We thank Dr. Tadashi Koyama for technical help. This work was supported in part by JSPS KAKENHI Grant Numbers 23249045, 15K09211, 15K19172; a grant to the Respiratory Failure Research Group from the Ministry of Health, Labour and Welfare, Japan; a grant for research on allergic disease and immunology, Japan.

תכשירי 1. והתרבות של תאי אפיתל הריאות <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> תאי אפיתל ריאה אנושית A549 תרבות (שורת תאים חסיד) ב בינוני הנשר שונה של Dulbecco (DMEM) בתוספת 10% בסרום שור העובר (FBS), 100 IU / פניצילין מ&quot;ל, 100 מיקרוגרם / מ&quot;ל ​​סטרפטומיצין. </li><li style=";text-align:right;direction:rtl"> סר וזורק תקשורת תרבית תאים מן מנת התרבות, ולשטוף פעם עם 5 - 10 מיליליטר של בופר פוספט (PBS). לאחר הכביסה, מיד לשאוב PBS. </li><li style=";text-align:right;direction:rtl"> הוסף 2 מ&quot;ל טריפסין / חומצה ethylenediaminetetraacetic (EDTA) (0.05%) ו לדגור על 37 מעלות צלזיוס, 5% CO 2 דקות 3. </li><li style=";text-align:right;direction:rtl"> אוסף את התא המנותק צינורות צנטריפוגה המכילים בינוני תרבית תאים, צנטריפוגה הצינורות ב RT במשך 4 דקות ב g 150 ×. </li><li style=";text-align:right;direction:rtl"> Resuspend התאים גלולה ב 2 מ&quot;ל של מדיום תרבית תאים ולהסיר מדגם עבור ספירת תאים. ספירת התאים באמצעות hemocytometer עם כתם כחול Trypan לבדוק כדאיות התא. </li><li style=";text-align:right;direction:rtl"> תאי A549 זרע על10 ס&quot;מ קלקר צלחות בצפיפות של 0.5 - 1.0 × 10 6 תאים / תבשיל עם 10 מ&quot;ל של מדיום עבור assay התכווצות ג&#39;ל. זרעים התאים על 6 צלחות קלקר גם בצפיפות של 0.5 - 1.0 × 10 5 תאים / היטב עם 2 מ&quot;ל של מדיום לאישור EMT. דגירת התאים ב 37 מעלות צלזיוס, 5% CO 2 למשך 24 שעות. </li></ol> נוהל EMT 2. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הוסף 10 μl של-β1 TGF (5 מיקרוגרם / מ&quot;ל) ו -10 μl של-α TNF (10 מיקרוגרם / מ&quot;ל) לצלחת עבור assay התכווצות ג&#39;ל זורעים בשלב 1.6. הוסף 2 μl של-β1 TGF (5 מיקרוגרם / מ&quot;ל) ו -2 μl של-α TNF (10 מיקרוגרם / מ&quot;ל) לצלחת לאישור EMT זורעים בשלב 1.6. לדגור על 37 מעלות צלזיוס, 5% CO 2 למשך 48 שעות. </li></ol> 3. אישור של נוהל EMT ידי PCR ו המערבי סופג <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> אשר שינוי במורפולוגיה (מאבן דמוי חלוק כדי ציר צורה) של תאים שטופלו באמצעות מיקרוסקופ לעומת שלב. הערה: נורםיש תאי A549 אל חלוק אבן דמוית ומראה בצורה משולש היא מאפיין של תאי אפיתל, אך לאחר גירוי עם-β1 TGF ו-α TNF, התאים להופיע ארוכים ציר בצורה דומה תאי mesenchymal 14,15. </li><li style=";text-align:right;direction:rtl"> חישוב הביטוי של סמן אפיתל, כגון E-cadherin, וסמנים mesenchymal כגון N-cadherin, vimentin, אקטין שריר α-חלקה באמצעות PCR או המערבי סופג. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> חלץ RNA הכולל את התאים באמצעות ערכת חילוץ RNA 16 לסנתז cDNA באמצעות transcriptase הפוכה 17 על פי פרוטוקול של היצרן. </li><li style=";text-align:right;direction:rtl"> למדוד ביטוי של רמות ה- mRNA באמצעות מערכת בזמן אמת PCR 18 וערכת PCR לצבוע cyanine monomeric פי הוראות היצרנים. פריימרים ספציפיים עבור GAPDH (glyceraldehyde dehydrogenase 3-פוספט), ACTA2 (אלפא-אקטין 2), CDH1 (cadherin-1; E-cadherin), ו VIM (vimentin) מוצגים בלוח 1 </stרונג&gt;. </li><li style=";text-align:right;direction:rtl"> Lyse את התאים באמצעות חיץ תמוגה (טבלה 2) תמיסה המכילה קוקטייל מעכב 1% פרוטאז. למדוד את כל ריכוזי חלבון מדגם באמצעות ערכת assay חלבון 19,20, ולהחיל אותן כמויות של חלבון ג&#39;ל polyacrylamide. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בצע-ג&#39;ל אלקטרופורזה SDS והעביר חצי יבש של חלבוני קרום PVDF 21. דגירה הממברנה עם נוגדנים ראשוניים בחסימת המאגר עבור 1 - שעות 2. לאחר דגירה, לשטוף פעמים הממברנה עם חיץ לשטוף דגירת hr קרום 1 עם נוגדנים שניים. הערה: עיין חומרים / ציוד שולחן עבור נוגדנים דילולים שימוש במחקרים אלה. ראה טבלה 2 עבור רכיבי חסימת חיץ. </li><li style=";text-align:right;direction:rtl"> לשטוף את הממברנה עם חיץ לשטוף פעמיים. צלם תמונות של הקרום עם ערכת זיהוי המערבית סופגת 22 באמצעות 11,23 מצלמת CCD קר. </li></ol></li></ol></li></ol> 4. Assay התכווצות ג&#39;ל EMT הערכה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לשאוב התקשורת מותנה מספינת תרבית תאים, ולשטוף היטב עם 5 - 10 מ&quot;ל של PBS להסיר תאים מתים. לאחר הכביסה, מיד לשאוב PBS. </li><li style=";text-align:right;direction:rtl"> הוסף 2 מ&quot;ל של 0.05% טריפסין / EDTA ו לדגור על 37 מעלות צלזיוס, 5% CO 2 דקות 3. </li><li style=";text-align:right;direction:rtl"> אוספים את התאים מנותקת צינורות צנטריפוגה המכיל DMEM בתוספת מעכב טריפסין (1 מ&quot;ג / מ&quot;ל), צנטריפוגה צינורות ב RT במשך 4 דקות ב 150 × גרם. </li><li style=";text-align:right;direction:rtl"> מערבבים סוג 1 ג&#39;ל קולגן עם מים מזוקקים, ו -4 × מרוכזים DMEM להתאים את הכרכים כדי להשיג ריכוז הקולגן של 1.75 מ&quot;ג / מ&quot;ל, 1 × ריכוז DMEM. הקפד לשמור המדיום ג&#39;ל על הקרח במהלך שלב זה. הערה: כדי להפוך 6 מ&quot;ל של מדיום ג&#39;ל, ומערבבים