We thank Dr. Tadashi Koyama for technical help. This work was supported in part by JSPS KAKENHI Grant Numbers 23249045, 15K09211, 15K19172; a grant to the Respiratory Failure Research Group from the Ministry of Health, Labour and Welfare, Japan; a grant for research on allergic disease and immunology, Japan.

1. الاستعدادات والثقافة من خلايا الرئة طلائي <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> ثقافة A549 الخلايا الظهارية الرئة البشرية (خط خلية ملتصقة) في Dulbecco لتعديل النسر متوسطة (DMEM) تستكمل مع 10٪ مصل بقري جنيني (FBS)، و 100 وحدة دولية / مل البنسلين، و 100 ميكروغرام / مل الستربتومايسين. </li><li style=";text-align:right;direction:rtl"> إزالة والتخلص من وسائل الإعلام ثقافة خلية من صحن الثقافة، ويغسل مرة واحدة مع 5-10 مل من الفوسفات مخزنة المالحة (PBS). بعد الغسيل، ونضح على الفور برنامج تلفزيوني. </li><li style=";text-align:right;direction:rtl"> إضافة 2 مل التربسين حامض / ethylenediaminetetraacetic (EDTA) (0.05٪)، واحتضان عند 37 درجة مئوية و 5٪ CO 2 لمدة 3 دقائق. </li><li style=";text-align:right;direction:rtl"> جمع خلايا منفصلة في أنابيب الطرد المركزي التي تحتوي على خلية ثقافة المتوسط، أنابيب الطرد المركزي في RT لمدة 4 دقائق في 150 × ز. </li><li style=";text-align:right;direction:rtl"> resuspend الخلايا بيليه في 2 مل من مستنبت الخلية وإزالة عينة لعد الخلايا. حساب عدد الخلايا باستخدام عدادة الكريات مع التريبان وصمة عار الزرقاء للتحقق بقاء الخلية. </li><li style=";text-align:right;direction:rtl"> خلايا البذور A549 على10 لوحات سم البوليسترين في مناطق ذات كثافة من 0،5-1،0 × 10 6 خلية / طبق مع 10 مل من المتوسط ​​لفحص هلام الانكماش. البذور الخلايا على 6 لوحات البوليسترين بشكل جيد في مناطق ذات كثافة من 0،5-1،0 × 10 5 خلية / جيدا مع 2 مل من المتوسط ​​للتأكيد EMT. احتضان الخلايا عند 37 درجة مئوية و 5٪ CO 2 لمدة 24 ساعة. </li></ol> إجراء 2. EMT <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إضافة 10 ميكرولتر من TGF-β1 (5 ميكروغرام / مل) و 10 ميكرولتر من TNF-α (10 ميكروغرام / مل) لوحة لفحص هلام انكماش المصنف في الخطوة 1.6. إضافة 2 ميكرولتر من TGF-β1 (5 ميكروغرام / مل) و 2 ميكرولتر من TNF-α (10 ميكروغرام / مل) لوحة للتأكيد EMT المصنف في الخطوة 1.6. احتضان عند 37 درجة مئوية و 5٪ CO 2 لمدة 48 ساعة. </li></ol> 3. تأكيد الإجراءات EMT بواسطة PCR والغربية التنشيف <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تأكيد التغيير في التشكل (من حجر مثل كوبلي إلى المغزل شكل) من الخلايا المعالجة باستخدام المجهر النقيض من المرحلة. ملاحظة: نورمخلايا A549 آل لها كوبلي الحجر تشبه والثلاثي ظهور شكل الذي هو سمة من الخلايا الظهارية، ولكن بعد التحفيز مع TGF-β1 وTNF-α، الخلايا تظهر طويلة والمغزل على شكل مشابه للخلايا اللحمة المتوسطة 14،15. </li><li style=";text-align:right;direction:rtl"> تقييم تعبير عن علامة الظهارية، مثل E-كادهيرين، وعلامات الوسيطة مثل N-كادهيرين، فيمنتين، وα السلس الأكتين العضلات باستخدام PCR أو النشاف الغربي. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> استخراج الحمض النووي الريبي مجموع من الخلايا باستخدام استخراج الحمض النووي الريبي مجموعة 16 وتوليف [كدنا باستخدام الناسخ العكسي 17 وفقا لبروتوكول الشركة المصنعة. </li><li style=";text-align:right;direction:rtl"> قياس التعبير عن مستويات مرنا في الوقت الحقيقي باستخدام نظام PCR 18 و أحادى cyanine الصبغة عدة PCR وفقا لتعليمات الشركة الصانعة. وترد. (E-كادهيرين كادهيرين-1)، وفيم (فيمنتين) في الجدول 1 الاشعال محددة لGAPDH (غليسيرألدهيد 3-فوسفات نازعة)، ACTA2 (ألفا الأكتين-2)، CDH1 </stرونغ&gt;. </li><li style=";text-align:right;direction:rtl"> ليز الخلايا باستخدام العازلة تحلل (الجدول 2) محلول يحتوي على 1٪ مثبط البروتياز كوكتيل. قياس تركيزات البروتين كل عينة باستخدام مجموعة البروتين مقايسة 19،20، وتطبيق نفس كميات من البروتين لهلام بولي أكريلاميد. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> أداء SDS هلام الكهربائي ونقل شبه الجافة من البروتينات لPVDF غشاء 21. احتضان الغشاء مع الأجسام المضادة الأولية في عرقلة العازلة 1 - 2 ساعة. بعد الحضانة، ويغسل مرتين الغشاء مع غسل العازلة واحتضان ساعة غشاء 1 مع الأجسام المضادة الثانية. ملاحظة: انظر الجدول المواد / المعدات عن الأجسام المضادة والتخفيفات المستخدمة في هذه الدراسات. انظر الجدول 2 لمكونات عازلة تمنع. </li><li style=";text-align:right;direction:rtl"> يغسل الغشاء مع العازلة غسل مرتين. التقاط صور للغشاء مع الغرب النشاف عدة الكشف عن 22 باستخدام كاميرا CCD 11،23 الباردة. </li></ol></li></ol></li></ol> 4. جل تقلص الفحص لتقييم EMT <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> نضح في وسائل الإعلام مكيفة من السفينة زراعة الخلايا، ويغسل جيدا مع 5-10 مل من برنامج تلفزيوني لإزالة الخلايا الميتة. بعد الغسيل، ونضح على الفور برنامج تلفزيوني. </li><li style=";text-align:right;direction:rtl"> إضافة 2 مل من 0.05٪ التربسين / EDTA واحتضان عند 37 درجة مئوية و 5٪ CO 2 لمدة 3 دقائق. </li><li style=";text-align:right;direction:rtl"> جمع خلايا منفصلة في أنابيب الطرد المركزي التي تحتوي على DMEM تستكمل مع مثبط التربسين (1 ملغ / مل)، أنابيب الطرد المركزي في RT لمدة 4 دقائق في 150 × ز. </li><li style=";text-align:right;direction:rtl"> مزيج نوع هلام 1 الكولاجين بالماء المقطر، و 4 × تتركز DMEM لضبط الكميات لتحقيق تركيز الكولاجين من 1.75 ملغ / مل، و 1 × تركيز DMEM. تأكد للحفاظ على المديين المتوسط ​​هلام على الجليد خلال هذه الخطوة. ملاحظة: لجعل 6 مل من المتوسط ​​هلام، وتخلط جيدا 3.5 مل من نوع 1 الكولاجين هلام (3 ملغ / مل)، و 1.5 مل من 4 × تتركز DMEM، و1ml من الماء المقطر. </li><li style=";text-align:right;direction:rtl"> Resuspend وبيليه الخلية في 500 ميكرولتر من برنامج تلفزيوني وأخذ عينة لعد الخلايا. عدعدد الخلايا باستخدام عدادة الكريات مع وصمة عار الأزرق التريبان للتحقق من سلامة الخلية. </li><li style=";text-align:right;direction:rtl"> إضافة المتوسطة هلام لضبط الكميات لتحقيق كثافة خلية من 3.0 × 5 10 خلايا / جيد (6.0 × 10 5 خلية / مل)، وبلطف ولكن سرعان ما مزجها قبل pipetting دون دبق. </li><li style=";text-align:right;direction:rtl"> الاستغناء عن 0.5 مل من الخليط في كل بئر من 24-جيدا لوحة غير المعالجة بسرعة وبدقة لجعل شكل أسطواني أنيق. يجب الحرص على عدم السماح لأي فقاعات الهواء لتلوث المواد الهلامية (الشكل 1A). ملاحظة: متوسطة الجل الذي يحتوي على خلايا لزجا، ويمكن أن جل بسهولة وشكل شكل هلال في البئر. </li><li style=";text-align:right;direction:rtl"> احتضان لوحة لمدة 15 دقيقة في حاضنة الخلية عند 37 درجة مئوية، و 5٪ CO 2 و 95٪ الرطوبة إلى هلام تماما. </li><li style=";text-align:right;direction:rtl"> فصل المواد الهلامية من لوحة من دون كسر عن طريق تحريك ملعقة تعقيم بطريقة لرسم محيط في اتجاه واحد. باستخدام ملعقة، ونقل بلطف المواد الهلامية على أطباق زراعة الأنسجة 60 ممتحتوي على 5 مل من DMEM / 1٪ FBS مع أو بدون TGF-β1 (5 نانوغرام / مل)، وTNF-α (10 نانوغرام / مل). </li><li style=";text-align:right;direction:rtl"> هز بلطف أطباق لضمان المواد الهلامية تطفو على المدى المتوسط. احتضان في حاضنة الخلية عند 37 درجة مئوية، و 5٪ CO 2 و 95٪ الرطوبة. </li></ol> 5. قياس جل الحجم <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> قياس حجم هلام الكولاجين بعد 0، 24، 48، و 72 ساعة باستخدام نظام تحليل الصور. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تشغيل نظام التوثيق هلام (الشكل 2A)، ووضع أطباق في مجلس الوزراء ضوء التدريع. ثم خلع غطاء من الأطباق في مجلس الوزراء. </li><li style=";text-align:right;direction:rtl"> فتح البرنامج هلام تحليل ذات الصلة. انقر على زر &quot;الحصول على الصور&quot; في القائمة شريط لإظهار صورة من المواد الهلامية في مجلس الوزراء. ثم انقر على &quot;اكتساب&quot; في شريط القوائم لالتقاط الصور من المواد الهلامية (الشكل 2B). </li><li style=";text-align:right;direction:rtl"> انقر على زر &quot;كشف&quot; في شريط القوائم (الشكل 2C) وضبط المنطقة القياس (الأصفر ط دائرةن الشكل 2C) عن طريق سحب الماوس. ثم انقر على زر &quot;لصناعة السيارات في كشف&quot; في شريط القوائم (انظر زر في الشكل 2D). البرنامج تلقائيا بالكشف عن المواد الهلامية تظهر خريطة التمثيل اللوني (الشكل 2D). </li><li style=";text-align:right;direction:rtl"> انقر على زر &quot;موافق&quot; لاستخراج مخطط من المواد الهلامية التي كتبها معالجة الصور ولحساب مناطق محاطة مخطط (الشكل 2E). بعد احتساب المنطقة، يتم عرض منطقة محسوب في نافذة منبثقة منفصل. ملاحظة: إذا كانت المواد الهلامية متداخلة مع بعضها البعض أثناء التصوير، ونقل المواد الهلامية بلطف باستخدام طرف ماصة معقمة. </li></ol></li></ol>

