We thank Reine Protacio for helpful comments during the preparation of this manuscript. We express our gratitude to the National Science Foundation (grants nos. 1243680 and 1613754) and the Hendrix College Odyssey Program for funding support.

<ol>
	<li>Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., Richmond, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+nucleosome+core+particle+at+2.8+A+resolution.">Crystal structure of the nucleosome core particle at 2.8 A resolution.</a> Nature. 389 (6648), 251-260 (1997).</li><li>Campos, E. I., Reinberg, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histones:+annotating+chromatin.">Histones: annotating chromatin.</a> Annu Rev Genet. 43, 559-599 (2009).</li><li>Rando, O. J., Winston, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+and+transcription+in+yeast.">Chromatin and transcription in yeast.</a> Genetics. 190 (2), 351-387 (2012).</li><li>Duina, A. A., Miller, M. E., Keeney, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Budding+yeast+for+budding+geneticists:+a+primer+on+the+Saccharomyces+cerevisiae+model+system.">Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system.</a> Genetics. 197 (1), 33-48 (2014).</li><li>Storici, F., Resnick, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delitto+perfetto+targeted+mutagenesis+in+yeast+with+oligonucleotides.">Delitto perfetto targeted mutagenesis in yeast with oligonucleotides.</a> Genet Eng (N Y). 25, 189-207 (2003).</li><li>Gray, M., Kupiec, M., Honigberg, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Site-specific+genomic+(SSG)+and+random+domain-localized+(RDL)+mutagenesis+in+yeast.">Site-specific genomic (SSG) and random domain-localized (RDL) mutagenesis in yeast.</a> BMC Biotechnol. 4, 7 (2004).</li><li>Erdeniz, N., Mortensen, U. H., Rothstein, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning-free+PCR-based+allele+replacement+methods.">Cloning-free PCR-based allele replacement methods.</a> Genome Res. 7 (12), 1174-1183 (1997).</li><li>Brachmann, C. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Designer+deletion+strains+derived+from+Saccharomyces+cerevisiae+S288C:+a+useful+set+of+strains+and+plasmids+for+PCR-mediated+gene+disruption+and+other+applications.">Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications.</a> Yeast. 14 (2), 115-132 (1998).</li><li>Lundblad, V., Hartzog, G., Moqtaderi, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Manipulation+of+cloned+yeast+DNA.">Manipulation of cloned yeast DNA.</a> Curr Protoc Mol Biol. Chapter 13, (2001).</li><li>Hoffman, C. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+yeast+DNA.">Preparation of yeast DNA.</a> Curr Protoc Mol Biol. Chapter 13, (2001).</li><li>Treco, D. A., Lundblad, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+yeast+media.">Preparation of yeast media.</a> Curr Protoc Mol Biol. Chapter 13, (2001).</li><li>Lederberg, J., Lederberg, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replica+plating+and+indirect+selection+of+bacterial+mutants.">Replica plating and indirect selection of bacterial mutants.</a> J Bacteriol. 63 (3), 399-406 (1952).</li><li>Sikorski, R. S., Hieter, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+system+of+shuttle+vectors+and+yeast+host+strains+designed+for+efficient+manipulation+of+DNA+in+Saccharomyces+cerevisiae.">A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.</a> Genetics. 122 (1), 19-27 (1989).</li><li>Johnson, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+systematic+mutational+analysis+of+a+histone+H3+residue+in+budding+yeast+provides+insights+into+chromatin+dynamics.">A systematic mutational analysis of a histone H3 residue in budding yeast provides insights into chromatin dynamics.</a> G3 (Bethesda). 5 (5), 741-749 (2015).</li><li>DiCarlo, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+in+Saccharomyces+cerevisiae+using+CRISPR-Cas+systems.">Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems.</a> Nucleic Acids Res. 41 (7), 4336-4343 (2013).</li><li>Cross, S. L., Smith, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+the+structure+and+cell+cycle+expression+of+mRNAs+encoded+by+two+histone+H3-H4+loci+in+Saccharomyces+cerevisiae.">Comparison of the structure and cell cycle expression of mRNAs encoded by two histone H3-H4 loci in Saccharomyces cerevisiae.</a> Mol Cell Biol. 8 (2), 945-954 (1988).</li><li>Libuda, D. E., Winston, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amplification+of+histone+genes+by+circular+chromosome+formation+in+Saccharomyces+cerevisiae.">Amplification of histone genes by circular chromosome formation in Saccharomyces cerevisiae.</a> Nature. 443 (7114), 1003-1007 (2006).</li></ol>

The authors declare that they have no competing financial interests.

