Name: design and use of a low cost, automated morbidostat for adaptive evolution of bacteria under antibiotic drug selection
Uploaded: 2016-09-27T15:00:00.000+00:00
Duration: 10 min 50 s
Description: Watch this Scientific Journal Video about Design and Use of a Low Cost, Automated Morbidostat for Adaptive Evolution of Bacteria Under Antibiotic Drug Selection at JoVE.com

The authors would like to thank Prof. Sze-Bi Hsu and Ms. Zhenzhen for useful discussions and help in the theoretical analysis and numerical simulation. Y. T. Y. would like to acknowledge funding support from the Ministry of Science and Technology under grant numbers MOST 103-2220-E-007-026 and MOST 104-2220-E-007-011, and from the National Tsing Hua University under grant numbers 103N2042E1, 104N2042E1, and 105N518CE1.

Morbidostat 장치의 1 조립 및 사전 테스트 <ol><li> Morbidostat 조립 <ol><li> 18 G 주사기 바늘 문화 유리 병의 뚜껑에 3 홀 펀치. ~ 길이 7cm를 폴리에틸렌 튜브의 세 가지를 잘라. 캡에 폴리에틸렌 튜브의이 세 가지를 삽입합니다. </li><li> 폴리 디메틸 실록산 (PDMS) 혼합물의 주조로 사용하기 위해 캡의 가장자리를 감싸 테이프를 사용합니다. 이쑤시개 수동으로 교반하여 성분 5 g 및 150 ml의 플라스틱 컨테이너에 PDMS의 B 성분의 0.5 g을 혼합한다. 10 ML의 주사기에 혼합로드합니다. <ol><li> 주사기와 캡의 PDMS 혼합물을 붓고. 70 ° C의 오븐에서 8 시간에 대한 PDMS를 경화 전체 캡을 굽는다. </li></ol></li><li> 납땜 인두와 탄소 저항과 24 게이지 와이어 및 LED 음극과 양극 LED를 납땜. 24 G 와이어와 680 Ω 탄소 저항을 납땜. 전기 테이프를 사용하여 와이어 연결을 절연. </li><li> 그래서24 G 선 및 100 kΩ의 탄소 저항기 검출기의 이미 터와 광 검출기의 콜렉터 lder. 전기 테이프를 사용하여 와이어 연결을 절연. </li><li> 문화 유리 병 홀더에 발광 다이오드를 배치합니다. 부가도 2의 회로도를 수행함으로써, LED는 IR (예를 들어, 이동 전화 카메라)를 검출 할 수있는 디지털 카메라를 사용하여 작동하도록 5 V.의 전원 공급 다이오드와 전원을 발광 연결한다. </li><li> 문화 유리 병 홀더 광 검출기를 배치합니다. 부가도 2의 회로도에 따라, 전자 제어 보드를 가로 지르는 전압을 측정하는 검출기 저항의 양측에 와이어를 연결 5 V.의 전원과 광 검출기 및 전원에 연결. </li><li> 교반기 수단 인 냉각 팬의 축에 자석을 붙인다. alignm합니다배양 병에 팬 및 배양 바이알과 자석 사이의 간격의 축부의 엔트 자기 교반 장치의 적절한 기능에 매우 중요하다. </li><li> 마이크로 펌프, 중간 병, 폐기물 병 실리콘 튜브의 대응 조각으로 배양 병의 폴리에틸렌 튜브의 각 부분을 연결합니다. 1 시간 동안 펌프를 켜고 전체 볼륨이 펌프 속도를 결정하기 위해 문화 유리 병에 매체 병에서 펌핑되는 측정한다. 일반적인 펌핑 속도가 희석 비율 D = 0.33 시간 -1 문화 유리 병의 볼륨을 작동하는 12 ml의 용에 해당 ~ 4 ㎖ / 시간이어야합니다. </li><li> 중간 크기 (34cm X 34cm X 43.5 cm) 진탕 배양기에 전체 어셈블리를 놓습니다. </li></ol></li><li> Morbidostat을 사전 테스트 <ol><li> 5 V로 냉각 팬의 집합 전원 전압은 자기 교반 막대를 테스트하기 위해 그 모터를 시작한다. 교반 작용 육안 검사 할 수 있습니다. 구동 전압냉각 팬 모터는 정확히 펄스 폭 변조 (PWM)에 의해 제어된다 s는. </li><li> 야생형 E. 일련의 준비 600에서 광학 밀도를 갖는 대장균 시료는 일반적으로 0.07에서 교정 0.3 nm의 범위. 테스트 E. 배치 배양 병에 대장균 샘플과 검출기 전압을 기록한다. <ol><li> 장소 ~ 100 플레이트 판독기에서 동일한 샘플 ㎕의 광학 밀도를 기록한다. 검량선을 플롯 광학 밀도 데이터 대 전압 검출기를 사용한다. 일반적으로, 광학 밀도의 1 단위 변화가 여기에 사용되는 바이어스 방식과 광 검출기에서 ~ 7.6 V 변화에 대응합니다. </li></ol></li></ol></li></ol> 2. Morbidostat 실행 <ol><li> 데일리 실험을 시작하기 전에 준비 <ol><li> 입구 부에서와 같이 장치를 형성하기 위해 내경이 1/32 인치 외부 직경 3/32 인치 세 울트라 화학성 타이곤 호스와 배양 병을 준비1.1 및 보충 그림 1인치 </li><li> M9 최소 배지 (0.2 % 포도당) 및 트리 메소 프림 (TMP) 약물 함유 배지를 준비합니다. 121 ℃에서 오토 클레이브 배지, 배지 병, 약물 매체 병, 폐기물 용기 및 배양 병을 소독. 주 : TMP 나중에 표 1의 농도 및 배지를 함유하는 약물 TMP가 멸균되지을 달성하기 위해 사용되는 원액이다. </li></ol></li><li> Morbidostat 실행 <ol><li> 실험 첫날, 냉동 야생형 1 ml의 E. 해동 실온 전송 함유 배양 병에 120 μL 세포에서 5 분간 콜라이 MG1655 ~ M9 세포 성장 배지 12 mL로. 1 일 이후에, 냉동 E. 1 ㎖를 해동 대장균 5 분 및 전송이 포함 된 새로운 문화 유리 병에 세포 120 μL의 전날 셀 ~ M9 성장 배지 12 ml를. </li><li> 진탕 배양기를 켜고 템피을 설정<html> 전혀 흔들림 30 ° C에 rature. </li><li> 마이크로 펌프, 자기 교반 장치 및 광학 밀도 측정 켜서 morbidostat 동작을 시작한다. 주 : 동작 동안, 임계 값 피드백 알고리즘은 약물 주입을 제어하기 위해 사용된다. 측정 된 광학 밀도가 미리 설정된 임계 값을 초과 할 경우, 약물 주입 펌프를 턴온 될 것이고, 매체 펌프가 턴 오프된다. 그렇지 않으면, 약물 주입 펌프는 꺼진 상태로 유지하고, 매체 펌프가 켜져 있습니다. </li><li> 미생물 성장이 있는지 확인하기 위해 수시로 전압을 모니터한다. 참고 : 때문에 동결 및 해동주기, E.의 대장균 세포는 매일의 성장시 ~ 4 시간의 지연을 나타낸다. </li><li> ~ 23 시간 후, 그것의 공급 전압을 해제하여 마이크로 펌프를 중지하고 문화 유리 병을 꺼내. 문화 유리 병에 15 % 글리세롤을 추가하고 저장을 위해 -80 ° C에서 샘플을 동결. </li><li> 반복 2.2.5에 2.2.1 단계를 반복합니다. </li></ol></li></ol>제작 &quot;&gt; 3. 항생제 감수성 측정 96 음 형식으로 주 : 항생제 내성 수준을 결정하기 위해 96 웰 포맷 플레이트 리더에서 성장 속도 측정을 수행한다. <ol><li> 실온에서 5 분 동안 매일 샘플을 냉동 및 해동 ~ 15ml의 M9 배지를 함유하는 바이알에 배양 세포의 15 μl를 옮긴다. 그들을 ~ 0.1에 도달 내지 600 nm에서의 광학 밀도까지 성장 할 수 있습니다. 1 ㎖의 병에 15 mL로 분할하고, 표 1에 나타낸 바와 같이 원하는 약물 농도를 얻기 위해,이 단계에서 TMP 약물을 추가한다. </li><li> 플레이트 리더에서 잘 각으로 단계 3.1과 장소에서 샘플 200 μl를 가지고 그들을 12 시간 5 성장할 수 있습니다. 파장 600 nm에서의 광학 밀도를 측정하는 동안 자동으로 기록된다. 주 : 각 데이터 포인트에 대해, 삼중 측정 기록 된 데이터의 일관성을 보장하기 위해 평균화된다. 시간에 대한 광학 밀도의 데이터는 수 bE는 성장 속도를 얻기 위해 사용된다. </li><li> IC (50)를 획득하기 위해 상기 약물 농도 대 성장 속도 데이터를 플롯. IC (50) 성장 속도가 최대 성장 속도 (5)의 50 %가되는 약물 농도로서 정의된다합니다. </li></ol> 미세 유체 장치 4. 단일 세포 형태와 항생제 감수성 측정 <ol><li> 다른 곳에서 15 설명한 바와 같이 PDMS에서 다층 소프트 리소그래피를 통해 미세 유체 장치의 제조를 수행합니다. <ol><li> 제어 및 흐름 층의 포토 레지스트 몰드를 만들기 위해 포토 리소그래피를 사용합니다. 제어 층에 베어 실리콘 웨이퍼 상에 몰드를 생산하는 네가티브 포토 레지스트 (~ 15㎛의 높이) 및 포지티브 레지스트 (~ 8 ㎛의 높이)를 사용할 수 있습니다. </li><li> 각각의 제어 층과 유동 층, 1 : 1 내지 20 : 5의 비율 가교와 PDMS 혼합물을 준비한다. 모든 거품을 제거하기 위해 진공하에 데시 케이 터에 혼합물을 넣어1 시간 동안. </li><li> (TMCS) 증기 트리메틸 위해 실리콘 웨이퍼 상에 포토 레지스트 층 제어 금형 노출. PDMS의 혼합물을 캐스팅하여 ~ 6mm 두께의 제어 층을 (가교 비율 5 : 1) 제어 층의 포토 리지 스트 몰드에 실리콘 웨이퍼. 오븐에서 1 시간 동안 80 ° C에서 40 분 동안 제어 층을 굽는다. </li><li> (1, 회전 속도가 60 초 동안 3,000 RPM 가교 율 20)와 유동 층 포토 리지 스트 몰드에 PDMS 혼합물을 스핀 코팅에 의해 유동 층을 만든다. 오븐에서 1 시간 동안 80 ° C에서 30 분 동안 유동 층을 굽는다. </li><li> 원하는 칩 사이즈로 제어 층 (통상 3cm X 2cm)을 절단 수동 제어 층을 박리 면도날을 사용한다. 유동 층의 상부에 상기 제어 층을 올려 놓고 입체 현미경을 정렬. 오븐 하룻밤에 80 ° C에서 정렬 된 어셈블리를 치료. 그 후, 잔류 TMCS을 용해하는 5 시간 동안 플라스틱 용기에 탈 이온수 250 ㎖에 조립체를 침지. </li><li> 이어서, 20 G 바늘 유입 구멍을 펀치 (PDMS 간 비율이 5 링크 : 회전 속도 2000 rpm으로 30 초를 들면, 1) 빈 PDMS 층으로 코팅 된 유리 슬라이드를 엘라스토머 전체 접합 40 초에서 공기 플라즈마 처리하여 1.2 토르 공기압. </li><li> PDMS의 세포 독성 효과를 감소시키기 위해 80 ℃에서 36 시간 동안 광범위한 베이킹을 수행. 이러한 베이킹 단계는 상기 세균 세포에 독성을 최소화하는 것이 중요합니다. </li></ol></li><li> 칩 성장 실험에 <ol><li> 미세 유체 장치에 넣기 전에 1 시간 동안 1 시간과 M9 매체에 대한 탈 이온수로 세척합니다. </li><li> 실온에서 5 분 동안 매일 샘플을 동결 해동 신선한 M9 배지로 새로운 시험관에 접종. 하룻밤 37 ℃에서 진탕 배양기에서 샘플을 놓습니다. </li><li> M9 매체와 미생물 샘플 10 배 희석하고 5 psi에서 미생물 시료 용기를 압박하여 미세 유체 장치에로드합니다. 그런 다음 TMP 약물을로드5 psi에서 약물 매체 컨테이너를 압박하여 칩에 매체. 15 분 동안 마이크로 유체 칩에 두 개의 챔버 사이에 마이크로 기계식 밸브를 작동하여 미생물 및 약물의 혼합을 실행합니다. </li><li> 거꾸로 현미경에 장착 된 현미경 인큐베이터에있는 마이크로 유체 칩을 놓습니다. CCD 카메라와 8 시간마다 시간이 도립 현미경에 장착 된 성장 챔버 내의 셀 화상을 취득. </li><li> 셀의 영상 데이터 (18)상의 임계 알고리즘을 통하여 세포 수를 계산하기 위해 사용자 정의 프로그램 스크립트를 사용한다. 셀 번호 데이터는 일반적으로 위에 세 미세 유체 챔버 평균을합니다. </li></ol></li></ol>

