في هذه الطريقة، يتم بدء النشاط التكامل المرتبط الموافقة المسبقة عن علم من خلال توفير هدفا الحمض النووي الخطية دخيلة 21، والمنتجات الحمض النووي الناجم عنويتم تنقية هذا التفاعل التكامل وتستخدم كمادة أولية لالكمي PCR القائم لاحق. في الجولة الأولى PCR التقليدية، وتتضخم الوصلات الحمض النووي الفيروسي الهدف باستخدام بادئات المناسبة. في الدور الثاني QPCR، وتستخدم بادئات LTR محددة لإثراء تحديدا السكان vDNA من الجولة الاولى المنتجات PCR. الرجاء مراجعة القسم بروتوكول للحصول على وصف مفصل لهذا الأسلوب. في الدراسات المختبرية مع بلدان جزر المحيط الهادئ فيروسات أدت إلى تقدم كبير في فهمنا لآلية التكامل الحمض النووي للفيروسات، وفي تطوير مثبطات IN. وبناء على زيادة التركيز مؤخرا على مواقع التكامل رسم الخرائط HIV-1، وتحديد دور العوامل الفيروسية والمضيف في HIV-1 التكامل، وتطوير الأدوية المضادة للفيروسات جديدة نحو مكافحة مقاومة الأدوية، نتصور اهتماما متزايدا في والاستخدام الواسع النطاق للIVI المقايسات ، مثل تلك المذكورة في هذا التقرير. وهذا، بدوره، يؤدي إلىالتحسينات المستقبلية في طريقة، وبالتالي تنويع نطاق تطبيقاتها.

<table align="left" border="1" cellpadding="0" cellspacing="0" style="width:679px;" width="679">
	<tbody>
		<tr>
			<td style="width:312px;">
			Fetal bovine serum (FBS)
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			10437-028
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:34px;">
			Heat-inactivated Fetal bovine serum (Hi-FBS)
			</td>
			<td style="width:198px;height:34px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;height:34px;">
			10438-026
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:42px;">
			Dulbecco&#8217;s modified Eagle&#8217;s medium (DMEM)
			
			</td>
			<td style="width:198px;height:42px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;height:42px;">
			11995-065
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Roswell Park Memorial Institute (RPMI) 1640 medium
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			11875-093
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Phosphate buffered saline (PBS) (1X)
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			20012-027
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Trypsin-EDTA (0.25%)
			
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			25200-056
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Penicillin-Streptomycin solution (100x)
			</td>
			<td style="width:198px;">
			Cellgro/Mediatech
			</td>
			<td style="width:138px;">
			30-002-CI
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HEK293T cells (293T)
			</td>
			<td style="width:198px;">
			American Type Culture Collection (ATCC)
			</td>
			<td style="width:138px;">
			CRL-3216
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HIV-1 proviral molecular clone pNL4-3
			</td>
			<td style="width:198px;">
			NIH AIDS Research and Reference Reagent Program
			
			</td>
			<td style="width:138px;">
			114
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			PolyFect transfection reagent
			</td>
			<td style="width:198px;">
			Qiagen
			</td>
			<td style="width:138px;">
			301107
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			DNase
			
			</td>
			<td style="width:198px;">
			Calbiochem/Merckmillipore
			</td>
			<td style="width:138px;">
			260913
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Immulon 2HB 96-well plates
			
			</td>
			<td style="width:198px;">
			Thermo Scientific
			
			</td>
			<td style="width:138px;">
			3455
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Triton X-100
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			T9284
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			ELISA coating antibody: anti-CA-183-H12-5C monoclonal antibody
			</td>
			<td style="width:198px;">
			NIH AIDS Research and Reference Reagent Program
			
			</td>
			<td style="width:138px;">
			1513
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			ELISA wash solution (0.2% Tween-20 in PBS)
			</td>
			<td style="width:198px;">
			---
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Donor bovine serum
			</td>
			<td style="width:198px;">
			&#160;Gibco/Invitrogen
			</td>
			<td style="width:138px;">
			16030074
			
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:78px;">
			Blocking Buffer (5% donor bovine serum in PBS) - Prepare fresh before use.
			
			</td>
			<td style="width:198px;height:78px;">
			---
			</td>
			<td style="width:138px;height:78px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Sample diluent (SD) buffer (10% donor bovine serum and 0.5% Triton X-100 in PBS) - Sterilize using 0.22 micron pore-size syringe filter and store aliquots at 4&#176;C.
			
