저자는 기꺼이 미국의 과학 연구의 공군 사무실에서 수상 FA9550-13-1-0108 지원을 인정합니다. 저자는 또한 버지니아 폴리 테크닉 연구소 및 주립 대학에서 중요한 기술 및 응용 과학 연구소에서와 국립 과학 재단 (National Science Foundation) 대학원 연구에서 자금, 미국의 해군 연구소의 사무실에서 수상 N00014-15-1-2502의 지원을 인정 원정대 프로그램, 보너스 번호 1607310.

<ol>
	<li>Zhang, R., Heyde, K. C., Scott, F. Y., Paek, S. -. H., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programming+Surface+Chemistry+with+Engineered+Cells.">Programming Surface Chemistry with Engineered Cells.</a> ACS Synth. Biol. , (2016).</li><li>Zhou, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reduced+graphene+oxide+films+used+as+matrix+of+MALDI-TOF-MS+for+detection+of+octachlorodibenzo-p-dioxin.">Reduced graphene oxide films used as matrix of MALDI-TOF-MS for detection of octachlorodibenzo-p-dioxin.</a> Chem. Commun. 46, 6974-6976 (2010).</li><li>Pardee, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Low-Cost+Detection+of+Zika+Virus+Using+Programmable+Biomolecular+Components.">Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components.</a> Cell. 165, 1255-1266 (2016).</li><li>B&#228;hring, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+Sensing+Properties+of+a+Self-Assembled+Supramolecular+Oligomer.">Design and Sensing Properties of a Self-Assembled Supramolecular Oligomer.</a> Chem. Eur. J. 22, 1958-1967 (2016).</li><li>Nicolau Jr, D. V., Armitage, J. P., Maini, P. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directional+persistence+and+the+optimality+of+run-and-tumble+chemotaxis.">Directional persistence and the optimality of run-and-tumble chemotaxis.</a> Comp. Biol. Chem. 33, 269-274 (2009).</li><li>Du, J., Shao, Z., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+microbial+factories+for+synthesis+of+value-added+products.">Engineering microbial factories for synthesis of value-added products.</a> J. Ind. Microbiol. Biotechnol. 38, 873-890 (2011).</li><li>Kim, H., Kim, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electric+Field+Control+of+Bacteria-Powered+Microrobots+Using+a+Static+Obstacle+Avoidance+Algorithm.">Electric Field Control of Bacteria-Powered Microrobots Using a Static Obstacle Avoidance Algorithm.</a> IEEE Trans. Rob. 32, 125-137 (2016).</li><li>Gardner, T. S., Cantor, C. R., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+a+genetic+toggle+switch+in+Escherichia+coli.">Construction of a genetic toggle switch in Escherichia coli.</a> Nature. 403, 339-342 (2000).</li><li>Heyde, K. C., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+Host-Microbiome+Interactions+using+an+in+Silico+Model+of+Biomimetic+Robots+and+Engineered+Living+Cells.">Exploring Host-Microbiome Interactions using an in Silico Model of Biomimetic Robots and Engineered Living Cells.</a> Sci. Rep. 5, 11988 (2015).</li><li>Rice, M. K., Ruder, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Creating+biological+nanomaterials+using+synthetic+biology.">Creating biological nanomaterials using synthetic biology.</a> Sci. Tech. Adv. Mater. 15, 014401 (2014).</li><li>Green, N. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin.+3.+The+nature+of+the+biotin-binding+site.">Avidin. 3. The nature of the biotin-binding site.</a> Biochem. J. 89, 599-609 (1963).</li><li>Mesulam, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tetramethyl+benzidine+for+horseradish+peroxidase+neurohistochemistry:+a+non-carcinogenic+blue+reaction+product+with+superior+sensitivity+for+visualizing+neural+afferents+and+efferents.">Tetramethyl benzidine for horseradish peroxidase neurohistochemistry: a non-carcinogenic blue reaction product with superior sensitivity for visualizing neural afferents and efferents.</a> J Histochem. Cytochem. 26, 106-117 (1978).</li><li>Litcofsky, K. D., Afeyan, R. B., Krom, R. J., Khalil, A. S., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iterative+plug-and-play+methodology+for+constructing+and+modifying+synthetic+gene+networks.">Iterative plug-and-play methodology for constructing and modifying synthetic gene networks.</a> Nat. Meth. 9, 1077-1080 (2012).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+Chemical+Synthesis,+Assembly,+and+Cloning+of+a+Mycoplasma+genitalium+Genome.">Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome.</a> Science. 319, 1215-1220 (2008).</li><li>Diamandis, E. P., Christopoulos, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biotin-(strept)avidin+system:+principles+and+applications+in+biotechnology.">The biotin-(strept)avidin system: principles and applications in biotechnology.</a> Clin. Chem. 37, 625-636 (1991).</li><li>Nerurkar, L. S., Namba, M., Brashears, G., Jacob, A. J., Lee, Y. J., Sever, J., L, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+detection+of+herpes+simplex+virus+in+clinical+specimens+by+use+of+capture+biotin-streptavidin+enzyme-linked+immunosorbent+assay.">Rapid detection of herpes simplex virus in clinical specimens by use of capture biotin-streptavidin enzyme-linked immunosorbent assay.</a> J. Clin. Micro. 20, 109-114 (1984).</li><li>Cui, Y., Wei, Q., Park, H., Lieber, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanowire+Nanosensors+for+Highly+Sensitive+and+Selective+Detection+of+Biological+and+Chemical+Species.">Nanowire Nanosensors for Highly Sensitive and Selective Detection of Biological and Chemical Species.</a> Science. 293, 1289-1292 (2001).</li></ol>

저자는 공개 아무것도 없어.

