We thank Dr. Tadashi Koyama for technical help. This work was supported in part by JSPS KAKENHI Grant Numbers 23249045, 15K09211, 15K19172; a grant to the Respiratory Failure Research Group from the Ministry of Health, Labour and Welfare, Japan; a grant for research on allergic disease and immunology, Japan.

1. 준비 및 문화 폐 상피 세포의 <ol><li> 둘 베코 변형 이글 중간 (DMEM)에서 배양 A549 인간 폐 상피 세포 (접착 세포 라인) 100 μg의가 / ㎖ 스트렙토 마이신, 10 % 우 태아 혈청 (FBS), 100 IU / ml의 페니실린, 및. </li><li> 분리 한 배양 접시에서 세포 배양 배지를 버리고, 5 회 세척 - 포스페이트 완충 식염수 10 ㎖ (PBS). 세척 후 즉시 PBS를 대기음. </li><li> 3 분 동안 CO 2 2ml의 트립신 / 에틸렌 디아민 테트라 아세트산 (EDTA) (0.05 %)를 첨가하고, 37 ℃에서 5 % 부화. </li><li> 세포 배양액을 원심 분리를 150 × g에서 4 분 동안 RT에서 튜브를 포함하는 원심 분리 튜브에 세포를 수집한다. </li><li> 세포를 세포 배양 배지 2 ㎖에 재현 탁하고 세포 펠렛을 계산하기위한 샘플을 제거한다. 세포 생존을 확인 트리 판 블루 염색과 혈구를 이용하여 세포의 수를 계산. </li><li> 종자에 A549 세포0.5의 밀도로 10cm 폴리스티렌 플레이트 - 겔 수축 검정 용 배지 10 ㎖, 1.0 × 106 세포 / 접시. 0.5의 밀도로 6 웰 폴리스티렌 플레이트에 세포를 시드 - 1.0 × 105 세포 / 웰으로 EMT 확인 용 배지 2 ㎖. 24 시간 동안 CO 2, 37 ℃에서 세포를 인큐베이션하고, 5 %. </li></ol> 2. EMT 절차 <ol><li> 단계 1.6에서 시드 젤의 수축 분석에 대한 판에 TGF-β1 (5 μg의 / ㎖)의 10 μL와 TNF-α의 10 μL (10 μg의 / ㎖)를 추가합니다. 단계 1.6에서 시드 EMT 확인에 대한 판에 TGF-β1 (5 μg의 / ㎖)의 2 μL 및 TNF-α의 2 μL (10 μg의 / ㎖)를 추가합니다. 48 시간 동안 CO 2를 37 ° C에서 품어 5 %. </li></ol> PCR 및 웨스턴 블로 팅에 의한 EMT 절차 3. 확인 <ol><li> 위상차 현미경을 사용하여 처리 된 세포의 (모양을 스핀들에 자갈 돌 등으로부터) 형태의 변화를 확인합니다. 참고 : 규범을알 A549 세포는 상피 세포의 특징 인 자갈 돌 같은 삼각형 모양의 외관을 가지고 있지만, TGF-β1 및 TNF-α로 자극 한 후, 세포를 길게 나타나 스핀들 즉 중간 엽 세포 14,15과 유사한 형상. </li><li> 이러한 E-cadherin의 같은 상피 마커의 발현을 평가하고, PCR 또는 웨스턴 블롯 이용한 N-cadherin의, 멘틴 및 α-평활근 액틴과 같은 중간 엽 마커. <ol><li> RNA 추출 키트 (16)를 사용하여 세포로부터 전체 RNA를 추출하고 제조 업체의 프로토콜에 따라 역전사 효소 (17)를 사용하여 cDNA를 합성. </li><li> 실시간 PCR 시스템 (18) 및 제조자의 지시에 따라 모노머 시아닌 염료 PCR 키트를 사용하여 mRNA 수준의 발현을 측정한다. GAPDH에 대한 특이 적 프라이머 (글리 세르 알데히드 -3- 포스페이트 탈수소 효소), ACTA2 (알파 - 액틴 2) CDH1 (헤린-1, E-cadherin의) 및 VIM (멘틴)는 표 1에 나타내었다 </st&gt; 룽. </li><li> 를 Lyse 용균 완충액 (표 2) 1 % 프로테아제 억제제 칵테일을 함유하는 용액을 사용하여 세포. 단백질 분석 키트 (19, 20)를 사용하여 모든 샘플의 단백질 농도를 측정하고, 폴리 아크릴 아미드 겔에 단백질의 동일한 양이 적용된다. <ol><li> SDS 겔 전기 영동하고 PVDF 막 (21)에 단백질의 반 건조 전송을 수행합니다. 2 시간 - 1 버퍼를 차단에서 일차 항체와 멤브레인을 품어. 배양 후, 세척 버퍼로 두 번 멤브레인을 씻고 두 번째 항체 막 1 시간을 품어. 참고 :이 연구에 사용 된 항체 희석을위한 재료 / 장비의 표를 참조하십시오. 버퍼를 차단의 구성 요소에 대한 표 2를 참조하십시오. </li><li> 두 번 세척 버퍼 막 씻으십시오. 감기 CCD 카메라 11,23를 사용하여 웨스턴 블로 팅 검출 키트 (22) 멤브레인의 사진을 촬영합니다. </li></ol></li></ol></li></ol> 4. 평가 EMT 젤 수축 분석 <ol><li> 세포 배양 용기로부터의 조정 배지를 흡인하고, 5 잘 세척 - 죽은 세포를 제거하기 위해 PBS 10 ㎖. 세척 후 즉시 PBS를 대기음. </li><li> 3 분 동안 CO 2를 0.05 % 트립신 / EDTA 2 ㎖를 추가하고 37 ° C에서 품어 5 %. </li><li> DMEM 150 × g에서 4 분 동안 RT에서 트립신 억제제 (1 ㎎ / ㎖), 원심 튜브를 보충 함유하는 원심 분리 튜브에 세포를 수집한다. </li><li> 증류수로 1 형 콜라겐 겔을 혼합 한 DMEM을 농축하여 4 × 1.75 ㎎ / ㎖의 콜라겐 농도를 달성하기 위해 볼륨을 조절하고, 1 × DMEM 농도. 이 단계 동안 얼음에 젤 매체를 유지해야합니다. 주 : 겔 배지 6 ㎖의하려면, 잘 3.5 mL의 1 형 콜라겐 겔 (3 ㎎ / ㎖) 1.5 × 4 농축 DMEM ml의 증류수 1ml를 혼합. </li><li> PBS 500 μL에있는 세포 펠렛을 resuspend 세포 계수에 대한 샘플을 제거합니다. 카운트트리 판 블루 염색하여 혈구를 이용하여 세포의 수는 세포 생존을 확인한다. </li><li> 부드럽게 세포 3.0 × 105 세포 / 웰의 밀도 (6.0 × 105 세포 / ㎖)을 달성하지만, 신속하게 겔화없이 피펫 팅하여 혼합 볼륨을 조정 겔 배지를 추가한다. </li><li> 스트레이트 원통 형상을 신속하고 신중 24- 웰 미처리 플레이트의 각 웰에 0.5 ml의 혼합물을 분배. 기포가 젤 (그림 1A)를 오염 할 수 있도록하지 않도록주의하십시오. 세포를 포함하는 겔 매체는 점성 쉽게 잘에서 젤 및 양식 초승달 모양 할 수 있습니다. </li><li> 37 ℃ 세포 배양기에서 15 분 동안 플레이트를 인큐베이션, 5 % CO 2, 95 % 습도 완전히 겔. </li><li> 한 방향으로 원주를 그리는 방법으로 멸균 주걱을 움직여서 깨지 않고 접시에서 겔을 분리. 주걱을 사용하여 부드럽게 60mm 조직 배양 접시에 겔을 전송할또는 TGF-β1 (5 NG / mL) 및 TNF-α (10 ng의 / ㎖)이없는 DMEM / 1 % FBS 함유하는 5 ㎖. </li><li> 부드럽게 젤이 매체에 떠 보장하기 위해 요리를 흔들어. 37 ° C, 5 % CO 2 및 95 % 습도에서 세포 배양기에서 인큐베이션. </li></ol> 젤 크기의 5. 측정 <ol><li> 영상 분석 시스템을 사용하여 0, 24, 48, 72 시간 후, 콜라겐 겔 크기를 측정한다. <ol><li> 겔 문서 시스템 (그림 2A)를 켜고 빛을 차단 캐비닛에 요리를 시작했습니다. 그런 다음 캐비닛의 요리의 뚜껑을 벗어. </li><li> 관련 겔 분석 소프트웨어를 엽니 다. 캐비닛의 젤의 이미지를 표시하려면 메뉴 바에서 &quot;이미지 수집 버튼&quot;을 클릭합니다. 그 후, 젤 (그림 2B)의 사진을 찍을 메뉴 바에서 &quot;획득&quot;을 클릭합니다. </li><li> 측정 영역을 메뉴 표시 줄 (그림 2C)에서 &quot;검색 버튼&quot;을 클릭하고 조정 (노란색 원 전마우스를 드래그하여 n 개의 그림 2C). 그런 다음, 메뉴 바의 &quot;자동 검색 버튼&quot;을 클릭합니다 (그림 2D에서 버튼을 참조). 이 소프트웨어는 자동으로 히트 맵 (그림 2D)를 보여주는 젤을 감지합니다. </li><li> 화상 처리에 의한 젤의 윤곽을 추출하고 개요 (그림 2E)에 의해 둘러싸인 영역을 계산하기 위해 &quot;OK&quot;를 클릭합니다. 면적을 산출 한 후, 산출 된 영역이 별도의 팝업 창에 표시된다. 참고 : 젤 이미징 동안 서로 겹치는 경우, 부드럽게 멸균 피펫 팁을 사용하여 젤을 이동합니다. </li></ol></li></ol>