			</td>
			<td style="width:198px;">
			---
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Recombinant p24 protein
			(Full-length CA protein was expressed from pET21a-CA plasmid in E. coli BL21-DE3 and purified as described in Ref # ----)
			</td>
			<td style="width:198px;">
			Dr. Wesley Sundquist
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HIV IgG
			</td>
			<td style="width:198px;">
			NIH AIDS Research and Reference Reagent Program
			
			</td>
			<td style="width:138px;">
			3957
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Goat anti-human IgG (H+L) cross-adsorbed secondary antibody, HRP conjugate
			</td>
			<td style="width:198px;">
			Pierce/ThermoFisher
			
			</td>
			<td style="width:138px;">
			31412
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			TMB Microwell Peroxidase substrate system
			</td>
			<td style="width:198px;">
			KPL, Inc.
			</td>
			<td style="width:138px;">
			50-76-00
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			SupT1 cells
			</td>
			<td style="width:198px;">
			American Type Culture Collection (ATCC)
			</td>
			<td style="width:138px;">
			CRL-1942
			
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HEPES pH 7.2-7.5
			(ready-to-use solution)
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			15630-080
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Potassium chloride (KCl) solution
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			60142
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Magnesium chloride (MgCl2) solution
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			M1028
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Dithiothreitol (DTT)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			43815
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Aprotinin
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			A6106
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Digitonin
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			D141
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			RNase A
			</td>
			<td style="width:198px;">
			Invitrogen
			</td>
			<td style="width:138px;">
			12091-021
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:29px;">
			Sucrose
			</td>
			<td style="width:198px;height:29px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;height:29px;">
			S0389
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			phiX174 Replicative Form 1 DNA
			</td>
			<td style="width:198px;">
			Promega
			</td>
			<td style="width:138px;">
			D1531
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			PhiX174-F primer:
			5&#8217;-CGCTTCCATGACGCAGAAGTT-3&#8217;
			
			PhiX174-R primer:
			5&#8217;-CACTGACCCTCAGCAATCTTA-3&#8217;
			
			
			</td>
			<td style="width:198px;">
			Invitrogen and/or IDT-DNA
			</td>
			<td style="width:138px;">
			
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			dNTP mix
			</td>
			<td style="width:198px;">
			Promega
			</td>
			<td style="width:138px;">
			U1515
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Go Taq DNA Polymerase
			</td>
			<td style="width:198px;">
			Promega
			</td>
			<td style="width:138px;">
			M3005
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Qiaquick gel extraction kit
			</td>
			<td style="width:198px;">
			Qiagen
			</td>
			<td style="width:138px;">
			28706
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Ultrapure distilled water
			</td>
			<td style="width:198px;">
			Invitrogen
			</td>
			<td style="width:138px;">
			10977-015
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Tris-EDTA (TE) buffer (100X)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			T9285
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Sodium dodecyl sulphate (SDS)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			L3771
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:50px;">
			Ethylenediamine tetraacetic acid, disodium salt (EDTA) solution, 0.5 M, pH 8.0
			</td>
			<td style="width:198px;height:50px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;height:50px;">
			E7889
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Proteinase K (20 mg/ml ready-to-use solution)
			</td>
			<td style="width:198px;">
			Qiagen
			</td>
			<td style="width:138px;">
			19131
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Phenol (equilibrated with 10&#160;mM Tris HCl, pH&#160;8.0 and 1&#160;mM EDTA)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			P4557
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Chloroform
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			288306
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Glycogen (5 mg/ml solution)
			</td>
			<td style="width:198px;">
			Ambion/Invitrogen
			</td>
			<td style="width:138px;">
			AM9510
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Sodium acetate (3M, pH 5.2)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			57899
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Ethanol
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			E7023
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			First round LTR primer:
			5&#8217;-GTGCGCGCTTCAGCAAG-3&#8217;)
			First round phiX174 primer:
			5&#8217;-CACTGACCCTCAGCAATCTTA-3&#8217;
			</td>
			<td style="width:198px;">
			Invitrogen and/or IDT-DNA
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Second round LTR-R primer:
			5&#8217;-TCTGGCTAACTAGGGAACCCA-3&#8217;
			Second round LTR-U primer:
			5&#8217;-CTGACTAAAAGGGTCTGAGG-3&#8217;;
			
			Second round Taqman probe:
			&#160;5&#8217;-56- FAM/TTAAGCCTCAATAAAGCTTGC
			CTTGAGTGC/36-TAMRA/-3&#8217;
			</td>
			<td style="width:198px;">
			Invitrogen and/or IDT-DNA
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			iQ Supermix
			</td>
			<td style="width:198px;">
			Bio-Rad
			</td>
			<td style="width:138px;">
			170-8862
			</td>
		</tr>
	</tbody>
</table>

measurement of in vitro integration activity of hiv-1 preintegration complexes

البروتينات HIV-1 مغلف الانخراط مستقبلات المشابهة على سطح الخلية المستهدفة، الأمر الذي يؤدي إلى الخلية الفيروسية الانصهار غشاء يليها الافراج عن جوهر قفيصة الفيروسية (CA) في السيتوبلازم. وفي وقت لاحق، والناسخ العكسي الفيروسي (RT)، كجزء من تحمل الاسم نفسه البروتين النووي مجمع يسمى النسخ العكسي مجمع (RTC)، يحول الفيروسي RNA الجينوم واحد الذين تقطعت بهم السبل في نسخة الحمض النووي المزدوج تقطعت بهم السبل (vDNA). وهذا يؤدي إلى نشوء حيوي من مجمع البروتين النووي أخرى، ووصف المجمع قبل التكامل (PIC)، ويتألف من vDNA والبروتينات فيروس المرتبطة بها والعوامل المضيفة. وإنزيم مدمج الفيروسي المرتبطة الموافقة المسبقة عن علم (IN) ينسق دمج vDNA في الحمض النووي الصبغي المضيفة في عملية من خطوتين ينظم زمنيا ومكانيا. أولا، في عمليات ينتهي 3 &#39;من vDNA في السيتوبلازم، وثانيا، بعد بالاتجار الموافقة المسبقة عن علم إلى النواة، فإنه يتوسط دمج vDNA معالجتها في الحمض النووي الصبغي. بلدان جزر المحيط الهادئ معزولةمن الخلايا المستهدفة المصابة تماما مع HIV-1 وظيفية في المختبر، كما أنها مؤهلة لدمج vDNA يرتبط إلى الحمض النووي الهدف مغاير وأضاف خارجيا. وقد ساهمت في فحوصات المختبر التكامل هذه على أساس الموافقة المسبقة عن علم كبير لترسيم تفاصيل الآلية التكامل للفيروسات، وإلى اكتشاف في مثبطات. في هذا التقرير، إلا أننا الإفاضة محدث HIV-1 فحص الموافقة المسبقة عن علم أن يوظف استراتيجية تستند في عملها متداخلة في الوقت الحقيقي البلمرة الكمية سلسلة من ردود الفعل (QPCR) لقياس النشاط في المختبر التكامل بين بلدان جزر المحيط الهادئ الأم معزولة.