<ol>
	<li>Levy, S. B., Marshall, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibiotic+resistance+worldwide:+causes,+challenges,+and+responses.">Antibiotic resistance worldwide: causes, challenges, and responses.</a> Nat. Med. 10, s122-s129 (2004).</li><li>Wang, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracking+the+in+vivo+evolution+of+multidrug+resistance+in+Staphylococus+aureus+by+whole+genome+sequencing.">Tracking the in vivo evolution of multidrug resistance in Staphylococus aureus by whole genome sequencing.</a> Pro. Natl. Acad. Sci. 104, 9451 (2007).</li><li>Dragosits, M., Mattanovich, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adaptive+laboratory+evolution+-+principles+and+applications+for+biotechnology.">Adaptive laboratory evolution - principles and applications for biotechnology.</a> Microbial Cell Factory. 12, 64 (2013).</li><li>Zhang, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acceleration+of+emergence+of+bacterial+antibiotic+resistance+in+connected+microenvironment.">Acceleration of emergence of bacterial antibiotic resistance in connected microenvironment.</a> Science. 333, 1764-1767 (2011).</li><li>Toprak, E., Veres, A., Michel, J. B., Chait, R., Hartl, D. L., Kishony, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+paths+to+antibiotic+resistance+under+dynamically+sustained+drug+selection.">Evolutionary paths to antibiotic resistance under dynamically sustained drug selection.</a> Nature Genetics. 44, 101-106 (2012).</li><li>Toprak, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Building+a+morbidostast:+an+automated+continuous+culture+device+for+studying+bacterial+drug+resistance+under+dynamically+sustained+drug+inhibition.">Building a morbidostast: an automated continuous culture device for studying bacterial drug resistance under dynamically sustained drug inhibition.</a> Nature Protocol. 8, 555-567 (2013).</li><li>Rosenthal, A. Z., Elowitz, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Following+evolution+of+bacterial+antibiotic+resistance+in+real+time.">Following evolution of bacterial antibiotic resistance in real time.</a> Nature Genetics. 44, 11-13 (2012).</li><li>Young, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+antibacterial+resistance+selection+and+quantitation.">In vitro antibacterial resistance selection and quantitation.</a> Curr Protoc Pharmacol. , (2006).</li><li>Novick, A., Szilard, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experiments+with+the+Chemostat+on+spontaneous+mutations+of+bacteria.">Experiments with the Chemostat on spontaneous mutations of bacteria.</a> Proc. Natl. Acad. Sci. U.S.A. 36, 708-719 (1950).</li><li>Balagadde, F. K., You, L., Hansen, C. L., Arnold, F. H., Quake, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+monitoring+of+bacteria+undergoing+programmed+population+control+in+a+microchemostat.">Long-term monitoring of bacteria undergoing programmed population control in a microchemostat.</a> Science. 309, 137-140 (2005).</li><li>Groisman, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microfluidic+chemostat+for+experiments+with+bacterial+and+yeast+cells.">A microfluidic chemostat for experiments with bacterial and yeast cells.</a> Nat. Methods. 2, 685-689 (2005).</li><li>Miller, A. W., Befort, C., Kerr, E. O., Dunham, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+Use+of+Multiplexed+Chemostat+Arrays.">Design and Use of Multiplexed Chemostat Arrays.</a> J. Vis. Exp. (72), e50262 (2013).</li><li>Takahashi, C. N., Miller, A. W., Ekness, F., Dunham, M. J., Klavins, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+low+cost,+customizable+turbidostat+for+use+in+synthetic+circuit+characterization.">A low cost, customizable turbidostat for use in synthetic circuit characterization.</a> ACS Synthetic Biology. , (2015).</li><li>Mohan, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+multiplexed+microfluidic+platform+for+rapid+antibiotic+susceptibility+testing.">A multiplexed microfluidic platform for rapid antibiotic susceptibility testing.</a> Biosens Bioelectrons. 49, 118-125 (2013).</li><li>Unger, M. A., Chou, H. P., Thorsen, T., Scherer, A., Quake, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monolithic+microfabricated+valves+and+pumps+by+multilayer+soft+lithography.">Monolithic microfabricated valves and pumps by multilayer soft lithography.</a> Science. 288, 113-116 (2000).</li><li>Kellogg, R. A., Gomez-Sjoberg, R., Leyrat, A. A., Tay, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Nat. Protocols. 9, 1713 (2014).</li><li>Gu, G. Y., Lee, Y. W., Chiang, C. C., Yang, Y. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nanoliter+microfluidic+serial+dilution+bioreactor.">A nanoliter microfluidic serial dilution bioreactor.</a> Biomicrofluidics. 9, 044126 (2015).</li><li>Gonzalez, R. C., Woods, R. E., Eddins, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Digital image using Matlab processing. , (2004).</li><li>Heikkila, E., Sundstrom, L., Huovinen, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trimethoprim+resistance+in+Escherichia+coli+isolates+from+a+geriatric+unit.">Trimethoprim resistance in Escherichia coli isolates from a geriatric unit.</a> Antimicrob. Agents Chemother. 34, 2013-2015 (1990).</li><li>Flensburg, J., Skold, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massive+overproduction+of+dihydrofolate+reductase+in+bacteria+as+a+response+to+the+use+of+trimethoprim.">Massive overproduction of dihydrofolate reductase in bacteria as a response to the use of trimethoprim.</a> Eur. J. Biochem. 162, 473-476 (1987).</li><li>Ohmae, E., Sasaki, Y., Gekko, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+five-tryptophan+mutations+on+structure,+stability+and+function+of+Escherichia+coli+dihydrofolate+reductase.">Effects of five-tryptophan mutations on structure, stability and function of Escherichia coli dihydrofolate reductase.</a> J. Biochem. 130, 439-447 (2001).</li><li>Smith, D. R., Calvo, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleotide+sequence+of+dihydrofolate+reductase+genes+from+trimethoprim-resistant+mutants+of+Escherichia+coli.+Evidence+that+dihydrofolate+reductase+interacts+with+another+essential+gene+product.">Nucleotide sequence of dihydrofolate reductase genes from trimethoprim-resistant mutants of Escherichia coli. Evidence that dihydrofolate reductase interacts with another essential gene product.</a> Mol. Gen. Genet. 187, 72-78 (1982).</li><li>Okumus, B., Yildiz, S., Toprak, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluidic+and+microfluidic+tools+for+quantitative+systems+biology.">Fluidic and microfluidic tools for quantitative systems biology.</a> Curr Opin Biotech. 25, 30-38 (2014).</li><li>Cho, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+antimicrobial+susceptibility+test+based+on+single-cell+morphological+analysis.">A rapid antimicrobial susceptibility test based on single-cell morphological analysis.</a> Sci. Transl. Med. 17, 267 (2014).</li><li>Hsu, S. B., Waltman, P. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+a+model+of+two+competitors+in+a+chemostat+with+an+external+inhibitor.">Analysis of a model of two competitors in a chemostat with an external inhibitor.</a> SIAM J. Applied Math. , 528-540 (1992).</li><li>Fu, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maximizing+biomass+productivity+and+cell+density+of+Chlorella+vulgaris+by+using+light-emitting+diode-based+photobioreactor.">Maximizing biomass productivity and cell density of Chlorella vulgaris by using light-emitting diode-based photobioreactor.</a> J. Biotech. 161, 242-249 (2012).</li><li>Peabody, V. G. L., Winkler, J., Kao, K. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tools+for+developing+tolerance+to+toxic+chemicals+in+microbial+systems+and+perspectives+on+moving+the+field+forward+and+into+the+industrial+setting.">Tools for developing tolerance to toxic chemicals in microbial systems and perspectives on moving the field forward and into the industrial setting.</a> Curr Opin in Chem Eng. 6, 9-17 (2014).</li></ol>