<ol>
	<li>Wynn, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+and+molecular+mechanisms+of+fibrosis.">Cellular and molecular mechanisms of fibrosis.</a> The Journal of pathology. 214, 199-214 (2008).</li><li>Hardie, W. D., Glasser, S. W., Hagood, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+in+the+pathogenesis+of+lung+fibrosis.">Emerging concepts in the pathogenesis of lung fibrosis.</a> The American journal of pathology. 175, 3-16 (2009).</li><li>Kovacic, J. C., Mercader, N., Torres, M., Boehm, M., Fuster, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-to-mesenchymal+and+endothelial-to-mesenchymal+transition:+from+cardiovascular+development+to+disease.">Epithelial-to-mesenchymal and endothelial-to-mesenchymal transition: from cardiovascular development to disease.</a> Circulation. 125, 1795-1808 (2012).</li><li>Thiery, J. P., Acloque, H., Huang, R. Y., Nieto, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transitions+in+development+and+disease.">Epithelial-mesenchymal transitions in development and disease.</a> Cell. 139, 871-890 (2009).</li><li>Kalluri, R., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+basics+of+epithelial-mesenchymal+transition.">The basics of epithelial-mesenchymal transition.</a> The Journal of clinical investigation. 119, 1420-1428 (2009).</li><li>Forino, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TGFbeta1+induces+epithelial-mesenchymal+transition,+but+not+myofibroblast+transdifferentiation+of+human+kidney+tubular+epithelial+cells+in+primary+culture.">TGFbeta1 induces epithelial-mesenchymal transition, but not myofibroblast transdifferentiation of human kidney tubular epithelial cells in primary culture.</a> International journal of experimental pathology. 87, 197-208 (2006).</li><li>Yang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Participation+of+miR-200+in+pulmonary+fibrosis.">Participation of miR-200 in pulmonary fibrosis.</a> The American journal of pathology. 180, 484-493 (2012).</li><li>Reynolds, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lung+inflammation+and+fibrosis:+an+alveolar+macrophage-centered+perspective+from+the+1970s+to+1980s.">Lung inflammation and fibrosis: an alveolar macrophage-centered perspective from the 1970s to 1980s.</a> American journal of respiratory and critical care medicine. 171, 98-102 (2005).</li><li>Camara, J., Jarai, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition+in+primary+human+bronchial+epithelial+cells+is+Smad-dependent+and+enhanced+by+fibronectin+and+TNF-alpha.">Epithelial-mesenchymal transition in primary human bronchial epithelial cells is Smad-dependent and enhanced by fibronectin and TNF-alpha.</a> Fibrogenesis &amp; tissue repair. 3, 2 (2010).</li><li>Kamitani, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+stimulation+with+TGF-beta1+and+TNF-alpha+induces+epithelial+mesenchymal+transition+in+bronchial+epithelial+cells.">Simultaneous stimulation with TGF-beta1 and TNF-alpha induces epithelial mesenchymal transition in bronchial epithelial cells.</a> International archives of allergy and immunology. 155, 119-128 (2011).</li><li>Mikami, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lymphotoxin+beta+receptor+signaling+induces+IL-8+production+in+human+bronchial+epithelial+cells.">Lymphotoxin beta receptor signaling induces IL-8 production in human bronchial epithelial cells.</a> PloS one. 9, e114791 (2014).</li><li>Yamauchi, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+necrosis+factor-alpha+enhances+both+epithelial-mesenchymal+transition+and+cell+contraction+induced+in+A549+human+alveolar+epithelial+cells+by+transforming+growth+factor-beta1.">Tumor necrosis factor-alpha enhances both epithelial-mesenchymal transition and cell contraction induced in A549 human alveolar epithelial cells by transforming growth factor-beta1.</a> Experimental lung research. 36, 12-24 (2010).</li><li>Grinnell, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fibroblasts,+myofibroblasts,+and+wound+contraction.">Fibroblasts, myofibroblasts, and wound contraction.</a> The Journal of cell biology. 124, 401-404 (1994).</li><li>Ramos, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FGF-1+reverts+epithelial-mesenchymal+transition+induced+by+TGF-{beta}1+through+MAPK/ERK+kinase+pathway+.">FGF-1 reverts epithelial-mesenchymal transition induced by TGF-{beta}1 through MAPK/ERK kinase pathway .</a> American journal of physiology. Lung cellular and molecular physiology. 299, L222-L231 (2010).</li><li>Ren, Z. X., Yu, H. B., Li, J. S., Shen, J. L., Du, W. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suitable+parameter+choice+on+quantitative+morphology+of+A549+cell+in+epithelial-mesenchymal+transition.">Suitable parameter choice on quantitative morphology of A549 cell in epithelial-mesenchymal transition.</a> Bioscience reports. 35, (2015).</li><li>Brinkmann, V., Kinzel, B., Kristofic, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TCR-independent+activation+of+human+CD4++45RO-+T+cells+by+anti-CD28+plus+IL-2:+Induction+of+clonal+expansion+and+priming+for+a+Th2+phenotype.">TCR-independent activation of human CD4+ 45RO- T cells by anti-CD28 plus IL-2: Induction of clonal expansion and priming for a Th2 phenotype.</a> Journal of immunology. 156, 4100-4106 (1996).</li><li>Krug, M. S., Berger, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=First-strand+cDNA+synthesis+primed+with+oligo(dT).">First-strand cDNA synthesis primed with oligo(dT).</a> Methods in enzymology. 152, 316-325 (1987).</li><li>Morozumi, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+detection+of+pathogens+in+clinical+samples+from+patients+with+community-acquired+pneumonia+by+real-time+PCR+with+pathogen-specific+molecular+beacon+probes.">Simultaneous detection of pathogens in clinical samples from patients with community-acquired pneumonia by real-time PCR with pathogen-specific molecular beacon probes.</a> Journal of clinical microbiology. 44, 1440-1446 (2006).</li><li>Smith, P. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measurement+of+protein+using+bicinchoninic+acid.">Measurement of protein using bicinchoninic acid.</a> Analytical biochemistry. 150, 76-85 (1985).</li><li>Wiechelman, K. J., Braun, R. D., Fitzpatrick, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigation+of+the+bicinchoninic+acid+protein+assay:+identification+of+the+groups+responsible+for+color+formation.">Investigation of the bicinchoninic acid protein assay: identification of the groups responsible for color formation.</a> Analytical biochemistry. 175, 231-237 (1988).</li><li>Ursitti, J. A., Mozdzanowski, J., Speicher, D. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroblotting+from+polyacrylamide+gels.">Electroblotting from polyacrylamide gels.</a> Current protocols in protein science. Chapter 10, Unit 10.7 (2001).</li><li>Kricka, L. J., Voyta, J. C., Bronstein, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemiluminescent+methods+for+detecting+and+quantitating+enzyme+activity.">Chemiluminescent methods for detecting and quantitating enzyme activity.</a> Methods in enzymology. 305, 370-390 (2000).</li><li>Noguchi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrative+analysis+of+the+tumorigenic+role+of+TAZ+in+human+non-small+cell+lung+cancer.">An integrative analysis of the tumorigenic role of TAZ in human non-small cell lung cancer.</a> Clinical cancer research : an official journal of the American Association for Cancer Research. 20, 4660-4672 (2014).</li><li>Kasai, H., Allen, J. T., Mason, R. M., Kamimura, T., Zhang, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TGF-beta1+induces+human+alveolar+epithelial+to+mesenchymal+cell+transition+(EMT).">TGF-beta1 induces human alveolar epithelial to mesenchymal cell transition (EMT).</a> Respiratory research. 6, 56 (2005).</li><li>Chen, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrin-mediated+type+II+TGF-beta+receptor+tyrosine+dephosphorylation+controls+SMAD-dependent+profibrotic+signaling.">Integrin-mediated type II TGF-beta receptor tyrosine dephosphorylation controls SMAD-dependent profibrotic signaling.</a> The Journal of clinical investigation. 124, 3295-3310 (2014).</li><li>Saito, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrated+expression+profiling+reveals+target+genes+of+TGF-beta+and+TNF-alpha+possibly+mediated+by+microRNAs+in+lung+cancer+cells.">An integrated expression profiling reveals target genes of TGF-beta and TNF-alpha possibly mediated by microRNAs in lung cancer cells.</a> PloS one. 8, e56587 (2013).</li><li>Dvashi, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+phosphatase+magnesium+dependent+1A+governs+the+wound+healing-inflammation-angiogenesis+cross+talk+on+injury.">Protein phosphatase magnesium dependent 1A governs the wound healing-inflammation-angiogenesis cross talk on injury.</a> The American journal of pathology. 184, 2936-2950 (2014).</li><li>Hallgren, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+ROCK1+dependent+contractility+in+fibroblast+from+chronic+obstructive+pulmonary+disease+patients.">Enhanced ROCK1 dependent contractility in fibroblast from chronic obstructive pulmonary disease patients.</a> Journal of translational medicine. 10, 171 (2012).</li><li>Kobayashi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Matrix+metalloproteinase-9+activates+TGF-beta+and+stimulates+fibroblast+contraction+of+collagen+gels.">Matrix metalloproteinase-9 activates TGF-beta and stimulates fibroblast contraction of collagen gels.</a> American journal of physiology. Lung cellular and molecular physiology. 306, L1006-L1015 (2014).</li><li>Horie, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histamine+induces+human+lung+fibroblast-mediated+collagen+gel+contraction+via+histamine+H1+receptor.">Histamine induces human lung fibroblast-mediated collagen gel contraction via histamine H1 receptor.</a> Experimental lung research. 40, 222-236 (2014).</li><li>Kohyama, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PGD(2)+modulates+fibroblast-mediated+native+collagen+gel+contraction.">PGD(2) modulates fibroblast-mediated native collagen gel contraction.</a> American journal of respiratory cell and molecular biology. 27, 375-381 (2002).</li><li>Muir, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Esophageal+epithelial+cells+acquire+functional+characteristics+of+activated+myofibroblasts+after+undergoing+an+epithelial+to+mesenchymal+transition.">Esophageal epithelial cells acquire functional characteristics of activated myofibroblasts after undergoing an epithelial to mesenchymal transition.</a> Experimental cell research. 330, 102-110 (2015).</li><li>Zhong, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+endoplasmic+reticulum+stress+in+epithelial-mesenchymal+transition+of+alveolar+epithelial+cells:+effects+of+misfolded+surfactant+protein.">Role of endoplasmic reticulum stress in epithelial-mesenchymal transition of alveolar epithelial cells: effects of misfolded surfactant protein.</a> American journal of respiratory cell and molecular biology. 45, 498-509 (2011).</li><li>Liu, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammatory+cytokines+augments+TGF-beta1-induced+epithelial-mesenchymal+transition+in+A549+cells+by+up-regulating+TbetaR-I.">Inflammatory cytokines augments TGF-beta1-induced epithelial-mesenchymal transition in A549 cells by up-regulating TbetaR-I.</a> Cell motility and the cytoskeleton. 65, 935-944 (2008).</li></ol>