The high level of sequence homology between the two non-allelic genes that code for each of the four core histone proteins in haploid S. cerevisiae cells can represent a challenge for investigators who wish to specifically target one of the two genes for mutagenesis. Previously described yeast mutagenesis methodologies, including the Delitto Perfetto, site-specific genomic (SSG) mutagenesis, and cloning-free PCR-based allele replacement methods5,6,7, as well as more recent yeast CRISPR-based techniques15, often rely at least in part on sequences within the ORF of a target gene to recruit the recombination or repair machineries to the desired genomic site to eventually generate the final mutant allele. On the other hand, the strategy we have presented here makes use of DNA sequences flanking the targeted ORF to drive the homologous recombination event required for the integration of the mutation, and, as a result, allows for more specific targeting of a gene over another despite the two genes having highly homologous ORFs. This feature makes our strategy particularly well-suited for histone mutagenesis. However, this strategy can also be adapted for mutagenesis of other genes in the yeast genome.
Additional features of our strategy include the facts that the lengths of the regions that drive homologous recombination of the mutant genes can be designed to be very extensive, thus increasing the efficiency of integration at the target genomic location, and that besides the desired mutation(s) no additional DNA sequences are introduced into the genome. An additional advantage of this system is that once a strain harboring replacement of a specific histone gene with URA3 has been constructed, it can be used for the generation of any desired mutant version of that particular histone gene. Thus, for example, strain yAAD156, which is available to the research community upon request, can be used to make any desired hht2 mutation without the need of constructing a de novo hht2&#916;::URA3 allele. Finally, by using properly designed PCR primers, this strategy can also be used to generate histone alleles with internal deletions or with mutations at multiple codons, as long as they are relatively near each other (for example, we have generated an hht2 allele encoding an H3-K56R,L61W double mutant protein using this strategy).
The ability to specifically target one of two highly homologous histone genes for mutagenesis could be useful in a number of different experimental settings. For example, since the HHT1-HHF1 genes are expressed at different levels compared to the HHT2-HHF2 genes16, it could be of interest to determine whether a particular H3 or H4 mutation confers different phenotypes depending on which gene it is expressed from. Another example is a scenario in which an investigator wishes to generate haploid cells expressing a particular histone mutant from both corresponding histone genes - this could be achieved by first mutagenizing each gene independently in two different strains, and then obtaining double mutant haploid cells through a cross and subsequent isolation of the desired meiotic products. Yet another example relates to mutagenesis of histones H2A and H2B: given the fact that two slightly different isoforms of each protein are encoded by the corresponding non-allelic gene set, an investigator may want to assess the effects of a specific H2A or H2B mutation in the context of either isoform. When designing experiments to mutagenize the HTA1 and HTB1 loci (encoding H2A and H2B, respectively), investigators should be aware of recent findings showing that strains carrying an (hta1-htb1)&#916; are viable only if they have amplified the HTA2-HTB2 locus (and nearby HHT1-HHF1 locus as well) through the generation of a small circular chromosome17, as this could complicate the interpretation of the results.
We have recently used a version of this histone mutagenesis strategy to generate histone H3 proteins expressing all possible amino acid substitutions at position 61, which is normally occupied by the amino acid leucine14. For those experiments, instead of using yAAD156 as the starting strain for the mutagenesis, we used strain yADP106, which harbors a replacement of the HHT2 ORF with both the URA3 and TRP1 nutritional markers (instead of just URA3). The presence of both marker genes facilitated the identification of candidates for integration of the mutant PCR products following the 5-FOA screen and purification step (steps 5 and 6 of the protocol), as such candidates became phenotypically Ura- and Trp-, whereas spontaneous URA3 mutation resulted in cells with a Ura- Trp+ phenotype. yADP106 is also available upon request, as is the sequence of the URA3-TRP1 cassette, which could be amplified as a unit and used for mutagenesis of other histone genes using the strategy described herein.
Inability to obtain the desired histone mutants using this strategy could be attributable to a number of possible reasons, including insufficient amount of full-size PCR products used for the integration step or an insufficient number of transformants following the co-transformation step. The former problem could be addressed by pooling together larger sets of PCR reactions or by designing different primer sets that produce a higher yield of product, whereas the latter problem could be solved by using higher amounts of backbone plasmid in the co-transformation experiment. Although, as indicated earlier, one can use this procedure to generate histone mutants harboring two or more amino acid substitutions, the targeted amino acids have to be relatively close to each other since the respective codons need to be located within the same primer molecule. Thus, this strategy cannot be easily adapted for the generation of histones with multiple mutations located distantly from each other across the length of the proteins.

The four core histone proteins H2A, H2B, H3, and H4 play central roles in the compaction, organization, and function of eukaryotic chromosomes. Two sets of each of these histones form the histone octamer, a molecular spool that directs the wrapping of ~147 base pairs of DNA around itself, ultimately resulting in the formation of a nucleosome1. Nucleosomes are active participants in a variety of chromosome-based processes, such as the regulation of gene transcription and the formation of euchromatin and heterochromatin across chromosomes, and as such have been the focus of intense research over the course of the past several decades. A number of mechanisms have been described by which nucleosomes can be manipulated in ways that can facilitate execution of specific processes &#8211; these mechanisms include posttranslational modification of histone residues, ATP-dependent nucleosome remodeling, and ATP-independent nucleosome reorganization and assembly/disassembly2,3.
The budding yeast Saccharomyces cerevisiae is a particularly powerful model organism for the understanding of histone function in eukaryotes. This can be largely attributed to the high degree of evolutionary conservation of the histone proteins throughout the domain eukarya and the amenability of yeast to a variety of genetic and biochemical experimental approaches4. Reverse-genetic approaches in yeast have been widely used to study the effects of specific histone mutations on various aspects of chromatin biology. For these types of experiments it is often preferable to use cells in which the mutant histones are expressed from their native genomic loci, as expression from autonomous plasmids can lead to abnormal intracellular levels of histone proteins (due to varying numbers of plasmids in cells) and concomitant alteration of chromatin environments, which can ultimately confound the interpretation of results.
Here, we describe a PCR-based technique that allows for targeted mutagenesis of histone genes at their native genomic locations that does not require a cloning step and results in the generation of the desired mutation(s) without leftover exogenous DNA sequences in the genome. This technique takes advantage of the efficient homologous recombination system in yeast and has several features in common with other similar techniques developed by other groups - most notably the Delitto Perfetto, site-specific genomic (SSG) mutagenesis, and cloning-free PCR-based allele replacement methods5,6,7. However, the technique we describe has an aspect that makes it particularly well-suited for mutagenesis of histone genes. In haploid yeast cells, each of the four core histones is encoded by two non-allelic and highly homologous genes: for example, histone H3 is encoded by the HHT1 and HHT2 genes, and the open reading frames (ORFs) of the two genes are over 90% identical in sequence. This high degree of homology can complicate experiments designed to specifically target one of the two histone-encoding genes for mutagenesis. Whereas the aforementioned methods often require the use of at least some sequences within the ORF of the target gene to drive homologous recombination, the technique we describe here makes use of sequences flanking the ORFs of the histone genes (which share much less sequence homology) for the recombination step, thus increasing the likelihood of successful targeting of mutagenesis to the desired locus. Moreover, the homologous regions that drive recombination can be very extensive, further contributing to efficient targeted homologous recombination.