<ol>
	<li>Wynn, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+and+molecular+mechanisms+of+fibrosis.">Cellular and molecular mechanisms of fibrosis.</a> The Journal of pathology. 214, 199-214 (2008).</li><li>Hardie, W. D., Glasser, S. W., Hagood, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+in+the+pathogenesis+of+lung+fibrosis.">Emerging concepts in the pathogenesis of lung fibrosis.</a> The American journal of pathology. 175, 3-16 (2009).</li><li>Kovacic, J. C., Mercader, N., Torres, M., Boehm, M., Fuster, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-to-mesenchymal+and+endothelial-to-mesenchymal+transition:+from+cardiovascular+development+to+disease.">Epithelial-to-mesenchymal and endothelial-to-mesenchymal transition: from cardiovascular development to disease.</a> Circulation. 125, 1795-1808 (2012).</li><li>Thiery, J. P., Acloque, H., Huang, R. Y., Nieto, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transitions+in+development+and+disease.">Epithelial-mesenchymal transitions in development and disease.</a> Cell. 139, 871-890 (2009).</li><li>Kalluri, R., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+basics+of+epithelial-mesenchymal+transition.">The basics of epithelial-mesenchymal transition.</a> The Journal of clinical investigation. 119, 1420-1428 (2009).</li><li>Forino, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TGFbeta1+induces+epithelial-mesenchymal+transition,+but+not+myofibroblast+transdifferentiation+of+human+kidney+tubular+epithelial+cells+in+primary+culture.">TGFbeta1 induces epithelial-mesenchymal transition, but not myofibroblast transdifferentiation of human kidney tubular epithelial cells in primary culture.</a> International journal of experimental pathology. 87, 197-208 (2006).</li><li>Yang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Participation+of+miR-200+in+pulmonary+fibrosis.">Participation of miR-200 in pulmonary fibrosis.</a> The American journal of pathology. 180, 484-493 (2012).</li><li>Reynolds, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lung+inflammation+and+fibrosis:+an+alveolar+macrophage-centered+perspective+from+the+1970s+to+1980s.">Lung inflammation and fibrosis: an alveolar macrophage-centered perspective from the 1970s to 1980s.</a> American journal of respiratory and critical care medicine. 171, 98-102 (2005).</li><li>Camara, J., Jarai, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition+in+primary+human+bronchial+epithelial+cells+is+Smad-dependent+and+enhanced+by+fibronectin+and+TNF-alpha.">Epithelial-mesenchymal transition in primary human bronchial epithelial cells is Smad-dependent and enhanced by fibronectin and TNF-alpha.</a> Fibrogenesis &amp; tissue repair. 3, 2 (2010).</li><li>Kamitani, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+stimulation+with+TGF-beta1+and+TNF-alpha+induces+epithelial+mesenchymal+transition+in+bronchial+epithelial+cells.">Simultaneous stimulation with TGF-beta1 and TNF-alpha induces epithelial mesenchymal transition in bronchial epithelial cells.</a> International archives of allergy and immunology. 155, 119-128 (2011).</li><li>Mikami, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lymphotoxin+beta+receptor+signaling+induces+IL-8+production+in+human+bronchial+epithelial+cells.">Lymphotoxin beta receptor signaling induces IL-8 production in human bronchial epithelial cells.</a> PloS one. 9, e114791 (2014).</li><li>Yamauchi, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+necrosis+factor-alpha+enhances+both+epithelial-mesenchymal+transition+and+cell+contraction+induced+in+A549+human+alveolar+epithelial+cells+by+transforming+growth+factor-beta1.">Tumor necrosis factor-alpha enhances both epithelial-mesenchymal transition and cell contraction induced in A549 human alveolar epithelial cells by transforming growth factor-beta1.</a> Experimental lung research. 36, 12-24 (2010).</li><li>Grinnell, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fibroblasts,+myofibroblasts,+and+wound+contraction.">Fibroblasts, myofibroblasts, and wound contraction.</a> The Journal of cell biology. 124, 401-404 (1994).</li><li>Ramos, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FGF-1+reverts+epithelial-mesenchymal+transition+induced+by+TGF-{beta}1+through+MAPK/ERK+kinase+pathway+.">FGF-1 reverts epithelial-mesenchymal transition induced by TGF-{beta}1 through MAPK/ERK kinase pathway .</a> American journal of physiology. Lung cellular and molecular physiology. 299, L222-L231 (2010).</li><li>Ren, Z. X., Yu, H. B., Li, J. S., Shen, J. L., Du, W. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suitable+parameter+choice+on+quantitative+morphology+of+A549+cell+in+epithelial-mesenchymal+transition.">Suitable parameter choice on quantitative morphology of A549 cell in epithelial-mesenchymal transition.</a> Bioscience reports. 35, (2015).</li><li>Brinkmann, V., Kinzel, B., Kristofic, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TCR-independent+activation+of+human+CD4++45RO-+T+cells+by+anti-CD28+plus+IL-2:+Induction+of+clonal+expansion+and+priming+for+a+Th2+phenotype.">TCR-independent activation of human CD4+ 45RO- T cells by anti-CD28 plus IL-2: Induction of clonal expansion and priming for a Th2 phenotype.</a> Journal of immunology. 156, 4100-4106 (1996).</li><li>Krug, M. S., Berger, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=First-strand+cDNA+synthesis+primed+with+oligo(dT).">First-strand cDNA synthesis primed with oligo(dT).</a> Methods in enzymology. 152, 316-325 (1987).</li><li>Morozumi, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+detection+of+pathogens+in+clinical+samples+from+patients+with+community-acquired+pneumonia+by+real-time+PCR+with+pathogen-specific+molecular+beacon+probes.">Simultaneous detection of pathogens in clinical samples from patients with community-acquired pneumonia by real-time PCR with pathogen-specific molecular beacon probes.</a> Journal of clinical microbiology. 44, 1440-1446 (2006).</li><li>Smith, P. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measurement+of+protein+using+bicinchoninic+acid.">Measurement of protein using bicinchoninic acid.</a> Analytical biochemistry. 150, 76-85 (1985).</li><li>Wiechelman, K. J., Braun, R. D., Fitzpatrick, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigation+of+the+bicinchoninic+acid+protein+assay:+identification+of+the+groups+responsible+for+color+formation.">Investigation of the bicinchoninic acid protein assay: identification of the groups responsible for color formation.</a> Analytical biochemistry. 175, 231-237 (1988).</li><li>Ursitti, J. A., Mozdzanowski, J., Speicher, D. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroblotting+from+polyacrylamide+gels.">Electroblotting from polyacrylamide gels.</a> Current protocols in protein science. Chapter 10, Unit 10.7 (2001).</li><li>Kricka, L. J., Voyta, J. C., Bronstein, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemiluminescent+methods+for+detecting+and+quantitating+enzyme+activity.">Chemiluminescent methods for detecting and quantitating enzyme activity.</a> Methods in enzymology. 305, 370-390 (2000).</li><li>Noguchi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrative+analysis+of+the+tumorigenic+role+of+TAZ+in+human+non-small+cell+lung+cancer.">An integrative analysis of the tumorigenic role of TAZ in human non-small cell lung cancer.</a> Clinical cancer research : an official journal of the American Association for Cancer Research. 20, 4660-4672 (2014).</li><li>Kasai, H., Allen, J. T., Mason, R. M., Kamimura, T., Zhang, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TGF-beta1+induces+human+alveolar+epithelial+to+mesenchymal+cell+transition+(EMT).">TGF-beta1 induces human alveolar epithelial to mesenchymal cell transition (EMT).</a> Respiratory research. 6, 56 (2005).</li><li>Chen, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrin-mediated+type+II+TGF-beta+receptor+tyrosine+dephosphorylation+controls+SMAD-dependent+profibrotic+signaling.">Integrin-mediated type II TGF-beta receptor tyrosine dephosphorylation controls SMAD-dependent profibrotic signaling.</a> The Journal of clinical investigation. 124, 3295-3310 (2014).</li><li>Saito, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrated+expression+profiling+reveals+target+genes+of+TGF-beta+and+TNF-alpha+possibly+mediated+by+microRNAs+in+lung+cancer+cells.">An integrated expression profiling reveals target genes of TGF-beta and TNF-alpha possibly mediated by microRNAs in lung cancer cells.</a> PloS one. 8, e56587 (2013).</li><li>Dvashi, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+phosphatase+magnesium+dependent+1A+governs+the+wound+healing-inflammation-angiogenesis+cross+talk+on+injury.">Protein phosphatase magnesium dependent 1A governs the wound healing-inflammation-angiogenesis cross talk on injury.</a> The American journal of pathology. 184, 2936-2950 (2014).</li><li>Hallgren, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+ROCK1+dependent+contractility+in+fibroblast+from+chronic+obstructive+pulmonary+disease+patients.">Enhanced ROCK1 dependent contractility in fibroblast from chronic obstructive pulmonary disease patients.</a> Journal of translational medicine. 10, 171 (2012).</li><li>Kobayashi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Matrix+metalloproteinase-9+activates+TGF-beta+and+stimulates+fibroblast+contraction+of+collagen+gels.">Matrix metalloproteinase-9 activates TGF-beta and stimulates fibroblast contraction of collagen gels.</a> American journal of physiology. Lung cellular and molecular physiology. 306, L1006-L1015 (2014).</li><li>Horie, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histamine+induces+human+lung+fibroblast-mediated+collagen+gel+contraction+via+histamine+H1+receptor.">Histamine induces human lung fibroblast-mediated collagen gel contraction via histamine H1 receptor.</a> Experimental lung research. 40, 222-236 (2014).</li><li>Kohyama, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PGD(2)+modulates+fibroblast-mediated+native+collagen+gel+contraction.">PGD(2) modulates fibroblast-mediated native collagen gel contraction.</a> American journal of respiratory cell and molecular biology. 27, 375-381 (2002).</li><li>Muir, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Esophageal+epithelial+cells+acquire+functional+characteristics+of+activated+myofibroblasts+after+undergoing+an+epithelial+to+mesenchymal+transition.">Esophageal epithelial cells acquire functional characteristics of activated myofibroblasts after undergoing an epithelial to mesenchymal transition.</a> Experimental cell research. 330, 102-110 (2015).</li><li>Zhong, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+endoplasmic+reticulum+stress+in+epithelial-mesenchymal+transition+of+alveolar+epithelial+cells:+effects+of+misfolded+surfactant+protein.">Role of endoplasmic reticulum stress in epithelial-mesenchymal transition of alveolar epithelial cells: effects of misfolded surfactant protein.</a> American journal of respiratory cell and molecular biology. 45, 498-509 (2011).</li><li>Liu, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammatory+cytokines+augments+TGF-beta1-induced+epithelial-mesenchymal+transition+in+A549+cells+by+up-regulating+TbetaR-I.">Inflammatory cytokines augments TGF-beta1-induced epithelial-mesenchymal transition in A549 cells by up-regulating TbetaR-I.</a> Cell motility and the cytoskeleton. 65, 935-944 (2008).</li></ol>