<html> عزل HIV-1 بلدان جزر المحيط الهادئ ويصور رسم تخطيطي للبروتوكول يستخدم لعزل HIV-1 بلدان جزر المحيط الهادئ من خلايا سوب-T1 المصابة تماما في الشكل 1. ويستمد هذا البروتوكول من الأساليب التي وصفها Engelman وآخرون. 19، 20. HIV-1 بلدان جزر المحيط الهادئ هي مجمعات البروتين النووي التي يتم تجميعها في الخلايا المصابة وتتكون من vDNA-كتب العكس، البروتينات الفيروسية، والعوامل الخلوية 19 و 20. يستخدم الطريقة الموضحة في هذا التقرير مقتطفات هيولية من الخلايا المصابة HIV-1 كمصدر للنشاط الاندماج المرتبطة الموافقة المسبقة عن علم. في النشاط التكامل المختبر من HIV-1 بلدان جزر المحيط الهادئ EP-together.within الصفحات = &quot;1&quot;&gt; ويرد التخطيطي النظر عن الطريقة المستخدمة لقياس النشاط IVI من HIV-1 بلدان جزر المحيط الهادئ في الشكل 2. هذه الطريقة تستخدم استراتيجية المتداخلة استنادا QPCR لقياس النشاط IVI المرتبطة الموافقة المسبقة عن علم، وتكييف الإجراءات، مع بعض التعديلات، من البروتوكولات نشرت من قبل المختبر Engelman 19 و 20 و 21. في هذه الطريقة، يتم بدء النشاط التكامل المرتبط الموافقة المسبقة عن علم من خلال توفير هدف الحمض النووي خطي مغاير 21، والمنتجات DNA الناتجة عن هذا التفاعل التكامل وتنقيته وتستخدم كمادة أولية لالكمي PCR القائم لاحق. في الجولة الأولى PCR التقليدية، وتقاطعات الحمض النووي الفيروسي الهدف وتتضخم باستخدام بادئات المناسبة. في الدور الثاني QPCR، وتستخدم بادئات LTR محددة لإثراء تحديدا السكان vDNA من الجولة الاولى المنتجات PCR. الرجاء مراجعة بروتوكول الصورةection للحصول على وصف مفصل لهذا الأسلوب. أداء نتائج ممثلة من مقايسة IVI باستخدام ترد HIV-1 بلدان جزر المحيط الهادئ في الشكل (3). تم spinoculated خلايا سوب-T1 (80 × 10 6 خلايا / عدوى) مع 30 مل من الدناز 1 المعاملة HIV-1 (~ 50 ميكروغرام من مكافئ P24) في وجود أو غياب من 1 ميكرومتر HIV-1 في المانع Raltegravir في 480 x ج و 25 درجة مئوية لمدة 2 ساعة. كانت الخلايا المزروعة في وقت لاحق لمدة 5 ساعات عند 37 درجة مئوية و 5٪ CO 2. وكانت بلدان جزر المحيط الهادئ معزولة كما هو موضح في قسم البروتوكول. نفذت ردود الفعل IVI خارج، كل باستخدام 200 ميكرولتر من بلدان جزر المحيط الهادئ و 600 نانوغرام من الحمض النووي الهدف (جزء DNA 2 كيلوبايت تضخيمها من الحمض النووي phiX174 بواسطة PCR)، عند 37 درجة مئوية لمدة 45 دقيقة. تم deproteinized ردود الفعل من قبل بروتين العلاج K في وجود SDS وEDTA عند 56 درجة CO / N. تم استخراج منتجات التفاعل مرتين مع الفينول، مرة واحدة مع الفينول: كلوروفورم (1: 1) خليط، ومرة ​​واحدةمع الكلوروفورم. وفي وقت لاحق، وكان الحمض النووي الايثانول عجلت في وجود الملح والجليكوجين شارك في مرسب، وغسلها بيليه الحمض النووي مرة واحدة مع 80٪ من الإيثانول. وكان معلق الحمض النووي المنقى في 50 ميكرولتر من nuclease خالية من المياه. تم استخدام استراتيجية QPCR المتداخلة لتحديد عدد من vDNA دمجها في phiX174 الحمض النووي. في الجولة الأولى PCR التقليدية، استخدمت الاشعال مكملة لتسلسل الحمض النووي على الهدف phiX174 والمنطقة LTR الفيروسية لتضخيم تقاطعات الحمض النووي الفيروسي متكاملة الهدف من 5 ميكرولتر من المنتجات الحمض النووي رد فعل التكامل. في الدور الثاني QPCR، استخدمت الاشعال LTR-تمتد لتضخيم حصرا تسلسل الحمض النووي فيروس نقص المناعة البشرية محددة من 5 ميكرولتر من المنتجات amplicon أول جولة ومن 10 أضعاف التخفيفات المسلسل من الأرقام نسخة معروفة (10 8 -10 0) من استنساخ الجزيئي