<table><tbody><tr><td>1 kb DNA Ladder (DNA standards)</td><td>New England BioLabs</td><td>N3232L</td><td></td></tr><tr><td>Agarose&amp;nbsp;</td><td>Sigma</td><td>A5093-100G</td><td></td></tr><tr><td>Boric Acid</td><td>Sigma</td><td>B0394-500G</td><td></td></tr><tr><td>dNTP mix (10 mM each)</td><td>ThermoFisher Scientific</td><td>R0192</td><td></td></tr><tr><td>EDTA solution (0.5 M, pH 8.0)</td><td>AmericanBio</td><td>AB00502-01000</td><td></td></tr><tr><td>Ethanol (200 Proof)</td><td>Fisher Scientific</td><td>16-100-824</td><td></td></tr><tr><td>Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA)</td><td>Sigma</td><td>E4884-500G</td><td></td></tr><tr><td>Lithium acetate dihydrate</td><td>Sigma</td><td>L6883-250G</td><td></td></tr><tr><td>MyCycler Thermal Cycler</td><td>BioRad</td><td>170-9703</td><td></td></tr><tr><td>Poly(ethylene glycol) (PEG)</td><td>Sigma</td><td>P3640-1KG</td><td></td></tr><tr><td>PrimeSTAR HS DNA Polymerase (high fidelity DNA polymerase)&amp;nbsp; and 5x buffer</td><td>Fisher Scientific</td><td>50-443-960</td><td></td></tr><tr><td>Salmon sperm DNA solution</td><td>ThermoFisher Scientific</td><td>15632-011</td><td></td></tr><tr><td>Sigma 7-9 (Tris base, powder form)</td><td>Sigma</td><td>T1378-1KG</td><td></td></tr><tr><td>Sodium acetate trihydrate</td><td>Sigma</td><td>236500-500G</td><td></td></tr><tr><td>Supra Sieve GPG Agarose (low metling temperature agarose)</td><td>AmericanBio</td><td>AB00985-00100</td><td></td></tr><tr><td>Taq Polymerase and 10x Buffer</td><td>New England BioLabs</td><td>M0273X</td><td></td></tr><tr><td>Toothpicks</td><td>Fisher Scientific</td><td>S67859</td><td></td></tr><tr><td>Tris-HCl (1 M, pH 8.0)</td><td>AmericanBio</td><td>AB14043-01000</td><td></td></tr><tr><td>a-D(+)-Glucose</td><td>Fisher Scientific</td><td>AC170080025</td><td>for yeast media</td></tr><tr><td>Agar</td><td>Fisher Scientific</td><td>DF0140-01-0</td><td>for yeast media</td></tr><tr><td>Peptone</td><td>Fisher Scientific</td><td>DF0118-07-2</td><td>for YPD medium</td></tr><tr><td>Yeast Extract</td><td>Fisher Scientific</td><td>DF0127-17-9</td><td>for YPD medium</td></tr><tr><td>4-aminobenzoic acid</td><td>Sigma</td><td>A9878-100G</td><td>for complete minimal dropout medium&amp;nbsp;</td></tr><tr><td>Adenine</td><td>Sigma</td><td>A8626-100G</td><td>for complete minimal dropout medium&amp;nbsp;</td></tr><tr><td>Glycine hydrochloride</td><td>Sigma</td><td>G2879-100G</td><td>for complete minimal dropout medium&amp;nbsp;</td></tr><tr><td>L-Alanine</td><td>Sigma</td><td>A7627-100G</td><td>for complete minimal dropout medium&amp;nbsp;</td></tr><tr><td>L-Arginine monohydrochloride</td><td>Sigma</td><td>A5131-100G</td><td>for complete minimal dropout medium&amp;nbsp;</td></tr><tr><td>L-Asparagine monohydrate</td><td>Sigma</td><td>A8381-100G</td><td>for complete minimal dropout medium&amp;nbsp;</td></tr><tr><td>L-Aspartic acid sodium salt monohydrate</td><td>Sigma</td><td>A6683-100G</td><td>for complete minimal dropout medium&amp;nbsp;</td></tr><tr><td>L-Cysteine hydrochloride monohydrate</td><td>Sigma</td><td>C7880-100G</td><td>for complete minimal dropout medium&amp;nbsp;</td></tr><tr><td>L-Glutamic acid hydrochloride</td><td>Sigma</td><td>G2128-100G</td><td>for complete minimal dropout medium&amp;nbsp;</td></tr><tr><td>L-Glutamine</td><td>Sigma</td><td>G3126-100G</td><td>for complete minimal dropout medium&amp;nbsp;</td></tr><tr><td>L-Histidine monohydrochloride monohydrate</td><td>Sigma</td><td>H8125-100G</td><td>for complete minimal dropout medium&amp;nbsp;</td></tr><tr><td>L-Isoleucine</td><td>Sigma</td><td>I2752-100G</td><td>for complete minimal dropout medium&amp;nbsp;</td></tr><tr><td>L-Leucine</td><td>Sigma</td><td>L8000-100G</td><td>for complete minimal dropout medium&amp;nbsp;</td></tr><tr><td>L-Lysine monohydrochloride</td><td>Sigma</td><td>L5626-100G</td><td>for complete minimal dropout medium&amp;nbsp;</td></tr><tr><td>L-Methionine</td><td>Sigma</td><td>M9625-100G</td><td>for complete minimal dropout medium&amp;nbsp;</td></tr><tr><td>L-Phenylalanine</td><td>Sigma</td><td>P2126-100G</td><td>for complete minimal dropout medium&amp;nbsp;</td></tr><tr><td>L-Proline</td><td>Sigma</td><td>P0380-100G</td><td>for complete minimal dropout medium&amp;nbsp;</td></tr><tr><td>L-Serine</td><td>Sigma</td><td>S4500-100G</td><td>for complete minimal dropout medium&amp;nbsp;</td></tr><tr><td>L-Threonine</td><td>Sigma</td><td>T8625-100G</td><td>for complete minimal dropout medium&amp;nbsp;</td></tr><tr><td>L-Tryptophan</td><td>Sigma</td><td>T0254-100G</td><td>for complete minimal dropout medium&amp;nbsp;</td></tr><tr><td>L-Tyrosine</td><td>Sigma</td><td>T3754-100G</td><td>for complete minimal dropout medium&amp;nbsp;</td></tr><tr><td>L-Valine</td><td>Sigma</td><td>V0500-100G</td><td>for complete minimal dropout medium&amp;nbsp;</td></tr><tr><td>myo-Inositol</td><td>Sigma</td><td>I5125-100G</td><td>for complete minimal dropout medium&amp;nbsp;</td></tr><tr><td>Uracil</td><td>Sigma</td><td>U0750-100G</td><td>for complete minimal dropout medium&amp;nbsp;</td></tr><tr><td>Ammonium Sulfate</td><td>Fisher Scientific</td><td>A702-500</td><td>for complete minimal dropout medium&amp;nbsp;</td></tr><tr><td>Yeast Nitrogen Base</td><td>Fisher Scientific</td><td>DF0919-07-3</td><td>for complete minimal dropout medium&amp;nbsp;</td></tr><tr><td>5-Fluoroorotic acid (5-FOA)</td><td>AmericanBio</td><td>AB04067-00005</td><td>for&amp;nbsp; 5-FOA medium</td></tr></tbody></table>