우리는 작용 물질의 표면과 생활 설계 세포를 인터페이스하기위한 새로운 전략을 발표했다. 이 IPTG로 유도 할 때 비오틴 수준 상승을 합성 할 수있는 세포주를 개발함으로써 달성되었다. 비오틴의 상승 된 수준은 기능화 된 표면을 수정하는 데 사용될 수있다. 프로토콜은 대장균 세포 라인을 설계하는 방법에 두 가지 작용 표면을 생성하는 방법을 상세히. 이 프로토콜에서 중요한 단계는 설계 세포주의 구축에 걸쳐 발생한다. 다운 스트림 문제, 모두 성장 곡선으로 설계 세포주의 특성 (그림 2)와 형광 응답 (그림 3)을 방지하기 위해 권장합니다. 절차상의 문제가 발생하는 경우, 이러한 PCR 추출 및 깁슨 조립체 (14)와 같은 다른 분자 클로닝 전략, 여기서 단계 적절한 치환 될 수있다. 비오틴 yie을 최적화조작 된 세포주 LD, DTB 충분한 양의 세포에 제공되는 것을 보장하기 위해 중요하다. 우리의 연구에서 우리는 세포 IPTG로 유도했을 때 200 NG가 / mL의 DTB는 비오틴 생산에 상당한 통계적으로 유의 한 증가를 유발 한 것으로 나타났습니다. 또한, BSA - 비오틴, SA-HRP 및 비오틴-HRP의 성공적인 결합을 효과적으로 수행하고 간접 및 직접 제어 방식을 모니터링하기위한 중요합니다. 빛에 불필요한 노출을 방지하고 접합체 효과적인 복합체를 형성하기 위해 4 ° C에서 하룻밤 배양 할 수 있도록주의하십시오. 우리 프로토콜 인해 이러한 4&#39;- hydroxyazobenzene -2- 카복실산 기반으로하는 시판 비오틴 검출 키트에 비해 (pg / ml 인 스케일) 생물학적 관련성 비오틴 적은 양을 검출 할 수있는 능력을 다른 방법 (15)에 비해 많은 장점을 제공한다 경쟁적 결합 전략. 스트렙토 아비딘을 이용한 바이오 비록주석 시스템 생명 공학 16, 17에서 일반적이며, 비오틴의 적은 양에 대응하는 우리의 시스템의 능력은 직접 작용 표면과 우리의 유전자 조작 세포 라인을 연결하는 우리를 할 수 있습니다. 우리의 프로토콜의 하나의 잠재적 인 제한은 비오틴 검출 결과의 동적 범위입니다. 간접 및 직접 제어 방식에서 우리는 (4도)는 각각 / mL로, 페이지 4 -10 6 세 -10이 10 ~ 10 비오틴을 감지 할 수 있습니다. 다행히 간접 제어 방식의 저역은 우리가 쉽게 조작 된 세포에서 비오틴 생산을 감지 할 수 있습니다. 그러나 간접 제어 다이나믹 레인지의 타이트한 밴드 비오틴 농도의 큰 변화 (100 배)을 감지하는 능력을 제한한다. 모두 간접 및 직접 제어 방식에 대한 동적 범위를 변경하는 추가적인 기술을 필요로한다. 그러나, 검출 셀 생산할 경우D 비오틴은 간접 제어 방식 (그림 5)의 동적 범위를 대상으로 연구를 허용해야 단계 4.6에서 비오틴 상층 액의 희석을 준비 문제입니다. 상층 액의 5 희석 우리가 효과적으로 간접 제어 방식의 동적 범위를 타겟팅 할 수 : 우리는 1 것을 발견했다. 이 희석 전략 직접 동적 범위를 변경하는 요구를 완화한다. 여기에 제시된 두 부분, 세포 물질 시스템은 기능화 된 표면의 구성을 수정하는 셀을 설계 허용한다. 동적, 살아있는 세포는 유전 적 반응을 생산하기 위해 화학적 환경을 해석 할 수 있습니다. 비오틴 증산이 유전 반응을 설계함으로써 기능화 된 표면을 통제하고 조작하는 능력을 설계 살아있는 세포를 부여 할 수있다. 제시된 프로토콜에 따라, 조작 된 세포는 판독 처리 가능한 동적 센서를 작동 할 수 있으며, 제 주변 기록 조건작용 인터페이스를 통해 그들. 이 기술은 분자 의학에서 환경 개선에 대한 분석 검출에 이르기까지 다양한 분야에 영향을 미칠 수 있습니다.

여기서, 우리는 조작 세포주에서 화학적 신호에 응답 할 수있는 프로그래밍이 된 기판을 현상하는 절차를보고한다. (1) 우리는 합성 조작 된 대장균 (대장균) 세포에 의해 생성 비오틴에 응답 비오틴 - 스트렙 타비 딘 인터페이스를 작성하여이를 수행합니다. 이전 프로그램은 독소의 표면 검사 2 및 치료 시점 진단 3 방위 및 보안에서 다양한 애플리케이션을 위해 설계되었다. 프로그래머블 표면 센서 및 액추에이터로서 유용 할 수있는 4이지만, 서로 다른 환경 문제에 적응할 수있는 능력을 부여하는로 &#39;똑똑한&#39;할 수있다. 대조적으로, 대장균 심지어 간단한 미생물은 본래 적응성이 있고 정교 종종 예기치 솔루션 과제에 응답 할 수있다. 이 적응성은 E. 사용할 수있다복잡한 유전자 네트워크에 의해 제어 대장균 인구는 비용 효율적으로 자원을 찾아, 5 부가가치 제품, 6, 심지어 전원 마이크로 규모의 로봇을 만들 수 있습니다. 7 프로그래밍 표면을 이용하여 살아있는 세포의 적응 효과를 결합함으로써, 우리는 상이한 환경 조건에 응답 할 수있는 스마트 기판을 생성 할 수있다. 합성 생물학은 생물의 행동을 프로그래밍하는 연구자들에게 새로운 능력을 부여하고있다. 새로운 유전자 조절 네트워크를 포함하는 셀을 설계함으로써, 연구자들은 프로그래밍 동작의 범위를 나타내는 셀을 설계 할 수있다. 기초 연구 너머 (8, 9)는, 이러한 동작은 부가가치 제품을 재 조립을 제어 생물학적 생산과 같은 애플리케이션에 사용될 수있다. 10 여기, 우리가 합성 생물학의 도구를 사용하여 우리 세부 방법 엔유도에 비오틴 합성 대장균 균주 때문에 엔지니어. 이 균주는 플라스미드 pKE1-의 lacI-bioB 조립 제한 효소 클로닝 방법을 사용하여 개발되었다. 대장균 균주 K-12 MG1655로 변환 할 때, 플라스미드는 bioB 비오틴 합성에 필수적인 효소의 상승 된 수준을 발현하는 능력을 부여한다 세포. 형질 전환 된 세포가 이소 프로필 β-D-1- 티오 갈 락토 피 라노 사이드 (IPTG)를 유도 비오틴 전구체 desthiobiotin (DTB)가 제공되었을 때, 비오틴의 높은 수준이 생성되었다. 스트렙 타비 딘과 비오틴의 결합 상호 작용은 자연에서 발견 강한 비 공유 결합 중 하나입니다. 이와 같이, 비오틴 - 스트렙 트 아비딘 상호 작용은 잘 특성화 높은 바이오 채용 모두이다. 이 원고 (11) 내에서, 우리는 감지 관능면 셀 생산 바이오틴을 검출 바이오틴 - 스트렙 상호 작용을 이용하는 두 가지 전략을 제시한다. 우리&quot;간접적&quot;와 &quot;직접&quot;제어 방식으로 이러한 대조적 인면을 참조하십시오. 간접 제어 방식에서, 셀 생산 바이오틴이 결합하고 결합 부위를 스트렙 타비 딘을위한 폴리스티렌 표면 상에 고정화 된 바이오틴 경쟁. 또한, 스트렙 타비 딘은 고추 냉이 퍼 옥시 다제 (HRP)가 결합된다. HRP 3, 3 &#39;, 5, 5&#39;- 테트라 메틸 벤지딘 (TMB)을 450 nm의 (OD 450)에서 스펙트럼의 흡광도 (즉, 광학 밀도)을 정량함으로써 모니터링 될 수있는 광 신호 (12)를 생성하기 위하여 변경한다. 따라서, 간접적 인 제어 방식이 연구는 OD 450 attentuation 신호를 모니터링하여 셀 생산 비오틴을 측정 할 수있다. 직접 제어 방식은 재료 표면에 직접 스트렙 타비 딘을 고정화 및 결합 부위를 스트렙 타비 딘 경쟁하는 셀 생산 비오틴 및 비오틴 HRP를 허용하여 스트렙 타비 딘 - 비오틴 이벤트를 이용한다. 다시,셀 생산 비오틴의 상대적 수준은 OD 450 신호를 측정하여 모니터링됩니다. 함께 찍은, 조작 된 세포와 기능화 된 표면은 우리가 살아있는 세포에 네트워크를 유도하여 프로그램 표면의 특성을 제어 할 수 있습니다. 즉, 우리는 함께 이러한 시스템을 연결하여 조작 재 계면의 생물체의 적응성과 신뢰성 사양을 활용하는 시스템을 만들었다.