HIV-1 (المعايير). وقد أجريت جميع ردود الفعل QPCR في ثلاث نسخ والبيانات ورالبريد تحليلها باستخدام البرمجيات التجارية. تم التخطيط القيم المستمدة من المعايير لتوليد منحنى القياسية، والتي من vDNA متكاملة نسخ ومحرف الأرقام. تمثل أشرطة الخطأ الانحرافات المعيارية. كما هو مبين في الشكل (3)، وبلدان جزر المحيط الهادئ HIV-1 دمج بقوة على vDNA المرتبطة في الحمض النووي الهدف (حارة 5). الأهم من ذلك، تم تخفيض كفاءة IVI من بلدان جزر المحيط الهادئ إلى حد كبير في ردود الفعل تستكمل مع المانع في Raltegravir (لين 6). هذه الصفات بقوة النشاط التكامل تقاس في هذا الاختبار إلى HIV-1 في. وعلاوة على ذلك، فإن ردود الفعل تحكم يحتوي لست] حشوية من الخلايا غير المصابة (لين 1)، بلدان جزر المحيط الهادئ وحدها (حارة 2)، تستهدف الحمض النووي وحده (حارة 3)، والعازلة وحدها (لين 4) لم تظهر أي نشاط الاندماج. وبالإضافة إلى ذلك، فإن السيطرة التي استبعدت البلمرة طق في الجولة الأولى PCR (لين 7) لا تضخيم المنتجات التكامل. والجدير بالذكر أن أشارت بيانات من سيطرة بلدان جزر المحيط الهادئ بذاتها (حارة 2) أن متداخلة specifi استراتيجية QPCRساتيا يقيس vDNA متكاملة ولكن ليس vDNA المرتبطة الموافقة المسبقة عن علم. بشكل جماعي، وهذه البيانات تظهر قياس النشاط التكامل المرتبط الموافقة المسبقة عن علم. <img alt="شكل 1" src="/files/ftp_upload/54581/54581fig1.jpg" /> الشكل 1: تمثيل تخطيطي لبروتوكول لإعداد HIV-1 بلدان جزر المحيط الهادئ. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54581/54581fig1large.jpg" target="_blank">الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.</a> يتم عزل مقتطفات هيولية تحتوي على بلدان جزر المحيط الهادئ من خلايا سوب-T1 المصابة HIV-1. وتستخدم هذه بلدان جزر المحيط الهادئ كمصدر للنشاط الاندماج في المختبر في التكامل الفحص. <img alt="الشكل 2" src="/files/ftp_upload/54581/54581fig2.jpg" /> الشكل 2: التمثيل التخطيطي لفي المختبر </e<html> م&gt; التكامل الفحص من HIV-1 بلدان جزر المحيط الهادئ. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54581/54581fig2large.jpg" target="_blank">الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.</a> وأجريت فحوصات التكامل في المختبر باستخدام HIV-1 بلدان جزر المحيط الهادئ والهدف مغاير phiX174 الحمض النووي. تم قياس HIV-1 الحمض النووي متكاملة من خلال استراتيجية PCR المتداخلة، حيث أن الجولة الأولى PCR التقليدية تضخم تقاطعات التكامل التي تتضخم تسلسل vDNA محددة تفضيلي في الدور الثاني QPCR. <img alt="الشكل (3)" src="/files/ftp_upload/54581/54581fig3.jpg" /> الشكل (3): HIV-1 الموافقة المسبقة عن علم المرتبطة vDNA التكامل آخر. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54581/54581fig3large.jpg" target="_blank">الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.</a> &quot;FO: المحافظة على together.within الصفحات =&quot; 1 &quot;&gt; النتائج التمثيلية للفحص النشاط التكامل المرتبطة PIC-HIV-1 vDNA متكاملة نسخ أرقام تم تحديدها من قبل بالتآمر القيم المستمدة من المنحنى القياسي إنشاؤها باستخدام 10X التخفيفات المسلسل. . وقد أجريت أرقام نسخة معروفة من استنساخ الجزيئي HIV-1 جميع ردود الفعل في ثلاث نسخ، وتم تحليل البيانات باستخدام البرمجيات التجارية. أشرطة الخطأ تمثل الانحرافات المعيارية. <table fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> مكون </td><td> مخزون </td><td> الحجم النهائي