targeted in situ mutagenesis of histone genes in budding yeast

We describe a PCR- and homologous recombination-based system for generating targeted mutations in histone genes in budding yeast cells. The resulting mutant alleles reside at their endogenous genomic sites and no exogenous DNA sequences are left in the genome following the procedure. Since in haploid yeast cells each of the four core histone proteins is encoded by two non-allelic genes with highly homologous open reading frames (ORFs), targeting mutagenesis specifically to one of two genes encoding a particular histone protein can be problematic. The strategy we describe here bypasses this problem by utilizing sequences outside, rather than within, the ORF of the target genes for the homologous recombination step. Another feature of this system is that the regions of DNA driving the homologous recombination steps can be made to be very extensive, thus increasing the likelihood of successful integration events. These features make this strategy particularly well-suited for histone gene mutagenesis, but can also be adapted for mutagenesis of other genes in the yeast genome.

We describe the generation of an hht2 allele expressing a histone H3 mutant protein harboring a substitution at position 53 from an arginine to a glutamic acid (H3-R53E mutant) as a representative example of the targeted in situ mutagenesis strategy.
We generated a strain in which the entire ORF of HHT2 is replaced by the URA3 gene (see step 1 of the protocol). This strain, yAAD156, also harbors a his3&#916;200 allele, which causes the cells to be auxotrophic for histidine. Following the procedure indicated in step 2 of the protocol, we then generated the two partially overlapping fragments of HHT2. The following primers were used for the first fragment: Forward Primer (OAD20): 5&#39; GCGTTCATTATCGCCCAATGTG 3&#39; and the Reverse Primer (R53Erev): 5&#39; GTTCAGTAGATTTTTGGAATtcTCTAATTTCTCTCAAG 3&#39;. The following primers were used for the second fragment: Forward Primer (R53Efor): 5&#39; CTTGAGAGAAATTAGAgaATTCCAAAAATCTACTGAAC 3&#39; and the Reverse Primer (OAD21): 5&#39; GCGCTTGATCAGCAGTTCATCG 3&#39;. Note that the Reverse Primer in the first reaction and the Forward Primer in the second reaction contain the desired mutated nucleotides (in lower case) - these mutated nucleotides are nestled in between two long stretches of wild-type sequences, as this allows for efficient annealing of the primer to the template DNA despite the mismatch at the mutated positions. Also note that the mutated nucleotides in these two primers are reverse complementary to each other and cause an AG to GA mutation in the sense strand, which results in a AGA to GAA codon change, which ultimately produces the R53E mutation in the encoded protein. Results from these PCR reactions are shown in Figure 2A.
Using the procedure in step 3, we then generated the full-size PCR products. The primers used were Forward Primer (OAD479): 5&#39;TATGGCTCGGTGTCAAAACA 3&#39; and Reverse Primer (OAD480): 5&#39; CATGGTTTCTTGCCGGTTAT 3&#39;. When designing these primers, it is important to make sure that the resulting fusion PCR products include at least 40 base pairs on either ends to drive the homologous recombination reaction (the longer the regions of homology, the more efficient and specific the homologous recombination events will be). In our experiment, the full-size PCR products contained a 195 base pair region and 220 base pair region homologous to the regions upstream and downstream of the HHT2 ORF, respectively. A sample of these PCR products was analyzed by agarose gel electrophoresis (Figure 2B).
The full-size PCR products were then co-transformed along with plasmid pRS413 (a centromeric, HIS3-marked plasmid13) and transformants were selected on plates lacking histidine (SC-his plates) as described in step 4 of the protocol. His+ colonies were then screened for 5-FOA resistance following the procedures described in step 5 of the protocol. Figure 3 shows an example of a transformation plate (SC-his) and 5-FOA plates following replica-plating from SC-his plates. Examples of candidate samples as well as samples unlikely to represent the desired integration events are also presented in Figure 3. In our experiment, we identified twelve candidate samples out of ~90,000 transformants screened. These candidates were then purified as described in step 6 of the protocol.
The twelve candidates were then subjected to the PCR analysis described in step 7 of the protocol to assess if they reflected authentic replacements of the URA3 gene with mutant PCR products. For our experiment, we used a Forward Primer that anneals 89 base pairs upstream from the integration site of the PCR product and a Reverse Primer that anneals 302 base pairs downstream from the integration site of the PCR product. These primers generate PCR products of 1217 base pairs in size if the HHT2 locus is occupied by HHT2 (or mutant versions of HHT2 harboring base pair substitutions), or PCR products of 2188 base pairs in size if the locus is occupied by the URA3 marker gene. The sequence of the Forward Primer used (OAD476) is: 5&#39; GAAACTATTGGCACGCCCTA and that of the Reverse Primer used (OAD477) is: 5&#39; CCTGCGAATCAACCGATACT 3&#39;. Of the twelve candidates we had identified, four showed integration of a PCR product at the correct location (see Figure 4A for an example). Finally, since the AG to GA mutation generates a new EcoRI restriction site, we subjected PCR products from one of the successful integration samples to an EcoRI digestion and were able to demonstrate that the mutant sequence had indeed been integrated into the genome (see Figure 4B). In this particular case we did not sequence the PCR products to ensure that additional unwanted mutations had not been incorporated into the genome: however, we have used a procedure very similar to this to generate a large number of HHT2 mutations in a past study14, and found that the majority of the integrated mutant alleles carry no mutations other than the desired ones.