<table border="0" cellpadding="0" cellspacing="0" width="1072">
	<tbody>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">LB Broth, Miller&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">12-795-027</td>
			<td style="width:219px;"></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Agar</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP9744500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Carbenicillin&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP26481</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">M9, Minimimal Salts, 5X</td>
			<td style="width:209px;">Sigma-Aldrich</td>
			<td style="width:119px;">M6030</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Casamino Acids&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP1424-100</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Magnesium Sulfate, Anhydrous</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">M65-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Calcium Chloride, Dihydrate</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">C79-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Dextrose (D-Glucose), Anhydrous</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">D16-1</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">NEB Turbo Cell Line</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">C2984l</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Oligonucleotide Primers</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">N/A</td>
			<td>25N synthesis, DSL purification</td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Q5 High-Fidelity Polymerase</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">M0491S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Q5 Reaction Buffer</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">B9027S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">dNTP Solution Mix</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">N0447S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Agarose</td>
			<td style="width:209px;">Bioexpress</td>
			<td style="width:119px;">E-3120-125</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Ethidium Bromide, 1%</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP1302-10</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Gel Extraction Kits</td>
			<td style="width:209px;">Epoch Biolabs</td>
			<td style="width:119px;">2260250</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">GenCatch Plasmid DNA Miniprep Kit</td>
			<td style="width:209px;">Epoch Biolabs</td>
			<td style="width:119px;">2160250</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">AatII</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">R0117S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">SacII</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">R0157S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">HindIII-HF</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">R3104S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">EcoRI-HF</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">R3101S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">Cutsmart Buffer</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">B7204S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">T4 DNA Ligase</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">M0202S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">T4 DNA Ligase Reaction Buffer</td>
			<td style="width:209px;">New England Biolabs</td>
			<td style="width:119px;">B0202S</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">ColiRolle Glass Plating Beads&#160;</td>
			<td style="width:209px;">EMD Millipore</td>
			<td style="width:119px;">7101-3</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Glycerol</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP229-1</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Isopropyl &#946;-D-1-thiogalactopyranoside (IPTG)</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP1755-10</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;width:527px;">NHS-Desthiobiotin (DTB)</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">16129</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Succinimidyl Trans-4-(maleimidylmethyl) Cyclohexane-1-Carboxylate (SMCC)&#160;</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">S1534</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Dimethyl Sulfoxide (DMSO)&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP231-100</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Succinimidyl 3-(2-pyridyldithio) Propionate (SPDP)&#160;</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">S1531</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">NHS-LC-LC-biotin</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">21343</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Horseradish Peroxidase (HRP)&#160;</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">31490</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Phosphate Buffered Saline (PBS), 10X Solution</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP399500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Streptavidin (SA)&#160;</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">21145</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Bovine Serum Albumin (BSA)</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP1600-100</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Dithiothreitol (DTT)</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP172-5</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Ethylenediaminetetaacetic acid (EDTA)&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">S311-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Tween 80&#160;</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">T164-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Hydrogen Peroxide</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">H325-4</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">3, 3&#39;, 5, 5&#39;-tetramethylbenzidine (TMB)</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">AC229280050</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Vivaspin 500 Centrifugal Concentrators&#160;</td>
			<td style="width:209px;">Viva Products</td>
			<td style="width:119px;">VS0192</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">Sodium Acetate, Anhydrous</td>
			<td style="width:209px;">Fisher Scientific</td>
			<td style="width:119px;">BP333-500</td>
			<td></td>
		</tr>
		<tr height="27">
			<td height="27" style="height:27px;">96-Well Polystyrene Plates</td>
			<td style="width:209px;">Thermo Fisher Scientific</td>
			<td style="width:119px;">266120</td>
			<td></td>
		</tr>
	</tbody>
</table>

using synthetic biology to engineer living cells that interface with programmable materials

우리는 설계 세포 관능 표면의 물성을 제어 할 수있는 생물 적 생물 - 인터페이스를 개발했다. 대장균의 합성 조작 된 균주 및 관능 재 계면이 시스템은 두 개의 모듈을 생성함으로써 만들어진다. 이 논문에서, 우리는 세부 유전자 분자 복제 전략을 사용하여 대장균의 균주 내에서 선택 행동을 설계하기위한 프로토콜. 화학 유도제에 노출 될 때 회 전개,이 균주는 바이오틴의 높은 수준을 생성한다. 또한, 세포 합성 비오틴에 응답 할 수있는 각각의 두 가지 작용 표면을 만들기위한 우리 상세히 프로토콜. 종합하면, 우리는 무생물 재료 기판 상 조성물 및 조립을 제어하는 ​​셀을 설계 허용 연결된, 비 생물 - 생물학적 시스템을 생성하는 방법을 제시한다.