저자는 공개 할 관심의 충돌이 없습니다.

본 연구에서 개발 된이 프로토콜은 두 단계를 포함한다. 첫 번째 단계에서는 두 번째 단계는 겔 수축 분석법 동안, EMT를 유도하기 위해 실행된다. 이 세포는 EMT을받은 것을 확인하는 것이 중요하기 때문에, 2 단계는 형태 학적 및 유전자 발현의 변화에​​ 훌륭한 보완을 제공합니다. 이전 연구 A549 세포 EMT는 TGF-β1을 24 만에 의한 것으로 나타났다; 우리는 이전에 10보고 그러나, TNF-α 치료는 EMT 및 중간 엽 세포 마커의 인수 향상시킵니다. TGF-β 매개 EMT의 메커니즘 SMAD 의존 (25)이라고 생각된다. TNFα는 젤의 수축의 증대로 연결 TGF-β1에 의한 EMT을 향상시킵니다. 이는 TGF-β1 유도 EMT의 향상을위한 TNFα의 메커니즘 된 Smad2 링커 영역의 인산화가없는 것으로 알려져있다, 또한 규제 26 시그널링 MAPK. 따라서 본 연구에서 개발 된 프로토콜은 STIMUL 포함TGF-β1 및 TNF-α 모두에 의해 ATION. 내가 젤 콜라겐 유형에 EMT 시행하고, 중간에 떠있는 세포의 삽입이 분석 (4 단계)의 중앙 부분입니다. 젤은 부드럽고 쉽게 손상되고 각면에 서로 다른 크기를 가지고 있기 때문에 중간에 젤을 적용하고 그 크기를 측정 할 때, 특히주의가 필요합니다. 이는이 단계를 수행하기 어려운 경우, 60mm 접시 27,28으로 겔을 이동시키지 않고 잘 겔 크기를 측정하는 다른 방법이있다. 일반적인 여러 문제가 첫 번째 문제는 단계 4.7에 언급 된 겔은 종종 변형되도록 콜라겐 겔 쉽게 RT에서 겔화 점이다. 따라서, 판 부드럽게 그들이 깔끔한 원통형 형태에 걸릴 확인하기 위해 우물에 젤을 캐스팅 한 후 흔들어해야합니다. 두 번째 문제는 기포가 겔화 중에 겔을 입력 할 경우, 겔의 크기가 불균일 한 것 때문이다. 어떤 공기 bubbl을 허용하는주의 말라ES는 젤을 오염합니다. 원래 방법 및이 방법 사이의 두 가지 차이가​​ 있습니다. 기존 방법의 콜라겐 겔의 최종 농도는 mL의 0.75 밀리그램 /하지만,이 방법의 1.75 밀리그램 / 겔들은 원래 방법보다 더욱 수축 할 수 있도록하기 위해 ml 인 것을 상기 제 1 차이이다. 두 번째 차이는 원래의 방법은 겔 부유 매체 용 무 혈청 배지를 사용하지만,이 방법은 세포의 수축력을 세포 생존을 유지하고 유지하기 위해 겔 부유 매체에 1 % FBS를 사용한다. 원래 섬유 모세포에 대한 개발 겔 수축 분석은 상처 치유 및 섬유증 (13)의 프로세스에 기여하는 세포의 수축력을 평가하기위한 시험 관내 모델에 적합하다. 한 콜라겐 형에 대한 섬유 아세포의 부착을 따라서 콜라겐 겔의 크기의 감소를 초래 기계적 긴장을 생성하도록되어있다. 또한,이 분석은 최근 사용되고기관지 천식 및 COPD 29-31 비롯한 염증성 질환으로기도 세포의 수축 연구를위한 시험 관내 모델로서. 이 특정 기기를 필요로하고 높은 재현성을 나타내는 정량적하지에서 겔 수축 분석은 이러한 세포 이동 분석과 같은 다른 분석에 대등하다. 그러나, EMT (32)을 평가하기위한 겔 수축 분석법을 적용하는 몇 가지보고가있다. 본 연구에서는, EMT받은 세포를 함유하는 겔은 크게 세포 수축을 나타내는 겔화 후 72 시간부터 24 크기로 감소 하였다. 이 방법의 한계는 그러나이 있습니다. 첫째는이 분석에있어서, 겔의 크기 변화가 겔의 모든 셀의 수축력의 합을 표시한다는 것이다. 그러나,이 분석을 이용하여 겔에서 단일 세포의 수축력을 평가하기 어렵다. 둘째, A549 세포는 암세포가 아닌 정상 인간 상피 세포는 것이다. 따라서, O를 추정하기 어려운직접 폐 섬유증의 발병에 UR의 결과. 그러나, A549 세포는 광범위기도 상피 세포의 기능을 연구하기 위해 사용되며, 몇몇 연구는 폐 섬유증 (33, 34)의 모델로 A549 세포를 사용하여 EMT 증거를 얻었다. 요약하면, 타입 I이 EMT는 이들 세포의 수축을 나타내는, 소형화 된 시행 된 중간 엽 세포를 포함하는 콜라겐 젤. 따라서, 겔 수축 분석법 EMT 과정을 통해 셀의 수축 기능의 획득을 평가하기위한 시험 관내 분석의 확장으로 간주되어야한다.

