The authors would like to thank Mark Harrison and Gwen Hirsch of the University of Georgia for kindly providing the bacterial strain and other support to this study.

1. Sample Preparation
NOTE: Food samples are prepared for pre-enrichment according to Microbiology Laboratory Guidebook (MLG) of U.S. Department of Agriculture Food Safety and Inspection Service (USDA-FSIS)11 and Bacteriological analytical manual (BAM) of U.S. Food and Drug Administration (FDA)12.
<ol>
	<li>Aseptically place a 25 g portion of food sample such as black pepper, chicken breast, ground beef, and alfalfa sprouts or an environmental swab into a sterile laboratory blender bag with a built-in filter. Prepare an environmental swab by aseptically moistening a sponge with enrichment broth (Rappaport-Vassiliadis, RV). Then, drag the swab over entire surface or predetermined area and place it into a laboratory blender bag.</li>
</ol>
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/58612/58612fig1.jpg" /> 
Figure 1: Representative food and environmental samples for quasi-metagenomics detection and subtyping of Salmonella. Samples are placed in sterile filter stomacher bags along with RV broth. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58612/58612fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<ol start="2">
	<li>Thoroughly mix each 25 g sample with 225 mL of RV enrichment broth using a laboratory blender or hand massage for 30 s. 
	NOTE: Variants of RV broth as recommended by MLG and BAM may be used depending on sample types.</li>
	<li>Incubate sample-enrichment broth mixture in a laboratory incubator at 42 &#176;C for 4&#8211;24 h.</li>
	<li>After incubation, collect a 50 mL subsample of enrichment broth from the filtered side of the bag in a separate 50 mL centrifuge tube.</li>
	<li>Centrifuge the tube at 100 x g for 10 min to remove solid debris in the homogenate.</li>
	<li>Recover the supernatant carefully to a new 50 mL centrifuge tube and centrifuge the tubes at 3,000&#8211;6,000 x g for 10 min to recover cell pellet.</li>
	<li>(Optional) Discard the supernatant and wash the pellet by re-suspension in 5 mL of Buffered Peptone Water (BPW) and centrifuge the tubes at 3,000&#8211;6,000 &#215; g for 10 min. 
	NOTE: BPW can prepared by dissolving 10 g of peptone, 5 g of sodium chloride, 3.5 g of disodium phosphate, and 1.5 g of monopotassium phosphate into 1 L of distilled water. The final pH should be adjusted to 7.2 &#177; 0.2 at 25 &#176;C. Autoclave at 121 &#186;C for 15 min. Commercially available BPW can also be used.</li>
	<li>Discard supernatant and re-suspend the pellet in 5 mL of BPW.</li>
</ol>
2. Immunomagnetic Separation (IMS) and Multiple Displacement Amplification (MDA)
NOTE: To prevent cross-contamination between samples, work in a biosafety cabinet, change pipette tips for each tube, avoid touching the tube with the pipette, and do not place tubes close together in magnetic stand during the washing step.
<ol>
	<li>Thaw the sample buffer and the reaction buffer from the MDA kit on ice or at 4 &#176;C in advance.</li>
	<li>Mix 1 mL of re-suspended cell pellet in BPW with 20 &#956;L of anti-Salmonella beads in 1.5 mL microcentrifuge tubes and place it on the rotating mixer for 30 min at room temperature. 
	NOTE: Competitive flora, fat particulates, and proteins in the resuspended pellet can interfere with IMS. Dilution of re-suspended cell pellet in BPW is helpful to reduce the loss of the bead-Salmonella complexes from the magnetic stand during washing steps.</li>
	<li>Insert the tubes into the magnetic stand and allow 3 min for the proper recovery of beads by inverting the rack several times to concentrate the beads into a pellet on the side of the tube.</li>
	<li>Keep the tubes on the magnetic stand. Aspirate and discard the supernatant from each tube, as well as the remaining liquid in each tube&#8217;s cap. 
	NOTE: Be careful not to disturb the pellet of IMS beads on the side wall of the tube against the magnet.</li>
	<li>Remove the tube holder from the magnetic stand and add 1 mL of wash buffer (PBS containing 0.05 % (v/v) polysorbate 20) and invert several times to remove non-specifically binding bacteria from the complex.</li>
	<li>Repeat steps 2.3&#8211;2.5 twice.</li>
	<li>After the 3rd wash, perform the final magnetic separation of beads by repeating steps 2.3&#8211;2.4. Remove tubes from magnetic rack and place them in a microfuge for 1 s to spin down beads. Then, place the tubes in the magnetic rack for 3 min before removing any residual wash buffer.</li>
	<li>Re-suspend the bead-Salmonella complexes in 9 &#956;L of Sample buffer and incubate at 95 &#176;C for 3 min for denaturation.</li>
	<li>After cooling to 4 &#176;C on ice, combine with 9 &#956;L of Reaction buffer plus 1 &#956;L of enzyme mix and keep on ice.</li>
	<li>In a thermal cycler, incubate tubes at 30 &#176;C for 2 h for amplification, followed by heating at 65 &#176;C for 10 min to inactivate the enzyme and cool to 4 &#176;C on ice.</li>
	<li>Assess the quantity and quality of the MDA products by measuring the DNA concentration and purity (260/280 ratio &#62; 1.8) on a fluorospectrometer instrument. 
	NOTE: Because of non-specific binding of IMS beads, genomic DNA from organisms other than Salmonella is likely to be present in the MDA products, but it does not affect downstream analysis.</li>
	<li>Store the final products (20 &#956;L) at -20 &#176;C until use for real-time PCR and/or library preparation for quasimetagenomics sequencing.</li>
</ol>
3. Real-Time PCR
NOTE: This step is optional for 1) detecting Salmonella without subtyping, and 2) assessing sample quality prior to quasimetagenomics sequencing.
<ol>
	<li>Prepare 18 &#956;L of PCR mixture per sample, containing Universal PCR Master Mix (10 &#956;L), forward primer (2 &#956;L, 900 nM), reverse primer (2 &#956;L, 900 nM), probe (2 &#956;L, 250 nM), and molecular grade water (2 &#956;L). 
	Note: Salmonella-specific oligonucleotide primers (forward: CTCACCAGGAGATTACAACATGG, reverse: AGCTCAGACCAAAAGTGACCATC) and probe were designed to amplify a 94-bp sequence within the ttr gene (GenBank accession no. AF 282268)13.</li>
	<li>Mix the MDA product from step 2.12 by gently pipetting up and down bead-Salmonella complexes along with liquid to create a suspension. Add 2 &#956;L of the suspension into 18 &#956;L of PCR mixture.</li>
	<li>Run real-time PCR using an optimized real-time PCR protocol, specifying two holding periods, one at 50 &#176;C for 2 min and another at 95 &#176;C for 10 min, followed by 40 cycles of 95 &#176;C for 15 s and 60 &#176;C for 60 s.</li>
	<li>Calculate the threshold cycle (Ct), which is the number of cycles required for the fluorescence from the amplified DNA to cross the threshold line. 
	NOTE: The threshold line is set in the linear phase between base line and plateau of the amplification plots of samples. Negative results correspond to Ct values over 40 or samples with Ct values higher than that of negative control.</li>
</ol>
4. Library Preparation for Quasimetagenomic Sequencing
NOTE: The MDA products can be sequenced by both short read and long read (nanopore) sequencing platforms. Use the latest version of DNA library prep kits provided by the manufacturers of the sequencing platforms. Perform DNA library preparation according to manufacturers&#8217; instruction. Use the 2D low-input genomic DNA protocol for library preparation for the long-read sequencing platform5. For library preparation for the short-read sequencing platform, minor modifications to the manufacturer&#8217;s protocol are provided below.
<ol>
	<li>Follow standard library preparation methods by adding buffer solutions and reagents to MDA products. Transfer 40 &#956;L of the sequencing prepped MDA&#160; products to a new plate and add 20 &#956;L of PCR purification beads to each well.</li>
	<li>Incubate the plate at room temperature for 10 min without shaking.</li>
	<li>Wash the beads with 80% ethanol and dry the beads for 12 min.</li>
	<li>Re-suspend dried beads in 53 &#956;L of resuspension buffer and incubate for 2 min without shaking.</li>
	<li>Dilute and pool libraries following manufacturer&#8217;s instruction. 
	NOTE: A 10 pM pooled and denatured library is now ready to be sequenced.</li>
</ol>