היטב 3.5 מ&quot;ל של ג&#39;ל קולגן מסוג 1 (3 מ&quot;ג / מ&quot;ל), 1.5 מ&quot;ל של 4 × מרוכזים DMEM, ו 1ml של מים מזוקקים. </li><li style=";text-align:right;direction:rtl"> Resuspend התא גלולה ב 500 μl של PBS ולהסיר מדגם עבור ספירת תאים. לספורמספר התאים באמצעות hemocytometer עם כתם כחול trypan לבדוק כדאיות התא. </li><li style=";text-align:right;direction:rtl"> הוסף בינוני ג&#39;ל להתאים את הכרכים להשיג צפיפות התאים של 3.0 × 10 5 תאים / טוב (6.0 × 10 5 תאים / מ&quot;ל) בעדינות אך במהירות לערבב אותו על ידי pipetting ללא gelation. </li><li style=";text-align:right;direction:rtl"> לוותר 0.5 מיליליטר של התערובת לבאר כל צלחת 24 גם שאינם מטופלים במהירות ובזהירות לעשות בצורה גלילית מסודרת. היזהר שלא לאפשר כל בועות אוויר לזהם את הג&#39;לים (איור 1 א). הערה: בינוני ג&#39;ל המכיל את התאים הוא צמיג ויכול ג&#39;ל טופס סהר צורה בקלות הבאר. </li><li style=";text-align:right;direction:rtl"> דגירה את הצלחת במשך 15 דקות בתוך חממת תא ב 37 מעלות צלזיוס, 5% CO 2 ולחות 95% להגליד לחלוטין. </li><li style=";text-align:right;direction:rtl"> ניתוק ג&#39;לים מהצלחת בלי לשבור על ידי הזזת מרית מעוקרת באופן לצייר היקף בכיוון אחד. בעזרת מרית, להעביר את הג&#39;לים בעדינות תרבות מנות 60 מ&quot;מ רקמההמכיל 5 מ&quot;ל של FBS% DMEM / 1 עם או בלי-β1 TGF (5 ng / ml) ו-α TNF (10 ng / ml). </li><li style=";text-align:right;direction:rtl"> נער בעדינות את הכלים כדי להבטיח ג&#39;לים צף על המדיום. מדגירים את תא חממה על 37 מעלות צלזיוס, 5% CO 2 ולחות 95%. </li></ol> מדידת 5. ג&#39;ל גודל <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מדוד את גודל ג&#39;ל קולגן לאחר 0, 24, 48, ו -72 שעות באמצעות מערכת ניתוח תמונה. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הפעל את מערכת תיעוד ג&#39;ל (איור 2 א), ולשים מנות לתוך ארון מגן אור. ואז מסירים את המכסה של הצלחות בארון הכלים. </li><li style=";text-align:right;direction:rtl"> פתח את התוכנה לניתוח ג&#39;ל קשורה. לחץ על &quot;כפתור רכישת תמונה&quot; בבר-התפריט כדי להציג את התמונה של הג&#39;לים בקבינט. לאחר מכן, לחץ &quot;לרכוש&quot; בשורת התפריטים כדי לצלם את ג&#39;לים (איור 2 ב). </li><li style=";text-align:right;direction:rtl"> לחץ על &quot;כפתור זיהוי&quot; בשורת התפריטים (איור 2 ג) ולהתאים באזור המדידה (i עיגול צהובn איור 2C) על ידי גרירת העכבר. לאחר מכן, לחץ על &quot;איתור אוטומטי כפתור&quot; בשורת התפריטים (ראה כפתור באיור 2D). התוכנה מזהה אוטומטית את הג&#39;לים מראים מפת חום (איור 2 ד). </li><li style=";text-align:right;direction:rtl"> לחץ &quot;אישור&quot; כדי לחלץ את קווי המתאר של ג&#39;ל על ידי עיבוד תמונה ולחשב אזורים המוקפים המתאר (האיור 2E). אחרי השטח חושב, באזור המחושב מוצג חלון מוקפץ נפרד. הערה: אם את הג&#39;לים חופפים זה לזה במהלך ההדמיה, להעביר ג&#39;לים בעדינות בעזרת קצה פיפטה סטרילית. </li></ol></li></ol>

<ol>
	<li>Wynn, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+and+molecular+mechanisms+of+fibrosis.">Cellular and molecular mechanisms of fibrosis.</a> The Journal of pathology. 214, 199-214 (2008).</li><li>Hardie, W. D., Glasser, S. W., Hagood, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+in+the+pathogenesis+of+lung+fibrosis.">Emerging concepts in the pathogenesis of lung fibrosis.</a> The American journal of pathology. 175, 3-16 (2009).</li><li>Kovacic, J. C., Mercader, N., Torres, M., Boehm, M., Fuster, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-to-mesenchymal+and+endothelial-to-mesenchymal+transition:+from+cardiovascular+development+to+disease.">Epithelial-to-mesenchymal and endothelial-to-mesenchymal transition: from cardiovascular development to disease.</a> Circulation. 125, 1795-1808 (2012).</li><li>Thiery, J. P., Acloque, H., Huang, R. Y., Nieto, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transitions+in+development+and+disease.">Epithelial-mesenchymal transitions in development and disease.</a> Cell. 139, 871-890 (2009).</li><li>Kalluri, R., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+basics+of+epithelial-mesenchymal+transition.">The basics of epithelial-mesenchymal transition.</a> The Journal of clinical investigation. 119, 1420-1428 (2009).</li><li>Forino, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TGFbeta1+induces+epithelial-mesenchymal+transition,+but+not+myofibroblast+transdifferentiation+of+human+kidney+tubular+epithelial+cells+in+primary+culture.">TGFbeta1 induces epithelial-mesenchymal transition, but not myofibroblast transdifferentiation of human kidney tubular epithelial cells in primary culture.</a> International journal of experimental pathology. 87, 197-208 (2006).</li><li>Yang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Participation+of+miR-200+in+pulmonary+fibrosis.">Participation of miR-200 in pulmonary fibrosis.</a> The American journal of pathology. 180, 484-493 (2012).