للرد فعل 50 ميكرولتر </td></tr><tr><td> phiX174 DNA البلازميد </td><td> 10 نانوغرام / ميكرولتر </td><td> 5.0 ميكرولتر </td></tr><tr><td> رد فعل العازلة GoTaq </td><td> 5X </td><td> 10.0 ميكرولتر </td></tr><tr><td> مزيج النوكليوتيدات dNTP </td><td> 10 ملي كل </td&gt; <td> 1.0 ميكرولتر </td></tr><tr><td> phiX174-F التمهيدي </td><td> 10 ميكرومتر </td><td> 2.5 ميكرولتر </td></tr><tr><td> phiX174-R التمهيدي </td><td> 10 ميكرومتر </td><td> 2.5 ميكرولتر </td></tr><tr><td> GoTaq البلمرة DNA </td><td> (5 U / ميكرولتر) </td><td> 0.25 ميكرولتر </td></tr><tr><td> الماء المقطر Nuclease خالية من </td><td> - </td><td> 28.75 ميكرولتر </td></tr></tbody></table> الجدول 1. <table fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> 95 ° C = 2 دقيقة </td></tr><tr><td> دورة 34 التكرار من: 95 ° C = 30 ثانية 53 ° C = 30 ثانية 72 ° C = 2 دقيقة </td></tr><tr><td> 72 ° C = 10 دقيقة </td></tr><tr><td> 4 ° C = امسك </td></tr></tbody></table> الجدول 2. <tab<html> لو فو: المحافظة على together.within الصفحات = &quot;1&quot; FO: المحافظة على مع next.within صفحة = &quot;دائما&quot;&gt; <tbody><tr><td> مكون </td><td> مخزون </td><td> الحجم النهائي للرد فعل 50 ميكرولتر </td></tr><tr><td> IVI ناتج التفاعل الحمض النووي </td><td> - </td><td> 5.0 ميكرولتر </td></tr><tr><td> رد فعل العازلة GoTaq </td><td> 5X </td><td> 10.0 ميكرولتر </td></tr><tr><td> مزيج النوكليوتيدات dNTP </td><td> 10 ملي كل </td><td> 1.0 ميكرولتر </td></tr><tr><td> LTR التمهيدي </td><td> 10 ميكرومتر </td><td> 2.5 ميكرولتر </td></tr><tr><td> phiX174 التمهيدي </td><td> 10 ميكرومتر </td><td> 2.5 ميكرولتر </td></tr><tr><td> GoTaq البلمرة DNA </td><td> (5 U / ميكرولتر) </td><td> 0.25 ميكرولتر </td></tr><tr><td> الماء المقطر Nuclease خالية من </td><td> - </td><td> 28.75 ميكرولتر </td></tr></tbody></table> الجدول 3. <table fo:k</html style=";text-align:right;direction:rtl">الآثار البيئية-together.within الصفحات = &quot;1&quot; FO: المحافظة على مع next.within صفحة = &quot;دائما&quot;&gt; <tbody><tr><td> 95 ° C = 5 دقيقة </td></tr><tr><td> دورة 23 التكرار من: 94 ° C = 30 ثانية 55 ° C = 30 ثانية 72 ° C = 4 دقيقة </td></tr><tr><td> 72 ° C = 10 دقيقة </td></tr><tr><td> 4 ° C = امسك </td></tr></tbody></table> جدول (4). <table fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> مكون </td><td> مخزون </td><td> الحجم النهائي للرد فعل 30 ميكرولتر </td></tr><tr><td> 1 ش المنتجات جولة PCR </td><td> - </td><td> 5.0 ميكرولتر </td></tr><tr><td> LTR-R التمهيدي </td><td> 10 ميكرومتر </td><td> 0.9 ميكرولتر </td></tr><tr><td> LTR-U التمهيدي </td><td> 10 ميكرومتر </td><td> 0.9 ميكرولتر </td></tr><tr> &lt;td&gt; التحقيق TAQMAN </td><td> 10 ميكرومتر </td><td> 0.3 ميكرولتر </td></tr><tr><td> معدل الذكاء SUPERMIX </td><td> 2X </td><td> 15.0 ميكرولتر </td></tr><tr><td> الماء المقطر Nuclease خالية من </td><td> - </td><td> 7.9 ميكرولتر </td></tr></tbody></table> الجدول 5. <table fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> 95 ° C = 3 دقيقة </td></tr><tr><td> دورة 39 التكرار من: 94 ° C = 15 ثانية 58 ° C = 30 ثانية 72 ° C = 30 ثانية لوحة مقروءة </td></tr></tbody></table> الجدول 6.