<ol>
	<li>Valderrama, W. B., Dudley, E. G., Doores, S., Cutter, C. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Commercially+Available+Rapid+Methods+for+Detection+of+Selected+Food-borne+Pathogens.">Commercially Available Rapid Methods for Detection of Selected Food-borne Pathogens.</a> Critical Reviews in Food Science and Nutrition. 56 (9), 1519-1531 (2016).</li><li>Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+metagenomic+sequencing+to+food+safety:+detection+of+Shiga+Toxin-producing+Escherichia+coli+on+fresh+bagged+spinach.">Application of metagenomic sequencing to food safety: detection of Shiga Toxin-producing Escherichia coli on fresh bagged spinach.</a> Applied and Environmental Microbiology. 81 (23), 8183-8191 (2015).</li><li>Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strain-Level+Discrimination+of+Shiga+Toxin-Producing+Escherichia+coli+in+Spinach+Using+Metagenomic+Sequencing.">Strain-Level Discrimination of Shiga Toxin-Producing Escherichia coli in Spinach Using Metagenomic Sequencing.</a> PLoS One. 11 (12), e0167870 (2016).</li><li>Hyeon, J. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quasi-metagenomics+and+realtime+sequencing+aided+detection+and+subtyping+of+Salmonella+enterica+from+food+samples.">Quasi-metagenomics and realtime sequencing aided detection and subtyping of Salmonella enterica from food samples.</a> Applied and Environmental Microbiology. , (2017).</li><li>Hyeon, J. Y., Deng, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+detection+of+Salmonella+in+raw+chicken+breast+using+real-time+PCR+combined+with+immunomagnetic+separation+and+whole+genome+amplification.">Rapid detection of Salmonella in raw chicken breast using real-time PCR combined with immunomagnetic separation and whole genome amplification.</a> Food Microbiology. 63, 111-116 (2017).</li><li>Hosono, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unbiased+whole-genome+amplification+directly+from+clinical+samples.">Unbiased whole-genome amplification directly from clinical samples.</a> Genome Research. 13 (5), 954-964 (2003).</li><li>Seth-Smith, H. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole-genome+sequences+of+Chlamydia+trachomatis+directly+from+clinical+samples+without+culture.">Whole-genome sequences of Chlamydia trachomatis directly from clinical samples without culture.</a> Genome Research. 23 (5), 855-866 (2013).</li><li>Jacobson, A. P., Gill, V. S., Irvin, K. A., Wang, H., Hammack, T. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+methods+to+prepare+samples+of+leafy+green+vegetables+for+preenrichment+with+the+Bacteriological+Analytical+Manual+Salmonella+culture+method.">Evaluation of methods to prepare samples of leafy green vegetables for preenrichment with the Bacteriological Analytical Manual Salmonella culture method.</a> Journal of Food Protection. 75 (2), 400-404 (2012).</li><li>Jacobson, A. P., Hammack, T. S., Andrews, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+sample+preparation+methods+for+the+isolation+of+Salmonella+from+alfalfa+and+mung+bean+seeds+with+the+Bacteriological+Analytical+Manual's+Salmonella+culture+method.">Evaluation of sample preparation methods for the isolation of Salmonella from alfalfa and mung bean seeds with the Bacteriological Analytical Manual's Salmonella culture method.</a> Journal of AOAC International. 91 (5), 1083-1089 (2008).</li><li>Deng, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+subtyping+methods+against+a+whole-genome-sequencing+standard+for+Salmonella+enterica+serotype+Enteritidis.">Comparative analysis of subtyping methods against a whole-genome-sequencing standard for Salmonella enterica serotype Enteritidis.</a> Journal of Clinical Microbiology. 53 (1), 212-218 (2015).</li><li>. Microbiology Laboratory Guidebook Available from: <a target="_blank" href="https://www.fsis.usda.gov/wps/portal/fsis/topics/science/laboratories-and-procedures/guidebooks-and-methods/microbiology-laboratory-guidebook/microbiology-laboratory-guidebook">https://www.fsis.usda.gov/wps/portal/fsis/topics/science/laboratories-and-procedures/guidebooks-and-methods/microbiology-laboratory-guidebook/microbiology-laboratory-guidebook</a> (2018)</li><li>. Bacteriological Analytical Manual (BAM) Chapter 5: Salmonella Available from: <a target="_blank" href="https://www.fda.gov/Food/FoodScienceResearch/LaboratoryMethods/ucm070149.htm">https://www.fda.gov/Food/FoodScienceResearch/LaboratoryMethods/ucm070149.htm</a> (2018)</li><li>Malorny, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diagnostic+real-time+PCR+for+detection+of+Salmonella+in+food.">Diagnostic real-time PCR for detection of Salmonella in food.</a> Applied and Environmental Microbiology. 70 (12), 7046-7052 (2004).</li><li>June, G. A., Sherrod, P. S., Hammack, T. S., Amaguana, R. M., Andrews, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Relative+effectiveness+of+selenite+cystine+broth,+tetrathionate+broth,+and+Rappaport-Vassiliadis+medium+for+the+recovery+of+Salmonella+from+raw+flesh+and+other+highly+contaminated+foods:+precollaborative+study.">Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella from raw flesh and other highly contaminated foods: precollaborative study.</a> Journal of AOAC International. 78 (2), 375-380 (1995).</li><li>Hammack, T. S., Amaguana, R. M., June, G. A., Sherrod, P. S., Andrews, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Relative+effectiveness+of+selenite+cystine+broth,+tetrathionate+broth,+and+Rappaport-Vassiliadis+medium+for+the+recovery+of+Salmonella+spp.+from+foods+with+a+low+microbial+load.">Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella spp. from foods with a low microbial load.</a> Journal of Food Protection. 62 (1), 16-21 (1999).</li><li>Wood, D. E., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kraken:+ultrafast+metagenomic+sequence+classification+using+exact+alignments.">Kraken: ultrafast metagenomic sequence classification using exact alignments.</a> Genome Biology. 15 (3), R46 (2014).</li><li>Davis, S., Pettengill, J. B., Luo, Y., Payne, J., Shpuntoff, A., Rand, H., Strain, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CFSAN+SNP+Pipeline:+an+automated+method+for+constructing+SNP+matrices+from+next-generation+sequence+data.">CFSAN SNP Pipeline: an automated method for constructing SNP matrices from next-generation sequence data.</a> PeerJ Computer Science. 1 (e20), (2015).</li><li>Zhang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Salmonella+serotype+determination+utilizing+high-throughput+genome+sequencing+data.">Salmonella serotype determination utilizing high-throughput genome sequencing data.</a> Journal of Clinical Microbiology. 53 (5), 1685-1692 (2015).</li><li>Rodrigue, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole+genome+amplification+and+de+novo+assembly+of+single+bacterial+cells.">Whole genome amplification and de novo assembly of single bacterial cells.</a> PLoS One. 4 (9), e6864 (2009).</li><li>Ramamurthy, T., Ghosh, A., Pazhani, G. P., Shinoda, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+Perspectives+on+Viable+but+Non-Culturable+(VBNC)+Pathogenic+Bacteria.">Current Perspectives on Viable but Non-Culturable (VBNC) Pathogenic Bacteria.</a> Front Public Health. 2, 103 (2014).</li></ol>