섬유화 간질 성 폐 질환, 심장 섬유증, 간경변, 단말 신부전, 전신성 경화증,자가 면역 질환 한 각종 만성 진행성 질환의 발병에 관여된다. 간질 성 폐 질환 중 특발성 폐 섬유증 (IPF)은 만성 진행성 질환이며, 불량한 예후를 보여줍니다. IPF의 병리학 적 특징은 예후와 관련된 활성화 된 섬유 아세포 및 근섬유로 이루어진 섬유 아세포 초점의 개발이다. 이러한 폐 섬유 아 세포의 기원은 원래 주민 폐 섬유 아 세포를 포함하고 골수에서 섬유 세포를 순환 여러 중간 엽 세포에서 파생 할 것을 제안한다. 최근 상피 간엽 전이 (EMT)는 간엽 세포 (2)의 형성과 관련이 제안되었으며, 섬유 성 질환의 발병에 기여. 그것은 생각된다 EMT는 종양의 침윤과 전이 3를 포함하여 태아의 발달 과정에서 중요한 역할을, 상처 치유, 암의 진행을한다. EMT의 방법에 따라, 상피 세포는 E-cadherin의 상피 마커의 손실에 의해 중간 엽 세포의 능력을 획득하고, 그러한 멘틴 같은 중배엽 마커, 및 α-평활근 액틴 (SMA) -4,5- 의해 발현. 이전 연구 EMT 처리가 신장 6 및 7에서 폐 섬유증 조직의 발달과 관련되었다는 증거를 나타내었다. 또한, 만성 염증은 섬유 성 질환 (8)을 촉진; 또한, 종양 괴사 인자 상과 부재 (14) (TNFSF14; LIGHT)와 같은 염증성 사이토 카인, 종양 괴사 인자 (TNF) -α 및 인터루킨 1β는 EMT 9-12을 향상시키는 것으로 나타났다. 콜라겐 겔 수축 분석법, 섬유 아세포 타입 I에 포함 된 콜라겐 계 세포 수축 분석법콜라겐 겔 삼차원, 수축의 평가를위한 시험 관내 모델에서 이상적이다. 수축성 섬유 아세포의 특성 함수 중 하나이며 정상 상처 복구 및 섬유증 (13)에 기여한다. 이 분석에서, 섬유 아세포의 부착이 어떤 조건 하에서 기계적 장력을 생성하도록되어 I는 인테그린 의존성 메커니즘을 통해 입력 콜라겐, 결과적으로 조직의 수축을 유도하는 것으로 생각된다. 여기서, 겔 수축 분석법의 개발이 EMT을받은 세포의 수축 기능의 획득을 평가하도록 적응 될 것으로보고있다. 이 보고서는이 변형 분석이 EMT을 시행 한 중간 엽 세포의 수축력을 평가하기에 적합 함을 보여줍니다.

<table><tbody><tr><td>DMEM</td><td>sigma aldrich</td><td>11965-092</td><td>For A549 medium</td></tr><tr><td>FBS</td><td>GIBCO</td><td>10437</td><td></td></tr><tr><td>Transforming Growth Factor-&amp;beta;1, Human, recombinant</td><td>Wako Laboratory chemicals</td><td>209-16544</td><td></td></tr><tr><td>Recombinant Human TNF-&amp;alpha;</td><td>R&amp;amp;D systems</td><td>210-TA/CF</td><td></td></tr><tr><td>E-Cadherin (24E10) Rabbit mAb</td><td>Cell Signaling Technology</td><td>#3195</td><td>1:3,000 dilution</td></tr><tr><td>Vimentin (D21H3) Rabbit mAb</td><td>Cell Signaling Technology</td><td>#5741</td><td>1:3,000 dilution</td></tr><tr><td>Anti-&amp;alpha;-Tubulin antibody</td><td>sigma aldrich</td><td>T9026</td><td>1:10,000 dilution</td></tr><tr><td>Monoclonal Anti-Actin, &amp;alpha;-Smooth Muscle antibody&amp;nbsp;</td><td>sigma aldrich</td><td>A5228</td><td>1:10,000 dilution</td></tr><tr><td>Anti-N-cadherin antibody</td><td>BD Transduction Laboratories</td><td>#610920</td><td>1:1,000 dilution</td></tr><tr><td>Anti-Mouse IgG, HRP-Linked Whole Ab Sheep (secondary antibody)</td><td>GE Healthcare</td><td>NA931-100UL</td><td>1:20,000 dilution</td></tr><tr><td>Anti-Rabbit IgG, HRP-Linked Whole Ab Donkey (secondary antibody)</td><td>GE Healthcare</td><td>NA934-100UL</td><td>1:20,000 dilution</td></tr><tr><td>Blocking reagent</td><td>GE Healthcare</td><td>RPN418</td><td>2% in TBS-T</td></tr><tr><td>6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid</td><td>corning</td><td>#353046</td><td></td></tr><tr><td>100 mm Cell culture dish</td><td>TPP</td><td>#93100</td><td></td></tr><tr><td>DMEM, powder</td><td>life technologies</td><td>12100-046</td><td>For 4&amp;times; DMEM</td></tr><tr><td>Type 1 collagen gel</td><td>Nitta gelatin</td><td>Cellmatrix type I-A</td><td></td></tr><tr><td>24 Well cell culture plate</td><td>AGC TECHNO GLASS</td><td>1820-024</td><td></td></tr><tr><td>Gel Documentation System&amp;nbsp;</td><td>ATTO</td><td>AE-6911FXN</td><td>Gel imager</td></tr><tr><td>Gel analyzing software</td><td>ATTO</td><td>Densitograph, ver. 3.00</td><td>analysing software bundled with AE-6911FXN</td></tr><tr><td>Trypsin-EDTA (0.05%), phenol red</td><td>life technologies</td><td>25300054</td><td></td></tr><tr><td>24 Well Plates, Non-Treated</td><td>IWAKI</td><td>1820-024</td><td></td></tr><tr><td>Trypan Blue Solution, 0.4%</td><td>life technologies</td><td>15250-061</td><td></td></tr><tr><td>RNA extraction kit</td><td>Qiagen</td><td>74106</td><td></td></tr><tr><td>Reverse transcriptase</td><td>life technologies</td><td>18080044</td><td></td></tr><tr><td>Real time PCR system</td><td>Stratagene</td><td>Mx-3000P</td><td></td></tr><tr><td>SYBR green PCR kit</td><td>Qiagen</td><td>204145</td><td></td></tr><tr><td>Protease Inhibitor Cocktail (100x)</td><td>life technologies</td><td>78429</td><td></td></tr><tr><td>PVDF membrane</td><td>ATTO</td><td>2392390</td><td></td></tr><tr><td>Protein assay kit</td><td>bio-rad</td><td>5000006JA&amp;nbsp;</td><td></td></tr><tr><td>Polyacrylamide gel</td><td>ATTO</td><td>2331810</td><td></td></tr><tr><td>Western blotting detection reagent</td><td>GE Healthcare</td><td>RPN2232</td><td></td></tr><tr><td>Cold CCD camera</td><td>ATTO</td><td>Ez-Capture MG/ST</td><td></td></tr><tr><td>Trypsin inhibitor</td><td>sigma aldrich</td><td>T9003-100MG</td><td></td></tr><tr><td>Polyoxyethylene (20)Sorbitan Monolaurate</td><td>Wako Laboratory chemicals</td><td>163-11512</td><td></td></tr><tr><td>Polyoxyethylene (9) octyiphenyl ether</td><td>Wako Laboratory chemicals</td><td>141-08321</td><td></td></tr></tbody></table>

development of an in vitro assay to evaluate contractile function of mesenchymal cells that underwent epithelial-mesenchymal transition