Watch this Scientific Journal Video about Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes at JoVE.com

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

This report describes an in vitro assay for measuring the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC)-associated integration activity in the cytoplasmic extracts of acutely infected cells. The integration of PIC-associated HIV-1 DNA into heterologous target DNA is quantified by using a nested real-time polymerase chain reaction strategy.

قياس ل<em&gt; في المختبر</em&gt; التكامل آخر من HIV-1 Preintegration مجمعات

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the ...

measurement-vitro-integration-activity-hiv-1-preintegration

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

7.4K Views.  Meharry Medical College. This report describes an in vitro assay for measuring the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC)-associated integration activity in the cytoplasmic extracts of acutely infected cells. The integration of PIC-associated HIV-1 DNA into heterologous target DNA is quantified by using a nested real-time polymerase chain reaction strategy. 

Video: Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her viral population uses the CCR5 coreceptor for cellular entry, and not an alternative coreceptor. One approach to tropism testing is to examine the sequence of the V3 region of the HIV envelope, which interacts with the coreceptor.
Methods: Viral RNA is extracted from blood plasma. The V3 region is amplified in triplicate with nested reverse transcriptase-PCR. The amplifications are then sequenced and analyzed using the software, RE_Call. Sequences are then submitted to a bioinformatic algorithm such as geno2pheno to infer viral tropism from the V3 region. Sequences are inferred to be non-R5 if their geno2pheno false positive rate falls below 5.75%. If any one of the three sequences from a sample is inferred to be non-R5, the patient is unlikely to respond to a CCR5-antagonist.

HIV tropism can be inferred from the V3 region of the viral envelope. V3 is PCR amplified in triplicate using nested RT-PCR, sequenced, and interpreted using bioinformatic software. Samples with with 1 or more sequence(s) with low g2P scores are classified as non-R5 virus.

الاستدلال الوراثي من HIV - 1 Tropism باستخدام السكان على أساس تسلسل V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

In vitro Uncoating of HIV-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is composed of CA protein arranged as a lattice of hexagon. The capsid is closed by 7 pentamers at the broad end and 5 at the narrow end of the cone1, 2. Encased in this capsid shell is the viral ribonucleoprotein complex, and together they comprise the core.
Following fusion of the viral membrane with the target cell membrane, the HIV-1 is released into the cytoplasm. The capsid then disassembles releasing free CA in the soluble form3 in a process referred to as uncoating. The intracellular location and timing of HIV-1 uncoating are poorly understood. Single amino-acid substitutions in CA that alter the stability of the capsid also impair the ability of HIV-1 to infect cells4. This indicates that the stability of the capsid is critical for HIV-1 infection.
HIV-1 uncoating has been difficult to study due to lack of availability of sensitive and reliable assays for this process. Here we describe a quantitative method for studying uncoating in vitro using cores isolated from infectious HIV-1 particles. The approach involves isolation of cores by sedimentation of concentrated virions through a layer of detergent and into a linear sucrose gradient, in the cold. To quantify uncoating, the isolated cores are incubated at 37&deg;C for various timed intervals and subsequently pelleted by ultracentrifugation. The extent of uncoating is analyzed by quantifying the fraction of CA in the supernatant. This approach has been employed to analyze effects of viral mutations on HIV-1 capsid stability4, 5, 6. It should also be useful for studying the role of cellular factors in HIV-1 uncoating.

In vitro Uncoating of HIV-1 Cores

Uncoating is an essential step in the early phase of the HIV-1 life cycle and is defined as the disassembly of the capsid shell and the release of the viral ribonucleoprotein complex (vRNP). Here, we demonstrate techniques for isolating intact cores from HIV-1 virions and for quantifying their uncoating in vitro.

Uncoating في المختبر من HIV - 1 النوى

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is ...

Imaging of HIV-1 Envelope-induced Virological Synapse and Signaling on Synthetic Lipid Bilayers

Human immunodeficiency virus type 1 (HIV-1) infection occurs most efficiently via cell to cell transmission2,10,11. This cell to cell transfer between CD4+ T cells involves the formation of a virological synapse (VS), which is an F-actin-dependent cell-cell junction formed upon the engagement of HIV-1 envelope gp120 on the infected cell with CD4 and the chemokine receptor (CKR) CCR5 or CXCR4 on the target cell 8. In addition to gp120 and its receptors, other membrane proteins, particularly the adhesion molecule LFA-1 and its ligands, the ICAM family, play a major role in VS formation and virus transmission as they are present on the surface of virus-infected donor cells and target cells, as well as on the envelope of HIV-1 virions1,4,5,6,7,13. VS formation is also accompanied by intracellular signaling events that are transduced as a result of gp120-engagement of its receptors. Indeed, we have recently showed that CD4+ T cell interaction with gp120 induces recruitment and phosphorylation of signaling molecules associated with the TCR signalosome including Lck, CD3&zeta;, ZAP70, LAT, SLP-76, Itk, and PLC&gamma;15.
In this article, we present a method to visualize supramolecular arrangement and membrane-proximal signaling events taking place during VS formation. We take advantage of the glass-supported planar bi-layer system as a reductionist model to represent the surface of HIV-infected cells bearing the viral envelope gp120 and the cellular adhesion molecule ICAM-1. The protocol describes general procedures for monitoring HIV-1 gp120-induced VS assembly and signal activation events that include i) bi-layer preparation and assembly in a flow cell, ii) injection of cells and immunofluorescence staining to detect intracellular signaling molecules on cells interacting with HIV-1 gp120 and ICAM-1 on bi-layers, iii) image acquisition by TIRF microscopy, and iv) data analysis. This system generates high-resolution images of VS interface beyond that achieved with the conventional cell-cell system as it allows detection of distinct clusters of individual molecular components of VS along with specific signaling molecules recruited to these sub-domains.