</li><li>Reynolds, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lung+inflammation+and+fibrosis:+an+alveolar+macrophage-centered+perspective+from+the+1970s+to+1980s.">Lung inflammation and fibrosis: an alveolar macrophage-centered perspective from the 1970s to 1980s.</a> American journal of respiratory and critical care medicine. 171, 98-102 (2005).</li><li>Camara, J., Jarai, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition+in+primary+human+bronchial+epithelial+cells+is+Smad-dependent+and+enhanced+by+fibronectin+and+TNF-alpha.">Epithelial-mesenchymal transition in primary human bronchial epithelial cells is Smad-dependent and enhanced by fibronectin and TNF-alpha.</a> Fibrogenesis &amp; tissue repair. 3, 2 (2010).</li><li>Kamitani, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+stimulation+with+TGF-beta1+and+TNF-alpha+induces+epithelial+mesenchymal+transition+in+bronchial+epithelial+cells.">Simultaneous stimulation with TGF-beta1 and TNF-alpha induces epithelial mesenchymal transition in bronchial epithelial cells.</a> International archives of allergy and immunology. 155, 119-128 (2011).</li><li>Mikami, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lymphotoxin+beta+receptor+signaling+induces+IL-8+production+in+human+bronchial+epithelial+cells.">Lymphotoxin beta receptor signaling induces IL-8 production in human bronchial epithelial cells.</a> PloS one. 9, e114791 (2014).</li><li>Yamauchi, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+necrosis+factor-alpha+enhances+both+epithelial-mesenchymal+transition+and+cell+contraction+induced+in+A549+human+alveolar+epithelial+cells+by+transforming+growth+factor-beta1.">Tumor necrosis factor-alpha enhances both epithelial-mesenchymal transition and cell contraction induced in A549 human alveolar epithelial cells by transforming growth factor-beta1.</a> Experimental lung research. 36, 12-24 (2010).</li><li>Grinnell, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fibroblasts,+myofibroblasts,+and+wound+contraction.">Fibroblasts, myofibroblasts, and wound contraction.</a> The Journal of cell biology. 124, 401-404 (1994).</li><li>Ramos, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FGF-1+reverts+epithelial-mesenchymal+transition+induced+by+TGF-{beta}1+through+MAPK/ERK+kinase+pathway+.">FGF-1 reverts epithelial-mesenchymal transition induced by TGF-{beta}1 through MAPK/ERK kinase pathway .</a> American journal of physiology. Lung cellular and molecular physiology. 299, L222-L231 (2010).</li><li>Ren, Z. X., Yu, H. B., Li, J. S., Shen, J. L., Du, W. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suitable+parameter+choice+on+quantitative+morphology+of+A549+cell+in+epithelial-mesenchymal+transition.">Suitable parameter choice on quantitative morphology of A549 cell in epithelial-mesenchymal transition.</a> Bioscience reports. 35, (2015).</li><li>Brinkmann, V., Kinzel, B., Kristofic, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TCR-independent+activation+of+human+CD4++45RO-+T+cells+by+anti-CD28+plus+IL-2:+Induction+of+clonal+expansion+and+priming+for+a+Th2+phenotype.">TCR-independent activation of human CD4+ 45RO- T cells by anti-CD28 plus IL-2: Induction of clonal expansion and priming for a Th2 phenotype.</a> Journal of immunology. 156, 4100-4106 (1996).</li><li>Krug, M. S., Berger, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=First-strand+cDNA+synthesis+primed+with+oligo(dT).">First-strand cDNA synthesis primed with oligo(dT).</a> Methods in enzymology. 152, 316-325 (1987).</li><li>Morozumi, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+detection+of+pathogens+in+clinical+samples+from+patients+with+community-acquired+pneumonia+by+real-time+PCR+with+pathogen-specific+molecular+beacon+probes.">Simultaneous detection of pathogens in clinical samples from patients with community-acquired pneumonia by real-time PCR with pathogen-specific molecular beacon probes.</a> Journal of clinical microbiology. 44, 1440-1446 (2006).</li><li>Smith, P. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measurement+of+protein+using+bicinchoninic+acid.">Measurement of protein using bicinchoninic acid.</a> Analytical biochemistry. 150, 76-85 (1985).</li><li>Wiechelman, K. J., Braun, R. D., Fitzpatrick, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigation+of+the+bicinchoninic+acid+protein+assay:+identification+of+the+groups+responsible+for+color+formation.">Investigation of the bicinchoninic acid protein assay: identification of the groups responsible for color formation.</a> Analytical biochemistry. 175, 231-237 (1988).</li><li>Ursitti, J. A., Mozdzanowski, J., Speicher, D. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroblotting+from+polyacrylamide+gels.">Electroblotting from polyacrylamide gels.