Fibrosis is often involved in the pathogenesis of various chronic progressive diseases such as interstitial pulmonary disease. Pathological hallmark is the formation of fibroblastic foci, which is associated with the disease severity. Mesenchymal cells consisting of the fibroblastic foci are proposed to be derived from several cell sources, including originally resident intrapulmonary fibroblasts and circulating fibrocytes from bone marrow. Recently, mesenchymal cells that underwent epithelial-mesenchymal transition (EMT) have been also supposed to contribute to the pathogenesis of fibrosis. In addition, EMT can be induced by transforming growth factor &#946;, and EMT can be enhanced by pro-inflammatory cytokines like tumor necrosis factor &#945;. The gel contraction assay is an ideal in vitro model for the evaluation of contractility, which is one of the characteristic functions of fibroblasts and contributes to wound repair and fibrosis. Here, the development of a gel contraction assay is demonstrated for evaluating contractile ability of mesenchymal cells that underwent EMT.

EMT 동안, 상피 세포는 E-cadherin의 같은 상피 마커를 잃게 및 멘틴 및 α-평활근은 4,5를하는 걸 같은 중간 엽 마커의 발현을 얻을 수 있습니다. TGF-β1 및 TNF-α와 A549 인간의 폐 상피 세포의 배양은 EMT를 유도한다. 정상 A549 세포의 모양은 상피 세포 (도 3a)의 특성 인 형상 및 삼각형 등 자갈 돌로 있지만, TGF-β1 및 TNF-α로 자극 한 후, 외관 간엽 비슷 긴 스핀들 형상으로 변경 세포 (그림 3B). 상피와 중간 엽 마커의 발현은 세포 EMT을받은 것을 확인 평가 하였다. 상대 mRNA 발현은 ΔΔCt 방법으로 계산 하였다. 개별 데이터가 가사 g 인 글리 세르 알데히드 -3- 포스페이트 데히드로게나 (GAPDH)에 대한 규격화 된엔. TGF-β1 및 48 시간에 대한 TNF-α로 처리 A549 세포는 상당히 CDH1의 발현을 감소 크게 VIM 및 ACTA2 (도 4a)의 발현이 증가 하였다. Q-PCR에 사용 된 프라이머 서열은 표 1에 나타낸다. 멘틴, N-cadherin의, 및 α-smooth muscle actin의 발현 반면,도 4b, TGF-β1 및 TNF-α 감쇠 E-cadherin의 발현과 자극에 나타낸 바와 같이 유도 하였다. 겔 수축 분석법 EMT을받은 세포의 수축력을 평가하기 위해 수행 하였다. TGF-β1 및 TNF-α와 EMT를 유도 한 후, 세포는 콜라겐 겔에 캐스팅하고, TGF-β1 및 TNF-α 또는 PBS를 함유하는 배지에서 72 시간 동안 배양 하였다. 도 5a에 도시 된 바와 같이, TGF-β1 및 TNF-α로 처리 된 세포를 함유하는 겔은 PBS로 처리 된 세포를 포함하는 제어 겔보다 작았 다. QUA하려면겔 크기 변경 ntify 겔은 겔 분석기 0, 24, 48, 치료 후 72 시간을 이용하여 분석 하였다. 72 시간 후, TGF-β1 및 TNF-α로 처리 된 세포를 함유하는 겔의 크기는 크게 제어 겔 (도 5b)에 비해 감소 하였다. 또한 TGF-β1으로 처리 된 세포를 함유하는 겔의 단독 제어 겔보다 작았지만 (데이터 미도시) TGF-β1 및 TNF-α로 처리 된 겔 이상인 것이 확인. <img alt="그림 1" src="/files/ftp_upload/53974/53974fig1.jpg" /> 그림 1. 젤을 만들기위한 보충 그림. 이러한 이미지는 우물에 던져 젤을 보여줍니다. 세포를 포함하는 겔 매체는 점성 쉽게 젤과 잘 양식 초승달 모양 할 수 있습니다. (A) 좌측 이미지 겔 올바르게 캐스트 것을 나타내고, 우측 이미지 &quot;스트레이트 원통 형태&quot;의 스키마를 도시한다. (B &lt;/ 강해&gt;)에서 왼쪽 그림은 겔이 변형 것을 나타내고, 우측 이미지는 기포가 겔을 오염 보여준다. (C) 젤, 그래서 쉽게 손상 부드럽고 보통 &quot;팩맨&quot;와 같은 변형. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53974/53974fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/53974/53974fig2.jpg" /> 젤 크기 측정을위한 그림 2. 단계. (A) 겔 문서 시스템은 PC와 젤 이미징 시스템으로 구성되어 있습니다. (B) &quot;영상 취득 버튼&quot;및 겔의 사진. (C) &quot;검색 버튼&quot;을 측정 영역 (노란색 원)를 조정하는 창입니다. (라) &quot;자동 감지 버튼&quot;소프트웨어는 해제하는 사진에서 젤의 히트 맵을 만든다<html> 겔의 개요 (보호). (E)은이 소프트웨어는 이미지 처리에 의한 젤의 윤곽을 추출하고, 윤곽으로 둘러싸인 영역을 계산한다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53974/53974fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" src="/files/ftp_upload/53974/53974fig3.jpg" /> 그림 3. EMT 유도 된 세포의 형태학. A549 인간의 폐 상피 세포는 / 잘 6 웰 플레이트에 1.0 × 10 5 세포의 밀도로 도금 또는 5 NG / ㎖ TGF-β1 10 NG / ㎖없이 배양 위상차 현미경 촬상 다음 48 시간 동안 TNF-α. (A) 및 (B)는 200 × 하에서 얻어진 화상이다. 스케일 (A)의 바 (B) 100 μm의.<html> t = &quot;_ 빈&quot;&gt;이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오. <img alt="그림 4" src="/files/ftp_upload/53974/53974fig4.jpg" /> 그림 4. TGF-β1 및 TNF-α와 EMT 자극. (A) EMT 마커의 발현 (CDH1, VIM 및 ACTA2)의 QRT-PCR 분석. (B) E-cadherin의, N-cadherin의, 비 멘틴의 발현을 웨스턴 블롯을 도시하고, 또는 TGF-β1 및 TNF-α 자극없이 A549 세포에서 단백질 악틴 평활근 α. α-tubulin의 내부 대조군으로서 사용 하였다. A549 세포는도 1 N = 3 독립적 인 실험에서와 같이 배양 하였다. ** P &lt;0.01; 오차 막대는 SEM을 나타냅니다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53974/53974fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> 세틸 / ftp_upload / 53974 / 53974fig5.jpg &quot;/&gt; 5. 셀을받은 EMT 획득 수축성 그림. A549 세포를 10cm 접시에서 1.0 × 106 세포 / 접시의 밀도로 도금 또는 5 NG / ㎖ TGF-β1, 48 시간 동안 10 NG / ml의 TNF-α없이 배양 하였다. 세포를 24 웰 플레이트 / 웰 3.0 × 105 세포의 밀도 1.75 ㎎ / ㎖의 콜라겐 겔을 함유하는 배지 500 μL으로 주조 하였다. 젤 형성 후, 그들은 함께 5 NG / ㎖ TGF-β1 및 60mm 접시에서 10 NG / ml의 TNF-α없이 배지에 첨가하고, 영상 (A) 한 다음 72 시간 동안 배양 하였다. 겔 크기는 이미지 분석 시스템을 사용하여 0, 24, 48, 72 시간 후에 측정 하였다. N = 9 독립적 인 실험 (B). ** P &lt;0.01; 오차 막대는 SEM을 나타냅니다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53974/53974fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <table border="1" fo:kEEP-together.within 페이지 = &quot;1&quot;FO : 유지 -에 - next.within 페이지 = &quot;항상&quot;&gt; <tbody><tr><td> 유전자 이름 </td><td colspan="2"> 앞으로 5 &#39;→ 3&#39; </td><td colspan="2"> 5 &#39;→ 3&#39;역 </td></tr><tr><td> ACTA2 </td><td colspan="2"> GCACCCAGCACCATGAAGA </td><td colspan="2"> ACCGATCCAGACAGAGTATTT </td></tr><tr><td> GAPDH </td><td colspan="2"> GGTGAAGGTCGGAGTCAACGGA </td><td colspan="2"> GAGGGATCTCGCTCCTGGAAGA </td></tr><tr><td> 정력 </td><td colspan="2"> GACAATGCGTCTCTGGCACGTCTT </td><td colspan="2"> TTCTTCTGCCTCCTGCAGGTTCTT </td></tr><tr><td> CDH1 </td><td colspan="2"> CCCATCAGCTGCCCAGAAAATGAA </td><td colspan="2"> CTGTCACCTTCAGCCATCCTGTTT </td></tr></tbody></table> 표 1. 프라이머 시퀀스. QRT-PCR에 사용되는 프라이머 시퀀스. GAPDH를 내부 컨트롤로서 사용 하였다. <table border="1" fo:keep-together.within 페이지 = &quot;1&quot;FO : 유지 -에 - next.within 페이지 = &quot;항상&quot;&gt; <tbody><tr><td> 용해 버퍼 : RIPA 버퍼 </td><td></td></tr><tr><td> 20 mM 트리스 - 염산 pH를 7.5 </td><td></td></tr><tr><td> 150 mM의 NaCl을 </td><td></td></tr><tr><td> 1 mM의 EDTA </td><td></td></tr><tr><td> 1 % 폴리 옥시 에틸렌 (9) octyiphenyl 에테르 </td><td></td></tr><tr><td> 0.1 % 나 - 데 옥시 콜레이트 </td><td></td></tr><tr><td> 0.1 % SDS </td><td></td></tr><tr><td> 버퍼 차단 </td><td></td></tr><tr><td> 세척 완충액 중 1 % 차단 시약 </td><td></td></tr><tr><td> 세척 버퍼 : TBST 버퍼 </td><td></td></tr><tr><td> 염화나트륨 </td><td> 45g </td></tr><tr><td> 1 M 트리스 산도 7.4 </td><td> 50 ㎖ </td></tr><tr><td> 폴리 옥시 에틸렌 (20) 소르 비탄 모노 라우 레이트 </td><td> 2.5 ml의 </td></tr><tr><td> 증류 물 </td><td> 5 L에 추가 </td></tr><tr><td&gt; 전체 </td><td> 5 L </td></tr></tbody></table> 표 2. 사용 된 버퍼의 구성 요소. 용해의 구성 요소, 차단 버퍼와 세척 버퍼입니다.