<img alt="Figure 2" src="/files/ftp_upload/55263/55263fig2.jpg" /> 
Figure 2: Generation of PCR Products Harboring Desired Mutations for Integration into the Yeast Genome. (A) PCR reaction to generate the partially overlapping fragments of HHT2 harboring the desired mutations. Top: cartoon representation of the two PCR reactions to obtain the two HHT2 fragments (refer to Figure 1B-1). Red circles represent the mismatched nucleotides on the primers used to introduce the AG to GA mutation in the sense strand of the gene. Bottom: gel electrophoresis analysis of PCR products a and b (lanes 2 and 3, respectively). DNA standards are shown in lane 1. (B) Fusion PCR reaction to generate full size PCR product for integration into yeast genome (refer to Figure 1B-2 and 3). Top: cartoon representation of the PCR reaction and expected PCR product (product c). Red circles represent desired mutation as described in (A) above. Bottom: gel electrophoresis analysis of PCR products c (lane 2). DNA standards are shown in lane 1. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55263/55263fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/55263/55263fig3.jpg" /> 
Figure 3: Representative Results from the Co-transformation Experiment and 5-FOA Screen. Left: representative SC-his plate plated with cells subjected to the co-transformation procedure after a 3-day incubation at 30&#730;C. Approximately 5,000 colonies were counted. Middle: representative 5-FOA plate following replica-plating from an SC-his co-transformation plate after a 2-day incubation at 30&#730;C. Samples 1 and 2 were considered candidates for having gone through a successful integration event due to their asymmetric morphologies. This is because a true replacement of the URA3 gene with the hht2 allele is likely to occur before (or very soon after) a transformed cell is plated on the SC-his plate and, as a result, the colony that will arise at that location will contain mostly, if not exclusively, 5-FOA-resistant cells &#8211; when such a colony is then subsequently replica-plated to a 5-FOA plate it will be squashed, giving rise to an asymmetric-looking patch of cells on the plate. Conversely, spontaneous mutations in the URA3 gene that can arise during colony formation are more likely to be confined within a small region of a colony, and thus more likely to give rise to papillae when replica-plated to a 5-FOA plate. Right: a different representative 5-FOA plate following replica-plating from an SC-his co-transformation plate after a 3-day incubation at 30 &#176;C. An additional candidate (sample 3) as well as two small papillae are visible on this plate (samples 4 and 5) &#8211; such papillae, which are most clearly visible after 3 or more days of incubation, are likely to represent spontaneous URA3 mutations and not the desired integration event. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55263/55263fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" src="/files/ftp_upload/55263/55263fig4.jpg" /> 
Figure 4: Molecular Analyses of Candidate Integration Samples. (A) PCR assay to identify successful integration events. Top: cartoon representations of the PCR reactions used to assess successful integration of the hht2 mutant allele into the genome. Bottom: gel electrophoresis analysis of PCR reactions using genomic DNA derived from an HHT2 wild-type strain (used as a control, lane 2), strain yAAD156 harboring the hht2&#916;::URA3 replacement (used as a control, lane 3), a candidate integration sample (lane 4), and a 5-FOA-resistant papillae sample (and thus unlikely to represent a correct integration event, lane 5). DNA standards are shown in lane 1. Note that the sizes of the PCR products for the candidate integration sample are consistent with a successful integration event, whereas the size of the PCR products for the papillae sample is consistent with an intact hht2&#916;::URA3 locus. (B) EcoRI digestion to confirm presence of mutant allele. Top: cartoon representation of the expected digestion fragments derived from an EcoRI digestion reaction of PCR products containing either the wild-type HHT2 gene or the mutant hht2 allele. Bottom: gel electrophoresis analysis of digestion reactions of PCR products derived from a wild-type HHT2 strain (lane 2; the PCR products used here were derived from the same sample as that used in lane 2 of panel A) and a candidate integration sample (lane 3; the PCR products used here were derived from the same sample as that used in lane 4 of panel A). DNA standards are shown in lane 1. Note that the digestion patterns confirm that the AG to GA mutation has been successfully introduced into the genome of the candidate integration sample. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55263/55263fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast at JoVE.com

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast | Genetics | Video

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

A strategy for generating mutations in histone genes at their endogenous location in Saccharomyces cerevisiae is presented.

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

We describe a PCR- and homologous recombination-based system for generating targeted mutations in histone genes in budding yeast cells. The resulting ...

targeted-in-situ-mutagenesis-of-histone-genes-in-budding-yeast

Nanyang Technological University

Research

Education

JoVE Journal

JoVE Core

Biology

Genetics

DNA Structure and Function

SCIENTISTS IN ACTION

15.3K Views.  Hendrix College. A strategy for generating mutations in histone genes at their endogenous location in Saccharomyces cerevisiae is presented. 