</a> Current protocols in protein science. Chapter 10, Unit 10.7 (2001).</li><li>Kricka, L. J., Voyta, J. C., Bronstein, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemiluminescent+methods+for+detecting+and+quantitating+enzyme+activity.">Chemiluminescent methods for detecting and quantitating enzyme activity.</a> Methods in enzymology. 305, 370-390 (2000).</li><li>Noguchi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrative+analysis+of+the+tumorigenic+role+of+TAZ+in+human+non-small+cell+lung+cancer.">An integrative analysis of the tumorigenic role of TAZ in human non-small cell lung cancer.</a> Clinical cancer research : an official journal of the American Association for Cancer Research. 20, 4660-4672 (2014).</li><li>Kasai, H., Allen, J. T., Mason, R. M., Kamimura, T., Zhang, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TGF-beta1+induces+human+alveolar+epithelial+to+mesenchymal+cell+transition+(EMT).">TGF-beta1 induces human alveolar epithelial to mesenchymal cell transition (EMT).</a> Respiratory research. 6, 56 (2005).</li><li>Chen, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrin-mediated+type+II+TGF-beta+receptor+tyrosine+dephosphorylation+controls+SMAD-dependent+profibrotic+signaling.">Integrin-mediated type II TGF-beta receptor tyrosine dephosphorylation controls SMAD-dependent profibrotic signaling.</a> The Journal of clinical investigation. 124, 3295-3310 (2014).</li><li>Saito, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrated+expression+profiling+reveals+target+genes+of+TGF-beta+and+TNF-alpha+possibly+mediated+by+microRNAs+in+lung+cancer+cells.">An integrated expression profiling reveals target genes of TGF-beta and TNF-alpha possibly mediated by microRNAs in lung cancer cells.</a> PloS one. 8, e56587 (2013).</li><li>Dvashi, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+phosphatase+magnesium+dependent+1A+governs+the+wound+healing-inflammation-angiogenesis+cross+talk+on+injury.">Protein phosphatase magnesium dependent 1A governs the wound healing-inflammation-angiogenesis cross talk on injury.</a> The American journal of pathology. 184, 2936-2950 (2014).</li><li>Hallgren, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+ROCK1+dependent+contractility+in+fibroblast+from+chronic+obstructive+pulmonary+disease+patients.">Enhanced ROCK1 dependent contractility in fibroblast from chronic obstructive pulmonary disease patients.</a> Journal of translational medicine. 10, 171 (2012).</li><li>Kobayashi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Matrix+metalloproteinase-9+activates+TGF-beta+and+stimulates+fibroblast+contraction+of+collagen+gels.">Matrix metalloproteinase-9 activates TGF-beta and stimulates fibroblast contraction of collagen gels.</a> American journal of physiology. Lung cellular and molecular physiology. 306, L1006-L1015 (2014).</li><li>Horie, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histamine+induces+human+lung+fibroblast-mediated+collagen+gel+contraction+via+histamine+H1+receptor.">Histamine induces human lung fibroblast-mediated collagen gel contraction via histamine H1 receptor.</a> Experimental lung research. 40, 222-236 (2014).</li><li>Kohyama, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PGD(2)+modulates+fibroblast-mediated+native+collagen+gel+contraction.">PGD(2) modulates fibroblast-mediated native collagen gel contraction.</a> American journal of respiratory cell and molecular biology. 27, 375-381 (2002).</li><li>Muir, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Esophageal+epithelial+cells+acquire+functional+characteristics+of+activated+myofibroblasts+after+undergoing+an+epithelial+to+mesenchymal+transition.">Esophageal epithelial cells acquire functional characteristics of activated myofibroblasts after undergoing an epithelial to mesenchymal transition.</a> Experimental cell research. 330, 102-110 (2015).</li><li>Zhong, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+endoplasmic+reticulum+stress+in+epithelial-mesenchymal+transition+of+alveolar+epithelial+cells:+effects+of+misfolded+surfactant+protein.">Role of endoplasmic reticulum stress in epithelial-mesenchymal transition of alveolar epithelial cells: effects of misfolded surfactant protein.</a> American journal of respiratory cell and molecular biology. 45, 498-509 (2011).</li><li>Liu, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammatory+cytokines+augments+TGF-beta1-induced+epithelial-mesenchymal+transition+in+A549+cells+by+up-regulating+TbetaR-I.">Inflammatory cytokines augments TGF-beta1-induced epithelial-mesenchymal transition in A549 cells by up-regulating TbetaR-I.</a> Cell motility and the cytoskeleton. 65, 935-944 (2008).</li></ol>

יש המחברים אין ניגודי אינטרסים לחשוף.