Watch this Scientific Journal Video about Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition at JoVE.com

Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition

Here, we describe the development and application of a gel contraction assay for evaluating contractile function in mesenchymal cells that underwent epithelial-mesenchymal transition.

개발<em&gt; 체외</em&gt; 분석은 중간 엽 세포를 시행 한 상피 - 중간 엽 전환의 수축 기능을 평가하는

Fibrosis is often involved in the pathogenesis of various chronic progressive diseases such as interstitial pulmonary disease. Pathological hallmark is ...

development-an-vitro-assay-to-evaluate-contractile-function

Nanyang Technological University

Research

JoVE Journal

Developmental Biology

Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition

12.1K 조회수.  The University of Tokyo Hospital. Here, we describe the development and application of a gel contraction assay for evaluating contractile function in mesenchymal cells that underwent epithelial-mesenchymal transition.

비디오: Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition

An Enzyme- and Serum-free Neural Stem Cell Culture Model for EMT Investigation Suited for Drug Discovery

Epithelial to mesenchymal transition (EMT) describes the process of epithelium transdifferentiating into mesenchyme. EMT is a fundamental process during embryonic development that also commonly occurs in glioblastoma, the most frequent malignant brain tumor. EMT has also been observed in multiple carcinomas outside the brain including breast cancer, lung cancer, colon cancer, gastric cancer. EMT is centrally linked to malignancy by promoting migration, invasion and metastasis formation. The mechanisms of EMT induction are not fully understood. Here we describe an in vitro system for standardized isolation of cortical neural stem cells (NSCs) and subsequent EMT-induction. This system provides the flexibility to use either single cells or explant culture. In this system, rat or mouse embryonic forebrain NSCs are cultured in a defined medium, devoid of serum and enzymes. The NSCs expressed Olig2 and Sox10, two transcription factors observed in oligodendrocyte precursor cells (OPCs). Using this system, interactions between FGF-, BMP- and TGF&#946;-signaling involving Zeb1, Zeb2, and Twist2 were observed where TGF&#946;-activation significantly enhanced cell migration, suggesting a synergistic BMP-/TGF&#946;-interaction. The results point to a network of FGF-, BMP- and TGF&#946;-signaling to be involved in EMT induction and maintenance. This model system is relevant to investigate EMT in vitro. It is cost-efficient and shows high reproducibility. It also allows for the comparison of different compounds with respect to their migration responses (quantitative distance measurement), and high-throughput screening of compounds to inhibit or enhance EMT (qualitative measurement). The model is therefore well suited to test drug libraries for substances affecting EMT.

Epithelial to mesenchymal transition (EMT) allows cancers to become invasive. To investigate EMT, a neural stem cell (NSC)-based in vitro model devoid of serum and enzymes is described. This standardized system allows quantitative and qualitative assessment of cell migration, gene and protein expression. The model is suited for drug discovery.

약 발견에 적합 EMT 조사를위한 효소 - 및 혈청이없는 신경 줄기 세포 배양 모델

Epithelial to mesenchymal transition (EMT) describes the process of epithelium transdifferentiating into mesenchyme. EMT is a fundamental process during ...

연구

발생학

In vitro Mesothelial Clearance Assay that Models the Early Steps of Ovarian Cancer Metastasis

Ovarian cancer is the fifth leading cause of cancer related deaths in the United States1. Despite a positive initial response to therapies, 70 to 90 percent of women with ovarian cancer develop new metastases, and the recurrence is often fatal2. It is, therefore, necessary to understand how secondary metastases arise in order to develop better treatments for intermediate and late stage ovarian cancer. Ovarian cancer metastasis occurs when malignant cells detach from the primary tumor site and disseminate throughout the peritoneal cavity. The disseminated cells can form multicellular clusters, or spheroids, that will either remain unattached, or implant onto organs within the peritoneal cavity3 (Figure 1, Movie 1). 
All of the organs within the peritoneal cavity are lined with a single, continuous, layer of mesothelial cells4-6 (Figure 2). However, mesothelial cells are absent from underneath peritoneal tumor masses, as revealed by electron micrograph studies of excised human tumor tissue sections3,5-7 (Figure 2). This suggests that mesothelial cells are excluded from underneath the tumor mass by an unknown process. 
Previous in vitro experiments demonstrated that primary ovarian cancer cells attach more efficiently to extracellular matrix than to mesothelial cells8, and more recent studies showed that primary peritoneal mesothelial cells actually provide a barrier to ovarian cancer cell adhesion and invasion (as compared to adhesion and invasion on substrates that were not covered with mesothelial cells)9,10. This would suggest that mesothelial cells act as a barrier against ovarian cancer metastasis. The cellular and molecular mechanisms by which ovarian cancer cells breach this barrier, and exclude the mesothelium have, until recently, remained unknown. 
Here we describe the methodology for an in vitro assay that models the interaction between ovarian cancer cell spheroids and mesothelial cells in vivo (Figure 3, Movie 2). Our protocol was adapted from previously described methods for analyzing ovarian tumor cell interactions with mesothelial monolayers8-16, and was first described in a report showing that ovarian tumor cells utilize an integrin &#x2013;dependent activation of myosin and traction force to promote the exclusion of the mesothelial cells from under a tumor spheroid17. This model takes advantage of time-lapse fluorescence microscopy to monitor the two cell populations in real time, providing spatial and temporal information on the interaction. The ovarian cancer cells express red fluorescent protein (RFP) while the mesothelial cells express green fluorescent protein (GFP). RFP-expressing ovarian cancer cell spheroids attach to the GFP-expressing mesothelial monolayer. The spheroids spread, invade, and force the mesothelial cells aside creating a hole in the monolayer. This hole is visualized as the negative space (black) in the GFP image. The area of the hole can then be measured to quantitatively analyze differences in clearance activity between control and experimental populations of ovarian cancer and/ or mesothelial cells. This assay requires only a small number of ovarian cancer cells (100 cells per spheroid X 20-30 spheroids per condition), so it is feasible to perform this assay using precious primary tumor cell samples. Furthermore, this assay can be easily adapted for high throughput screening.