الكتاب ليس لديهم تضارب المصالح في الكشف عنها.

ويضم البروتوكول وضعت في هذه الدراسة خطوتين. يتم تنفيذ الخطوة الأولى للحث على EMT، في حين أن الخطوة الثانية هي فحص هلام الانكماش. وبما أنه من المهم للتأكد من أن الخلايا خضعت EMT الخطوة 2 توفر عنصرا مكملا ممتازا للتغيرات التعبير المورفولوجية والجينات. وأظهرت دراسات سابقة أن EMT خلايا A549 والناجمة عن TGF-β1 فقط (24)؛ ومع ذلك، ونحن قد ذكرت في وقت سابق 10، المعاملة تنف ألفا يعزز EMT والحصول على علامات الخلية الوسيطة. ويعتقد أن آليات EMT بوساطة TGF-β-هو 25 التي تعتمد على smad. TNFα يعزز EMT TGF-β1 التي يسببها الذي يؤدي إلى تعزيز الانكماش هلام. وقد أفيد أن آليات TNFα لتعزيز EMT يسببها TGF-β1-ليست الفسفرة الوحيدة من منطقة رابط smad2، ولكن أيضا MAPK يشير تنظيم 26. ولذلك، فإن بروتوكول المتقدمة في هذه الدراسة شملت الامفيتامينأوجه كل من TGF-β1 وTNF-α. التضمين من الخلايا التي خضعت EMT في النوع الأول الكولاجين هلام، وتطفو على المتوسط، هي الجوانب الرئيسية من هذا الاختبار (الخطوة 4). لأن المواد الهلامية هي لينة وتلف بسهولة، ولها أبعاد مختلفة على كل جانب، لا بد من الحذر الشديد عند تطبيق المواد الهلامية على المدى المتوسط ​​وقياس أحجامها. إذا كان من الصعب للقيام بهذه الخطوة، هناك طريقة بديلة لقياس أحجام جل في البئر دون تحريك المواد الهلامية في صحن 60 ملم 27،28. هناك العديد من المشاكل المشتركة، المشكلة الأولى هي أن المواد الهلامية الكولاجين يهلم بسهولة في RT، لذلك كثيرا ما تشوه المواد الهلامية كما ذكر في الخطوة 4.7. ولذلك، يجب أن تهتز لوحة بلطف بعد صب المواد الهلامية في الآبار للتأكد من أنها تأخذ على شكل أسطواني أنيق. والمشكلة الثانية هي أنه إذا تدخل أي فقاعات الهواء والمواد الهلامية خلال دبق، ثم حجم المواد الهلامية سيكون متفاوتا. يجب الحرص على عدم السماح لأي bubbl الهواءوفاق لتلوث المواد الهلامية. هناك نوعان من الاختلافات الرئيسية بين طريقة الأصلي وهذا الأسلوب. الاختلافات الأولى هي أن تركيز النهائي من المواد الهلامية الكولاجين طريقة الأصلي هو 0.75 ملغ / مل إلا أن هذا الأسلوب هو 1.75 ملغ / مل من أجل السماح المواد الهلامية للتعاقد أكثر مما تفعل مع أسلوب الأصلي. الاختلافات الثانية هي أن أسلوب الأصلي يستخدم المتوسطة مجانا المصل لهلام العائمة المتوسطة ولكن يستخدم هذا الأسلوب 1٪ FBS في المتوسط ​​عائم هلام من اجل الحفاظ على سلامة الخلية والحفاظ على انقباض الخلايا. انكماش فحص هلام وضعت أصلا لالليفية هو المثل الأعلى في نموذج المختبر لتقييم انقباض الخلايا التي تساهم في عملية التئام الجروح وتليف 13. ومن المفترض المرفق من الخلايا الليفية الكولاجين من صنف 1 لإنتاج التوترات الميكانيكية الذي يؤدي بالتالي إلى انخفاض في حجم المواد الهلامية الكولاجين. بالإضافة إلى ذلك، تم مؤخرا استخدام هذا الاختبارلتكون نموذجا في المختبر لدراسة انكماش خلايا الشعب الهوائية في الأمراض الالتهابية، بما في ذلك الربو القصبي ومرض الانسداد الرئوي المزمن 29-31. مقايسة هلام الانكماش مشابه لفحوصات أخرى، مثل فحوصات الهجرة الخلية، لأنه لا يحتاج إلى أجهزة معينة ويسلك استنساخ الكمي عالية. ومع ذلك، هناك بعض التقارير تطبيق هلام انكماش فحص لتقييم EMT 32. في هذه الدراسة، والمواد الهلامية التي تحتوي على الخلايا التي خضع EMT انخفضت بشكل ملحوظ في حجم 24-72 ساعة بعد دبق، مشيرا إلى انكماش الخلية. ولكن هناك قيود على هذا الأسلوب. الأول هو أن في هذا الاختبار، وتغيير حجم المواد الهلامية تظهر مجموع انقباض جميع الخلايا في المواد الهلامية. ومع ذلك، فإنه من الصعب تقييم انقباض خلية واحدة في المواد الهلامية باستخدام هذا الاختبار. والثاني هو أن الخلايا A549 هو خط الخلايا السرطانية، وليس العادية الخلايا الظهارية الإنسان. ولذلك، فإنه من الصعب استقراء ساور النتائج مباشرة إلى التسبب في التليف الرئوي. ومع ذلك، يتم استخدام خلايا A549 على نطاق واسع لدراسة وظائف الخلايا الظهارية مجرى الهواء، وأسفرت عن العديد من الدراسات دليلا على EMT باستخدام خلايا A549 كنموذج من التليف الرئوي 33،34. وباختصار، فإن النوع الأول الكولاجين والمواد الهلامية التي تحتوي على خلايا اللحمة المتوسطة التي خضعت خفضت EMT في حجم، مشيرا إلى انكماش تلك الخلايا. وبالتالي، ينبغي النظر في انكماش فحص هلام باعتبارها الموسعة في الفحص المختبري لتقييم الاستحواذ على وظيفة مقلص في الخلايا من خلال عملية EMT.