Video: Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most mutagenesis-based screens, researchers have relied on the use of toxic chemicals, carcinogens, or irradiation, which requires designated equipment, safety setup, and/or disposal of hazardous materials. We have developed a simple approach to induce heritable mutations in C. elegans using germline-expressed histone-miniSOG, a light-inducible potent generator of reactive oxygen species. This mutagenesis method is free of toxic chemicals and requires minimal laboratory safety and waste management. The induced DNA modifications include single-nucleotide changes and small deletions, and complement those caused by classical chemical mutagenesis. This methodology can also be used to induce integration of extrachromosomal transgenes. Here, we provide the details of the LED setup and protocols for standard mutagenesis and transgene integration.

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Genetically-encoded histone-miniSOG induces genome-wide heritable mutations in a blue&#160;light-dependent manner. This mutagenesis method is simple, fast, free of toxic chemicals, and well-suited for forward genetic screening and transgene integration.

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most ...

Chromatin Immunoprecipitation (ChIP) of Histone Modifications from Saccharomyces cerevisiae

Histone post-translational modifications (PTMs), such as acetylation, methylation and phosphorylation, are dynamically regulated by a series of enzymes that add or remove these marks in response to signals received by the cell. These PTMS are key contributors to the regulation of processes such as gene expression control and DNA repair. Chromatin immunoprecipitation (chIP) has been an instrumental approach for dissecting the abundance and localization of many histone PTMs throughout the genome in response to diverse perturbations to the cell. Here, a versatile method for performing chIP of post-translationally modified histones from the budding yeast Saccharomyces cerevisiae (S. cerevisiae) is described. This method relies on crosslinking of proteins and DNA using formaldehyde treatment of yeast cultures, generation of yeast lysates by bead beating, solubilization of chromatin fragments by micrococcal nuclease, and immunoprecipitation of histone-DNA complexes. DNA associated with the histone mark of interest is purified and subjected to quantitative PCR analysis to evaluate its enrichment at multiple loci throughout the genome. Representative experiments probing the localization of the histone marks H3K4me2 and H4K16ac in wildtype and mutant yeast are discussed to demonstrate data analysis and interpretation. This method is suitable for a variety of histone PTMs and can be performed with different mutant strains or in the presence of diverse environmental stresses, making it an excellent tool for investigating changes in chromatin dynamics under different conditions.

Chromatin Immunoprecipitation ChIP of Histone Modifications from Saccharomyces cerevisiae

Here, we describe a protocol for chromatin immunoprecipitation of modified histones from the budding yeast Saccharomyces cerevisiae. Immunoprecipitated DNA is subsequently used for quantitative PCR to interrogate the abundance and localization of histone post-translational modifications throughout the genome.

Histone post-translational modifications (PTMs), such as acetylation, methylation and phosphorylation, are dynamically regulated by a series of enzymes ...

Gene-targeted Random Mutagenesis to Select Heterochromatin-destabilizing Proteasome Mutants in Fission Yeast

Random mutagenesis of a target gene is commonly used to identify mutations that yield the desired phenotype. Of the methods that may be used to achieve random mutagenesis, error-prone PCR is a convenient and efficient strategy for generating a diverse pool of mutants (i.e., a mutant library). Error-prone PCR is the method of choice when a researcher seeks to mutate a pre-defined region, such as the coding region of a gene while leaving other genomic regions unaffected. After the mutant library is amplified by error-prone PCR, it must be cloned into a suitable plasmid. The size of the library generated by error-prone PCR is constrained by the efficiency of the cloning step. However, in the fission yeast, Schizosaccharomyces pombe, the cloning step can be replaced by the use of a highly efficient one-step fusion PCR to generate constructs for transformation. Mutants of desired phenotypes may then be selected using appropriate reporters. Here, we describe this strategy in detail, taking as an example, a reporter inserted at centromeric heterochromatin.

This article describes a detailed methodology for random mutagenesis of a target gene in fission yeast. As an example, we target rpt4+, which encodes a subunit of the 19S proteasome, and screen for mutations that destabilize heterochromatin.

Random mutagenesis of a target gene is commonly used to identify mutations that yield the desired phenotype. Of the methods that may be used to achieve ...

Single Molecule Fluorescence In Situ Hybridization (smFISH) Analysis in Budding Yeast Vegetative Growth and Meiosis

Single molecule fluorescence in situ hybridization (smFISH) is a powerful technique to study gene expression in single cells due to its ability to detect and count individual RNA molecules. Complementary to deep sequencing-based methods, smFISH provides information about the cell-to-cell variation in transcript abundance and the subcellular localization of a given RNA. Recently, we have used smFISH to study the expression of the gene&#160;NDC80&#160;during meiosis in budding yeast, in which two transcript isoforms exist and the short transcript isoform has its entire sequence shared with the long isoform. To confidently identify each transcript isoform, we optimized known smFISH protocols and obtained high consistency and quality of smFISH data for the samples acquired during budding yeast meiosis. Here, we describe this optimized protocol, the criteria that we use to determine whether high quality of smFISH data is obtained, and some tips for implementing this protocol in&#160;other yeast strains and growth conditions.

Single Molecule Fluorescence In Situ Hybridization smFISH Analysis in Budding Yeast Vegetative Growth and Meiosis

This single molecule fluorescence in situ hybridization protocol is optimized to quantify the number of RNA molecules in budding yeast during vegetative growth and meiosis.

Single molecule fluorescence in situ hybridization (smFISH) is a powerful technique to study gene expression in single cells due to its ability to detect ...