The authors declare that they have no competing financial interests.

Because of the often-low abundance and in-homogenous presence of Salmonella in food and environmental samples, culture enrichment before IMS-MDA is still necessary for Salmonella detection and subtyping; it is therefore a critical step of the protocol. To identify optimal conditions to increase the abundance of Salmonella relative to sample background flora, different enrichment media may be evaluated for specific samples. According to MLG and BAM, both selective medium such as RV broth and non-selective medium such as buffered peptone water and lactose broth can be used for Salmonella enrichment from food samples. The use of RV at 42 &#176;C has been evaluated in our previous study4 for Salmonella enrichment from raw chicken meat, iceberg lettuce and black peppercorns to support quasimetagenomic analysis of the pathogen. According to FDA BAM and AOAC precollaborative8,9and collaborative studies14,15, RV is recommended for the analysis of high microbial and low microbial load foods.
The optimal duration of culture enrichment depends on multiple factors, such as sample type, level of Salmonella contamination, and the physiological state of the Salmonella contaminant. For example, when low levels of Salmonella (e.g., &#60; 1 CFU/g) cells are present in a meat sample and under refrigeration stress, longer enrichment time (e.g., &#62; 12 h) may be needed to revive and enrich Salmonella cells. Sufficient abundance of Salmonella in the modified microbiome leads to adequate sequencing coverage of the Salmonella contaminant genome, which can allow strain-level single nucleotide polymorphism (SNP) typing4. Shorter culture enrichment (e.g., less than 12 h) is possible for rapid detection5 or serotyping of Salmonella4.
Higher levels of Salmonella contamination and/or longer culture enrichment of contaminated food samples can result in higher concentrations of Salmonella genomic DNA in modified food microbiomes, which lead to lower Ct values from the real-time PCR analysis. Ct values display a negative correlation with sequencing coverage of the Salmonella contaminant genome4, and therefore can be used for optimization and modification of the workflow. According to our experience, culture enrichment, especially the length of it, is often the focus of troubleshooting efforts. For example, the Ct value of the IMS-MDA product from a raw chicken breast sample was relatively high at 35.94 (Figure 1). This sample was inoculated with 2.5 CFU/g of SE cells and incubated in BPW at 37 &#176;C for 2 h. Sequencing of this sample did not provide sufficient coverage of the SE genome to allow serotype prediction. In comparison, all the other samples with 4 h or longer enrichment were successfully serotyped from quasimetagenomic sequencing data (data not shown).
After sequencing, we recommend using Kraken16 to identify Salmonella reads for further bioinformatics analyses. CFSAN SNP pipeline17 and SeqSero18 can be used for SNP typing and serotyping prediction from raw sequencing reads, respectively.
This quasimetagenomic technique has several limitations. First, DNA concentration and purity of IMS-MDA products measured by a fluorospectrometer should be used only as a preliminary indicator of proper sample preparation. Due to the high efficiency of MDA, trace amounts of input DNA can be amplified to suffice whole genome sequencing19. Therefore, high quality and quantity DNA samples can still be generated even if culture enrichment or IMS fails to effectively concentrate Salmonella cells. The optional real-time PCR analysis provides a more targeted and informative assessment of the entire sample preparation workflow. Second, difficult-to-culture Salmonella cells, such as viable but nonculturable (VBNC) bacteria20, may not grow during culture enrichment. Therefore, these cells may not be detected by our method.
In summary, compared with traditional methods, our sample preparation method and quasi-metogenomic sequencing approach can allow substantial reduction of the analytical turnaround from Salmonella-contaminated food and environmental samples to robust subtyping of the Salmonella contaminants. In addition to Salmonella, this technique has the potential be applied to rapid and concerted detection and subtyping other foodborne pathogens.