وتشارك التليف في التسبب في أمراض مختلفة التقدمية المزمنة، مثل مرض الرئة الخلالي، تليف القلب، وتليف الكبد والفشل الكلوي المحطة، التصلب الجهازي، وأمراض المناعة الذاتية 1. بين أمراض الرئة الخلالي، والتليف الرئوي مجهول السبب (IPF) هو مرض التدريجي المزمن ويظهر سوء أحوال الطقس. السمة المميزة المرضية للفريق الحكومي الدولي هو تطوير بؤر أرومي ليفي التي تتكون من الخلايا الليفية وmyofibroblasts تنشيط التي ترتبط مع التكهن. واقترح أصول هذه الخلايا الليفية الرئوية التي يمكن جنيها من عدة خلايا اللحمة المتوسطة، بما في ذلك الخلايا الليفية الرئوية المقيمين أصلا وتعميم الخلايا الليفية من نخاع العظام. في الآونة الأخيرة، وقد اقترح الانتقالية الظهارية الوسيطة (EMT) لتترافق مع تشكيل خلايا اللحمة المتوسطة 2، والمساهمة في التسبب في اضطرابات متليفة. ويعتقد أن EMتي يلعب دورا هاما في عملية نمو الجنين، التئام الجروح، وتطور السرطان، بما في ذلك غزو الورم والانبثاث 3. بعد عملية EMT، الخلايا الظهارية الحصول على قدرة خلايا اللحمة المتوسطة التي كتبها ضياع معالم الظهارية، مثل E-كادهيرين، والتعبير عن علامات الوسيطة، مثل فيمنتين، وα العضلات الملساء الأكتين (SMA) 4،5. وأظهرت دراسات سابقة الدليل على أن عملية EMT ارتبط تطور التليف الأنسجة في الكلى 6 و 7 الرئة. بالإضافة إلى ذلك، والتهاب مزمن يعزز المرض متليف 8؛ علاوة على ذلك، فإن هذه السيتوكينات الالتهابية مثل عامل نخر الورم أعضاء الفصيلة 14 (TNFSF14؛ ضوء)، عامل نخر الورم (TNF) -α، وانترلوكين 1β، وقد ثبت لتعزيز EMT 9-12. جل الكولاجين فحص الانكماش، انكماش الخلايا الفحص المعتمدة على الكولاجين التي هي جزء لا يتجزأ الليفية في النوع الأولالكولاجين جل ثلاثة الأبعاد، هو المثل الأعلى في نموذج المختبر لتقييم انقباض. انقباض هي واحدة من وظائف مميزة من الخلايا الليفية، وتسهم في ترميم الجروح العادية وتليف 13. في هذا الاختبار، ويعتقد أن المرفق من الخلايا الليفية إلى النوع الأول الكولاجين من خلال الآليات التي تعتمد على إنتغرين من المفترض أن تنتج التوتر الميكانيكي تحت بعض الظروف، وبالتالي يؤدي إلى تقلص الأنسجة. هنا، يتم الإبلاغ عن تطوير فحص هلام انكماش يمكن تكييفها لتقييم الاستحواذ على وظيفة مقلص في الخلايا التي خضع EMT. يوضح هذا التقرير أن هذا الاختبار تعديل هو مناسبة لتقييم انقباض في خلايا اللحمة المتوسطة التي خضعت EMT.