Characterizing Histone Post-translational Modification Alterations in Yeast Neurodegenerative Proteinopathy Models

Neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and Parkinson&#39;s disease (PD), cause the loss of hundreds of thousands of lives each year. Effective treatment options able to halt disease progression are lacking. Despite the extensive sequencing efforts in large patient populations, the majority of ALS and PD cases remain unexplained by genetic mutations alone. Epigenetics mechanisms, such as the post-translational modification of histone proteins, may be involved in neurodegenerative disease etiology and progression and lead to new targets for pharmaceutical intervention. Mammalian in vivo and in vitro models of ALS and PD are costly and often require prolonged and laborious experimental protocols. Here, we outline a practical, fast, and cost-effective approach to determining genome-wide alterations in histone modification levels using Saccharomyces cerevisiae as a model system. This protocol allows for comprehensive investigations into epigenetic changes connected to neurodegenerative proteinopathies that corroborate previous findings in different model systems while significantly expanding our knowledge of the neurodegenerative disease epigenome.

This protocol outlines experimental procedures to characterize genome-wide changes in the levels of histone post-translational modifications (PTM) occurring in connection with the overexpression of proteins associated with ALS and Parkinson&#39;s disease in Saccharomyces cerevisiae models. After SDS-PAGE separation, individual histone PTM levels are detected with modification-specific antibodies via Western blotting.

Neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and Parkinson&#39;s disease (PD), cause the loss of hundreds of thousands of lives ...

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

A genetic screen for mutant alleles that suppress phenotypic defects caused by a mutation is a powerful approach to identify genes that belong to closely related biochemical pathways. Previous methods such as the Synthetic Genetic Array (SGA) analysis, and random mutagenesis techniques using ultraviolet (UV) or chemicals like ethyl methanesulfonate (EMS) or N-ethyl-N- nitrosourea (ENU), have been widely used but are often costly and laborious. Also, these mutagen-based screening methods are frequently associated with severe side effects on the organism, inducing multiple mutations that add to the complexity of isolating the suppressors. Here, we present a simple and effective protocol to identify suppressor mutations in mutants which confer a growth defect in Schizosaccharomyces pombe. The fitness of cells with a growth deficiency in standard rich liquid media or synthetic liquid media can be monitored for recovery using an automated 96-well plate reader over an extended period. Once a cell acquires a suppressor mutation in the culture, its descendants outcompete those of the parental cells. The recovered cells that have a competitive growth advantage over the parental cells can then be isolated and backcrossed with the parental cells. The suppressor mutations are then identified using whole-genome sequencing. Using this approach, we have successfully isolated multiple suppressors that alleviate the severe growth defects caused by loss of Elf1, an AAA+ family ATPase that is important in nuclear mRNA transport and maintenance of genomic stability. There are currently over 400 genes in S. pombe with mutants conferring a growth defect. As many of these genes are uncharacterized, we propose that our method will hasten the identification of novel functional interactions with this user-friendly, high-throughput approach.

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

We present a simple suppressor screen protocol in fission yeast. This method is efficient, mutagen-free, and&#160; selective&#160; for&#160; mutations that&#160; often&#160; occur at&#160; &#160;a&#160; single&#160; genomic&#160; locus.&#160; The protocol is suitable for isolating suppressors that alleviate growth defects in liquid culture that are caused by a mutation or a drug.

A genetic screen for mutant alleles that suppress phenotypic defects caused by a mutation is a powerful approach to identify genes that belong to closely ...

Genetic Studies of Human DNA Repair Proteins Using Yeast as a Model System 

Understanding the roles of human DNA repair proteins in genetic pathways is a formidable challenge to many researchers. Genetic studies in mammalian systems have been limited due to the lack of readily available tools including defined mutant genetic cell lines, regulatory expression systems, and appropriate selectable markers. To circumvent these difficulties, model genetic systems in lower eukaryotes have become an attractive choice for the study of functionally conserved DNA repair proteins and pathways. We have developed a model yeast system to study the poorly defined genetic functions of the Werner syndrome helicase-nuclease (WRN) in nucleic acid metabolism. Cellular phenotypes associated with defined genetic mutant backgrounds can be investigated to clarify the cellular and molecular functions of WRN through its catalytic activities and protein interactions. The human WRN gene and associated variants, cloned into DNA plasmids for expression in yeast, can be placed under the control of a regulatory plasmid element. The expression construct can then be transformed into the appropriate yeast mutant background, and genetic function assayed by a variety of methodologies. Using this approach, we determined that WRN, like its related RecQ family members BLM and Sgs1, operates in a Top3-dependent pathway that is likely to be important for genomic stability. This is described in our recent publication [1] at <a href="http://www.impactaging.com">www.impactaging.com</a>. Detailed methods of specific assays for genetic complementation studies in yeast are provided in this paper.

Genetic Studies of Human DNA Repair Proteins Using Yeast as a Model System

Genetic studies in yeast can be employed to investigate the molecular and cellular functions of human genes in cellular DNA metabolism. Methods are described for the genetic characterization of the human WRN gene product defective in the premature aging disorder Werner syndrome in functionally conserved pathways using yeast as a tractable model system.

Understanding the roles of human DNA repair proteins in genetic pathways is a formidable challenge to many researchers.  Genetic studies in mammalian ...

Locus-Specific Chromatin Isolation from Yeast Cells

Single-Copy Gene Locus Chromatin Purification in Saccharomyces cerevisiae

The basic organizational unit of eukaryotic chromatin is the nucleosome core particle (NCP), which comprises DNA wrapped ~1.7 times around a histone octamer. Chromatin is defined as the entity of NCPs and numerous other protein complexes, including transcription factors, chromatin remodeling and modifying enzymes. It is still unclear how these protein-DNA interactions are orchestrated at the level of specific genomic loci during different stages of the cell cycle. This is mainly due to the current technical limitations, which make it challenging to obtain precise measurements of such dynamic interactions. Here, we describe an improved method combining site-specific recombination with an efficient single-step affinity purification protocol to isolate a single-copy gene locus of interest in its native chromatin state. The method allows for the robust enrichment of the target locus over genomic chromatin, making this technique an effective strategy for identifying and quantifying protein interactions in an unbiased and systematic manner, for example by mass spectrometry. Further to such compositional analyses, native chromatin purified by this method likely reflects the in vivo situation regarding nucleosome positioning and histone modifications and is, therefore, amenable to further structural and biochemical analyses of chromatin derived from virtually any genomic locus in yeast.