The authors have nothing to disclose.

저가의 구성 요소에서 낮은 풋 프린트 morbidostat 장치가 설명된다. 장치 등록 약제 내성 수준의 증가는 이전보고 5의 것과 일치한다. 약물 내성의 진화 연구를 위해 설계된 장치는 다른 많은 실험에 잠재적으로 적용 할 수있다. 첫째, 약물 - 유도 된 돌연변이의 광범위한 데이터베이스 임상 적 항생제의 큰 세트에 설정 될 수있다. 예를 들어 다제 내성의 진화 경로 단순히 실험에 사용 된 약물의 수를 증가시킴으로써 조사 될 수있다. 여기에보고 모듈의 주요 장점은 다양한 실험 조건 하에서 대규모 병렬 실험 있도록 유연한 구성 가능성이다. 개념은 마이크로 유체 측정에서 설명되었다하더라도, 조사 파워는 유체 기술은 마이크로 유체 (23)를 결합함으로써 개선 될 수있다. 당 비용측정 (규모의 경제)이 극적으로 감소 시약 소비 감소 노동에 의해 감소된다. 여기서, 하나의 세포 형태 데이터는 미세 유체 플랫폼으로부터 추출 될 수있다. 최근에, 단셀의 미세 형태 테스트가 성공적 미생물학 임상 실험실에서 구현되었으며, 표준 직렬 국물 희석 시험 (24)에 상대적으로 행한다. 미세 유체 장치의 가용성 증가, 결합 기술은 대규모 높은 처리량 실험실 진화 실험을 가능하게한다. 몇 가지 단계는 morbidostat을 실행하는 것이 중요하다. 자기 교반 장치는 자석과 냉각 팬으로 형성되어 있기 때문에, 우선, 그 배양 병에 대한 팬의 축 정렬하기 위해 매우 중요하다. 또한, 배양 바이알과 자석 사이의 간격은 안정된 동작을 보장하는 것이 매우 중요하다. 둘째, 매일의 실험의 시작 부분에서 새로운 문화 바이알로 전환하는 것도 중요하다생물막 형성을 피할 수 있습니다. 그렇지 않으면, 생물막 형성은 2 ~ 3 일 이내에 발생할 수 있습니다. 셋째, 때문에 E. 대장균 시료 일관성을 보장하기 위해 매일의 실험 기간 동안 고정 된 샘플 매일 해동, 상기 미생물로부터 총 세탁을 방지하기 위해 적어도 4 시간의 지연 시간을 설정하는 것이 중요하다. 또한, 하나는 E.을 동결하지 않도록 선택할 수 있습니다 직접 대장균 샘플과 새로운 문화를 시작하는 새로운 문화의 병을 접종 샘플을 사용합니다. 실제적인 세팅에서, 현재의 시스템 설계는 잠재적 용도를 확장하는 여러 한계를 극복해야한다. 전체 시스템의 부피가 현재 하루 소비 매체에 의해 제한된다 (chemostatic 동작 동안, 하나의 배양 바이알은 0.33 시간 -1의 전형적인 희석율에서 하루 중 약 0.5 L를 소비한다). 작업 부피를 줄이기 위해 더욱 최적화 plumbi와 약물 억제 인구 역학 조심 시뮬레이션에 의해 달성 될 수있다NG 25 매개 변수. 마지막 morbidostat 세균 배양 실험 광범위한 분야에 쉽게 적용된다. 예를 들면, 발광 다이오드를 부착함으로써, 시스템은 박테리아 또는 미세 조류 (26)의 진화 모니터링을 가능하게하는 광 생물 반응기로서 재구성 될 수있다. 모듈은 무선 배터리 팩 장치를 조작하여 흡착제로 기밀 용기에서 혐기성 및 호기성 배양을 확장 할 수있다. 다른 예로서, 독소의 농도는 서서히 목표 화학적 27 내성 균주 엔지니어 증가 될 수있다.