הפרוטוקול שפותח במחקר זה כולל שני שלבים. השלב הראשון מתבצע על מנת לגרום EMT, ואילו השלב השני הוא assay התכווצות ג&#39;ל. מאז חשוב לאשר תאים עברו EMT, שלב 2 מספק השלמה מצוינת שינויי ביטוי מורפולוגיים גן. מחקרים קודמים הראו כי EMT של תאי A549 הושר על ידי TGF-β1 רק 24; עם זאת, כפי שכבר דווח בעבר 10, טיפול-α TNF משפרים EMT ורכישת סמני תא mesenchymal. הוא חשב כי מנגנוני EMT TGF-β בתיווך הוא הסמאד תלוי 25. TNFα משפר EMT-induced TGF-β1 שמוביל שיפור של התכווצות ג&#39;ל. זה כבר דווח כי מנגנוני TNFα עבור שיפור של EMT TGF-β1-induced אינם זירחון רק של אזור מקשר smad2, אלא גם MAPK איתות תקנה 26. לפיכך, פרוטוקול שפותח במחקר זה כלל Stimulation ידי שני β1-TGF ו-α TNF. הטבעה של תאים שעברו EMT לתוך סוג אני קולגן ג&#39;ל, ומרחף על המדיום, הם היבטים מרכזיים של assay זה (שלב 4). מאחר ג&#39;ל רכה נפגעו בקלות, ויש ממדים שונים בכל צד, בזהירות רבה נדרשת בעת יישום ג&#39;לים למדיום ומדידת הגדלים שלהם. אם קשה לבצע את הצעד הזה, יש שיטה חלופית כדי למדוד את גדלי ג&#39;ל הבאר מבלי להזיז את הג&#39;לים לתוך 60 מ&quot;מ צלחת 27,28. ישנן מספר בעיות נפוצות, הבעיה הראשונה היא כי ג&#39;ל קולגן gelate בקלות ב RT, אז הג&#39;לים לעתים קרובות לעוות כאמור בשלב 4.7. לכן, הצלחת חייבת להיות מזועזעת בעדינות אחרי הליהוק הג&#39;לים לתוך בארות כדי לוודא שהם לובשים צורה גלילית מסודרת. הבעיה השנייה היא שאם כל בועות אוויר להיכנס ג&#39;לים במהלך gelation, אז את גודל ג&#39;ל יהיה אחיד. היזהר שלא תאפשר לאויר bubbles לזהם את הג&#39;לים. ישנם שני הבדלים עיקריים בין השיטה המקורית והשיטה. ההבדלים הראשון הוא כי ריכוז סופי של ג&#39;ל קולגן של השיטה המקורית הוא 0.75 מ&quot;ג / מ&quot;ל ​​אבל זה של שיטה זו הוא 1.75 מ&quot;ג / מ&quot;ל ​​על מנת לאפשר את הג&#39;לים להתכווץ יותר ממה שהם עושים עם השיטה המקורית. ההבדלים השניים הוא השיטה המקורית משתמשת במדיום חופשי בסרום בינוני ג&#39;ל צף אך שיטה זו משתמשת 1% FBS במדיום צף ג&#39;ל על מנת לשמור על כדאיויות תא ולשמור התכווצות תא. את assay התכווצות ג&#39;ל פותח במקור עבור פיברובלסטים הוא אידאל במודל חוץ גופייה על מנת לאמוד את ההתכווצות של תאים שתורמים לתהליך של ריפוי פצע סיסטיק 13. הקובץ המצורף של פיברובלסטים, הקלד 1 קולגן אמור לייצר מתחים מכאניים וכתוצאה מכך מובילה לירידה בגודל של ג&#39;ל קולגן. בנוסף, assay זה לאחרונה נעשה שימושכמודל חוץ גופית לחקר התכווצות של תאים בדרכי הנשימה במחלות דלקתיות, כולל אסטמה ו- COPD 29-31. את assay התכווצות ג&#39;ל ניתן להשוות מבחנים אחרים, כגון מבחני נדידת תאים, בכך שהיא אינה דורשת מכשירים ספציפיים ותערוכות שחזור וכמותית גבוהה. עם זאת, ישנם כמה דיווחים החלת assay התכווצות ג&#39;ל להערכת EMT 32. במחקר זה, ג&#39;לים המכילים תאים שעברו EMT ירד משמעותית בגודל 24 עד 72 שעות לאחר gelation, המציין התכווצות התא. יש עם זאת מגבלות לשיטה זו. הראשונה היא כי ב assay זה, השינוי בגודל של הג&#39;לים להראות סכום של התכווצות של כל התאים את הג&#39;לים. עם זאת, קשה להעריך התכווצות תא בודד בג&#39;לים באמצעות assay. השני הוא כי תאי A549 הוא קו תאים סרטניים, לא תאי אפיתל אדם נורמלים. לכן, קשה להסיק oתוצאות ur ישירות בפתוגנזה של פיברוזיס ריאתי. עם זאת, תאי A549 נמצאים בשימוש נרחב כדי ללמוד את הפונקציות של תאי אפיתל דרכי נשימה, וכמה מחקרים הניבו ראיות של EMT באמצעות תאי A549 כמודל של פיברוזיס ריאתי 33,34. לסיכום, את הסוג שאני קולגן ג&#39;ל המכיל תאי mesenchymal שעברו EMT הופחת בגודל, המציין התכווצות של תאים אלה. לפיכך, assay התכווצות הג&#39;ל צריך להיחשב assay מורחבת במבחנה להעריך רכישת פונקצית התכווצות בתאים בתהליך EMT.