Metagenomics sequencing theoretically allows concerted detection and subtyping of foodborne pathogens. However, food samples present challenges to the pathogen analysis by direct sequencing of the food microbiome. First, foodborne pathogens are often present at low levels in food samples. Most of the commercially available rapid detection methods still require 8&#8211;48 h culturing to enrich pathogen cells to a detectable level1. Second, many foods contain abundant microflora cells and/or food DNA, making foodborne pathogen DNA a small fraction of food metagenome and an elusive target for detection and subtyping by direct metagenomic sequencing.
Modification of food microbiomes has been reported to allow substantial concentration of foodborne pathogen DNA to facilitate sequencing-based detection of Shiga toxin-producing Escherichia coli2,3 and Salmonella enterica4. Because modified food microbiomes are still mixtures of different microbial species, their sequencing is termed as quasi-metagenomic analysis4. Microbiome modification can be performed by culture enrichment alone2,3 or in combination with immunomagnetic separation (IMS) and multiple displacement amplification (MDA)4,5. IMS can selectively capture pathogen cells from the enrichment culture via antibody-coated magnetic beads. MDA can generate sufficient amounts of genomic DNA for sequencing through the highly efficient &#632;29 DNA polymerase6. IMS-MDA has allowed culture-independent pathogen detection from clinical samples7, and shortening of the culture enrichment for quasi-metagenomic detection and subtyping of Salmonella in food samples4.
The overall goal of this method is to prepare quasi-metagenomic DNA from food samples to allow targeted concentration of Salmonella genomic DNA and subsequent detection and subtyping of the Salmonella contaminant by sequencing. Compared to standard methods for Salmonella detection8,9 and subtyping10, the quasimetagenomic approach can substantially shorten the turnaround time from contaminated food and environmental samples to molecular subtypes of the pathogen by unifying the two typically separated analyses into a single workflow. This method is particularly useful for applications such as foodborne outbreak response and other trace back investigations where robust pathogen subtyping is required in addition to pathogen detection and rapid analytical turnaround is important.

<table><tbody><tr><td>Laboratory blender bag w/filter</td><td>VWR</td><td>10048-886</td><td></td></tr><tr><td>Buffered peptone water</td><td>Oxoid Micorbiology Products</td><td>CM0509</td><td></td></tr><tr><td>Rappaport Vassiliadis broth</td><td>Neogen Acumedia</td><td>7730A</td><td></td></tr><tr><td>Polysorbate 20&amp;nbsp;</td><td>Millipore Sigma</td><td>P9416</td><td>Tween 20</td></tr><tr><td>Stomacher blender</td><td>Seward&amp;nbsp;</td><td>30010108</td><td></td></tr><tr><td>Centrifuge</td><td>Fisher Scientific</td><td>75005194</td><td></td></tr><tr><td>50 mL Centrifuge tubes</td><td>Fisher Scientific</td><td>05-539-6</td><td></td></tr><tr><td>Thermal Cycler</td><td>Techne Prime</td><td>EW-93945-13</td><td></td></tr><tr><td>StepOne Real-Time Thermal cycler</td><td>Applied Biosystems</td><td>4.76357</td><td></td></tr><tr><td>AMPure XP beads</td><td>Beckman Coulter</td><td>A63881</td><td>PCR purification beads; mix well before use; store at 4 &amp;deg;C</td></tr><tr><td>Nextera XT library prep kit</td><td>Illumina</td><td>FC-131-1024</td><td>Store at -80 &amp;deg;C</td></tr><tr><td>MinIon library prep kit</td><td>Oxford Nanopore</td><td>SQK-LSK108</td><td>Store at -80 &amp;deg;C</td></tr><tr><td>NanoDrop</td><td>Thermo Scientific</td><td>ND-2000</td><td></td></tr><tr><td>Dynabead Anti-Salmonella beads</td><td>Applied Biosystems</td><td>71002</td><td>Vortex well prior to use</td></tr><tr><td>Illustra GenomiPhi V2 DNA amplification kit (MDA kit)&lt;br/&gt; -Sample buffer&lt;br/&gt; -Reaction buffer&lt;br/&gt; -Enzyme mix</td><td>GE Healthcare</td><td>25-6600-30</td><td>Store at -80 &amp;deg;C</td></tr><tr><td>HulaMixer</td><td>Invitrogen</td><td>15920D</td><td></td></tr><tr><td>DynaMag magnetic rack</td><td>Invitrogen</td><td>12321D</td><td></td></tr><tr><td>TaqMan Universal PCR mastermix</td><td>Applied Biosystems</td><td>4304437</td><td>Mix well before use; store at 4 &amp;deg;C</td></tr><tr><td>Microfuge</td><td>Fisher Scientific</td><td>05-090-100</td><td></td></tr></tbody></table>

quasi-metagenomic analysis of salmonella from food and environmental samples

Quasi-metagenomics sequencing refers to the sequencing-based analysis of modified microbiomes of food and environmental samples. In this protocol, microbiome modification is designed to concentrate genomic DNA of a target foodborne pathogen contaminant to facilitate the detection and subtyping of the pathogen in a single workflow. Here, we explain and demonstrate the sample preparation steps for the quasi-metagenomics analysis of Salmonella enterica from representative food and environmental samples including alfalfa sprouts, ground black pepper, ground beef, chicken breast and environmental swabs. Samples are first subjected to the culture enrichment of Salmonella for a shortened and adjustable duration (4&#8211;24 h). Salmonella cells are then selectively captured from the enrichment culture by immunomagnetic separation (IMS). Finally, multiple displacement amplification (MDA) is performed to amplify DNA from IMS-captured cells. The DNA output of this protocol can be sequenced by high throughput sequencing platforms. An optional quantitative PCR analysis can be performed to replace sequencing for Salmonella detection or assess the concentration of Salmonella DNA before sequencing.