최초의 항생제 페니실린의 도입 이후, 미생물의 항생제 내성은 세계적인 건강 문제 (1)로 발전하고있다. 항생제 내성의 획득은 생체 내 향적 연구 할 수 있지만, 이러한 실험의 조건들은 전체에 걸쳐 방출이 제어되지 않는다. 이와 달리, 적응 실험실 진화 항생제 약물 (3)로부터 환경 스트레스 또는 선택 압력 하에서 미생물 종의 분자 적 진화를 공개 할 수있다. 최근 항생제 내성 많은 잘 제어 진화 실험은 항생제 내성 출현을 해명 하였다. 예를 들어, 오스틴의 그룹은 적절하게 설계 미세 유체 복실 환경 4의 급속한 출현을 보여 주었다. 최근에 개발 된 약물 morbidostat 선택 압력 하에서 5,6- 체계적 돌연변이를 유도한다. morbidostat, 미생물 SELEC연속적으로 거의 일정한 집단을 유지하기 위해 항생 물질의 농도를 조절 능 장치는 미생물 7,8에서 사용한 변동 테스트에서 큰 전진한다. 변동 시험에서, 항생제 약물을 고농도로 주입하고, 살아남은 돌연변이 스크리닝하고 계산한다. 대신, morbidostat에서 미생물 끊임없이 도전하고 여러 돌연변이를 획득한다. morbidostat는 chemostat, 미생물 인구 9 희석 동안 지속적으로 영양분을 공급하여 일정한 인구를 유지하고 1950 년 노빅과 Szliard에 의해 발명 문화 장치와 유사하게 작동합니다. 도입 이후, chemostat는 고급 및 개선되었습니다. 현재 마이크로 유체 chemostats은 나노 리터 및 단일 셀 용량에 도달했습니다. 그러나, 이러한 장치는 많은 돌연변이 이벤트 10, 11와 큰 세포 인구를 필요로 적응 진화 실험에 적합하다. 최근, 미니~ 10 ml로 작업 볼륨이 chemostats는 리터 규모의 생물 반응기 및 마이크로 유체 chemostat (12, 13) 사이의 간극을 채우기 위해 개발되었다. 여기에서 우리는 항생제 약물 내성 연구에 대한 설계 및 저가의 사용, 자동 morbidostat을 제시한다. 제안 된 모듈은 최소한의 하드웨어 요구 사항을 가진 미생물 실험실에서 진탕 배양기에서 사용될 수있다. 오픈 소스 펌웨어는 쉽게 대사 공학 3과 적응 진화의 특정 애플리케이션에 맞게 조정된다. 마지막으로, morbidostat 항생제 감수성 검사 (14)에 대한 멀티 플렉스 미세 유체 플랫폼에 통합되어 있습니다.

<table><tbody><tr><td>Environmental Shaker Incubator</td><td>BioSan</td><td>ES-20</td><td></td></tr><tr><td>Arduino Leonardo board</td><td>Arduino</td><td>Leonardo</td><td></td></tr><tr><td>680 Ohm Carbon Resistor</td><td>Digikey</td><td></td><td>Bias resistor for LED</td></tr><tr><td>100k Ohm Carbon resistor</td><td>Digikey</td><td></td><td>Bias resistor for phototransistor</td></tr><tr><td>940 nm light emitting diode</td><td>Bright LED Electronic</td><td>BIR-BM13E4G-2</td><td>Optical density measurement</td></tr><tr><td>940 nm phototransistor</td><td>Kodenshi&amp;nbsp;</td><td>ST-2L2B</td><td>Optical density measurement</td></tr><tr><td>Darlington pair IC Toshiba</td><td>Mouser</td><td>ULN2803APG</td><td>this IC drives micropumps and magnetic stirring unit</td></tr><tr><td>5 V DC brushless fan</td><td>ADDA</td><td>AD0405LX-G70</td><td>spec: 5 V supply voltage and 80&amp;nbsp;mA; available www.jameco.com</td></tr><tr><td>Piezoelectric micropump</td><td>CurieJet</td><td>PS15I-FT-5L</td><td>Pressure &gt; 3&amp;nbsp;kPa; Flow rate &gt;5 ml/min</td></tr><tr><td>Tygon 3350 Tuning</td><td>Saint Gobain</td><td>ABW00001</td><td>ID: 1/32&quot; OD: 3/32&quot; L:50&#039;&amp;nbsp;</td></tr><tr><td>Magnetic Stir bar</td><td>COWIE</td><td></td><td>tapered shape dim: 10&amp;nbsp;mm x 4 mm</td></tr><tr><td>Glass scintillation 20 ml vial</td><td>DGS</td><td></td><td>Pyrex glass 28 mm (diameter) x 61 mm (height)</td></tr><tr><td>Culture vial holder</td><td></td><td></td><td>Custom made from Polyformaldehyde&amp;nbsp;</td></tr><tr><td>Silicone</td><td>Dow Corning</td><td>Sylgald 184</td><td>used to seal the glass vial</td></tr><tr><td>Medium bottle</td><td>VWR</td><td>66022-065</td><td></td></tr><tr><td>Difco M9 minimal salt 5x</td><td>BD</td><td></td><td>Medium</td></tr><tr><td>Cadamino Acid</td><td>BD</td><td></td><td>Medium</td></tr><tr><td>glucose</td><td>Sigma</td><td></td><td></td></tr><tr><td>Agar Bateriological</td><td>Oxoid</td><td></td><td>for agar plate</td></tr><tr><td>Luria Bertani medium</td><td></td><td></td><td></td></tr><tr><td>Inverted microscope</td><td>Leica Microsystems</td><td>Leica DMI-LED</td><td>used for microfluidic measurement Use 40X objective NA = 0.55</td></tr><tr><td>Microscope Incubator</td><td>Live Cell Instrument</td><td>CU-109</td><td>used for microfluidic measurement</td></tr><tr><td>Solenoidal valves</td><td>Pneumadyne</td><td>S10MM-31-12-3</td><td>Normally open 1.3 Watt 12 Vdc</td></tr><tr><td>USB interface card</td><td>Hobby Engineering</td><td>USBIO24-R Digital I/O Module&amp;nbsp;</td><td>for microfluidics measurement</td></tr><tr><td>Air compressor</td><td>Rocker Scientific</td><td>ROCKER 440</td><td>Pressure source for microfluidcs; Max. Pressure 80 psi</td></tr><tr><td>Male luer-lock fittings to 1/8&quot; barb</td><td>ValuePlastics.com</td><td>MTLL230-1</td><td>used for microfluidic control</td></tr><tr><td>1/8&quot; barb to 10-32 threaded port</td><td>ValuePlastics.com</td><td>B-1</td><td>used for microfluidic control</td></tr><tr><td>Female luer-lock fittings to 10-32 threaded port</td><td>ValuePlastics.com</td><td>KFTL-1</td><td>used for microfluidic control</td></tr><tr><td>NPN darlington transistor 500 mA, 40&amp;nbsp;V (2N6427)</td><td>DigiKey.com</td><td>2N6427GOS-ND</td><td>used for microfluidic control</td></tr><tr><td>10 kOhm, carbon film resistor, 0.25 W</td><td>DigiKey.com</td><td>P10KBACT-ND</td><td>used for microfluidic control</td></tr><tr><td>Tantalum capacitor, 10&amp;nbsp;&amp;mu;F, 25 V, 10%</td><td>DigiKey.com</td><td>478-1841-ND</td><td>used for microfluidic control</td></tr><tr><td>Andor CCD camera</td><td>Andor</td><td>Zyla 4.2 Plus SCMOS</td><td>used for microfluidic on chip imaging</td></tr><tr><td>ELISA plate reader</td><td></td><td></td><td></td></tr><tr><td>two component Silicone&amp;nbsp;</td><td>Momentive</td><td>RTV 615</td><td>used for microfluidic chip fabrication</td></tr><tr><td>SU-8 photoresist</td><td>Micrchem</td><td>SU8 2015</td><td>used for microfluidic chip fabrication</td></tr><tr><td>AZ4620 photoresist</td><td>Clariant</td><td>AZ 4620</td><td>used for microfluidic chip fabrication</td></tr><tr><td>Plasma cleaner</td><td>Harrick Plasma</td><td>PDC 32G</td><td>used for microfluidic chip fabrication</td></tr><tr><td>20 Gauge Syringe Needle</td><td>BD</td><td></td><td>used for microfluidic chip fabrication</td></tr><tr><td>Labcycler</td><td>Sensoquest</td><td>Labcycler</td><td>PCR</td></tr><tr><td>DNA polymerase</td><td>Toyobo</td><td>KDO Plus</td><td>PCR amplification</td></tr><tr><td>Trimethoprim</td><td>Sigma</td><td></td><td></td></tr><tr><td>Plate reader</td><td>Biotek</td><td>Synergy H1 hybrid&amp;nbsp;</td><td>antibiotic resistane measurement</td></tr></tbody></table>