Author Spotlight: Advancing Chromatin Research and Overcoming Limitations with a High-Enrichment Locus-Specific Chromatin Isolation Protocol 

This protocol presents a locus-specific chromatin isolation method based on site-specific recombination to purify a single-copy gene locus of interest in its native chromatin context from budding yeast, Saccharomyces cerevisiae.

The basic organizational unit of eukaryotic chromatin is the nucleosome core particle (NCP), which comprises DNA wrapped ~1.7 times around a histone ...

Biochemistry

Quantitation and Analysis of the Formation of HO-Endonuclease Stimulated Chromosomal Translocations by Single-Strand Annealing in Saccharomyces cerevisiae

Genetic variation is frequently mediated by genomic rearrangements that arise through interaction between dispersed repetitive elements present in every eukaryotic genome. This process is an important mechanism for generating diversity between and within organisms1-3. The human genome consists of approximately 40% repetitive sequence of retrotransposon origin, including a variety of LINEs and SINEs4. Exchange events between these repetitive elements can lead to genome rearrangements, including translocations, that can disrupt gene dosage and expression that can result in autoimmune and cardiovascular diseases5, as well as cancer in humans6-9.
Exchange between repetitive elements occurs in a variety of ways. Exchange between sequences that share perfect (or near-perfect) homology occurs by a process called homologous recombination (HR). By contrast, non-homologous end joining (NHEJ) uses little-or-no sequence homology for exchange10,11. The primary purpose of HR, in mitotic cells, is to repair double-strand breaks (DSBs) generated endogenously by aberrant DNA replication and oxidative lesions, or by exposure to ionizing radiation (IR), and other exogenous DNA damaging agents. 
In the assay described here, DSBs are simultaneously created bordering recombination substrates at two different chromosomal loci in diploid cells by a galactose-inducible HO-endonuclease (Figure 1). The repair of the broken chromosomes generates chromosomal translocations by single strand annealing (SSA), a process where homologous sequences adjacent to the chromosome ends are covalently joined subsequent to annealing. One of the substrates, his3-&Delta;3', contains a 3' truncated HIS3 allele and is located on one copy of chromosome XV at the native HIS3 locus. The second substrate, his3-&Delta;5', is located at the LEU2 locus on one copy of chromosome III, and contains a 5' truncated HIS3 allele. Both substrates are flanked by a HO endonuclease recognition site that can be targeted for incision by HO-endonuclease. HO endonuclease recognition sites native to the MAT locus, on both copies of chromosome III, have been deleted in all strains. This prevents interaction between the recombination substrates and other broken chromosome ends from interfering in the assay. The KAN-MX-marked galactose-inducible HO endonuclease expression cassette is inserted at the TRP1 locus on chromosome IV. The substrates share 311 bp or 60 bp of the HIS3 coding sequence that can be used by the HR machinery for repair by SSA. Cells that use these substrates to repair broken chromosomes by HR form an intact HIS3 allele and a tXV::III chromosomal translocation that can be selected for by the ability to grow on medium lacking histidine (Figure 2A). Translocation frequency by HR is calculated by dividing the number of histidine prototrophic colonies that arise on selective medium by the total number of viable cells that arise after plating appropriate dilutions onto non-selective medium (Figure 2B). A variety of DNA repair mutants have been used to study the genetic control of translocation formation by SSA using this system12-14.

Quantitation and Analysis of the Formation of HO-Endonuclease Stimulated Chromosomal Translocations by Single-Strand Annealing in Saccharomyces cerevisiae

The HO-stimulated translocation assay monitors single-strand annealing following the creation of DNA double-strand breaks at multiple loci in diploid Saccharomyces cerevisiae. This mechanism may model genome rearrangements in somatic cells of higher eukaryotes following exposure to high doses of ionizing radiation.

Genetic variation is frequently mediated by genomic rearrangements that arise through interaction between dispersed repetitive elements present in every ...

Studying Ribonucleotide Incorporation: Strand-specific Detection of Ribonucleotides in the Yeast Genome and Measuring Ribonucleotide-induced Mutagenesis

The presence of ribonucleotides in nuclear DNA has been shown to be a source of genomic instability. The extent of ribonucleotide incorporation can be assessed by alkaline hydrolysis and gel electrophoresis as RNA is highly susceptible to hydrolysis in alkaline conditions. This, in combination with Southern blot analysis can be used to determine the location and strand into which the ribonucleotides have been incorporated. However, this procedure is only semi-quantitative and may not be sensitive enough to detect small changes in ribonucleotide content, although strand-specific Southern blot probing improves the sensitivity. As a measure of one of the most striking biological consequences of ribonucleotides in DNA, spontaneous mutagenesis can be analyzed using a forward mutation assay. Using appropriate reporter genes, rare mutations that results in the loss of function can be selected and overall and specific mutation rates can be measured by combining data from fluctuation experiments with DNA sequencing of the reporter gene. The fluctuation assay is applicable to examine a wide variety of mutagenic processes in specific genetic background or growth conditions.

Ribonucleotides are among the most abundant non-canonical nucleotides incorporated into the genome during eukaryotic nuclear DNA replication. If not properly removed, ribonucleotides can cause DNA damage and mutagenesis. Here, we present two experimental approaches that are used to assess the abundance of ribonucleotide incorporation into DNA and its mutagenic effects.

The presence of ribonucleotides in nuclear DNA has been shown to be a source of genomic instability. The extent of ribonucleotide incorporation can be ...

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video