<table border="0" cellpadding="0" cellspacing="0" width="598">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DMEM</td>
			<td style="width:96px;">sigma aldrich</td>
			<td style="width:119px;">11965-092</td>
			<td style="width:167px;">For A549 medium</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">FBS</td>
			<td style="width:96px;">GIBCO</td>
			<td style="width:119px;">10437</td>
			<td></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">Transforming Growth Factor-&#946;1, Human, recombinant</td>
			<td style="width:96px;">Wako Laboratory chemicals</td>
			<td style="width:119px;">209-16544</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Recombinant Human TNF-&#945;</td>
			<td style="width:96px;">R&#38;D systems</td>
			<td style="width:119px;">210-TA/CF</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">E-Cadherin (24E10) Rabbit mAb</td>
			<td style="width:96px;">Cell Signaling Technology</td>
			<td style="width:119px;">#3195</td>
			<td>1:3000 dilution</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Vimentin (D21H3) Rabbit mAb</td>
			<td style="width:96px;">Cell Signaling Technology</td>
			<td style="width:119px;">#5741</td>
			<td>1:3000 dilution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Anti-&#945;-Tubulin antibody</td>
			<td style="width:96px;">sigma aldrich</td>
			<td style="width:119px;">T9026</td>
			<td>1:10000 dilution</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Monoclonal Anti-Actin, &#945;-Smooth Muscle antibody&#160;</td>
			<td style="width:96px;">sigma aldrich</td>
			<td style="width:119px;">A5228</td>
			<td>1:10000 dilution</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Anti-N-cadherin antibody</td>
			<td style="width:96px;">BD Transduction Laboratories</td>
			<td style="width:119px;">#610920</td>
			<td>1:1000 dilution</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Anti-Mouse IgG, HRP-Linked Whole Ab Sheep (secondary antibody)</td>
			<td style="width:96px;">GE Healthcare</td>
			<td style="width:119px;">NA931-100UL</td>
			<td>1:20000 dilution</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Anti-Rabbit IgG, HRP-Linked Whole Ab Donkey (secondary antibody)</td>
			<td style="width:96px;">GE Healthcare</td>
			<td style="width:119px;">NA934-100UL</td>
			<td>1:20000 dilution</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">blocking reagent</td>
			<td style="width:96px;">GE Healthcare</td>
			<td style="width:119px;">RPN418</td>
			<td>2% in TBS-T</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid</td>
			<td style="width:96px;">corning</td>
			<td style="width:119px;">#353046</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">100 mm cell culture dish</td>
			<td style="width:96px;">TPP</td>
			<td style="width:119px;">#93100</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">DMEM, powder</td>
			<td style="width:96px;">life technologies</td>
			<td style="width:119px;">12100-046</td>
			<td>For 4&#215;DMEM</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">type 1 collagen gel</td>
			<td style="width:96px;">Nitta gelatin</td>
			<td style="width:119px;">Cellmatrix type I-A</td>
			<td></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">24 well cell culture plate</td>
			<td style="width:96px;">AGC TECHNO GLASS</td>
			<td style="width:119px;">1820-024</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Gel Documentation System&#160;</td>
			<td style="width:96px;">ATTO</td>
			<td style="width:119px;">AE-6911FXN</td>
			<td>Gel imager</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">gel analyzing software</td>
			<td style="width:96px;">ATTO</td>
			<td style="width:119px;">Densitograph, ver. 3.00</td>
			<td>analysing software bundled with AE-6911FXN</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Trypsin-EDTA (0.05%), phenol red</td>
			<td style="width:96px;">life technologies</td>
			<td style="width:119px;">25300054</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">24 Well Plates, Non-Treated</td>
			<td style="width:96px;">IWAKI</td>
			<td style="width:119px;">1820-024</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Trypan Blue Solution, 0.4%</td>
			<td style="width:96px;">life technologies</td>
			<td style="width:119px;">15250-061</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">RNA extraction kit</td>
			<td style="width:96px;">Qiagen</td>
			<td style="width:119px;">74106</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">reverse transcriptase</td>
			<td style="width:96px;">life technologies</td>
			<td style="width:119px;">18080044</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">real time PCR system</td>
			<td style="width:96px;">Stratagene</td>
			<td style="width:119px;">Mx-3000P</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">SYBR green PCR kit</td>
			<td style="width:96px;">Qiagen</td>
			<td style="width:119px;">204145</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Protease Inhibitor Cocktail (100X)</td>
			<td style="width:96px;">life technologies</td>
			<td style="width:119px;">78429</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">PVDF membrane</td>
			<td style="width:96px;">ATTO</td>
			<td style="width:119px;">2392390</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">protein assay kit</td>
			<td style="width:96px;">bio-rad</td>
			<td style="width:119px;">5000006JA&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">polyacrylamide gel</td>
			<td style="width:96px;">ATTO</td>
			<td style="width:119px;">2331810</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">western blotting detection reagent</td>
			<td style="width:96px;">GE Healthcare</td>
			<td style="width:119px;">RPN2232</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">cold CCD camera</td>
			<td style="width:96px;">ATTO</td>
			<td style="width:119px;">Ez-Capture MG/ST</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Trypsin inhibitor</td>
			<td style="width:96px;">sigma aldrich</td>
			<td style="width:119px;">T9003-100MG</td>
			<td></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Polyoxyethylene (20)Sorbitan Monolaurate</td>
			<td style="width:96px;">Wako Laboratory chemicals</td>
			<td style="width:119px;">163-11512</td>
			<td></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">polyoxyethylene (9) octyiphenyl ether</td>
			<td style="width:96px;">Wako Laboratory chemicals</td>
			<td style="width:119px;">141-08321</td>
			<td></td>
		</tr>
	</tbody>
</table>

development of an in vitro assay to evaluate contractile function of mesenchymal cells that underwent epithelial-mesenchymal transition

Fibrosis is often involved in the pathogenesis of various chronic progressive diseases such as interstitial pulmonary disease. Pathological hallmark is the formation of fibroblastic foci, which is associated with the disease severity. Mesenchymal cells consisting of the fibroblastic foci are proposed to be derived from several cell sources, including originally resident intrapulmonary fibroblasts and circulating fibrocytes from bone marrow. Recently, mesenchymal cells that underwent epithelial-mesenchymal transition (EMT) have been also supposed to contribute to the pathogenesis of fibrosis. In addition, EMT can be induced by transforming growth factor &#946;, and EMT can be enhanced by pro-inflammatory cytokines like tumor necrosis factor &#945;. The gel contraction assay is an ideal in vitro model for the evaluation of contractility, which is one of the characteristic functions of fibroblasts and contributes to wound repair and fibrosis. Here, the development of a gel contraction assay is demonstrated for evaluating contractile ability of mesenchymal cells that underwent EMT.