design and use of a low cost, automated morbidostat for adaptive evolution of bacteria under antibiotic drug selection

우리는 항생제 내성의 진화 경로를 특성화 저렴한 비용으로, 구성 morbidostat에 대해 설명합니다. morbidostat 연속적 박테리아 증식을 모니터링하여 동적으로 약물 내성을 획득 진화 항상 세균 도전 약물 농도를 조절하는 세균 배양 장치이다. 이 장치는 ~ 10 ML의 작업 볼륨을 갖추고 있으며, 완전 자동화 및 광학 밀도 측정 및 매체 및 약물 전달 마이크로 펌프가 장착되어 있습니다. 플랫폼의 유효성을 확인하기 위해, 우리는 1655 대장균 MG에서 trimethoprim을 저항의 단계적 취득을 측정하고, 세포 형태 및 항생제 감수성을 조사 할 수있는 멀티 플렉스 미세 유체 플랫폼과 장치를 통합. 접근 방식은 항생제 약물 내성의 실험실 연구를 확장 업 및 대사 공학 및 기타 세균 배양 실험에서 변형 개선을 위해 진화를 적응 적하는 확장 가능한 것입니다 수 있습니다.

상술 morbidostat은도 1에 도식화한다. 실험 진화 항생제 감수성 시험 및 세포 형태 검사를 포함하는 일반적인 동작을 morbidostat, E.에서 검증 된 (TMP) trimethoprim을 노출 대장균 MG1655 문화, 일반적으로 사용되는 항생제 약물 5,6. TMP는 약물 내성이 매우 독특한 단계적 증가를 유도하고, 돌연변이 디 하이드로 리덕 타제 (DHFR) 유전자 클러스터를 해결한다. 따라서, TMP는 morbidostat 동작을 검증하기위한 매우 효과적인 표준 약물이다. 매일, 상기 미생물은 소정의 광학 밀도가 임계치를 초과하여 증가하고도 2a에 도시 된 바와 같이, 약물 주입을 유발하는 것으로 예상된다. 약물 주입 성장을 억제 할 것으로 예상 결과, 광학 밀도가 감소된다. 몇몇 시험 런은 최적의 약물 농도를 결정하기 위해 필요할 수있다. 엄지 손가락의 규칙으로, 우리는 increasE로 약물 매체의 농도, 약물 매체 성장을 억제하는 것이 실패 찾은 후 5 배. 실험 전체 과정 후, 매일 샘플을 냉동 및 해동 IC (50), 약제 내성 수준의 정량적 측정 값을 결정하기 위해 사용된다. 도 2b에 플롯은 항생제 약물 저항의 일시적인 증가를 보여줍니다. 약물 저항은 1,500 배 정도 증가에 ~ 1,000 μg의 / ㎖ 이상 ~ 12 실험실 진화 5 이전의 연구 결과와 일치 일, 임상 19을 분리합니다. 마지막 날 돌연변이의 DHFR의 점 돌연변이는 생거 시퀀싱에 의해 측정하고, 표 2에 열거되어있다. 하나의 돌연변이가 프로모터 영역에 위치한 프로모터 영역의 단일 점 돌연변이가 크게 DHFR의 발현 수준을 변경할 수 있음을 나타낸다 발견 효소 20. 위치 49910에서 또 다른 돌연변이 DHFR의 유전자 영역에 위치하고 행위에 가깝습니다DHFR의 필자 사이트 (21) 효소. 한천 플레이트를 포함하는 약물의 선택은 오직 하나의 돌연변이를 부여하는 경향으로 다수의 돌연변이와 약제 내성의 인수는 morbidostat의 유용성을 증명한다. 세포 형태를 더 민감 판독 같이, 항생제 감수성 단일 세포 형태 검사가 병렬로 수행되는, 다중 마이크로 유체 플랫폼 (14).도 3은 다중 마이크로 유체 칩의 디자인을 도시한다. 세균 세포의 현미경 사진 (그림 5) TMP의 하위 억제 농도에 따라 형태를 모두 야생형의 변화와 돌연변이 균주를 알 수있다. 돌연변이 균주는 유의 한 filamentation을 보여줍니다 동안 야생형 균주는 상당한 filamentation을 보여줍니다. 단일 세포 수준에서의 형태 변화는 항생제 내성의 신속한 진단에 사용될 수있다. (4)에 표시 치 도표TMP의 다양한 농도에서 페이지의 성장 곡선. 돌연변이 샘플 항생제 저항의 상당한 증가를 나타낸다. 도 4 온칩 성장 데이터는도 2b에 표시된 플레이트 판독기에서 IC 50 값과 일치한다. <img alt="그림 1" src="/files/ftp_upload/54426/54426fig1.jpg" /> 그림 1. morbidostat의 설계도 morbidostat은 미생물 집단의 광학 밀도를 측정하고, 따라서 약물의 농도를 조절하는 연속 배양 장치이다. 이 장치는 약물 주입 모드와 약물 희석 모드에서 실행됩니다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/54426fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/54426/54426fig2.jpg"/&gt; 도 2 : 성장 곡선 및 항생제 저항성 수준의 증가 피드백에서 (a) 대표 성장 곡선.. 미생물 성장은 그 주입 임계 값 알고리즘에 의해 트리거되는 항생제에 의해 억제된다. 양의 증가 속도가 미리 설정된 임계치 이상의 광학 농도 (OD TH = 0.086)를 제기 할 때, 약물 주입 모드로 전환 장치. 그렇지 않으면, 장치는 약 희석 모드에서 실행. 빨간색과 보라색 화살표는 각각 약물 주사 및 약물 희석 모드로 전환 나타냅니다. (b) 노출 trimethoprim을 12 일 동안 셀 저항 레벨. 이 IC (50)는 항생제 약물 내성의 별개의 단계적 증가를 보여줍니다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/54426fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img al<html> t = &quot;그림 3&quot;SRC = &quot;/ 파일 / ftp_upload / 54426 / 54426fig3.jpg&quot;/&gt; 그림 3 : 세포 형태 및 온 - 칩 항생제 감수성 조사를위한 미세 유체 장치 칩 레이아웃 (가) 현미경 사진.. 녹색 및 청색 구획 각각 성장 및 약물 배지 챔버, 그리고 적색 레이아웃 제어 계층을 나타낸다. 성장 챔버의 크기는 450 μm의 (난) 400 μm의 (w)는 8 μm의 (시간을) X X입니다. 성장 챔버 균로드와 약물 챔버는 TMP로 로딩된다. 스케일 바는 1cm입니다. (b) 동일한 칩의 뷰를 확대. 스케일 바 = 500 μm의. (다) 전 양원의보기를 확대하고 혼합 한 후. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/54426fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> &quot;SRC =&quot;/ 파일 / ftp_upload / 54426 / 54426fig4.jpg &quot;/&gt; 그림 4 : E.의 온 - 칩 성장 곡선 (a) 야생형 선조 균주 및 (일 12시) (b) 돌연변이 균주 : 대장균 TMP의 다양한 농도에 노출. 돌연변이 샘플은 항생제 약물 저항의 상당한 증가를 보여줍니다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/54426fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 5" src="/files/ftp_upload/54426/54426fig5.jpg" /> 그림 5 : 단일 세포 형태 학적 (A - D) TMP의 서브 억제 수준의 치료 후 셀의 밝은 필드 이미지. (d 돌연변이의 부재에서 야생형 세포의 상당한 filamentation (b)를 참고 </strong&gt;). 패널 (전자 - h를) (- D A)의 디지털화 된 이미지입니다. 모든 세균 이미지가 40X 배율 목적으로 CCD 카메라에 의해 촬영되었다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/54426fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> 보충 그림 1 :. 치수 및 문화 유리 병 홀더의 조립 <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/Supplemental_Figure_1.pdf" target="_blank">이 파일을 다운로드하려면 여기를 클릭하십시오.</a> 보충 그림 2 :. LED와 광 검출기의 회로도 <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/Supplementary_Figure_2.PNG" target="_blank">이 파일을 다운로드하려면 여기를 클릭하십시오.</a> 부가 코드 :. 미세 유체 칩에서 얻은 세포 이미지에서 세포 수를 계산하는 사용자 정의 스크립트 <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/renamed_40eb7.pdf" target="_blank">이 파일을 다운로드하려면 여기를 클릭하십시오.