Prior to quasimetagenomic sequencing, the overall quantity and purity of IMS-MDA products can be evaluated by fluorospectrometer (Table 1).
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td>Enrichment time (h)</td>
			<td>Ct value</td>
			<td>Concentration (ng/ul)</td>
			<td>Purity (260/280)</td>
		</tr>
		<tr>
			<td>Brand A</td>
			<td>4</td>
			<td>24.71</td>
			<td>812.91</td>
			<td>1.89</td>
		</tr>
		<tr>
			<td></td>
			<td>8</td>
			<td>25.80</td>
			<td>900.36</td>
			<td>1.87</td>
		</tr>
		<tr>
			<td></td>
			<td>12</td>
			<td>15.41</td>
			<td>753.88</td>
			<td>1.84</td>
		</tr>
		<tr>
			<td>Brand B</td>
			<td>4</td>
			<td>20.63</td>
			<td>872.61</td>
			<td>1.87</td>
		</tr>
		<tr>
			<td></td>
			<td>8</td>
			<td>22.61</td>
			<td>993.41</td>
			<td>1.87</td>
		</tr>
		<tr>
			<td></td>
			<td>12</td>
			<td>19.08</td>
			<td>954.44</td>
			<td>1.87</td>
		</tr>
	</tbody>
</table>
Table 1: Quality and quantity assessment of DNA samples for quasi-metagenomic sequencing. Salmonella cells were inoculated in 25 g of raw chicken breast of two brands at 1 CFU/g. Inoculated samples were enriched in RV for 4, 8, and 12 h before IMS-MDA.
Targeted quantity assessment of Salmonella DNA can be performed by real-time PCR (Table 1 and Figure 2), which also serves as an alternative for Salmonella detection if subtyping is not needed.
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/58612/58612fig2.jpg" /> 
Figure 2: Real-time PCR for Salmonella detection or sample assessment for quasi-metagenomics sequencing. Amplification curves of real-time PCR of Salmonella DNA in IMS-MDA products after 4, 8 and 12 h of enrichment time are shown. A sample after only 2 h enrichment is also included. Salmonella cells (0.27 CFU/g) were inoculated 25 g of raw chicken breast from two brands A and B. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58612/58612fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Fluorospectrometer readings allow initial evaluation of sample preparation. Concentration of IMS-MDA products prepared from Salmonella contaminated chicken breast samples ranged from 701.54 to 945.86 ng/&#181;L, suggesting that the sample DNA has been amplified. According to manufacturer&#39;s guidance, the minimum DNA sample concentration for short read and long read sequencing is 0.2 ng/&#181;L and 1 &#181;g, respectively. The 260/280 ratio ranged from 1.85 to 1.88 (Table 1), showing high purity of the DNA samples with low levels of protein contamination.
Lower Ct values indicate higher concentrations of Salmonella genomic DNA in the sample. As shown in Table 1 and Figure 2, Ct values of IMS-MDA products decrease as enrichment time increases. In our previous study4, when Ct values were lower than 25, the majority (&#62;50%) of the SE genome was likely to be sequenced, and serotype prediction from raw sequencing reads was successful.
Unsuccessful culture enrichment or IMS can result in a relatively high Ct values indicating low concentration of Salmonella genomic DNA in the final sample as shown in Figure 2. This can happen despite a high DNA concentration and purity of the IMS-MDA products as suggested by fluorospectrometer readings.

Watch this Scientific Journal Video about Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples at JoVE.com

Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples

Here, we present a protocol to prepare DNA samples from food and environmental microbiomes for concerted detection and subtyping of Salmonella through quasimetagenomic sequencing. The combined use of culture enrichment, immunomagnetic separation (IMS), and multiple displacement amplification (MDA) allows effective concentration of Salmonella genomic DNA from food and environmental samples.&#160;

Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples

Quasi-metagenomics sequencing refers to the sequencing-based analysis of modified microbiomes of food and environmental samples. In this protocol, ...

quasi-metagenomic-analysis-salmonella-from-food-environmental

Nanyang Technological University

Research

JoVE Journal

Biology

8.6K Views.  Center for Food Safety. Deze methode kan worden gebruikt om Salmonella uit voedselmonsters te detecteren en de ziekteverwekker te identificeren tot het stamniveau door genetische fingerprinting. Het belangrijkste voordeel van deze techniek is dat het Salmonella detectie en subtypering combineert in een enkele workflow en de doorlooptijd aanzienlijk verkort van salmonella-besmet voedselmonster tot vingerafdruk van de ziekteverwekker. Om te beginnen, aseptisch plaats een 25 gram monster van voedsel in een steriele lab...

Video: Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples

Metagenomic Analysis of Silage

Metagenomics is defined as the direct analysis of deoxyribonucleic acid (DNA) purified from environmental samples and enables taxonomic identification of the microbial communities present within them. Two main metagenomic approaches exist; sequencing the 16S rRNA gene coding region, which exhibits sufficient variation between taxa for identification, and shotgun sequencing, in which genomes of the organisms that are present in the sample are analyzed and ascribed to "operational taxonomic units"; species, genera or families depending on the extent of sequencing coverage. 
In this study, shotgun sequencing was used to analyze the microbial community present in cattle silage and, coupled with a range of bioinformatics tools to quality check and filter the DNA sequence reads, perform taxonomic classification of the microbial populations present within the sampled silage, and achieve functional annotation of the sequences. These methods were employed to identify potentially harmful bacteria that existed within the silage, an indication of silage spoilage. If spoiled silage is not remediated, then upon ingestion it could be potentially fatal to the livestock.

Metagenomics was used to investigate the microbiome of silage cattle feed. Analysis was performed by shotgun sequencing. This approach was used to characterize the composition of the microbial community within the cattle feed.

Metagenomics is defined as the direct analysis of deoxyribonucleic acid (DNA) purified from environmental samples and enables taxonomic identification of ...