In vitro Mesothelial Clearance Assay that Models the Early Steps of Ovarian Cancer Metastasis

The mesothelial clearance assay described here takes advantage of fluorescently labeled cells and time-lapse video microscopy to visualize and quantitatively measure the interactions of ovarian cancer multicellular spheroids and mesothelial cell monolayers. This assay models the early steps of ovarian cancer metastasis.

체외 Mesothelial 정리 분석에서는 그것이 난소 암 전이의 초기 단계 모델

Ovarian cancer is the fifth leading cause of cancer related deaths in the United States1. Despite a positive initial response to therapies, 70 to 90 ...

의학

The Aortic Ring Co-culture Assay: A Convenient Tool to Assess the Angiogenic Potential of Mesenchymal Stromal Cells In Vitro

Angiogenesis is a complex, highly regulated process responsible for providing and maintaining adequate tissue perfusion. Insufficient vasculature maintenance and pathological malformations can result in severe ischemic diseases, while overly abundant vascular development is associated with cancer and inflammatory disorders. A promising form of pro-angiogenic therapy is the use of angiogenic cell sources, which can provide regulatory factors as well as physical support for newly developing vasculature.
Mesenchymal Stromal Cells (MSCs) are extensively investigated candidates for vascular regeneration due to their paracrine effects and their ability to detect and home to ischemic or inflamed tissues. In particular, first trimester human umbilical cord perivascular cells (FTM HUCPVCs) are a highly promising candidate due to their pericyte-like properties, high proliferative and multilineage potential, immune-privileged properties, and robust paracrine profile. To effectively evaluate potentially angiogenic regenerative cells, it is a requisite to test them in reliable and &#34;translatable&#34; pre-clinical assays. The aortic ring assay is an ex vivo angiogenesis model that allows for easy quantification of tubular endothelial structures, provides accessory supportive cells and extracellular matrix (ECM) from the host, excludes inflammatory components, and is fast and inexpensive to set up. This is advantageous when compared to in vivo models (e.g., corneal assay, Matrigel plug assay); the aortic ring assay can track the administered cells and observe intercellular interactions while avoiding xeno-immune rejection.
We present a protocol for a novel application of the aortic ring assay, which includes human MSCs in co-cultures with developing rat aortic endothelial networks. This assay allows for the analysis of the MSC contribution to tube formation and development through physical pericyte-like interactions and of their potency for actively migrating to sites of angiogenesis, and for evaluating their ability to perform and mediate ECM processing. This protocol provides further information on changes in MSC phenotype and gene expression following co-culture.

The Aortic Ring Co-culture Assay: A Convenient Tool to Assess the Angiogenic Potential of Mesenchymal Stromal Cells In Vitro

Here, we present a novel application of the aortic ring assay where prelabelled mesenchymal cells are co-cultured with rat aorta-derived endothelial networks. This novel method allows visualization of Mesenchymal Stromal Cells (MSCs) homing and integration with endothelial networks, quantification of network properties, and evaluation of MSC immunophenotypes and gene expression.

대동맥 반지 공동 문화 분석 결과: Mesenchymal Stromal 세포에 생체 외에서 의 신생 잠재력을 평가 하는 편리한 도구

Angiogenesis is a complex, highly regulated process responsible for providing and maintaining adequate tissue perfusion. Insufficient vasculature ...

Utilization of Microscale Silicon Cantilevers to Assess Cellular Contractile Function In Vitro

The development of more predictive and biologically relevant in vitro assays is predicated on the advancement of versatile cell culture systems which facilitate the functional assessment of the seeded cells. To that end, microscale cantilever technology offers a platform with which to measure the contractile functionality of a range of cell types, including skeletal, cardiac, and smooth muscle cells, through assessment of contraction induced substrate bending. Application of multiplexed cantilever arrays provides the means to develop moderate to high-throughput protocols for assessing drug efficacy and toxicity, disease phenotype and progression, as well as neuromuscular and other cell-cell interactions. This manuscript provides the details for fabricating reliable cantilever arrays for this purpose, and the methods required to successfully culture cells on these surfaces. Further description is provided on the steps necessary to perform functional analysis of contractile cell types maintained on such arrays using a novel laser and photo-detector system. The representative data provided highlights the precision and reproducible nature of the analysis of contractile function possible using this system, as well as the wide range of studies to which such technology can be applied. Successful widespread adoption of this system could provide investigators with the means to perform rapid, low cost functional studies in vitro, leading to more accurate predictions of tissue performance, disease development and response to novel therapeutic treatment.

Utilization of Microscale Silicon Cantilevers to Assess Cellular Contractile Function In Vitro

This protocol describes the use of microscale silicon cantilevers as pliable culture surfaces for measuring the contractility of muscle cells in vitro. Cellular contraction causes cantilever bending, which can be measured, recorded, and converted into readouts of force, providing a non-invasive and scalable system for measuring contractile function in vitro.

마이크로 실리콘 캔틸레버의 이용은 세포 수축 기능을 평가하기 위해<em&gt; 체외</em

The development of more predictive and biologically relevant in vitro assays is predicated on the advancement of versatile cell culture systems which ...

생체공학

High Throughput Traction Force Microscopy Using PDMS Reveals Dose-Dependent Effects of Transforming Growth Factor-&#946; on the Epithelial-to-Mesenchymal Transition

Cellular contractility is essential in diverse aspects of biology, driving processes that range from motility and division, to tissue contraction and mechanical stability, and represents a core element of multi-cellular animal life. In adherent cells, acto-myosin contraction is seen in traction forces that cells exert on their substrate. Dysregulation of cellular contractility appears in a myriad of pathologies, making contractility a promising target in diverse diagnostic approaches using biophysics as a metric. Moreover, novel therapeutic strategies can be based on correcting the apparent malfunction of cell contractility. These applications,&#160;however, require direct quantification of these forces.
We have developed silicone elastomer-based traction force microscopy (TFM) in a parallelized multi-well format. Our use of a silicone rubber, specifically polydimethylsiloxane (PDMS), rather than the commonly employed hydrogel polyacrylamide (PAA) enables us to make robust and inert substrates with indefinite shelf-lives requiring no specialized storage conditions. Unlike pillar-PDMS based approaches that have a modulus in the GPa range, the PDMS used here is very compliant, ranging from approximately 0.4 kPa to 100 kPa. We create a high-throughput platform for TFM by partitioning these large monolithic substrates spatially into biochemically independent wells, creating a multi-well platform for traction force screening that is compatible with existing multi-well systems.
In this manuscript, we use this multi-well traction force system to examine the Epithelial to Mesenchymal Transition (EMT); we induce EMT in NMuMG cells by exposing them to TGF-&#946;, and to quantify the biophysical changes during EMT. We measure the contractility as a function of concentration and duration of TGF-&#946; exposure. Our findings here demonstrate the utility of parallelized TFM in the context of disease biophysics.

We present a high throughput traction force assay fabricated with silicone rubber (PDMS). This novel assay is suitable for studying physical changes in cell contractility during various biological and biomedical processes and diseases. We demonstrate this method's utility by measuring a TGF-&#946; dependent increase in contractility during the epithelial-to-mesenchymal transition.