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td colspan="2"> 견본 </td><td colspan="11"> TMP 약물 (μg의 / ㎖) </td></tr><tr><td colspan="2"> 하루 1-3 </td><td> 0 </td><td> 0.06 </td><td> 0.12 </td><td> 0.25 </td><td> 0.5 </td><td> 1 </td><td> 이 </td><td> 4 </td><td> 8 </td><td> (16) </td><td> (32) </td></tr><tr><td colspan="2"> 4 일 </td><td> 0 </td><td> 1 </td><td> 이 </td><td> 삼 </td><td> (5) </td><td> (10) </td><td> (20) </td><td> (40) </td><td> (80) </td><td> (160) </td><td> (320) </td></tr><tr><td colspan="2"> 하루 5-7 </td><td> 0 </td><td> 이 </td><td> 4 </td><td> 8 </td> &lt;TD&gt; (15) </td><td> (30) </td><td> (60) </td><td> (120) </td><td> (240) </td><td> 480 </td><td> 960 </td></tr><tr><td colspan="2"> 하루 8 ~ 12 </td><td> 0 </td><td> 삼 </td><td> (7) </td><td> (15) </td><td> (30) </td><td> (60) </td><td> (125) </td><td> (250) </td><td> (500) </td><td> 1,000 </td><td> 2,000 </td></tr></tbody></table> 표 1. μg의 / ㎖ 단위로 측정 플레이트 판독기 약물 농도에 IC (50)를 결정하는 데 사용 약물 농도는 매일 냉동 샘플에 대해 표시된다. 세포가 높은 약품 내성을 같이 사용 된 약물 농도는 그에 따라 증가한다. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 아니 </td><td> 위치 </td><td> SNP </td><td> 노트 </td></tr><tr><td> 1 </td><td> 49894 </td><td> C-&gt; T </td><tD&gt; DHFR 유전자 </td></tr><tr><td> 이 </td><td> 49910 </td><td> T-&gt;를 </td><td> DHFR 유전자 </td></tr><tr><td> 삼 </td><td> 49795 </td><td> C-&gt; T </td><td> DHFR 프로모터 </td></tr></tbody></table> 표 2. 생거 시퀀싱에 의해 식별 DHFR 변이 대표적인 시퀀스 데이터는 마지막 날 돌연변이 (12 일)의 3 DHFR 점 돌연변이를 나타낸다. 프로모터 유전자 영역은 각각 하나와 2 개의 SNP를 포함한다. PCR을에 사용되는 순방향 및 역방향 프라이머 3&#39;TCTAGAGAGATCATTACCGA GGACCGCGAACATCTGTCAT5 &#39;와 3&#39;ACTAGT TTACCGCCGCTC CAGAATCTCAA AGCAATAGCTG5&#39;이었다.

Watch this Scientific Journal Video about Design and Use of a Low Cost, Automated Morbidostat for Adaptive Evolution of Bacteria Under Antibiotic Drug Selection at JoVE.com

Design and Use of a Low Cost, Automated Morbidostat for Adaptive Evolution of Bacteria Under Antibiotic Drug Selection

We describe a low cost, configurable morbidostat that enables the characterization of antibiotic drug resistance by dynamically adjusting the drug concentration. The device can be integrated with a multiplexed microfluidic platform. The approach can be scaled up for laboratory antibiotic drug resistance studies.

디자인과 낮은 비용의 사용, 자동 Morbidostat 박테리아의 적응 진화에 대한 항생제 약물 선택에서

We describe a low cost, configurable morbidostat for characterizing the evolutionary pathway of antibiotic resistance. The morbidostat is a bacterial ...

design-use-low-cost-automated-morbidostat-for-adaptive-evolution

Nanyang Technological University

Research

JoVE Journal

Genetics

9.6K 조회수.  National Tsing Hua University. We describe a low cost, configurable morbidostat that enables the characterization of antibiotic drug resistance by dynamically adjusting the drug concentration. The device can be integrated with a multiplexed microfluidic platform. The approach can be scaled up for laboratory antibiotic drug resistance studies.

비디오: Design and Use of a Low Cost, Automated Morbidostat for Adaptive Evolution of Bacteria Under Antibiotic Drug Selection

Procedure for Adaptive Laboratory Evolution of Microorganisms Using a Chemostat

Natural evolution involves genetic diversity such as environmental change and a selection between small populations. Adaptive laboratory evolution (ALE) refers to the experimental situation in which evolution is observed using living organisms under controlled conditions and stressors; organisms are thereby artificially forced to make evolutionary changes. Microorganisms are subject to a variety of stressors in the environment and are capable of regulating certain stress-inducible proteins to increase their chances of survival. Naturally occurring spontaneous mutations bring about changes in a microorganism's genome that affect its chances of survival. Long-term exposure to chemostat culture provokes an accumulation of spontaneous mutations and renders the most adaptable strain dominant. Compared to the colony transfer and serial transfer methods, chemostat culture entails the highest number of cell divisions and, therefore, the highest number of diverse populations. Although chemostat culture for ALE requires more complicated culture devices, it is less labor intensive once the operation begins. Comparative genomic and transcriptome analyses of the adapted strain provide evolutionary clues as to how the stressors contribute to mutations that overcome the stress. The goal of the current paper is to bring about accelerated evolution of microorganisms under controlled laboratory conditions.

Here, we present a protocol to obtain adaptive laboratory evolution of microorganisms under conditions using chemostat culture. Also, genomic analysis of the evolved strain is discussed.