خلال EMT، الخلايا الظهارية تفقد علامات الظهارية، مثل E-كادهيرين، واكتساب التعبير عن علامات الوسيطة، مثل فيمنتين وα العضلات الملساء الأكتين 4،5. حضانة الخلايا الظهارية A549 الإنسان الرئة مع TGF-β1 وTNF-α تحرض EMT. ظهور خلايا A549 العادية بمثابة حجر كوبلي مثل شكل وشكل المثلث الذي هو سمة من الخلايا الظهارية (الشكل 3A)، ولكن بعد حفز مع TGF-β1 وTNF-α، تغير مظهرها شكل مغزل الطويلة التي تشبه الوسيطة الخلايا (الشكل 3B). تم تقييم التعبير عن الظهارية والوسيطة علامات للتأكد من أن الخلايا خضعت EMT. تم احتساب التعبير مرنا نسبيا مع طريقة ΔΔCt. تم تطبيع البيانات الفردية ضد نازعة غليسيرألدهيد-3-فوسفات (GAPDH) أن التجهيزات المنزلية زإيني. قد خلايا A549 تعامل مع TGF-β1 وTNF-α لمدة 48 ساعة انخفاض كبير تعبيرا عن CDH1 وزادت بشكل ملحوظ تعبيرا عن VIM وACTA2 الشكل (4A). وتظهر تسلسل الاشعال تستخدم لف-PCR في TABLE1. كما هو مبين في الشكل 4B، التحفيز مع TGF-β1 وTNF-α التعبير المخفف كادهيرين E، في حين أن التعبير عن فيمنتين، N-كادهيرين، وα السلس الأكتين العضلات وكان المستحث. تم إجراء فحص هلام انكماش لتقييم انقباض الخلايا التي خضع EMT. بعد حمل EMT مع TGF-β1 وTNF-α، ويلقي الخلايا في هلام الكولاجين والمحتضنة لمدة 72 ساعة في وسائل الإعلام التي تحتوي على عامل النمو التحويلي β1 وTNF-α، أو برنامج تلفزيوني. كما هو مبين في الشكل 5A، وكانت المواد الهلامية التي تحتوي على الخلايا المعالجة مع TGF-β1 وTNF-α أصغر من المواد الهلامية تحكم تحتوي على خلايا تعامل مع برنامج تلفزيوني. لرابعا علىntify التغييرات في حجم هلام، وقد تم تحليل المواد الهلامية باستخدام محلل هلام 0، 24، 48، و 72 ساعة بعد تلقي العلاج. بعد 72 ساعة، وبشكل ملحوظ خفضت مقارنة أحجام من المواد الهلامية التي تحتوي على الخلايا المعالجة مع TGF-β1 وTNF-α الى المواد الهلامية التحكم (الشكل 5B). أكدنا أيضا أن المواد الهلامية التي تحتوي على الخلايا المعالجة مع TGF-β1 كان وحده أصغر من المواد الهلامية السيطرة ولكن لم تكن أصغر من المواد الهلامية تعامل مع TGF-β1 وTNF-α (لا تظهر البيانات). <img alt="شكل 1" src="/files/ftp_upload/53974/53974fig1.jpg" /> الشكل 1. الشكل التكميلي لجعل هلام. هذه الصور تظهر المواد الهلامية يلقى في الآبار. متوسطة الجل الذي يحتوي على خلايا لزجا ويمكن هلام بسهولة وشكل شكل هلال في البئر. (A) تظهر الصورة اليسرى التي يتم محمل المواد الهلامية بشكل صحيح، ويوضح الصورة الصحيحة مخطط &quot;شكل أسطواني أنيق&quot;. (B &lt;/ قوي&gt;) الصورة اليسرى تبين أن المواد الهلامية تشوه، ويوضح الصورة الصحيحة أن فقاعات الهواء تلوث المواد الهلامية. (C) والمواد الهلامية هي لينة، ألحقت أضرارا بهذه السهولة، وعادة ما تشوه مثل &quot;باك مان&quot;. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53974/53974fig1large.jpg" target="_blank">يرجى النقر هنا لمشاهدة نسخة أكبر من هذا الرقم.</a> <img alt="الشكل 2" src="/files/ftp_upload/53974/53974fig2.jpg" /> الشكل 2. خطوات لقياس جل الحجم. (A) ويتكون نظام توثيق جل من جهاز كمبيوتر ونظام هلام التصوير. (ب) &quot;صورة زر الاستحواذ&quot;، وصورة من المواد الهلامية. (ج) &quot;زر الكشف&quot;، ونافذة لضبط المنطقة القياس (دائرة صفراء). (D) على زر &quot;الكشف التلقائي&quot;، والبرنامج يجعل خريطة التمثيل اللوني من المواد الهلامية من صورة لدي<html> TECT الخطوط العريضة للالهلام. (E) البرنامج مقتطفات الخطوط العريضة للالمواد الهلامية التي كتبها معالجة الصور، ويحسب المناطق التي تحيط بها المخطط. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53974/53974fig2large.jpg" target="_blank">الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.</a> <img alt="الشكل (3)" src="/files/ftp_upload/53974/53974fig3.jpg" /> الشكل 3. الأشكال التضاريسية من الخلايا التي يسببها EMT. كانت مطلية A549 ظهائر رئة الإنسان في مناطق ذات كثافة من 1.0 × 5 10 خلايا / جيد في لوحة 6 جيدا وحضنت مع أو بدون 5 نانوغرام / مل TGF-β1 و 10 نانوغرام / مل TNF-α لمدة 48 ساعة، تليها مرحلة النقيض من التصوير المجهري. (أ) و (ب) عبارة عن صور تم الحصول عليها تحت × 200. القضبان على نطاق وفي الفقرة (أ) و (ب)، و 100 ميكرون.<html> ر = &quot;_ فارغة&quot;&gt; الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم. <img alt="الشكل (4)" src="/files/ftp_upload/53974/53974fig4.jpg" /> الشكل 4. EMT تحفيز مع TGF-β1 وTNF-α. (أ) تحليل QRT-PCR من EMT علامة التعبير (CDH1، فيم، وACTA2). (ب) لطخة غربية تظهر التعبير عن E-كادهيرين، N-كادهيرين، فيمنتين، وألفا العضلات الملساء الأكتين البروتينات في الخلايا A549 حفز مع أو بدون TGF-β1 وTNF-α. α تويولين كانت تستخدم الرقابة الداخلية. كانت خلايا A549 مثقف كما في الشكل 1. N = 3 تجارب مستقلة. ** ف &lt;0.01. أشرطة الخطأ تمثل SEM. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53974/53974fig4large.jpg" target="_blank">الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.</a> <html> ديزيل / ftp_upload / 53974 / 53974fig5.jpg &quot;/&gt; الرقم 5. الخلايا التي تمر EMT المكتسبة انقباض. كانت مطلية خلايا A549 في مناطق ذات كثافة من 1.0 × 10 6 خلية / طبق في 10 سم أطباق وحضنت مع أو بدون 5 نانوغرام / مل TGF-β1 و 10 نانوغرام / مل TNF-α لمدة 48 ساعة. وبعد ذلك يلقي الخلايا في 500 ميكرولتر من المتوسط ​​تحتوي على 1.75 ملغ / هلام الكولاجين مل في مناطق ذات كثافة من 3.0 × 5 10 خلايا / جيد في 24 لوحة جيدا. بعد تشكيل هلام، تم إضافتها إلى متوسطة مع أو بدون 5 نانوغرام / مل TGF-β1 و 10 نانوغرام / مل TNF-α في أطباق 60 ملم والمحتضنة لمدة 72 ساعة تليها التصوير (A). تم قياس أحجام هلام بعد 0، 24، 48، و 72 ساعة باستخدام نظام تحليل الصور. N = 9 تجارب مستقلة (B). ** ف &lt;0.01. أشرطة الخطأ تمثل SEM. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53974/53974fig5large.jpg" target="_blank">الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.</a> <table border="1" fo:k</html style=";text-align:right;direction:rtl"><html> الآثار البيئية-together.within الصفحات = &quot;1&quot; FO: المحافظة على مع next.within صفحة = &quot;دائما&quot;&gt; <tbody><tr><td> اسم الجين </td><td colspan="2"> إلى الأمام 5 &#39;→ 3&#39; </td><td colspan="2"> عكس 5 &#39;→ 3&#39; </td></tr><tr><td> ACTA2 </td><td colspan="2"> GCACCCAGCACCATGAAGA </td><td colspan="2"> ACCGATCCAGACAGAGTATTT </td></tr><tr><td> GAPDH </td><td colspan="2"> GGTGAAGGTCGGAGTCAACGGA </td><td colspan="2"> GAGGGATCTCGCTCCTGGAAGA </td></tr><tr><td> همة </td><td colspan="2"> GACAATGCGTCTCTGGCACGTCTT </td><td colspan="2"> TTCTTCTGCCTCCTGCAGGTTCTT </td></tr><tr><td> CDH1 </td><td colspan="2"> CCCATCAGCTGCCCAGAAAATGAA </td><td colspan="2"> CTGTCACCTTCAGCCATCCTGTTT </td></tr></tbody></table> جدول تسلسل 1. التمهيدي. متواليات التمهيدي تستخدم لQRT-PCR. وقد استخدم GAPDH كما الرقابة الداخلية. <table border="1" fo:keep-</html style=";text-align:right;direction:rtl">together.within الصفحات = &quot;1&quot; FO: المحافظة على مع next.within صفحة = &quot;دائما&quot;&gt; <tbody><tr><td> تحلل العازلة: المعهد الملكي العازلة </td><td></td></tr><tr><td> 20 ملي تريس، حمض الهيدروكلوريك 7.5 درجة الحموضة </td><td></td></tr><tr><td> 150 مم كلوريد الصوديوم </td><td></td></tr><tr><td> 1 ملم EDTA </td><td></td></tr><tr><td> 1٪ البولي أوكسي إتيلين (9) الأثير octyiphenyl </td><td></td></tr><tr><td> 0.1٪ نا deoxycholate </td><td></td></tr><tr><td> 0.1٪ SDS </td><td></td></tr><tr><td> حجب العازلة </td><td></td></tr><tr><td> 1٪ كاشف الحظر في غسل العازلة </td><td></td></tr><tr><td> غسل المخزن المؤقت: العازلة TBST </td><td></td></tr><tr><td> كلوريد الصوديوم </td><td> 45 ز </td></tr><tr><td> 1 م تريس 7.4 درجة الحموضة </td><td> 50 مل </td></tr><tr><td> البولي أوكسي إتيلين (20) سوربيتان monolaurate </td><td> 2.5 مل </td></tr><tr><td> تقطير المياه </td><td> إضافة إلى 5 L </td></tr><tr><td&gt; إجمالي </td><td> 5 L </td></tr></tbody></table> الجدول 2. مكونات المخازن المستخدمة. مكونات تحلل العازلة الحجب وغسل العازلة.

Watch this Scientific Journal Video about Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition at JoVE.com

Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition

Here, we describe the development and application of a gel contraction assay for evaluating contractile function in mesenchymal cells that underwent epithelial-mesenchymal transition.

تطوير<em&gt; في المختبر</em&gt; الفحص لتقييم مقلص وظيفة الخلايا الجذعية الوسيطة التي خضعت طلائي-الوسيطة الانتقالية

Fibrosis is often involved in the pathogenesis of various chronic progressive diseases such as interstitial pulmonary disease. Pathological hallmark is ...

development-an-vitro-assay-to-evaluate-contractile-function

Nanyang Technological University

Research

JoVE Journal

Developmental Biology

Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition

12.1K Views.  The University of Tokyo Hospital. Here, we describe the development and application of a gel contraction assay for evaluating contractile function in mesenchymal cells that underwent epithelial-mesenchymal transition.

Video: Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition

An Enzymatic Method to Rescue Mesenchymal Stem Cells from Clotted Bone Marrow Samples

Mesenchymal stem cells (MSCs) - usually obtained from bone marrow - often require expansion culture. Our protocol uses clinical grade urokinase to degrade clots in the bone marrow and release MSCs for further use. This protocol provides a rapid and inexpensive alternative to bone marrow resampling. Bone marrow is a major source of MSCs, which are interesting for tissue engineering and autologous stem cell therapies. Upon withdrawal bone marrow may clot, as it comprises all of the hematopoietic system. The resulting clots contain also MSCs that are lost for expansion culture or direct stem cell therapy. We experienced that 74% of canine bone marrow samples contained clots and yielded less than half of the stem cell number expected from unclotted samples. Thus, we developed a protocol for enzymatic digestion of those clots to avoid labor-intense and costly bone marrow resampling. Urokinase - a clinically approved and readily available thrombolytic drug &#8211; clears away the bone marrow clots almost completely. As a consequence, treated bone marrow aspirates yield similar numbers of MSCs as unclotted samples. Also, after urokinase treatment the cells kept their metabolic activity and the ability to differentiate into chondrogenic, osteogenic and adipogenic lineages. Our protocol salvages clotted blood and bone marrow samples without affecting the quality of the cells. This obsoletes resampling, considerably reduces sampling costs and enables the use of clotted samples for research or therapy.

Mesenchymal stem cells are usually obtained from bone marrow and require expansion culture. When samples clot before processing, a protocol using the (enzymatic) thrombolytic drug urokinase can be applied to degrade the clot. Thus, cells are released and available for expansion culture. This protocol provides a rapid and inexpensive alternative to resampling.