פיברוזיס מעורב בפתוגנזה של מחלות פרוגרסיבי שונות כרוניות, כגון מחלת ריאות אינטרסטיציאלית, סיסטיק לב, שחמת כבד, אי ספיקת כליות סופנית, טרשת מערכתית, ומחלות אוטואימוניות מחלה 1. בין מחלות ריאה אינטרסטיציאלית פיברוזיס ריאתי אידיופתי (IPF) הוא מחלה מתקדמת כרונית ומראה פרוגנוזה גרועה. סימן היכר הפתולוגי של IPF הוא הפיתוח של מוקדי fibroblastic המורכבים פיברובלסטים מופעל myofibroblasts המשויכים הפרוגנוזה. מקורותיה של פיברובלסטים ריאתי כאלו מוצעות לנבוע מכמה תאים mesenchymal, כולל fibroblasts ריאות תושב במקור ומדחסים fibrocytes ממח העצם. לאחרונה, מעבר mesenchymal-אפיתל (EMT) הוצע להיות מזוהה עם ההיווצרות של תאי mesenchymal 2, ולתרום בפתוגנזה של פרעות fibrotic. הוא חשב כי EMT משחק תפקידים חשובים בתהליך של התפתחות עוברת, ריפוי פצעים, והתקדמות של סרטן, כולל חדירת גידול וגרור 3. בעקבות התהליך של EMT, תאי אפיתל להשיג את היכולת של תאי mesenchymal ידי אובדן של סמנים אפיתל, כגון E-cadherin, ועל ידי ביטוי של סמני mesenchymal, כגון vimentin, יקטין שריר α-חלקה (SMA) 4,5. מחקרים קודמים הראו הראיות כי תהליך EMT כבר קשור להתפתחות של סיסטיק רקמות הכליה 6 וריאות 7. בנוסף, דלקת כרונית מקדמת fibrotic מחלת 8; יתר על כן, ציטוקינים דלקתיים כגון חבר superfamily גורם גידול נמק 14 (TNFSF14; LIGHT), tumor necrosis factor (TNF) -α, ו- interleukin-1β, הוכחו לשפר EMT 9-12. assay התכווצות ג&#39;ל קולגן, assay התכווצות תא מבוסס קולגן, אשר פיברובלסטים מוטבעים מהסוג Iקולגן ג&#39;ל תלת ממדית, הוא אידיאל במודל חוץ גופית לצורך הערכה של התכווצות. התכווצות היא אחת הפונקציה האופיינית של פיברובלסטים ותורמת תיקון פצע נורמלי סיסטיק 13. ב assay זה, הוא חשב כי את הקובץ המצורף של פיברובלסטים Type I קולגן באמצעות מנגנוני integrin תלוי אמור לייצר מתח מכאני בתנאים מסוימים, וכתוצאה מכך להוביל להתכווצות רקמות. כאן, בפיתוח של assay התכווצות ג&#39;ל מדווח להיות מותאם על מנת להעריך את רכישת פונקצית התכווצות בתאים שעברו EMT. דו&quot;ח זה מדגים כי assay שונה זו מתאימה להערכת contractility בתאי mesenchymal שעברו EMT.