Chemostat를 사용하여 미생물의 적응 연구소 발전을위한 절차

Natural evolution involves genetic diversity such as environmental change and a selection between small populations. Adaptive laboratory evolution (ALE) ...

연구

유전학

Testing the Role of Multicopy Plasmids in the Evolution of Antibiotic Resistance

Multicopy plasmids are extremely abundant in prokaryotes but their role in bacterial evolution remains poorly understood. We recently showed that the increase in gene copy number per cell provided by multicopy plasmids could accelerate the evolution of plasmid-encoded genes. In this work, we present an experimental system to test the ability of multicopy plasmids to promote gene evolution. Using simple molecular biology methods, we constructed a model system where an antibiotic resistance gene can be inserted into Escherichia coli MG1655, either in the chromosome or on a multicopy plasmid. We use an experimental evolution approach to propagate the different strains under increasing concentrations of antibiotics and we measure survival of bacterial populations over time. The choice of the antibiotic molecule and the resistance gene is so that the gene can only confer resistance through the acquisition of mutations. This &#34;evolutionary rescue&#34; approach provides a simple method to test the potential of multicopy plasmids to promote the acquisition of antibiotic resistance. In the next step of the experimental system, the molecular bases of antibiotic resistance are characterized. To identify mutations responsible for the acquisition of antibiotic resistance we use deep DNA sequencing of samples obtained from whole populations and clones. Finally, to confirm the role of the mutations in the gene under study, we reconstruct them in the parental background and test the resistance phenotype of the resulting strains.

Here we present an experimental method to test the role of multicopy plasmids in the evolution of antibiotic resistance.

항생제 내성의 진화에서 다중 플라스 미드의 역할 테스트

Multicopy plasmids are extremely abundant in prokaryotes but their role in bacterial evolution remains poorly understood. We recently showed that the ...

Designing Automated, High-throughput, Continuous Cell Growth Experiments Using eVOLVER

Continuous culture methods enable cells to be grown under quantitatively controlled environmental conditions, and are thus broadly useful for measuring fitness phenotypes and improving our understanding of how genotypes are shaped by selection. Extensive recent efforts to develop and apply niche continuous culture devices have revealed the benefits of conducting new forms of cell culture control. This includes defining custom selection pressures and increasing throughput for studies ranging from long-term experimental evolution to genome-wide library selections and synthetic gene circuit characterization. The eVOLVER platform was recently developed to meet this growing demand: a continuous culture platform with a high degree of scalability, flexibility, and automation. eVOLVER provides a single standardizing platform that can be (re)-configured and scaled with minimal effort to perform many different types of high-throughput or multi-dimensional growth selection experiments. Here, a protocol is presented to provide users of the eVOLVER framework a description for configuring the system to conduct a custom, large-scale continuous growth experiment. Specifically, the protocol guides users on how to program the system to multiplex two selection pressures &#8212; temperature and osmolarity &#8212; across many eVOLVER vials in order to quantify fitness landscapes of Saccharomyces cerevisiae mutants at fine resolution. We show how the device can be configured both programmatically, through its open-source web-based software, and physically, by arranging fluidic and hardware layouts. The process of physically setting up the device, programming the culture routine, monitoring and interacting with the experiment in real-time over the internet, sampling vials for subsequent offline analysis, and post experiment data analysis are detailed. This should serve as a starting point for researchers across diverse disciplines to apply eVOLVER in the design of their own complex and high-throughput cell growth experiments to study and manipulate biological systems.

The eVOLVER framework enables high-throughput continuous microbial culture with high resolution and dynamic control over experimental parameters. This protocol demonstrates how to apply the system to conduct a complex fitness experiment, guiding users on programming automated control over many individual cultures, measuring, collecting, and interacting with experimental data in real-time.

에 버 버를 사용 하 여 자동화 된 고 처리량, 지속적인 세포 성장 실험 설계

Continuous culture methods enable cells to be grown under quantitatively controlled environmental conditions, and are thus broadly useful for measuring ...

Quantification of Plasmid-Mediated Antibiotic Resistance in an Experimental Evolution Approach

Plasmids play a major role in microbial ecology and evolution as vehicles of lateral gene transfer and reservoirs of accessory gene functions in microbial populations. This is especially the case under rapidly changing environments such as fluctuating antibiotics exposure. We recently showed that plasmids maintain antibiotic resistance genes in Escherichia coli without positive selection for the plasmid presence. Here we describe an experimental system that allows following both the plasmid genotype and phenotype in long-term evolution experiments. We use molecular techniques to design a model plasmid that is subsequently introduced to an experimental evolution batch system approach in an E. coli host. We follow the plasmid frequency over time by applying replica plating of the E. coli populations while quantifying the antibiotic resistance persistence. In addition, we monitor the conformation of plasmids in host cells by analyzing the extent of plasmid multimer formation by plasmid nicking and agarose gel electrophoresis. Such an approach allows us to visualize not only the genome size of evolving plasmids but also their topological conformation-a factor highly important for plasmid inheritance. Our system combines molecular strategies with traditional microbiology approaches and provides a set-up to follow plasmids in bacterial populations over a long time. The presented approach can be applied to study a wide range of mobile genetic elements in the future.

Our experimental approach provides a strategy to follow plasmid abundance and antibiotic resistance over time in bacterial populations.

실험적 진화 접근법에서 플라스미드 매개 항생제 내성의 정량화

Plasmids play a major role in microbial ecology and evolution as vehicles of lateral gene transfer and reservoirs of accessory gene functions in microbial ...

Daily Transfers, Archiving Populations, and Measuring Fitness in the Long-Term Evolution Experiment with Escherichia coli

The Long-Term Evolution Experiment (LTEE) has followed twelve populations of Escherichia coli as they have adapted to a simple laboratory environment for more than 35 years and 77,000 bacterial generations. The setup and procedures used in the LTEE epitomize reliable and reproducible methods for studying microbial evolution. In this protocol, we first describe how the LTEE populations are transferred to fresh medium and cultured each day. Then, we describe how the LTEE populations are regularly checked for possible signs of contamination and archived to provide a permanent frozen "fossil record" for later study. Multiple safeguards included in these procedures are designed to prevent contamination, detect various problems when they occur, and recover from disruptions without appreciably setting back the progress of the experiment. One way that the overall tempo and character of evolutionary changes are monitored in the LTEE is by measuring the competitive fitness of populations and strains from the experiment. We describe how co-culture competition assays are conducted and provide both a spreadsheet and an R package (fitnessR) for calculating relative fitness from the results. Over the course of the LTEE, the behaviors of some populations have changed in interesting ways, and new technologies like whole-genome sequencing have provided additional avenues for investigating how the populations have evolved. We end by discussing how the original LTEE procedures have been updated to accommodate or take advantage of these changes. This protocol will be useful for researchers who use the LTEE as a model system for studying connections between evolution and genetics, molecular biology, systems biology, and ecology. More broadly, the LTEE provides a tried-and-true template for those who are beginning their own evolution experiments with new microbes, environments, and questions.

Daily Transfers, Archiving Populations, and Measuring Fitness in the Long-Term Evolution Experiment with Escherichia coli

This protocol describes how to maintain the Escherichia coli Long-Term Evolution Experiment (LTEE) by performing its daily transfers and periodic freeze-downs and how to conduct competition assays to measure fitness improvements in evolved bacteria. These procedures can serve as a template for researchers starting their own microbial evolution experiments.

Daily Transfers, Archiving Populations, and Measuring Fitness in the Long-Term Evolution Experiment with Escherichia coli (대장균을 사용한 장기 진화 실험에서의 일일 이동, 인구 보관 및 적합성 측정)

The Long-Term Evolution Experiment (LTEE) has followed twelve populations of Escherichia coli as they have adapted to a simple laboratory environment for ...