PDMS를 이용한 높은 처리량 견인력 현미경 검사법은 상피-중간엽 전이에 대한 성장 인자-β 변환의 용량 의존적 효과를 밝혀냅니다.

Cellular contractility is essential in diverse aspects of biology, driving processes that range from motility and division, to tissue contraction and ...

An Explant Assay for Assessing Cellular Behavior of the Cranial Mesenchyme

The central nervous system is derived from the neural plate that undergoes a series of complex morphogenetic movements resulting in formation of the neural tube in a process known as neurulation. During neurulation, morphogenesis of the mesenchyme that underlies the neural plate is believed to drive neural fold elevation. The cranial mesenchyme is comprised of the paraxial mesoderm and neural crest cells. The cells of the cranial mesenchyme form a pourous meshwork composed of stellate shaped cells and intermingling extracellular matrix (ECM) strands that support the neural folds. During neurulation, the cranial mesenchyme undergoes stereotypical rearrangements resulting in its expansion and these movements are believed to provide a driving force for neural fold elevation. However, the pathways and cellular behaviors that drive cranial mesenchyme morphogenesis remain poorly studied. Interactions between the ECM and the cells of the cranial mesenchyme underly these cell behaviors. Here we describe a simple ex vivo explant assay devised to characterize the behaviors of these cells. This assay is amendable to pharmacological manipulations to dissect the signaling pathways involved and live imaging analyses to further characterize the behavior of these cells. We present a representative experiment demonstrating the utility of this assay in characterizing the migratory properties of the cranial mesenchyme on a variety of ECM components.

The cranial mesenchyme undergoes dramatic morphogenic movements that likely provides a driving force for elevation of the neural folds1,2. Here we describe a simple ex vivo explant assay to characterize the cellular behaviors of the cranial mesenchyme during neurulation. This assay has numerous applications including being amenable to pharmacological manipulations and live imaging analyses.

두개골 Mesenchyme의 셀룰러 행동을 평가하기위한 Explant 분석

The central nervous system is derived from the neural plate that undergoes a series of complex morphogenetic movements resulting in formation of the ...

생물학

Simplified, High-throughput Analysis of Single-cell Contractility using Micropatterned Elastomers

Cellular contractile force generation is a fundamental trait shared by virtually all cells. These contractile forces are crucial to proper development, function at both the cellular and tissue levels,and regulate the mechanical systems in the body. Numerous biological processes are force-dependent, including motility, adhesion, and division of single-cells, as well as contraction and relaxation of organs such as the heart, bladder, lungs, intestines, and uterus. Given its importance in maintaining proper physiological function, cellular contractility can also drive disease processes when exaggerated or disrupted. Asthma, hypertension, preterm labor, fibrotic scarring, and underactive bladder are all examples of mechanically driven disease processes that could potentially be alleviated with proper control of cellular contractile force. Here, we present a comprehensive protocol for utilizing a novel microplate-based contractility assay technology known as fluorescently labeled elastomeric contractible surfaces (FLECS), that provides simplified and intuitive analysis of single-cell contractility in a massively scaled manner. Herein, we provide a step-wise protocol for obtaining two six-point dose-response curves describing the effects of two contractile inhibitors on the contraction of primary human bladder smooth muscle cells in a simple procedure utilizing just a single FLECS assay microplate, to demonstrate proper technique to users of the method. Using FLECS Technology, all researchers with basic biological laboratories and fluorescent microscopy systems gain access to studying this fundamental but difficult-to-quantify functional cell phenotype, effectively lowering the entry barrier into the field of force biology and phenotypic screening of contractile cell force.

This work presents a flexible protocol for utilizing fluorescently labeled elastomeric contractible surfaces (FLECS) Technology in microwell format for simplified, hands-off quantification of single-cell contractile forces based on visualized displacements of fluorescent protein micropatterns.

마이크로 패턴화된 엘라스토머를 이용한 단일 세포 수축성의 단순화된 고처리량 분석

Cellular contractile force generation is a fundamental trait shared by virtually all cells. These contractile forces are crucial to proper development, ...

Induction and Analysis of Epithelial to Mesenchymal Transition

Epithelial to mesenchymal transition (EMT) is essential for proper morphogenesis during development. Misregulation of this process has been implicated as a key event in fibrosis and the progression of carcinomas to a metastatic state. Understanding the processes that underlie EMT is imperative for the early diagnosis and clinical control of these disease states. Reliable induction of EMT in vitro is a useful tool for drug discovery as well as to identify common gene expression signatures for diagnostic purposes. Here we demonstrate a straightforward method for the induction of EMT in a variety of cell types. Methods for the analysis of cells pre- and post-EMT induction by immunocytochemistry are also included. Additionally, we demonstrate the effectiveness of this method through antibody-based array analysis and migration/invasion assays.

A straightforward method is described for the induction of epithelial to mesenchymal transition (EMT) in a variety of cell types. Methods for the analysis of cells in EMT states by immunocytochemistry are included.

간엽 전환을 유도하고 상피의 분석

Epithelial  to mesenchymal transition (EMT) is essential for proper morphogenesis during  development. Misregulation of this  process has been implicated ...

In Vitro Assessment of Cardiac Function Using Skinned Cardiomyocytes

In this article, we describe the steps required to isolate a single permeabilized (&#34;skinned&#34;) cardiomyocyte and attach it to a force-measuring apparatus and a motor to perform functional studies. These studies will allow measurement of cardiomyocyte stiffness (passive force) and its activation with different calcium (Ca2+)-containing solutions to determine, amongst others: maximum force development, myofilament Ca2+-sensitivity (pCa50), cooperativity (nHill) and the rate of force redevelopment (ktr). This method also enables determination of the effects of drugs acting directly on myofilaments and of the expression of exogenous recombinant proteins on both active and passive properties of cardiomyocytes. Clinically, skinned cardiomyocyte studies highlight the pathophysiology of many myocardial diseases and allow in vitro assessment of the impact of therapeutic interventions targeting the myofilaments. Altogether, this technique enables the clarification of cardiac pathophysiology by investigating correlations between in vitro and in vivo parameters in animal models and human tissue obtained during open heart or transplant surgery.

This protocol aims to describe step-by-step the technique of extraction and assessment of cardiac function using skinned cardiomyocytes. This methodology allows measurement and acutemodulation of myofilament function using small frozen biopsies that can be collected from different cardiac locations, from mice to men.

피부 심근세포를 이용한 심장 기능의 체외 평가

In this article, we describe the steps required to isolate a single permeabilized (&#34;skinned&#34;) cardiomyocyte and attach it to a force-measuring ...

Isolation of Primary Patient-specific Aortic Smooth Muscle Cells and Semiquantitative Real-time Contraction Measurements In Vitro

Smooth muscle cells (SMCs) are the predominant cell type in the aortic media. Their contractile machinery is important for the transmission of force in the aorta and regulates vasoconstriction and vasodilation. Mutations in genes encoding for the SMC contractile apparatus proteins are associated with aortic diseases, such as thoracic aortic aneurysms. Measuring SMC contraction in vitro is challenging, especially in a high-throughput manner, which is essential for screening patient material. Currently available methods are not suitable for this purpose. This paper presents a novel method based on electric cell-substrate impedance sensing (ECIS). First, an explant protocol is described to isolate patient-specific human primary SMCs from aortic biopsies and patient-specific human primary dermal fibroblasts for the study of aortic aneurysms. Next, a detailed description of a new contraction method is given to measure the contractile response of these cells, including the subsequent analysis and suggestion for comparing different groups. This method can be used to study the contraction of adherent cells in the context of translational (cardiovascular) studies and patient and drug screening studies.

Isolation of Primary Patient-specific Aortic Smooth Muscle Cells and Semiquantitative Real-time Contraction Measurements In Vitro

This paper describes an explant culture-based method for the isolation and culturing of primary, patient-specific human aortic smooth muscle cells and dermal fibroblasts. Furthermore, a novel method is presented for measuring cell contraction and subsequent analysis, which can be used to study patient-specific differences in these cells.

일차 환자 특이적 대동맥 평활근 세포 및 체외에서 반정량적 실시간 수축 측정의 분리

Smooth muscle cells (SMCs) are the predominant cell type in the aortic media. Their contractile machinery is important for the transmission of force in ...

개발

요약

더 많은 비디오 탐색

이 비디오의 챕터