대표 결과 첨부 다섯 수치로 표시됩니다. 리더 시각적 합성 조작 된 대장균 균주를 생성하기위한 중요한 단계를 수행 할 수 있도록 먼저, 그래픽 복제 프로세스 (도 1)을 제시한다. 세포 집단의 동력학을 특성화하기 위해, 우리는 인구의 600 나노 미터 (OD 600)에서 광학 밀도를 측정함으로써 생성되는 성장 곡선 (도 2)을 제공한다. 그 후, 우리는 조절 유전자 네트워크 우리 광학적 IPTG로 유도시 세포에 의해 생성 될 bioB의 상대적인 양을 측정 할 수 bioB 대한 프록시로서 (도 3) mCherry를 이용하여 검증하는 방법을 보여준다. 다음은 간접적 인 제어 및 직접 제어 작용면에 대해 응답 데이터를 제시한다. 이러한 데이터 그래프 (그림 4)는 무료의 측정 솔루션을 사용하여 개발되었다비오틴은 표면 기능화 &#39;응답 프로파일을 특성화. 마지막으로, 우리는 이에 작용면 수정 조작 된 세포를 비오틴 (도 5)을 생성하도록 유도하는 방법을 나타내는 특성 데이터를 제시한다. <img alt="그림 1" src="/files/ftp_upload/55300/55300fig1.jpg" /> 그림 1 : 설계 및 유도 성, 엔지니어링 세포의 건설. (A) 프라이머 비오틴 합성 경로에서 중요한 효소를 코딩하는 대장균 게놈에서 bioB 유전자를 분리하기 위해 설계되었다. (B)가 P의 L은 TETO -lacI-1 및 P-2 TRC 서열 대응 프라이머 유전자 전환 스위치를 포함하는 플라스미드로부터 분리 될 수있다. (C) 추출 bioB 유전자 상기 전환 스위치로부터의 두 단편은 그 유전자 회로를 생성하는데 사용될 수있다. 다음 산업사 수 IPTG의 첨가DTB가 bioB 용 기질로서 첨가하면 bioB하여 비오틴 합성 식 UCE. (D) 조립 된 플라스미드 K-12 MG1655 대장균에 형질 전환 하였다. 이것은 DTB을 기판으로 제공 될 때 조작 세포주에서 bioB하여 비오틴 합성의 발현을 유도하기 위해 IPTG의 존재를 일으켰다. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/55300/55300fig2.jpg" /> 그림 2 : 설계된 세포에 대한 성장 곡선. 공학적, 유도 MG1655 야생형 세포 성장 및 최소 배지 (즉, 바이오틴없는 M9 배지)뿐만 아니라, 최소 배지 DTB 보충 (200 NG / ㎖) 및 / 또는 IPTG (0.5 mM)을 모니터링 하였다. 플롯은 OD 600 독서, 측정을 매 5 마일 표시<html> 24 시간 동안 N. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" src="/files/ftp_upload/55300/55300fig3.jpg" /> 그림 3 : 엔지니어링 유전자 네트워크 테스트. 형광 단백질 mCherry는 대신에 사용 조작 된 세포 IPTG로 유도했을 때 우리는 광학적으로 유도 프로파일을 측정 할 수 있도록 bioB 유전자. 우리는 IPTG (블루 다이아몬드)로 유도되지 않은 세포에 IPTG (적색 다이아몬드)에 의한 세포 대비. 이러한 결과는 유도 유전자 네트워크의 효능을 입증한다. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> /55300/55300fig4.jpg &quot;/&gt; 그림 4 : 기능화 소재 인터페이스의 확인. 비오틴 농도의 변화에 대한 우리의 기능화 된 표면을 노출시킴으로써, 우리는 OD 450 흡광도를 측정하여 광학 응답을 측정 할 수있다. 이러한 결과는 반응의 광 강도 비오틴의 농도를 잇는 우리 교정 곡선을 생성 할 수있다. 여기, 우리는 모두 간접 (왼쪽)와 직접 (오른쪽) 작용 표면 체계를위한 광 신호 곡선 대 비오틴을 제시한다. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 5" src="/files/ftp_upload/55300/55300fig5.jpg" /> 그림 5 : 엔지니어링 세포는 재질 인터페이스를 제어 할 수 있습니다. 프로토콜 절 5 또는 6을 이용함으로써 유도 조작 C의 제품을 사용할 수있다ELL 학생은 화학적으로 기능화 된 표면을 수정합니다. 우리는 OD 450을 측정하여 광학적으로 이러한 반응을 모니터링 할 수 있습니다. 또한,도 4에서 개발 한 검량선을 이용함으로써 농도 내 바이오틴에 응답하여 광 강도를 연결할 수있다. 우리는 여기서, 야생형 세포 (흰색)의 pKE1-의 lacI-bioB 플라스미드 (오렌지)를 포함하는 유도되지 않은 셀에 대한 우리의 간접 제어 방식 관능면에 의해 측정 된 다른 비오틴 농도, 및 pKE1-의 lacI-bioB 함유 유도 세포를 제시 플라스미드 (회색). <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55300/55300fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 화학 </td><td> 최종 농도 </td><td> 양 </td></tr><tr><td> 5 배 M9 염 </td><td> 1 배 </td><td> 20 ㎖ </td></tr><tr><td> 1 M 황산 </td><td> 2 밀리미터 </td><td> 200 μL </td></tr><tr><td> 1 M CaCl2를 </td><td> 0.1 mM의 </td><td> 10 μL </td></tr><tr><td> 20 % 글루코스 </td><td> 0.40 % </td><td> 2 mL의 </td></tr><tr><td> 2 % 비오틴 무 카사 미노산 </td><td> 0.02 % </td><td> 1 mL의 </td></tr><tr><td> DI 물 </td><td> N / A </td><td> 76.8 mL의 </td></tr></tbody></table> 표 1 : M9 미디어 레시피. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 이름 </td><td colspan="2"> 프라이머 시퀀스 </td><td> 용법 </td></tr><tr><td> 1-F </td><td colspan="2"> CCGCCGGAATTCTCCCTATCAGTGATAGAGATT </td><td> 카세트의 lacI 추출 </td></tr><tr><td> 1-R </td><td colspan="2"> 기음CGACGTCTCACTGCCCGCTTTCCAGTC </td><td> 카세트의 lacI 추출 </td></tr><tr><td> nBioB1-F </td><td colspan="2"> CCCAAGCTTCTGAAATGAGCTGTTGACAATTAATCAT </td><td> P의 TRC-2 추출 </td></tr><tr><td> nBioB1-R </td><td colspan="2"> GGGGGGTTCTTTTAATAAAGGTACCGTGTGAAATTGTT </td><td> P의 TRC-2 추출 </td></tr><tr><td> nBioB2-F1 </td><td colspan="2"> ACCCCCCTAAGGAGGTCATCATGGCTCACCGCCCACG </td><td> bioB 추출 </td></tr><tr><td> nBioB2-R </td><td colspan="2"> TCCCCGCGGTCATAATGCTGCCGCGTTGTAATATTC </td><td> bioB 추출 </td></tr><tr><td> nBioB2-F2 </td><td colspan="2"> ACGGTACCTTTATTAAAAGAACCCCCCTAAGGAGGTCATC </td><td> 합성 RBS 추가 </td></tr></tbody></table> 표 2 : 프라이머의 목록입니다. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td&gt; 1 단계 </td><td> 2 단계 </td><td> 3 단계 </td><td> 4 단계 </td><td> 5 단계 </td><td> 6 단계 </td><td> 7 단계 </td><td> 8 단계 </td><td> 9 단계 </td></tr><tr><td> 98 ° C </td><td> 98 ° C </td><td> 70 ° C </td><td> 72 ° C </td><td> 98 ° C </td><td> 60 ° C </td><td> 72 ° C </td><td> 72 ° C </td><td> 4 ° C </td></tr><tr><td> 0시 반 </td><td> 0시 10분 </td><td> 0시 반 </td><td> 01 : 00 / 킬로바이트 </td><td> 0시 10분 </td><td> 0시 반 </td><td> 01 : 00 / 킬로바이트 </td><td> 2시 </td><td> ∞ </td></tr><tr><td rowspan="2"></td><td colspan="3"> 12 회 반복 </td><td colspan="3" rowspan="2"> 25 회 반복 </td><td colspan="2" rowspan="2"></td></tr><tr><td colspan="3"> -1 C / 사이클 ° </td></tr></tbody></table>표 3 : PCR 프로그램. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 이름 </td><td> 음량 </td></tr><tr><td> 세포 용 해물 (템플릿) </td><td> 10 μL </td></tr><tr><td> 프라이머 (각) </td><td> 0.625 μL (각) </td></tr><tr><td> 5 배 Q5 버퍼 </td><td> 5 μL </td></tr><tr><td> Q5의 중합 </td><td> 0.25 μL </td></tr><tr><td> 의 dNTP 믹스 </td><td> 0.5 μL </td></tr><tr><td> DI 물 </td><td> 6.75 μL </td></tr></tbody></table> 표 4 : 전체 세포 PCR 반응 (25 μL). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 이름 </td><td> 음량 </td></tr><tr><td> (10)X 반응 버퍼 </td><td> 5 μL </td></tr><tr><td> 효소 1 </td><td> 1 μL </td></tr><tr><td> 효소 2 </td><td> 1 μL </td></tr><tr><td> 템플릿 DNA </td><td> 1 μg의 </td></tr><tr><td> DI 물 </td><td> 43 μL - DNA의 볼륨 </td></tr></tbody></table> 표 5 : 제한 효소 분해 반응 (50 μL). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 이름 </td><td> 음량 </td></tr><tr><td> DNA </td><td> + X μg의 인서트 50 μg의 벡터 </td></tr><tr><td> 10 배 리가 버퍼 </td><td> 1 μL </td></tr><tr><td> T4 리가 </td><td> 1 μL </td></tr><tr><td> DI 물 </td><td> 8 μL - DNA의 볼륨 </td></tr></tbody></table>도표 6 : 연결 반응 (10 μL). <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 이름 </td><td> 집중 </td><td> 노트 </td></tr><tr><td> 염화칼슘 (2) </td><td> 100 밀리미터 </td><td></td></tr><tr><td> Carbeniccilin </td><td> 50 ㎎ / ㎖ (1000X) </td><td></td></tr><tr><td> DTB </td><td> 50 μg의 / mL의 </td><td></td></tr><tr><td> IPTG </td><td> 0.5 M </td><td></td></tr><tr><td> SMCC </td><td> 20 ㎎ / ㎖ </td><td> 100 ㎕ DMSO에 2 mg의 </td></tr><tr><td> SPDP </td><td> 20 ㎎ / ㎖ </td><td> 100 ㎕ DMSO에 2 mg의 </td></tr><tr><td> LC-LC-비오틴 </td><td> 20 ㎎ / ㎖ </td><td> 100 ㎕ DMSO에 2 mg의 </td></tr><tr><td> HRP </td><td> 10 ㎎ / ㎖ </td><td> PBS에서 </td></tr><tr><td> SA (경유) </td><td> 10 ㎎ / ㎖ </td><td> PBS에서 </td></tr><tr><td> SA (직접) </td><td> 0.17 μg의 / mL의 </td><td> PBS에서 </td></tr><tr><td> BSA </td><td> 20 ㎎ / ㎖ </td><td> PBS에서 </td></tr><tr><td> DTT </td><td> 100MM </td><td> DI 물에 </td></tr><tr><td> EDTA </td><td> 5 밀리미터 </td><td> 10 mL의 PBS에 18.6 mg의 </td></tr><tr><td> 카세인 </td><td> 0.50 % </td><td> PBS에서 </td></tr><tr><td> 트윈 80 </td><td> 20 % </td><td> DI 물에 </td></tr><tr><td> PBS의 트윈 80 </td><td> 0.05 % </td><td></td></tr><tr><td> 아세트산 나트륨 </td><td> 50 mM의 </td><td> DI 물에, 3 M 염산을 사용하여 5.1 pH로 조정 </td></tr><tr><td> TMB </td><td> 1% </td><td> DMSO에서 </td></tr><tr><td> H 2 O 2 </td><td> 삼% </td><td> DI 물에 </td></tr><tr><td> H 2 SO 4 </td><td> 2 M </td><td> DI 물에 </td></tr></tbody></table>도표 7 : 시약 솔루션의 목록입니다.