<table><tbody><tr><td>DMEM</td><td>sigma aldrich</td><td>11965-092</td><td>For A549 medium</td></tr><tr><td>FBS</td><td>GIBCO</td><td>10437</td><td></td></tr><tr><td>Transforming Growth Factor-&amp;beta;1, Human, recombinant</td><td>Wako Laboratory chemicals</td><td>209-16544</td><td></td></tr><tr><td>Recombinant Human TNF-&amp;alpha;</td><td>R&amp;amp;D systems</td><td>210-TA/CF</td><td></td></tr><tr><td>E-Cadherin (24E10) Rabbit mAb</td><td>Cell Signaling Technology</td><td>#3195</td><td>1:3,000 dilution</td></tr><tr><td>Vimentin (D21H3) Rabbit mAb</td><td>Cell Signaling Technology</td><td>#5741</td><td>1:3,000 dilution</td></tr><tr><td>Anti-&amp;alpha;-Tubulin antibody</td><td>sigma aldrich</td><td>T9026</td><td>1:10,000 dilution</td></tr><tr><td>Monoclonal Anti-Actin, &amp;alpha;-Smooth Muscle antibody&amp;nbsp;</td><td>sigma aldrich</td><td>A5228</td><td>1:10,000 dilution</td></tr><tr><td>Anti-N-cadherin antibody</td><td>BD Transduction Laboratories</td><td>#610920</td><td>1:1,000 dilution</td></tr><tr><td>Anti-Mouse IgG, HRP-Linked Whole Ab Sheep (secondary antibody)</td><td>GE Healthcare</td><td>NA931-100UL</td><td>1:20,000 dilution</td></tr><tr><td>Anti-Rabbit IgG, HRP-Linked Whole Ab Donkey (secondary antibody)</td><td>GE Healthcare</td><td>NA934-100UL</td><td>1:20,000 dilution</td></tr><tr><td>Blocking reagent</td><td>GE Healthcare</td><td>RPN418</td><td>2% in TBS-T</td></tr><tr><td>6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid</td><td>corning</td><td>#353046</td><td></td></tr><tr><td>100 mm Cell culture dish</td><td>TPP</td><td>#93100</td><td></td></tr><tr><td>DMEM, powder</td><td>life technologies</td><td>12100-046</td><td>For 4&amp;times; DMEM</td></tr><tr><td>Type 1 collagen gel</td><td>Nitta gelatin</td><td>Cellmatrix type I-A</td><td></td></tr><tr><td>24 Well cell culture plate</td><td>AGC TECHNO GLASS</td><td>1820-024</td><td></td></tr><tr><td>Gel Documentation System&amp;nbsp;</td><td>ATTO</td><td>AE-6911FXN</td><td>Gel imager</td></tr><tr><td>Gel analyzing software</td><td>ATTO</td><td>Densitograph, ver. 3.00</td><td>analysing software bundled with AE-6911FXN</td></tr><tr><td>Trypsin-EDTA (0.05%), phenol red</td><td>life technologies</td><td>25300054</td><td></td></tr><tr><td>24 Well Plates, Non-Treated</td><td>IWAKI</td><td>1820-024</td><td></td></tr><tr><td>Trypan Blue Solution, 0.4%</td><td>life technologies</td><td>15250-061</td><td></td></tr><tr><td>RNA extraction kit</td><td>Qiagen</td><td>74106</td><td></td></tr><tr><td>Reverse transcriptase</td><td>life technologies</td><td>18080044</td><td></td></tr><tr><td>Real time PCR system</td><td>Stratagene</td><td>Mx-3000P</td><td></td></tr><tr><td>SYBR green PCR kit</td><td>Qiagen</td><td>204145</td><td></td></tr><tr><td>Protease Inhibitor Cocktail (100x)</td><td>life technologies</td><td>78429</td><td></td></tr><tr><td>PVDF membrane</td><td>ATTO</td><td>2392390</td><td></td></tr><tr><td>Protein assay kit</td><td>bio-rad</td><td>5000006JA&amp;nbsp;</td><td></td></tr><tr><td>Polyacrylamide gel</td><td>ATTO</td><td>2331810</td><td></td></tr><tr><td>Western blotting detection reagent</td><td>GE Healthcare</td><td>RPN2232</td><td></td></tr><tr><td>Cold CCD camera</td><td>ATTO</td><td>Ez-Capture MG/ST</td><td></td></tr><tr><td>Trypsin inhibitor</td><td>sigma aldrich</td><td>T9003-100MG</td><td></td></tr><tr><td>Polyoxyethylene (20)Sorbitan Monolaurate</td><td>Wako Laboratory chemicals</td><td>163-11512</td><td></td></tr><tr><td>Polyoxyethylene (9) octyiphenyl ether</td><td>Wako Laboratory chemicals</td><td>141-08321</td><td></td></tr></tbody></table>

development of an in vitro assay to evaluate contractile function of mesenchymal cells that underwent epithelial-mesenchymal transition

Fibrosis is often involved in the pathogenesis of various chronic progressive diseases such as interstitial pulmonary disease. Pathological hallmark is the formation of fibroblastic foci, which is associated with the disease severity. Mesenchymal cells consisting of the fibroblastic foci are proposed to be derived from several cell sources, including originally resident intrapulmonary fibroblasts and circulating fibrocytes from bone marrow. Recently, mesenchymal cells that underwent epithelial-mesenchymal transition (EMT) have been also supposed to contribute to the pathogenesis of fibrosis. In addition, EMT can be induced by transforming growth factor &#946;, and EMT can be enhanced by pro-inflammatory cytokines like tumor necrosis factor &#945;. The gel contraction assay is an ideal in vitro model for the evaluation of contractility, which is one of the characteristic functions of fibroblasts and contributes to wound repair and fibrosis. Here, the development of a gel contraction assay is demonstrated for evaluating contractile ability of mesenchymal cells that underwent EMT.