على الطريقة الأنزيمية لانقاذ الوسيطة الخلايا الجذعية من عينات متخدر نخاع العظم

Mesenchymal stem cells (MSCs) - usually obtained from bone marrow - often require expansion culture. Our protocol uses clinical grade urokinase to degrade ...

In Vitro and In Vivo Models to Study Corneal Endothelial-mesenchymal Transition

Corneal endothelial cells (CECs) play a crucial role in maintaining corneal clarity through active pumping. A reduced CEC count may lead to corneal edema and diminished visual acuity. However, human CECs are prone to compromised proliferative potential. Furthermore, stimulation of cell growth is often complicated by gradual endothelial-mesenchymal transition (EnMT). Therefore, understanding the mechanism of EnMT is necessary for facilitating the regeneration of CECs with competent function. In this study, we prepared a primary culture of bovine CECs by peeling the CECs with Descemet's membrane from the corneal button and demonstrated that bovine CECs exhibited the EnMT process, including phenotypic change, nuclear translocation of &#946;-catenin, and EMT regulators snail and slug, in the in vitro culture. Furthermore, we used a rat corneal endothelium cryoinjury model to demonstrate the EnMT process in vivo. Collectively, the in vitro primary culture of bovine CECs and in vivo rat corneal endothelium cryoinjury models offers useful platforms for investigating the mechanism of EnMT.

In Vitro and In Vivo Models to Study Corneal Endothelial-mesenchymal Transition

A primary culture of bovine corneal endothelial cells was used to investigate the mechanism of corneal endothelial-mesenchymal transition. Furthermore, a rat corneal endothelium cryoinjury model was used to demonstrate corneal endothelial-mesenchymal transition in vivo.

في المختبر وفي النماذج الحية لدراسة الانتقال القرنية غشائي-الوسيطة

Corneal endothelial cells (CECs) play a crucial role in maintaining corneal clarity through active pumping. A reduced CEC count may lead to corneal edema ...

Isolation of Mouse Endometrial Epithelial and Stromal Cells for In Vitro Decidualization

Decidualization is a progesterone-dependent differentiation process of endometrial stromal cells and is a prerequisite for successful embryo implantation. Although many efforts have been made to reveal the underlying mechanisms of decidualization, the exact signaling between the epithelial cells that are in contact with the embryo and the underlying stromal cells remains poorly understood. Therefore, studying decidualization in a way that takes both the epithelial and stromal cells into account could improve our knowledge about the molecular details of decidualization. For this purpose, in vivo models of artificial decidualization are physiologically the most relevant; however, manipulation of intercellular communication is limited. Currently, in vitro cultures of endometrial stromal cells are being used to investigate the modulation of decidualization by several signaling molecules. Conventionally, human or mouse endometrial stromal cells are used. However, the availability of human samples is very often limited. Furthermore, the use of murine tissues is accompanied with variety in the method of culturing. This study presents a validated and standardized method to obtain pure Endometrial Epithelial Cell (EEC) and Stromal Cell (ESC) cultures using adult intact mice treated with estrogen for three consecutive days. The protocol is optimized to improve the yield, viability, and purity of the cells and was further extended in order to study decidualization in a coculture of EEC and ESC. This model may be suitable to exploit the importance of both cell types in decidualization and to evaluate the contribution of significant signaling molecules secreted by EEC or ESC during the intercellular communication.

Isolation of Mouse Endometrial Epithelial and Stromal Cells for In Vitro Decidualization

This study presents a standardized and validated method for the isolation and culture of primary mouse endometrial stromal and epithelial cells, which can be used in a coculture system to study in vitro decidualization.

عزل ماوس بطانة الرحم طلائي واللحمية خلايا ل<em&gt; في المختبر</em&gt; Decidualization

Decidualization is a progesterone-dependent differentiation process of endometrial stromal cells and is a prerequisite for successful embryo implantation. ...

In Vitro Growth of Mouse Preantral Follicles Under Simulated Microgravity

14 day-old mouse ovarian tissue and preantral follicles isolated from same-aged mice were incubated in a simulated microgravity culture system. We quantitatively assessed follicle survival, measured follicle and oocyte diameters, and examined ultrastructure of the oocytes produced from the system. We observed decreased follicle survival, downregulation of expressions of proliferating cell nuclear antigen and growth differentiation factor 9, as indicators for the development of granulosa cells and oocytes, respectively, and oocyte ultrastructural abnormalities under the simulated microgravity condition. The simulated microgravity experimental setup needs to be optimized to provide a model for investigation of the mechanisms involved in the oocyte/follicle in vitro development.

In Vitro Growth of Mouse Preantral Follicles Under Simulated Microgravity

A highly promising technique to generate tissue constructs without using matrix is to culture cells in a simulated microgravity condition. Using a rotary culture system, we examined ovarian follicle growth and oocyte maturation in terms of follicle survival, morphology, growth, and oocyte function under the simulated microgravity condition.

في المختبر نمو بصيلات بريانترال الماوس تحت ظروف محاكاة الجاذبية الصغرية

14 day-old mouse ovarian tissue and preantral follicles isolated from same-aged mice were incubated in a simulated microgravity culture system. We ...

In Vitro Differentiation of Human Mesenchymal Stem Cells into Functional Cardiomyocyte-like Cells

Myocardial infarction and the subsequent ischemic cascade result in the extensive loss of cardiomyocytes, leading to congestive heart failure, the leading cause of mortality worldwide. Mesenchymal stem cells (MSCs) are a promising option for cell-based therapies to replace current, invasive techniques. MSCs can differentiate into mesenchymal lineages, including cardiac cell types, but complete differentiation into functional cells has not yet been achieved. Previous methods of differentiation were based on pharmacological agents or growth factors. However, more physiologically relevant strategies can also enable MSCs to undergo cardiomyogenic transformation. Here, we present a differentiation method using MSC aggregates on cardiomyocyte feeder layers to produce cardiomyocyte-like contracting cells.
Human umbilical cord perivascular cells (HUCPVCs) have been shown to have a greater differentiation potential than commonly investigated MSC types, such as bone marrow MSCs (BMSCs). As an ontogenetically younger source, we investigated the cardiomyogenic potential of first-trimester (FTM) HUCPVCs compared to older sources. FTM HUCPVCs are a novel, rich source of MSCs that retain their in utero immunoprivileged properties when cultured in vitro. Using this differentiation protocol, FTM and term HUCPVCs achieved significantly increased cardiomyogenic differentiation compared to BMSCs, as indicated by the increased expression of cardiomyocyte markers (i.e., myocyte enhancer factor 2C, cardiac troponin T, heavy chain cardiac myosin, signal regulatory protein &#945;, and connexin 43). They also maintained significantly lower immunogenicity, as demonstrated by their lower HLA-A expression and higher HLA-G expression. Applying aggregate-based differentiation, FTM HUCPVCs showed increased aggregate formation potential and generated contracting cells clusters within 1 week of co-culture on cardiac feeder layers, becoming the first MSC type to do so. 
Our results demonstrate that this differentiation strategy can effectively harness the cardiomyogenic potential of young MSCs, such as FTM HUCPVCs, and suggests that in vitro pre-differentiation could be a potential strategy to increase their regenerative efficacy in vivo.

In Vitro Differentiation of Human Mesenchymal Stem Cells into Functional Cardiomyocyte-like Cells

Here, we present a method to efficiently harness the cardiac differentiation potential of young sources of human mesenchymal stem cells in order to generate functional, contracting, cardiomyocyte-like cells in vitro.

في المختبر تمايز الخلايا الجذعية البشرية الوسيطة إلى الفنية كارديوميوسيتي مثل الخلايا

Myocardial infarction and the subsequent ischemic cascade result in the extensive loss of cardiomyocytes, leading to congestive heart failure, the leading ...