Genetics

Combination of Adhesive-tape-based Sampling and Fluorescence in situ Hybridization for Rapid Detection of Salmonella on Fresh Produce

This protocol describes a simple approach for adhesive-tape-based sampling of tomato and other fresh produce surfaces, followed by on-tape fluorescence in situ hybridization (FISH) for rapid culture-independent detection of Salmonella spp. Cell-charged tapes can also be placed face-down on selective agar for solid-phase enrichment prior to detection. Alternatively, low-volume liquid enrichments (liquid surface miniculture) can be performed on the surface of the tape in non-selective broth, followed by FISH and analysis via flow cytometry. To begin, sterile adhesive tape is brought into contact with fresh produce, gentle pressure is applied, and the tape is removed, physically extracting microbes present on these surfaces. Tapes are mounted sticky-side up onto glass microscope slides and the sampled cells are fixed with 10% formalin (30 min) and dehydrated using a graded ethanol series (50, 80, and 95%; 3 min each concentration). Next, cell-charged tapes are spotted with buffer containing a Salmonella-targeted DNA probe cocktail and hybridized for 15 - 30 min at 55&deg;C, followed by a brief rinse in a washing buffer to remove unbound probe. Adherent, FISH-labeled cells are then counterstained with the DNA dye 4',6-diamidino-2-phenylindole (DAPI) and results are viewed using fluorescence microscopy. For solid-phase enrichment, cell-charged tapes are placed face-down on a suitable selective agar surface and incubated to allow in situ growth of Salmonella microcolonies, followed by FISH and microscopy as described above. For liquid surface miniculture, cell-charged tapes are placed sticky side up and a silicone perfusion chamber is applied so that the tape and microscope slide form the bottom of a water-tight chamber into which a small volume (&le; 500 &mu;L) of Trypticase Soy Broth (TSB) is introduced. The inlet ports are sealed and the chambers are incubated at 35 - 37&deg;C, allowing growth-based amplification of tape-extracted microbes. Following incubation, inlet ports are unsealed, cells are detached and mixed with vigorous back and forth pipetting, harvested via centrifugation and fixed in 10% neutral buffered formalin. Finally, samples are hybridized and examined via flow cytometry to reveal the presence of Salmonella spp. As described here, our "tape-FISH" approach can provide simple and rapid sampling and detection of Salmonella on tomato surfaces. We have also used this approach for sampling other types of fresh produce, including spinach and jalape&ntilde;o peppers.

Combination of Adhesive-tape-based Sampling and Fluorescence in situ Hybridization for Rapid Detection of Salmonella on Fresh Produce

This protocol describes a simple adhesive-tape-based approach for sampling of tomato and other fresh produce surfaces, followed by rapid whole cell detection of Salmonella using fluorescence in situ hybridization (FISH).

This protocol describes a simple approach for adhesive-tape-based sampling of tomato and other fresh produce surfaces, followed by on-tape fluorescence in ...

Immunology and Infection

An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium

Current commercial PCRs tests for identifying Salmonella target genes unique to this genus. However, there are two species, six subspecies, and over 2,500 different Salmonella serovars, and not all are equal in their significance to public health. For example, finding S. enterica subspecies IIIa Arizona on a table egg layer farm is insignificant compared to the isolation of S. enterica subspecies I serovar Enteritidis, the leading cause of salmonellosis linked to the consumption of table eggs. Serovars are identified based on antigenic differences in lipopolysaccharide (LPS)(O antigen) and flagellin (H1 and H2 antigens). These antigenic differences are the outward appearance of the diversity of genes and gene alleles associated with this phenotype.
We have developed an allelotyping, multiplex PCR that keys on genetic differences between four major S. enterica subspecies I serovars found in poultry and associated with significant human disease in the US. The PCR primer pairs were targeted to key genes or sequences unique to a specific Salmonella serovar and designed to produce an amplicon with size specific for that gene or allele. Salmonella serovar is assigned to an isolate based on the combination of PCR test results for specific LPS and flagellin gene alleles. The multiplex PCRs described in this article are specific for the detection of S. enterica subspecies I serovars Enteritidis, Hadar, Heidelberg, and Typhimurium.
Here we demonstrate how to use the multiplex PCRs to identify serovar for a Salmonella isolate.

An Allelotyping PCR for Identifying Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium

We describe a multiplex PCR for the rapid detection of Salmonella enterica serovars Enteritidis, Hadar, Heidelberg, and Typhimurium. Specific Salmonella serovars can be identified by targeting a multiplex PCR to genes and sequences unique to the O-antigen biosynthesis cluster and flagellin of a given serovar. Serovar is assigned then to a Salmonella isolate based on the appearance of specific, size amplicons (PCR product) corresponding to the target allele.

Current commercial PCRs tests for identifying Salmonella target genes unique to this genus.  However, there are two species, six subspecies, and over ...

Digital PCR-based Competitive Index for High-throughput Analysis of Fitness in Salmonella

A competitive index is a common method used to assess bacterial fitness and/or virulence. The utility of this approach is exemplified by its ease to perform and its ability to standardize the fitness of many strains to a wild-type organism. The technique is limited, however, by available phenotypic markers and the number of strains that can be assessed simultaneously, creating the need for a great number of replicate experiments. Concurrent with large numbers of experiments, the labor and material costs for quantifying bacteria based on phenotypic markers are not insignificant. To overcome these negative aspects while retaining the positive aspects, we have developed a molecular-based approach to directly quantify microorganisms after engineering genetic markers onto bacterial chromosomes. Unique, 25 base pair DNA barcodes were inserted at an innocuous locus on the chromosome of wild-type and mutant strains of Salmonella. In vitro competition experiments were performed using inocula consisting of pooled strains. Following the competition, the absolute numbers of each strain were quantified using digital PCR and the competitive indices for each strain were calculated from those values. Our data indicate that this approach to quantifying Salmonella is extremely sensitive, accurate, and precise for detecting both highly abundant (high fitness) and rare (low fitness) microorganisms. Additionally, this technique is easily adaptable to nearly any organism with chromosomes capable of modification, as well as to various experimental designs that require absolute quantification of microorganisms.