Watch this Scientific Journal Video about Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials at JoVE.com

Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials

이 논문은 조작 된 세포와 합성 제어 프로그램 재료 표면을 조작하는 대장균을 설계 에이블 작용 표면을 개발하기위한 프로토콜의 시리즈를 제공합니다.

살아있는 세포를 엔지니어하는 합성 생물학을 사용하여 해당 프로그램 자료와 인터페이스

We have developed an abiotic-biotic interface that allows engineered cells to control the material properties of a functionalized surface. This system is ...

using-synthetic-biology-to-engineer-living-cells-that-interface-with

Nanyang Technological University

Research

JoVE Journal

Bioengineering

8.8K 조회수.  Carnegie Mellon University.  이 논문은 조작 된 세포와 합성 제어 프로그램 재료 표면을 조작하는 대장균을 설계 에이블 작용 표면을 개발하기위한 프로토콜의 시리즈를 제공합니다. 

비디오: Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials

Fluorescence Lifetime Imaging of Molecular Rotors in Living Cells

Diffusion is often an important rate-determining step in chemical reactions or biological processes and plays a role in a wide range of intracellular events. Viscosity is one of the key parameters affecting the diffusion of molecules and proteins, and changes in viscosity have been linked to disease and malfunction at the cellular level.1-3 While methods to measure the bulk viscosity are well developed, imaging microviscosity remains a challenge. Viscosity maps of microscopic objects, such as single cells, have until recently been hard to obtain. Mapping viscosity with fluorescence techniques is advantageous because, similar to other optical techniques, it is minimally invasive, non-destructive and can be applied to living cells and tissues.
Fluorescent molecular rotors exhibit fluorescence lifetimes and quantum yields which are a function of the viscosity of their microenvironment.4,5 Intramolecular twisting or rotation leads to non-radiative decay from the excited state back to the ground state. A viscous environment slows this rotation or twisting, restricting access to this non-radiative decay pathway. This leads to an increase in the fluorescence quantum yield and the fluorescence lifetime. Fluorescence Lifetime Imaging (FLIM) of modified hydrophobic BODIPY dyes that act as fluorescent molecular rotors show that the fluorescence lifetime of these probes is a function of the microviscosity of their environment.6-8 A logarithmic plot of the fluorescence lifetime versus the solvent viscosity yields a straight line that obeys the F&ouml;rster Hoffman equation.9 This plot also serves as a calibration graph to convert fluorescence lifetime into viscosity.
Following incubation of living cells with the modified BODIPY fluorescent molecular rotor, a punctate dye distribution is observed in the fluorescence images. The viscosity value obtained in the puncta in live cells is around 100 times higher than that of water and of cellular cytoplasm.6,7 Time-resolved fluorescence anisotropy measurements yield rotational correlation times in agreement with these large microviscosity values. Mapping the fluorescence lifetime is independent of the fluorescence intensity, and thus allows the separation of probe concentration and viscosity effects. 
In summary, we have developed a practical and versatile approach to map the microviscosity in cells based on FLIM of fluorescent molecular rotors.

Fluorescence Lifetime Imaging (FLIM) has emerged as a key technique to image the environment and interaction of specific proteins and dyes in living cells. FLIM of fluorescent molecular rotors allows mapping of viscosity in living cells.

생활 세포의 분자 Rotors의 형광 수명 이미징

Diffusion is often an important rate-determining step in chemical reactions or biological processes and plays a role in a wide range of intracellular ...

연구

생체공학

Bridging the Bio-Electronic Interface with Biofabrication

Advancements in lab-on-a-chip technology promise to revolutionize both research and medicine through lower costs, better sensitivity, portability, and higher throughput. The incorporation of biological components onto biological microelectromechanical systems (bioMEMS) has shown great potential for achieving these goals. Microfabricated electronic chips allow for micrometer-scale features as well as an electrical connection for sensing and actuation. Functional biological components give the system the capacity for specific detection of analytes, enzymatic functions, and whole-cell capabilities. Standard microfabrication processes and bio-analytical techniques have been successfully utilized for decades in the computer and biological industries, respectively. Their combination and interfacing in a lab-on-a-chip environment, however, brings forth new challenges. There is a call for techniques that can build an interface between the electrode and biological component that is mild and is easy to fabricate and pattern.
Biofabrication, described here, is one such approach that has shown great promise for its easy-to-assemble incorporation of biological components with versatility in the on-chip functions that are enabled. Biofabrication uses biological materials and biological mechanisms (self-assembly, enzymatic assembly) for bottom-up hierarchical assembly. While our labs have demonstrated these concepts in many formats 1,2,3, here we demonstrate the assembly process based on electrodeposition followed by multiple applications of signal-based interactions. The assembly process consists of the electrodeposition of biocompatible stimuli-responsive polymer films on electrodes and their subsequent functionalization with biological components such as DNA, enzymes, or live cells 4,5. Electrodeposition takes advantage of the pH gradient created at the surface of a biased electrode from the electrolysis of water 6,7,. Chitosan and alginate are stimuli-responsive biological polymers that can be triggered to self-assemble into hydrogel films in response to imposed electrical signals 8. The thickness of these hydrogels is determined by the extent to which the pH gradient extends from the electrode. This can be modified using varying current densities and deposition times 6,7. This protocol will describe how chitosan films are deposited and functionalized by covalently attaching biological components to the abundant primary amine groups present on the film through either enzymatic or electrochemical methods 9,10. Alginate films and their entrapment of live cells will also be addressed 11. Finally, the utility of biofabrication is demonstrated through examples of signal-based interaction, including chemical-to-electrical, cell-to-cell, and also enzyme-to-cell signal transmission. 
Both the electrodeposition and functionalization can be performed under near-physiological conditions without the need for reagents and thus spare labile biological components from harsh conditions. Additionally, both chitosan and alginate have long been used for biologically-relevant purposes 12,13. Overall, biofabrication, a rapid technique that can be simply performed on a benchtop, can be used for creating micron scale patterns of functional biological components on electrodes and can be used for a variety of lab-on-a-chip applications.

This article describes a biofabrication approach: deposition of stimuli-responsive polysaccharides in the presence of biased electrodes to create biocompatible films which can be functionalized with cells or proteins. We demonstrate a bench-top strategy for the generation of the films as well as their basic uses for creating interactive biofunctionalized surfaces for lab-on-a-chip applications.

Biofabrication와 바이오 전자 인터페이스 브리지

Advancements in lab-on-a-chip technology promise to revolutionize both research and medicine through lower costs, better sensitivity, portability, and ...