The Aortic Ring Co-culture Assay: A Convenient Tool to Assess the Angiogenic Potential of Mesenchymal Stromal Cells In Vitro

Angiogenesis is a complex, highly regulated process responsible for providing and maintaining adequate tissue perfusion. Insufficient vasculature maintenance and pathological malformations can result in severe ischemic diseases, while overly abundant vascular development is associated with cancer and inflammatory disorders. A promising form of pro-angiogenic therapy is the use of angiogenic cell sources, which can provide regulatory factors as well as physical support for newly developing vasculature.
Mesenchymal Stromal Cells (MSCs) are extensively investigated candidates for vascular regeneration due to their paracrine effects and their ability to detect and home to ischemic or inflamed tissues. In particular, first trimester human umbilical cord perivascular cells (FTM HUCPVCs) are a highly promising candidate due to their pericyte-like properties, high proliferative and multilineage potential, immune-privileged properties, and robust paracrine profile. To effectively evaluate potentially angiogenic regenerative cells, it is a requisite to test them in reliable and &#34;translatable&#34; pre-clinical assays. The aortic ring assay is an ex vivo angiogenesis model that allows for easy quantification of tubular endothelial structures, provides accessory supportive cells and extracellular matrix (ECM) from the host, excludes inflammatory components, and is fast and inexpensive to set up. This is advantageous when compared to in vivo models (e.g., corneal assay, Matrigel plug assay); the aortic ring assay can track the administered cells and observe intercellular interactions while avoiding xeno-immune rejection.
We present a protocol for a novel application of the aortic ring assay, which includes human MSCs in co-cultures with developing rat aortic endothelial networks. This assay allows for the analysis of the MSC contribution to tube formation and development through physical pericyte-like interactions and of their potency for actively migrating to sites of angiogenesis, and for evaluating their ability to perform and mediate ECM processing. This protocol provides further information on changes in MSC phenotype and gene expression following co-culture.

The Aortic Ring Co-culture Assay: A Convenient Tool to Assess the Angiogenic Potential of Mesenchymal Stromal Cells In Vitro

Here, we present a novel application of the aortic ring assay where prelabelled mesenchymal cells are co-cultured with rat aorta-derived endothelial networks. This novel method allows visualization of Mesenchymal Stromal Cells (MSCs) homing and integration with endothelial networks, quantification of network properties, and evaluation of MSC immunophenotypes and gene expression.

والرزن ثقافة المشارك خاتم الابهري: أداة ملائمة تقييم إمكانات الأوعية الوسيطة Stromal الخلايا في المختبر

Angiogenesis is a complex, highly regulated process responsible for providing and maintaining adequate tissue perfusion. Insufficient vasculature ...

Development of an In Vitro Assay to Quantitate Hematopoietic Stem and Progenitor Cells (HSPCs) in Developing Zebrafish Embryos

Hematopoiesis is an essential cellular process in which hematopoietic stem and progenitor cells (HSPCs) differentiate into the multitude of different cell lineages that comprise mature blood. Isolation and identification of these HSPCs is difficult because they are defined ex post facto; they can only be defined after their differentiation into specific cell lineages. Over the past few decades, the zebrafish (Danio rerio) has become a model organism to study hematopoiesis. Zebrafish embryos develop ex utero, and by 48 h post-fertilization (hpf) have generated definitive HSPCs. Assays to assess HSPC differentiation and proliferation capabilities have been developed, utilizing transplantation and subsequent reconstitution of the hematopoietic system in addition to visualizing specialized transgenic lines with confocal microscopy. However, these assays are cost prohibitive, technically difficult, and time consuming for many laboratories. Development of an in vitro model to assess HSPCs would be cost effective, quicker, and present fewer difficulties compared to previously described methods, allowing laboratories to quickly assess mutagenesis and drug screens that affect HSPC biology. This novel in vitro assay to assess HSPCs is performed by plating dissociated whole zebrafish embryos and adding exogenous factors that promote only HSPC differentiation and proliferation. Embryos are dissociated into single cells and plated with HSPC-supportive colony stimulating factors that cause them to generate colony forming units (CFUs) that arise from a single progenitor cell. These assays should allow more careful examination of the molecular pathways responsible for HSPC proliferation, differentiation, and regulation, which will allow researchers to understand the underpinnings of vertebrate hematopoiesis and its dysregulation during disease.

Development of an In Vitro Assay to Quantitate Hematopoietic Stem and Progenitor Cells HSPCs in Developing Zebrafish Embryos

Here, we present a simple method to quantitate hematopoietic stem and progenitor cells (HSPCs) in embryonic zebrafish. HSPCs from dissociated zebrafish are plated in methylcellulose with supportive factors, differentiating into mature blood. This allows the detection of blood defects and allows drug screening to be easily conducted.

تطوير التحليل في المختبر كوانتيتاتي الجذعية المكونة للدم والسلف الخلايا (هسبكس) في تطوير الأجنة الزرد

Hematopoiesis is an essential cellular process in which hematopoietic stem and progenitor cells (HSPCs) differentiate into the multitude of different cell ...

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and chromosome dynamics. While the germline is an excellent model, the analysis is often two dimensional due to the time and labor required for three-dimensional analysis. Major readouts in such studies are the number/position of nuclei and protein distribution within the germline. Here, we present a method to perform automated analysis of the germline using confocal microscopy and computational approaches to determine the number and position of nuclei in each region of the germline. Our method also analyzes germline protein distribution that enables the three-dimensional examination of protein expression in different genetic backgrounds. Further, our study shows variations in cytoskeletal architecture in distinct regions of the germline that may accommodate specific spatial developmental requirements. Finally, our method enables automated counting of the sperm in the spermatheca of each germline. Taken together, our method enables rapid and reproducible phenotypic analysis of the C. elegans germline.

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

We present an automated method for three-dimensional reconstruction of the Caenorhabditis elegans germline. Our method determines the number and position of each nucleus within the germline and analyses germline protein distribution and cytoskeletal structure.

التحليل الحسابي ل Germline ايليجانس كاينورهابديتيس دراسة توزيع الأنوية، والبروتينات، وسيتوسكيليتون

The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and ...

In Vitro Generation of Somite Derivatives from Human Induced Pluripotent Stem Cells

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give rise to multiple cell types, including the myotome (MYO), sclerotome (SCL), dermatome (D), and syndetome (SYN), which in turn develop into skeletal muscle, axial skeleton, dorsal dermis, and axial tendon/ligament, respectively. Therefore, the generation of SMs and their derivatives from human induced pluripotent stem cells (iPSCs) is critical to obtain pluripotent stem cells (PSCs) for application in regenerative medicine and for disease research in the field of orthopedic surgery. Although the induction protocols for MYO and SCL from PSCs have been previously reported by several researchers, no study has yet demonstrated the induction of SYN and D from iPSCs. Therefore, efficient induction of fully competent SMs remains a major challenge. Here, we recapitulate human SM patterning with human iPSCs in vitro by mimicking the signaling environment during chick/mouse SM development, and report on methods of systematic induction of SM derivatives (MYO, SCL, D, and SYN) from human iPSCs under chemically defined conditions through the presomitic mesoderm (PSM) and SM states. Knowledge regarding chick/mouse&#160;SM development was successfully applied to the induction of SMs with human iPSCs. This method could be a novel tool for studying human somitogenesis and patterning without the use of embryos and for cell-based therapy and disease modeling.

We present here a protocol for the differentiation of human induced pluripotent stem cells into each somite derivative (myotome, sclerotome, dermatome, and syndetome) in chemically defined conditions, which has applications in future disease modeling and cell-based therapies in orthopedic surgery.

في المختبر توليد المشتقات سميط من البشرية التي يسببها الخلايا الجذعية Pluripotent

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give ...

Assessment of Oxidative Damage in the Primary Mouse Ocular Surface Cells/Stem Cells in Response to Ultraviolet-C (UV-C) Damage

The ocular surface is subjected to regular wear and tear due to various environmental factors. Exposure to UV-C radiation constitutes an occupational health hazard. Here, we demonstrate the exposure of primary stem cells from the mouse ocular surface to UV-C radiation. Reactive oxygen species (ROS) formation is the readout of the extent of oxidative stress/damage. In an experimental in vitro setting, it is also essential to assess the percentage of dead cells generated due to oxidative stress. In this article, we will demonstrate the 2&#39;,7&#39;-Dichlorofluoresceindiacetate (DCFDA) staining of UV-C exposed mouse primary ocular surface stem cells and their quantification based on the fluorescent images of DCFDA staining. DCFDA staining directly corresponds to ROS generation. We also demonstrate the quantification of dead and live cells by simultaneous staining with propidium iodide (PI) and Hoechst 3332 respectively and the percentage of DCFDA (ROS positive) and PI positive cells.

Assessment of Oxidative Damage in the Primary Mouse Ocular Surface Cells/Stem Cells in Response to Ultraviolet-C UV-C Damage

This protocol demonstrates the simultaneous detection of reactive oxygen species (ROS), live cells, and dead cells in live primary cultures from mouse ocular surface cells. 2&#39;,7&#39;-Dichlorofluoresceindiacetate, propidium iodide, and Hoechst staining are used to assess the ROS, dead cells, and live cells, respectively, followed by imaging and analysis.

تقييم الضرر التأكسدي في الخلايا السطحية الرئيسية للفأرة /الخلايا الجذعية استجابة للأضرار فوق البنفسجية-C (UV-C)

The ocular surface is subjected to regular wear and tear due to various environmental factors. Exposure to UV-C radiation constitutes an occupational ...