Digital PCR-based Competitive Index for High-throughput Analysis of Fitness in Salmonella

This molecular-based approach for determining bacterial fitness facilitates precise and accurate detection of microorganisms using unique genomic DNA barcodes that are quantified via digital PCR. The protocol describes calculating the competitive index for Salmonella strains; however, the technology is readily adaptable to protocols requiring absolute quantification of any genetically-malleable organism.

A competitive index is a common method used to assess bacterial fitness and/or virulence. The utility of this approach is exemplified by its ease to ...

Heuristic Mining of Hierarchical Genotypes and Accessory Genome Loci in Bacterial Populations

Routine and systematic use of bacterial whole-genome sequencing (WGS) is enhancing the accuracy and resolution of epidemiological investigations carried out by Public Health laboratories and regulatory agencies. Large volumes of publicly available WGS data can be used to study pathogenic populations at a large scale. Recently, a freely available computational platform called ProkEvo was published to enable reproducible, automated, and scalable hierarchical-based population genomic analyses using bacterial WGS data. This implementation of ProkEvo demonstrated the importance of combining standard genotypic mapping of populations with mining of accessory genomic content for ecological inference. In particular, the work highlighted here used ProkEvo-derived outputs for population-scaled hierarchical analyses using the R programming language. The main objective was to provide a practical guide for microbiologists, ecologists, and epidemiologists by showing how to: i) use a phylogeny-guided mapping of hierarchical genotypes; ii) assess frequency distributions of genotypes as a proxy for ecological fitness; iii) determine kinship relationships and genetic diversity using specific genotypic classifications; and iv) map lineage differentiating accessory loci. To enhance reproducibility and portability, R markdown files were used to demonstrate the entire analytical approach. The example dataset contained genomic data from 2,365 isolates of the zoonotic foodborne pathogen Salmonella Newport. Phylogeny-anchored mapping of hierarchical genotypes (Serovar -&#62; BAPS1 -&#62; ST -&#62; cgMLST) revealed the population genetic structure, highlighting sequence types (STs) as the keystone differentiating genotype. Across the three most dominant lineages, ST5 and ST118 shared a common ancestor more recently than with the highly clonal ST45 phylotype. ST-based differences were further highlighted by the distribution of accessory antimicrobial resistance (AMR) loci. Lastly, a phylogeny-anchored visualization was used to combine hierarchical genotypes and AMR content to reveal the kinship structure and lineage-specific genomic signatures. Combined, this analytical approach provides some guidelines for conducting heuristic bacterial population genomic analyses using pan-genomic information.

This analytical computational platform provides practical guidance for microbiologists, ecologists, and epidemiologists interested in bacterial population genomics. Specifically, the work presented here demonstrated how to perform: i) phylogeny-guided mapping of hierarchical genotypes; ii) frequency-based analysis of genotypes; iii) kinship and clonality analyses; iv) identification of lineage differentiating accessory loci.

Routine and systematic use of bacterial whole-genome sequencing (WGS) is enhancing the accuracy and resolution of epidemiological investigations carried ...

Characterization of a Pathogenic Escherichia coli Strain Derived from Oreochromis spp. Farms Using Whole-Genome Sequencing

Aquaculture is one of the fastest-growing food-producing sectors worldwide and tilapia (Oreochromis spp.) farming constitutes the major freshwater fish variety cultured. Because aquaculture practices are susceptible to microbial contamination derived from anthropogenic sources, extensive antibiotic usage is needed, leading to aquaculture systems becoming an important source of antibiotic-resistant and pathogenic bacteria of clinical relevance such as Escherichia coli (E. coli). Here, the antimicrobial resistance, virulence, and mobilome features of a pathogenic E. coli strain, recovered from inland farmed Oreochromis spp., were elucidated through whole-genome sequencing (WGS) and in silico analysis. Antimicrobial susceptibility testing (AST) and WGS were performed. Furthermore, phylogenetic group, serotype, multilocus sequence typing (MLST), acquired antimicrobial resistance, virulence, plasmid, and prophage content were determined using diverse available web tools. The E. coli isolate only exhibited intermediate susceptibility to ampicillin and was characterized as ONT:H21-B1-ST40 strain by WGS-based typing. Although only a single antimicrobial resistance-related gene was detected [mdf(A)], several virulence-associated genes (VAGs) from the atypical enteropathogenic E. coli (aEPEC) pathotype were identified. Additionally, the cargo of plasmid replicons from large plasmid groups and 18 prophage-associated regions were detected. In conclusion, the WGS characterization of an aEPEC isolate, recovered from a fish farm in Sinaloa, Mexico, allows insights into its pathogenic potential and the possible human health risk of consuming raw aquacultural products. It is necessary to exploit next-generation sequencing (NGS) techniques for studying environmental microorganisms and to adopt a one health framework to learn how health issues originate.

Characterization of a Pathogenic Escherichia coli Strain Derived from Oreochromis spp. Farms Using Whole-Genome Sequencing

The feasibility of whole-genome sequencing (WGS) strategies using benchtop instruments has simplified the genome interrogation of every microbe of public health relevance in a lab setting. A methodological adaptation of the workflow for bacterial WGS is described and a bioinformatics pipeline for analysis is also presented.

Aquaculture is one of the fastest-growing food-producing sectors worldwide and tilapia (Oreochromis spp.) farming constitutes the major freshwater fish ...

High-throughput Assay to Phenotype Salmonella enterica Typhimurium Association, Invasion, and Replication in Macrophages

Salmonella species are zoonotic pathogens and leading causes of food borne illnesses in humans and livestock1. Understanding the mechanisms underlying Salmonella-host interactions are&#160;important to elucidate the molecular pathogenesis of Salmonella infection. The Gentamicin protection assay to phenotype Salmonella association, invasion and replication in phagocytic cells was adapted to allow high-throughput screening to define the roles of deletion mutants of Salmonella enterica serotype Typhimurium in host interactions using RAW 264.7 murine macrophages. Under this protocol, the variance in measurements is significantly reduced compared to the standard protocol, because wild-type and multiple mutant strains can be tested in the same culture dish and at the same time. The use of multichannel pipettes increases the throughput and enhances precision. Furthermore, concerns related to using less host cells per well in 96-well culture dish were addressed. Here, the protocol of the modified in vitro Salmonella invasion assay using phagocytic cells was successfully employed to phenotype 38 individual Salmonella deletion mutants for association, invasion and intracellular replication. The in vitro phenotypes are presented, some of which were subsequently confirmed to have in vivo phenotypes in an animal model. Thus, the modified, standardized assay to phenotype Salmonella association, invasion and replication in macrophages with high-throughput capacity could be utilized more broadly to study bacterial-host interactions.