Measuring the Mechanical Properties of Living Cells Using Atomic Force Microscopy

Mechanical properties of cells and extracellular matrix (ECM) play important roles in many biological processes including stem cell differentiation, tumor formation, and wound healing. Changes in stiffness of cells and ECM are often signs of changes in cell physiology or diseases in tissues. Hence, cell stiffness is an index to evaluate the status of cell cultures. Among the multitude of methods applied to measure the stiffness of cells and tissues, micro-indentation using an Atomic Force Microscope (AFM) provides a way to reliably measure the stiffness of living cells. This method has been widely applied to characterize the micro-scale stiffness for a variety of materials ranging from metal surfaces to soft biological tissues and cells. The basic principle of this method is to indent a cell with an AFM tip of selected geometry and measure the applied force from the bending of the AFM cantilever. Fitting the force-indentation curve to the Hertz model for the corresponding tip geometry can give quantitative measurements of material stiffness. This paper demonstrates the procedure to characterize the stiffness of living cells using AFM. Key steps including the process of AFM calibration, force-curve acquisition, and data analysis using a MATLAB routine are demonstrated. Limitations of this method are also discussed.

This paper demonstrates a protocol to characterize the mechanical properties of living cells by means of microindentation using an Atomic Force Microscope (AFM).

원자 힘 현미경을 사용하여 살아있는 세포의 기계적 특성을 측정

Mechanical  properties of cells and extracellular matrix (ECM) play important roles in many  biological processes including stem cell differentiation, ...

Ratiometric Biosensors that Measure Mitochondrial Redox State and ATP in Living Yeast Cells

Mitochondria have roles in many cellular processes, from energy metabolism and calcium homeostasis to control of cellular lifespan and programmed cell death. These processes affect and are affected by the redox status of and ATP production by mitochondria. Here, we describe the use of two ratiometric, genetically encoded biosensors that can detect mitochondrial redox state and ATP levels at subcellular resolution in living yeast cells. Mitochondrial redox state is measured using redox-sensitive Green Fluorescent Protein (roGFP) that is targeted to the mitochondrial matrix. Mito-roGFP contains cysteines at positions 147 and 204 of GFP, which undergo reversible and environment-dependent oxidation and reduction, which in turn alter the excitation spectrum of the protein. MitGO-ATeam is a F&ouml;rster resonance energy transfer (FRET) probe in which the &epsilon; subunit of the FoF1-ATP synthase is sandwiched between FRET donor and acceptor fluorescent proteins. Binding of ATP to the &epsilon; subunit results in conformation changes in the protein that bring the FRET donor and acceptor in close proximity and allow for fluorescence resonance energy transfer from the donor to acceptor.

We describe the use of two ratiometric, genetically encoded biosensors, which are based on GFP, to monitor mitochondrial redox state and ATP levels at subcellular resolution in living yeast cells.

생활 효모 세포에서 미토콘드리아 산화 환원 상태와 ATP를 측정 비례 바이오 센서

Mitochondria have roles in many cellular processes, from energy metabolism and calcium homeostasis to control of cellular lifespan and programmed cell ...

Characterization Of Multi-layered Fish Scales (Atractosteus spatula) Using Nanoindentation, X-ray CT, FTIR, and SEM

The hierarchical architecture of protective biological materials such as mineralized fish scales, gastropod shells, ram&#8217;s horn, antlers, and turtle shells provides unique design principles with potentials for guiding the design of protective materials and systems in the future. Understanding the structure-property relationships for these material systems at the microscale and nanoscale where failure initiates is essential. Currently, experimental techniques such as nanoindentation, X-ray CT, and SEM provide researchers with a way to correlate the mechanical behavior with hierarchical microstructures of these material systems1-6. However, a well-defined standard procedure for specimen preparation of mineralized biomaterials is not currently available. In this study, the methods for probing spatially correlated chemical, structural, and mechanical properties of the multilayered scale of A. spatula using nanoindentation, FTIR, SEM, with energy-dispersive X-ray (EDX) microanalysis, and X-ray CT are presented.

Characterization Of Multi-layered Fish Scales Atractosteus spatula Using Nanoindentation, X-ray CT, FTIR, and SEM

This paper presents the methods used for probing spatially correlated chemical, structural, and mechanical properties of the multilayered scale of Atractosteus spatula (A. spatula) using nanoindentation, Fourier transform infrared (FTIR) spectroscopy, scanning electron microscopy (SEM), and X-ray computed tomography (X-ray CT). The experimental results have been used to investigate the design principles of protective biological materials.

다층 물고기 비늘 (의 특성<em&gt; Atractosteus 주걱</em&gt;) 나노 인 덴 테이션, X-선 CT, FTIR, 및 SEM을 사용하여

The hierarchical architecture of protective biological materials such as mineralized fish scales, gastropod shells, ram&#8217;s horn, antlers, and turtle ...

Development of Amelogenin-chitosan Hydrogel for In Vitro Enamel Regrowth with a Dense Interface

Biomimetic enamel reconstruction is a significant topic in material science and dentistry as a novel approach for the treatment of dental caries or erosion. Amelogenin has been proven to be a critical protein for controlling the organized growth of apatite crystals. In this paper, we present a detailed protocol for superficial enamel reconstruction by using a novel amelogenin-chitosan hydrogel. Compared to other conventional treatments, such as topical fluoride and mouthwash, this method not only has the potential to prevent the development of dental caries but also promotes significant and durable enamel restoration. The organized enamel-like microstructure regulated by amelogenin assemblies can significantly improve the mechanical properties of etched enamel, while the dense enamel-restoration interface formed by an in situ regrowth of apatite crystals can improve the effectiveness and durability of restorations. Furthermore, chitosan hydrogel is easy to use and can suppress bacterial infection, which is the major risk factor for the occurrence of dental caries. Therefore, this biocompatible and biodegradable amelogenin-chitosan hydrogel shows promise as a biomaterial for the prevention, restoration, and treatment of defective enamel.

Development of Amelogenin-chitosan Hydrogel for In Vitro Enamel Regrowth with a Dense Interface

In this article, we describe a protocol for fabricating an amelogenin-chitosan hydrogel for superficial enamel reconstruction. Organized in situ growth of apatite crystals in the hydrogel formed a dense enamel-restoration interface, which will improve the effectiveness and durability of restorations.

에 대한 성별 감정 - 키토산 하이드로 겔의 개발<em&gt; 체외</em고밀도 인터페이스&gt; 에나멜 재성장

Biomimetic enamel reconstruction is a significant topic in material science and dentistry as a novel approach for the treatment of dental caries or ...