This article describes a method to visualize formation of an HIV-1 envelope-induced virological synapse on glass supported planar bilayers by total internal reflection fluorescence (TIRF) microscopy. The method can also be combined with immunofluorescence staining to detect activation and redistribution of signaling molecules that occur during HIV-1 envelope-induced virological synapse formation.

التصوير من HIV-1 مغلف من صنع المشبك الفيروسية، واشارة على طبقات ثنائية الدهون الاصطناعية

Human immunodeficiency virus type 1 (HIV-1) infection occurs most efficiently via cell to cell transmission2,10,11. This cell to cell transfer between ...

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

Plasmodium falciparum, the causative agent of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important health problems worldwide, being responsible for a total of 4 million deaths annually1. Due to their extensive overlap in developing regions, especially Sub-Saharan Africa, co-infections with malaria and HIV-1 are common, but the interplay between the two diseases is poorly understood. Epidemiological reports have suggested that malarial infection transiently enhances HIV-1 replication and increases HIV-1 viral load in co-infected individuals2,3. Because this viremia stays high for several weeks after treatment with antimalarials, this phenomenon could have an impact on disease progression and transmission.
The cellular immunological mechanisms behind these observations have been studied only scarcely. The few in vitro studies investigating the impact of malaria on HIV-1 have demonstrated that exposure to soluble malarial antigens can increase HIV-1 infection and reactivation in immune cells. However, these studies used whole cell extracts of P. falciparum schizont stage parasites and peripheral blood mononuclear cells (PBMC), making it hard to decipher which malarial component(s) was responsible for the observed effects and what the target host cells were4,5. Recent work has demonstrated that exposure of immature monocyte-derived dendritic cells to the malarial pigment hemozoin increased their ability to transfer HIV-1 to CD4+ T cells6,7, but that it decreased HIV-1 infection of macrophages8. To shed light on this complex process, a systematic analysis of the interactions between the malaria parasite and HIV-1 in different relevant human primary cell populations is critically needed.
Several techniques for investigating the impact of HIV-1 on the phagocytosis of micro-organisms and the effect of such pathogens on HIV-1 replication have been described. We here present a method to investigate the effects of P. falciparum-infected erythrocytes on the replication of HIV-1 in human primary monocyte-derived macrophages. The impact of parasite exposure on HIV-1 transcriptional/translational events is monitored by using single cycle pseudotyped viruses in which a luciferase reporter gene has replaced the Env gene while the effect on the quantity of virus released by the infected macrophages is determined by measuring the HIV-1 capsid protein p24 by ELISA in cell supernatants.

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

We have developed an in vitro malaria-HIV-1 co-infection model to study the impact of Plasmodium falciparum on the HIV-1 replicative cycle in human primary monocyte-derived macrophages. This versatile system can easily be adapted to other primary cell types susceptible to HIV-1 infection.

و<em&gt; في المختبر</em&gt; المشارك عدوى نموذج لدراسة<em&gt; المتصورة المنجلية</em&gt; HIV-1-التفاعلات في الإنسان خلايا الوحيدات المشتقة الابتدائية المناعي

Plasmodium falciparum, the causative agent  of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important ...

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.

تقييد أنزيم الاستنساخ القائم على أسلوب لتقييم<em&gt; في المختبر</em&gt; القدرة تكرار HIV-1 النوع الفرعي C-الكمامة MJ4 همي الفيروسات

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target ...

Conformational Evaluation of HIV-1 Trimeric Envelope Glycoproteins Using a Cell-based ELISA Assay

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins are able to fuel the fusion process through their conformational changes could lead to the design of better, more effective immunogens for vaccine strategies. Here we describe a cell-based ELISA assay that allows studying the recognition of trimeric HIV-1 Env by monoclonal antibodies. Following expression of HIV-1 trimeric Env at the surface of transfected cells, conformation specific anti-Env antibodies are incubated with the cells. A horseradish peroxidase-conjugated secondary antibody and a simple chemiluminescence reaction are then used to detect bound antibodies. This system is highly flexible and can detect Env conformational changes induced by soluble CD4 or cellular proteins. It requires minimal amount of material and no highly-specialized equipment or know-how. Thus, this technique can be established for medium to high throughput screening of antigens and antibodies, such as newly-isolated antibodies.

Understanding viral surface antigens conformations is required to evaluate antibody neutralization and guide the design of effective vaccine immunogens. Here we describe a cell-based ELISA assay that allows the study of the recognition of trimeric HIV-1 Env expressed at the surface of transfected cells by specific anti-Env antibodies.

تقييم بتكوين لHIV-1 مغلف مثلوثي بروتينات سكرية باستخدام خلية القاعدة ELISA الفحص

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins ...

Isolation of Exosomes from the Plasma of HIV-1 Positive Individuals

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. They are found in a number of biological fluids and are known to carry a variety of proteins, lipids, and nucleic acid molecules. Originally thought to be little more than reservoirs for cellular debris, the roles of exosomes regulating biological processes and in diseases are increasingly appreciated.
Several methods have been described for isolating exosomes from cellular culture media and biological fluids. Due to their small size and low density, differential ultracentrifugation and/or ultrafiltration are the most commonly used techniques for exosome isolation. However, plasma of HIV-1 infected individuals contains both exosomes and HIV viral particles, which are similar in size and density. Thus, efficient separation of exosomes from HIV viral particles in human plasma has been a challenge.
To address this limitation, we developed a procedure modified from Cantin et. al., 2008 for purification of exosomes from HIV particles in human plasma. Iodixanol velocity gradients were used to separate exosomes from HIV-1 particles in the plasma of HIV-1 positive individuals. Virus particles were identified by p24 ELISA. Exosomes were identified on the basis of exosome markers acetylcholinesterase (AChE), and the CD9, CD63, and CD45 antigens. Our gradient procedure yielded exosome preparations free of virus particles. The efficient purification of exosomes from human plasma enabled us to examine the content of plasma-derived exosomes and to investigate their immune modulatory potential and other biological functions.