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

The efficient generation of genetic diversity represents an invaluable molecular tool that can be used to label DNA synthesis, to create unique molecular signatures, or to evolve proteins in the laboratory. Here, we present a protocol that allows the generation of large (>1011) mutant libraries for a given target sequence. This method is based on replication of a ColE1 plasmid encoding the desired sequence by a low-fidelity variant of DNA polymerase I (LF-Pol I). The target plasmid is transformed into a mutator strain of E. coli and plated on solid media, yielding between 0.2 and 1 mutations/kb, depending on the location of the target gene. Higher mutation frequencies are achieved by iterating this process of mutagenesis. Compared to alternative methods of mutagenesis, our protocol stands out for its simplicity, as no cloning or PCR are involved. Thus, our method is ideal for mutational labeling of plasmids or other Pol I templates or to explore large sections of sequence space for the evolution of activities not present in the original target. The tight spatial control that PCR or randomized oligonucleotide-based methods offer can also be achieved through subsequent cloning of specific sections of the library. Here we provide protocols showing how to create a random mutant library and how to establish drug-based selections in E. coli to identify mutants exhibiting new biochemical activities.

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

Here we demonstrate a simple protocol to create a random mutant library for a given target sequence. We show how this method, which is performed in vivo in Escherichia coli, can be coupled with functional selections to evolve new enzymatic activities.

에서 단백질의 감독 진화에 대한 돌연변이 유발 및 기능 선택 프로토콜 E. 대장균</em

The efficient generation of genetic diversity represents an invaluable molecular tool that can be used to label DNA synthesis, to create unique molecular ...

생물학

The Use of Chemostats in Microbial Systems Biology

Cells regulate their rate of growth in response to signals from the external world. As the cell grows, diverse cellular processes must be coordinated including macromolecular synthesis, metabolism and ultimately, commitment to the cell division cycle. The chemostat, a method of experimentally controlling cell growth rate, provides a powerful means of systematically studying how growth rate impacts cellular processes - including gene expression and metabolism - and the regulatory networks that control the rate of cell growth. When maintained for hundreds of generations chemostats can be used to study adaptive evolution of microbes in environmental conditions that limit cell growth. We describe the principle of chemostat cultures, demonstrate their operation and provide examples of their various applications. Following a period of disuse after their introduction in the middle of the twentieth century, the convergence of genome-scale methodologies with a renewed interest in the regulation of cell growth and the molecular basis of adaptive evolution is stimulating a renaissance in the use of chemostats in biological research.

Cell growth rate is a regulated process and a primary determinant of cell physiology. Continuous culturing using chemostats enables extrinsic control of cell growth rate by nutrient limitation facilitating the study of molecular networks that control cell growth and how those networks evolve to optimize cell growth.

미생물 시스템 생물학의 Chemostats의 사용

Cells regulate their rate of growth in response to signals from the external world. As the cell grows, diverse cellular processes must be coordinated ...

Design and Use of Multiplexed Chemostat Arrays

Chemostats are continuous culture systems in which cells are grown in a tightly controlled, chemically constant environment where culture density is constrained by limiting specific nutrients.1,2 Data from chemostats are highly reproducible for the measurement of quantitative phenotypes as they provide a constant growth rate and environment at steady state. For these reasons, chemostats have become useful tools for fine-scale characterization of physiology through analysis of gene expression3-6 and other characteristics of cultures at steady-state equilibrium.7 Long-term experiments in chemostats can highlight specific trajectories that microbial populations adopt during adaptive evolution in a controlled environment. In fact, chemostats have been used for experimental evolution since their invention.8 A common result in evolution experiments is for each biological replicate to acquire a unique repertoire of mutations.9-13 This diversity suggests that there is much left to be discovered by performing evolution experiments with far greater throughput. 
We present here the design and operation of a relatively simple, low cost array of miniature chemostats&mdash;or ministats&mdash;and validate their use in determination of physiology and in evolution experiments with yeast. This approach entails growth of tens of chemostats run off a single multiplexed peristaltic pump. The cultures are maintained at a 20 ml working volume, which is practical for a variety of applications. It is our hope that increasing throughput, decreasing expense, and providing detailed building and operation instructions may also motivate research and industrial application of this design as a general platform for functionally characterizing large numbers of strains, species, and growth parameters, as well as genetic or drug libraries.

We developed and validated a small-footprint array of miniature chemostats built from readily available parts for low cost. Physiological and experimental evolution results were similar to larger volume chemostats. The ministat array provides a compact, inexpensive, and accessible platform for traditional chemostat experiments, functional genomics, and chemical screening applications.

다중 Chemostat 배열의 설계 및 사용

Chemostats are continuous culture systems in which cells are grown in a tightly controlled, chemically constant environment where culture density is ...

An Automated Culture System for Use in Preclinical Testing of Host-Directed Therapies for Tuberculosis

Mycobacterium tuberculosis (Mtb), the causative agent of tuberculosis (TB), was the most significant infectious disease killer globally until the advent of COVID-19. Mtb has evolved to persist in its intracellular environment, evade host defenses, and has developed resistance to many anti-tubercular drugs. One approach to solving resistance is identifying existing&#160;approved drugs that will boost the host immune response to Mtb. These drugs could then be repurposed as adjunctive host-directed therapies (HDT) to shorten treatment time and help overcome antibiotic resistance.
Quantification of intracellular Mtb growth in macrophages is a crucial aspect of assessing potential HDT. The gold standard for measuring Mtb growth is counting colony-forming units (CFU) on agar plates. This is a slow, labor-intensive assay that does not lend itself to rapid screening of drugs. In this protocol, an automated, broth-based culture system, which is more commonly used to detect Mtb in clinical specimens, has been adapted for preclinical screening of host-directed therapies. The capacity of the liquid culture assay system to investigate intracellular Mtb growth in macrophages treated with HDT was evaluated. The HDTs tested for their ability to inhibit Mtb growth were all-trans Retinoic acid (AtRA), both in solution and encapsulated in poly(lactic-co-glycolic acid) (PLGA) microparticles and the combination of interferon-gamma and linezolid. The advantages of this automated liquid culture-based technique over the CFU method include simplicity of setup, less labor-intensive preparation, and faster time to results (5-12 days compared to 21 days or more for agar plates).

Rapid and efficient quantification of intracellular M. tuberculosis growth is crucial for pursuing improved therapies against tuberculosis (TB). This protocol describes a broth-based colorimetric detection assay using an automated liquid culture system to quantify Mtb growth in macrophages treated with candidate host-directed therapies.

결핵에 대한 숙주 유도 요법의 전임상 테스트에 사용하기 위한 자동화된 배양 시스템

Mycobacterium tuberculosis (Mtb), the causative agent of tuberculosis (TB), was the most significant infectious disease killer globally until the advent ...

면역학 및 감염병학

Monitoring Intraspecies Competition in a Bacterial Cell Population by Cocultivation of Fluorescently Labelled Strains

Many microorganisms such as bacteria proliferate extremely fast and the populations may reach high cell densities. Small fractions of cells in a population always have accumulated mutations that are either detrimental or beneficial for the cell. If the fitness effect of a mutation provides the subpopulation with a strong selective growth advantage, the individuals of this subpopulation may rapidly outcompete and even completely eliminate their immediate fellows. Thus, small genetic changes and selection-driven accumulation of cells that have acquired beneficial mutations may lead to a complete shift of the genotype of a cell population. Here we present a procedure to monitor the rapid clonal expansion and elimination of beneficial and detrimental mutations, respectively, in a bacterial cell population over time by cocultivation of fluorescently labeled individuals of the Gram-positive model bacterium Bacillus subtilis. The method is easy to perform and very illustrative to display intraspecies competition among the individuals in a bacterial cell population.

Bacteria may accumulate either detrimental or beneficial mutations during their lifetime. In a population of cells individuals that have accumulated beneficial mutations may rapidly outcompete their fellows. Here we present a simple procedure to visualize intraspecies competition in a bacterial cell population over time using fluorescently labeled individuals.&#160;

디자인과 낮은 비용의 사용, 자동 Morbidostat 박테리아의 적응 진화에 대한 항생제 약물 선택에서

요약

더 많은 비디오 탐색

이 비디오의 챕터