Sealable Femtoliter Chamber Arrays for Cell-free Biology

Cell-free systems provide a flexible platform for probing specific networks of biological reactions isolated from the complex resource sharing (e.g., global gene expression, cell division) encountered within living cells. However, such systems, used in conventional macro-scale bulk reactors, often fail to exhibit the dynamic behaviors and efficiencies characteristic of their living micro-scale counterparts. Understanding the impact of internal cell structure and scale on reaction dynamics is crucial to understanding complex gene networks. Here we report a microfabricated device that confines cell-free reactions in cellular scale volumes while allowing flexible characterization of the enclosed molecular system. This multilayered poly(dimethylsiloxane) (PDMS) device contains femtoliter-scale reaction chambers on an elastomeric membrane which can be actuated (open and closed). When actuated, the chambers confine Cell-Free Protein Synthesis (CFPS) reactions expressing a fluorescent protein, allowing for the visualization of the reaction kinetics over time using time-lapse fluorescent microscopy. Here we demonstrate how this device may be used to measure the noise structure of CFPS reactions in a manner that is directly analogous to those used to characterize cellular systems, thereby enabling the use of noise biology techniques used in cellular systems to characterize CFPS gene circuits and their interactions with the cell-free environment.

A microfabricated device with sealable femtoliter-volume reaction chambers is described. This report includes a protocol for sealing cell-free protein synthesis reactants inside these chambers for the purpose of understanding the role of crowding and confinement in gene expression.

무 세포 생물학 밀봉 Femtoliter 상공 회의소 배열

Cell-free systems provide a flexible platform for probing specific networks of biological reactions isolated from the complex resource sharing (e.g., ...

Creating a Structurally Realistic Finite Element Geometric Model of a Cardiomyocyte to Study the Role of Cellular Architecture in Cardiomyocyte Systems Biology

With the advent of three-dimensional (3D) imaging technologies such as electron tomography, serial-block-face scanning electron microscopy and confocal microscopy, the scientific community has unprecedented access to large datasets at sub-micrometer resolution that characterize the architectural remodeling that accompanies changes in cardiomyocyte function in health and disease. However, these datasets have been under-utilized for&#160;investigating the role of cellular architecture remodeling in cardiomyocyte function. The purpose of this protocol is to outline how to create an accurate finite element model of a cardiomyocyte using high resolution electron microscopy and confocal microscopy images. A detailed and accurate model of cellular architecture has significant potential to provide new insights into cardiomyocyte biology, more than experiments alone can garner. The power of this method lies in its ability to computationally fuse information from two disparate imaging modalities of cardiomyocyte ultrastructure to develop one unified and detailed model of the cardiomyocyte. This protocol outlines steps to integrate electron tomography and confocal microscopy images of adult male Wistar (name for a specific breed of albino rat) rat cardiomyocytes to develop a half-sarcomere finite element model of the cardiomyocyte. The procedure generates a 3D finite element model that contains an accurate, high-resolution depiction (on the order of ~35 nm) of the distribution of mitochondria, myofibrils and ryanodine receptor clusters that release the necessary calcium for cardiomyocyte contraction from the sarcoplasmic reticular network (SR) into the myofibril and cytosolic compartment. The model generated here as an illustration does not incorporate details of the transverse-tubule architecture or the sarcoplasmic reticular network and is therefore a minimal model of the cardiomyocyte. Nevertheless, the model can already be applied in simulation-based investigations into the role of cell structure in calcium signaling and mitochondrial bioenergetics, which is illustrated and discussed using two case studies that are presented following the detailed protocol.

This protocol outlines a novel method to create a spatially detailed finite element model of the intracellular architecture of cardiomyocytes from electron microscopy and confocal microscopy images. The power of this spatially detailed model is demonstrated using case studies in calcium signaling and bioenergetics.

Cardiomyocyte 시스템 생물학에서 세포 아키텍처의 역할을 연구 하기 Cardiomyocyte의 구조적으로 현실적인 유한 요소 형상 모델 생성

With the advent of three-dimensional (3D) imaging technologies such as electron tomography, serial-block-face scanning electron microscopy and confocal ...

Measurement of Force-Sensitive Protein Dynamics in Living Cells Using a Combination of Fluorescent Techniques

Cells sense and respond to physical cues in their environment by converting mechanical stimuli into biochemically-detectable signals in a process called mechanotransduction. A crucial step in mechanotransduction is the transmission of forces between the external and internal environments. To transmit forces, there must be a sustained, unbroken physical linkage created by a series of protein-protein interactions. For a given protein-protein interaction, mechanical load can either have no effect on the interaction, lead to faster disassociation of the interaction, or even stabilize the interaction. Understanding how molecular load dictates protein turnover in living cells can provide valuable information about the mechanical state of a protein, in turn elucidating its role in mechanotransduction. Existing techniques for measuring force-sensitive protein dynamics either lack direct measurements of protein load or rely on the measurements performed outside of the cellular context. Here, we describe a protocol for the F&#246;rster resonance energy transfer-fluorescence recovery after photobleaching (FRET-FRAP) technique, which enables the measurement of force-sensitive protein dynamics within living cells. This technique is potentially applicable to any FRET-based tension sensor, facilitating the study of force-sensitive protein dynamics in variety of subcellular structures and in different cell types.

Here, we present a protocol for the simultaneous use of F&#246;rster resonance energy transfer-based tension sensors to measure protein load and fluorescence recovery after photobleaching to measure protein dynamics enabling the measurement of force-sensitive protein dynamics within living cells.

살아있는 세포 형광 기술의 조합을 사용 하 여 힘에 민감한 단백질 역학의 측정

Cells sense and respond to physical cues in their environment by converting mechanical stimuli into biochemically-detectable signals in a process called ...

A Microfluidic Platform for Stimulating Chondrocytes with Dynamic Compression

Mechanical stimuli are known to modulate biological functions of cells and tissues. Recent studies have suggested that compressive stress alters growth plate cartilage architecture and results in growth modulation of long bones of children. To determine the role of compressive stress in bone growth, we created a microfluidic device actuated by pneumatic pressure, to dynamically (or statically) compress growth plate chondrocytes embedded in alginate hydrogel cylinders. In this article, we describe detailed methods for fabricating and characterizing this device. The advantages of our protocol are: 1) Five different magnitudes of compressive stress can be generated on five technical replicates in a single platform, 2) It is easy to visualize cell morphology via a conventional light microscope, 3) Cells can be rapidly isolated from the device after compression to facilitate downstream assays, and 4) The platform can be applied to study mechanobiology of any cell type that can grow in hydrogels.

This article provides detailed methods for fabricating and characterizing a pneumatically actuating microfluidic device for chondrocyte compression.

동적 압축으로 연골 세포 자극을 위한 미세 유체 플랫폼

Mechanical stimuli are known to modulate biological functions of cells and tissues. Recent studies have suggested that compressive stress alters growth ...