Techniques describing a gradient procedure to separate exosomes from human immunodeficiency virus (HIV) particles are described. This procedure was used to isolate exosomes away from HIV particles in human plasma from HIV-infected individuals. The isolated exosomes were analyzed for cytokine/chemokine content.

عزل Exosomes من البلازما من HIV-1 الأفراد ايجابية

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. ...

Visualization of HIV-1 Gag Binding to Giant Unilamellar Vesicle (GUV) Membranes

The structural protein of HIV-1, Pr55Gag (or Gag), binds to the plasma membrane in cells during the virus assembly process. Membrane binding of Gag is an essential step for virus particle formation, since a defect in Gag membrane binding results in severe impairment of viral particle production. To gain mechanistic details of Gag-lipid membrane interactions, in vitro methods based on NMR, protein footprinting, surface plasmon resonance, liposome flotation centrifugation, or fluorescence lipid bead binding have been developed thus far. However, each of these in vitro methods has its limitations. To overcome some of these limitations and provide a complementary approach to the previously established methods, we developed an in vitro assay in which interactions between HIV-1 Gag and lipid membranes take place in a &#34;cell-like&#34; environment. In this assay, Gag binding to lipid membranes is visually analyzed using YFP-tagged Gag synthesized in a wheat germ-based in vitro translation system and GUVs prepared by an electroformation technique. Here we describe the background and the protocols to obtain myristoylated full-length Gag proteins and GUV membranes necessary for the assay and to detect Gag-GUV binding by microscopy.

Visualization of HIV-1 Gag Binding to Giant Unilamellar Vesicle GUV Membranes

We illustrate here an in vitro membrane binding assay in which interactions between HIV-1 Gag and lipid membranes are visually analyzed using YFP-tagged Gag synthesized in a wheat germ-based in vitro translation system and GUVs prepared by an electroformation technique.

تصور HIV-1 الكمامة ملزم لالعملاق Unilamellar الحويصلة (GUV) الأغشية

The structural protein of HIV-1, Pr55Gag (or Gag), binds to the plasma membrane in cells during the virus assembly process. Membrane binding of Gag is an ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential to be used as drug therapies for HIV-1 infection. Post-integration inhibitors include ribozymes, short hairpin (sh) RNAs, small interfering (si) RNAs, U1 interference (U1i) RNAs and RNA aptamers. Many of these have been identified using transient co-transfection assays with an HIV-1 expression plasmid and some have advanced to clinical trials. In addition to measures of efficacy, small RNAs have been evaluated for their potential to affect the expression of human RNAs, alter cell growth and/or differentiation, and elicit innate immune responses. In the protocols described here, a set of transient transfection assays designed to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps in the HIV-1 replication cycle are described. We have used these assays to identify new ribozymes and optimize the format of shRNAs and siRNAs targeting HIV-1 RNA. The methods provide a quick set of assays that are useful for screening new anti-HIV-1 RNAs and could be adapted to screen other post-integration inhibitors of HIV-1 replication.

Methods to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps of the HIV-1 replication cycle are described. These methods are useful for screening new molecules and optimizing the format of existing ones.

تقييم فعالية وسمية الرنا استهداف HIV-1 الإنتاج للاستخدام في الجينات أو العلاج بالعقاقير

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

SILAC Based Proteomic Characterization of Exosomes from HIV-1 Infected Cells

Proteomics is the large-scale analysis of proteins. Proteomic techniques, such as liquid chromatography tandem mass spectroscopy (LC-MS/MS), can characterize thousands of proteins at a time. These powerful techniques allow us to have a systemic understanding of cellular changes, especially when cells are subjected to various stimuli, such as infections, stresses, and specific test conditions. Even with recent developments, analyzing the exosomal proteome is time-consuming and often involves complex methodologies. In addition, the resultant large dataset often needs robust and streamlined analysis in order for researchers to perform further downstream studies. Here, we describe a SILAC-based protocol for characterizing the exosomal proteome when cells are infected with HIV-1. The method is based on simple isotope labeling, isolation of exosomes from differentially labeled cells, and mass spectrometry analysis. This is followed by detailed data mining and bioinformatics analysis of the proteomic hits. The resultant datasets and candidates are easy to understand and often offer a wealth of information that is useful for downstream analysis. This protocol is applicable to other subcellular compartments and a wide range of test conditions.

Here, we describe a quantitative proteomics method using the technique of stable isotope labeling by amino acids in cell culture (SILAC) to analyze the effects of HIV-1 infection on host exosomal proteomes. This protocol can be easily adapted to cells under different stress or infection conditions.