High-throughput Assay to Phenotype Salmonella enterica Typhimurium Association, Invasion, and Replication in Macrophages

A high-throughput assay to in vitro phenotype Salmonella or other bacterial association, invasion, and replication in phagocytic cells with high-throughput capacity was developed. The method was employed to evaluate Salmonella gene knockout mutant strains for their involvements in host-pathogen interactions.

Salmonella species are zoonotic pathogens and leading causes of food borne illnesses in humans and livestock1. Understanding the mechanisms underlying ...

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella spp./Shigella spp. The gold standard method for the detection of Salmonella spp./Shigella spp. is direct culture but this is labor-intensive and time-consuming. Here, we describe a high-throughput platform for Salmonella spp./Shigella spp. screening, using real-time polymerase chain reaction (PCR) combined with guided culture. There are two major stages: real-time PCR and the guided culture. For the first stage (real-time PCR), we explain each step of the method: sample collection, pre-enrichment, DNA extraction and real-time PCR. If the real-time PCR result is positive, then the second stage (guided culture) is performed: selective culture, biochemical identification and serological characterization. We also illustrate representative results generated from it. The protocol described here would be a valuable platform for the rapid, specific, sensitive and high-throughput screening of Salmonella spp./Shigella spp.

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Salmonella spp./Shigella spp. are common pathogens attributed to diarrhea. Here, we describe a high-throughput platform for the screening of Salmonella spp./Shigella spp. using real-time PCR combined with guided culture.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella ...

Automated Analysis of Intracellular Phenotypes of Salmonella Using ImageJ

Salmonella is an enteric pathogen able to invade the intestinal epithelium and replicate in enterocytes, both inside Salmonella-specific vacuoles and free in the cytosol (cytosolic hyper-replication). These different phenotypes of intracellular replication drive to different pathways of pathogenesis, i.e., cytosolic hyper-replication induces inflammatory cell death and extrusion into the gut lumen, while vacuolar replication leads to trans-epithelium penetration and systemic spread. Significant effort was made to create microscopy tools to study the behavior of Salmonella inside invaded cells, such as the pCHAR-Duo fluorescence reporter plasmid that allows discrimination between vacuolar and cytosolic bacteria by differential expression of mCherry and GFP. However, intracellular phenotypes are often manually scored, a time-consuming procedure that limits analysis to a small number of samples and cells. To overcome these limitations, two complementary and automated image analyses were developed using ImageJ, a freely available image analysis software. In the high-throughput protocol, epithelial cells were infected with Salmonella carrying pCHAR-Duo using 96-well plates. Imaging was performed using an automated fluorescence microscope. Then, two image analysis methods were applied to measure the intracellular behavior of Salmonella at different detail levels. The first method measures the overall intracellular bacterial load and the extent of cytosolic hyper-replication. It is fast and allows the scoring of a high number of cells and samples, making it suitable for high-throughput assays such as screening experiments. The second method performs single-cell analysis to determine the percentage of infected cells, the mean vacuolar load of Salmonella, and the cytosolic hyper-replication rate giving greater details about Salmonella behavior inside epithelial cells. The protocols can be performed by specifically designed ImageJ scripts to automatically run batch analyses of the major steps of Salmonella-enterocyte interaction.

Automated Analysis of Intracellular Phenotypes of Salmonella Using ImageJ

Salmonella invades and replicates inside intestinal epithelial cells both in Salmonella-specific vacuoles and free in the cytosol (hyper-replication). A high-throughput fluorescence microscopy-based protocol is described here to quantify the intracellular phenotypes of Salmonella by two complementary image analyses through ImageJ, reaching single-cell resolution and scoring.

Salmonella is an enteric pathogen able to invade the intestinal epithelium and replicate in enterocytes, both inside Salmonella-specific vacuoles and free ...

Loop-Mediated Isothermal Amplification for Screening Salmonella in Animal Food and Confirming Salmonella from Culture Isolation

Loop-mediated isothermal amplification (LAMP) has emerged as a powerful nucleic acid amplification test for the rapid detection of numerous bacterial, fungal, parasitic, and viral agents. Salmonella is a bacterial pathogen of worldwide food safety concern, including food for animals. Presented here is a multi-laboratory-validated Salmonella LAMP protocol that can be used to rapidly screen animal food for the presence of Salmonella contamination and can also be used to confirm presumptive Salmonella isolates recovered from all food categories. The LAMP assay specifically targets the Salmonella invasion gene (invA) and is rapid, sensitive, and highly specific. Template DNAs are prepared from enrichment broths of animal food or pure cultures of presumptive Salmonella isolates. The LAMP reagent mixture is prepared by combining an isothermal master mix, primers, DNA template, and water. The LAMP assay runs at a constant temperature of 65 &#176;C for 30 min. Positive results are monitored via real-time fluorescence and can be detected as early as 5 min. The LAMP assay exhibits high tolerance to inhibitors in animal food or culture medium, serving as a rapid, reliable, robust, cost-effective, and user-friendly method for screening and confirming Salmonella. The LAMP method has recently been incorporated into the U.S. Food and Drug Administration&#8217;s Bacteriological Analytical Manual (BAM) Chapter 5.

Loop-Mediated Isothermal Amplification for Screening Salmonella in Animal Food and Confirming Salmonella from Culture Isolation

Loop-mediated isothermal amplification (LAMP) is an isothermal nucleic acid amplification test (iNAAT) that has attracted broad interest in the pathogen detection field. Here, we present a multi-laboratory-validated Salmonella LAMP protocol as a rapid, reliable, and robust method for screening Salmonella in animal food and confirming presumptive Salmonella from culture isolation.

Loop-mediated isothermal amplification (LAMP) has emerged as a powerful nucleic acid amplification test for the rapid detection of numerous bacterial, ...

Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video