במהלך EMT, תאי אפיתל לאבד סמנים אפיתל, כמו E-cadherin, ולהשיג ביטוי של סמנים mesenchymal, כגון vimentin ו α-שריר חלק אקטין 4,5. דגירה של תאי אפיתל ריאה האנושית A549 עם-β1 TGF ו- TNF-α גורמת EMT. הופעתו של תאי A549 נורמלים הם אבן חלוק כמו צורה וצורה משולשת היא מאפיין של תאי אפיתל (איור 3 א), אלא לאחר מגורה עם TGF-β1 ו- TNF-α, את המראה השתנה לצורתו ציר הארוכה דומה mesenchymal תאים (איור 3). הביטוי של סמנים אפיתל mesenchymal הוערך כדי לאשר התאים עברו EMT. ביטוי mRNA יחסית חושב עם שיטת ΔΔCt. נתונים הפרט היה מנורמל נגד dehydrogenase glyceraldehyde-3-phosphate (GAPDH) כי הוא משק gפנטן. תאים A549 שטופלו-β1 TGF ו-α TNF במשך 48 שעות היה מופחת באופן משמעותי ביטוי CDH1 והגדילה משמעותית הביטוי של VIM ו ACTA2 (איור 4 א). רצפים פריימרים המשמשים Q-PCR מוצגים Table1. כפי שניתן לראות בתרשים 4 ב &#39;, גירוי עם TGF-β1 ו- TNF-α ביטוי E-cadherin המוחלש, ואילו הביטוי של vimentin, N-cadherin, יקטין שריר α-החלקה הושר. את assay התכווצות ג&#39;ל בוצע על מנת להעריך את ההתכווצות של תאים שעברו EMT. לאחר גרימת EMT עם-β1 TGF ו- TNF-α, תאים נוצקו לתוך ג&#39;ל קולגן וטופחו במשך 72 שעות ב מדיה המכילה TGF-β1 ו- TNF-α, או PBS. כפי שניתן לראות בתרשים 5A, ג&#39;לים המכילים תאים שטופלו TGF-β1 ו- TNF-α היו קטנים יותר מאשר ג&#39;לים מלאה המכיל תאים שטופלו PBS. כדי קואהntify השינויים בגודל ג&#39;ל, ג&#39;ל נותחו באמצעות נתח ג&#39;ל 0, 24, 48, ו -72 שעות לאחר הטיפול. לאחר 72 שעות, בגדלים של ג&#39;ל המכיל תאים שטופלו-β1 TGF ו- TNF-α הופחתו באופן משמעותי לעומת הג&#39;לים הביקורת (איור 5). גם אנחנו אישר כי ג&#39;ל המכיל תאים שטופלו-β1 TGF לבד היו קטנים יותר מאשר ג&#39;ל שליטה אך לא היו קטנים יותר מאשר את הג&#39;לים שטופלו-β1 TGF ו-α TNF (מידע לא מוצג). <img alt="איור 1" src="/files/ftp_upload/53974/53974fig1.jpg" /> איור 1. איור משלים להכנת ג&#39;לי. תמונות אלו מראות את הג&#39;לים יצוקים לתוך בארות. מדיום ג&#39;ל המכיל את התאים הוא צמיג ויכול ג&#39;ל בקלות ובצורת סהר טופס הבאר. (א) את התמונה השמאלית מראה כי ג&#39;לים casted כראוי, ואת התמונה הימנית מראה את הסכימה של &quot;בצורת גלילית מסודרת&quot;. (B &lt;/ Strong&gt;) את התמונה השמאלית מראה כי ג&#39;לים לעוות, והתמונה מימין מראה כי בועות אוויר לזהם את הג&#39;לים. (C) הג&#39;לים רכים, כך נפגע בקלות ובדרך כלל לעוות כמו &quot;פק-מן&quot;. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53974/53974fig1large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 2" src="/files/ftp_upload/53974/53974fig2.jpg" /> איור 2. שלבים למדידת ג&#39;ל גודל. (א) מערכת תיעוד ג&#39;ל מורכב PC ומערכת הדמיה ג&#39;ל. (ב) &quot;כפתור הרכישה&quot;, ותמונה של ג&#39;ל. (ג) &quot;כפתור זיהוי&quot;, והחלון להתאמת באזור המדידה (עיגול צהוב). (ד) &quot;כפתור האיתור אוטומטי&quot;, והתוכנה עושות מפת חום של הג&#39;לים מתמונה לדה<html> tect את קווי המתאר של ג&#39;ל. (E) התוכנה מחלצת את קווי המתאר של ג&#39;ל על ידי עיבוד תמונה, ומחשב באזורים מוקפים המתווה. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53974/53974fig2large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 3" src="/files/ftp_upload/53974/53974fig3.jpg" /> איור 3. מורפולוגיות של תאי נגרם EMT. Epithelia הריאה האנושי A549 היה מצופה בצפיפות של 1.0 × 10 5 תאים / גם בצלחת 6 באר וטופח עם או בלי 5 ng / ml TGF-β1 ו -10 ng / ml TNF-α במשך 48 שעות, ואחריו הדמיה מיקרוסקופית לעומת שלב. (א) ו- (ב) הם תמונות שהושגו לפי × 200. ברי המידה (א) ו- (ב), 100 מיקרומטר.<html> t = &quot;_ blank&quot;&gt; לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו. <img alt="איור 4" src="/files/ftp_upload/53974/53974fig4.jpg" /> איור 4. גירוי EMT עם-β1 TGF ו-α TNF. (א) qRT-PCR ניתוח של ביטוי סמן EMT (CDH1, VIM, ו ACTA2). (ב) כתם המערבי מראה את הביטוי של-cadherin E, N-cadherin, vimentin, ואת אלפא שריר חלק אקטין חלבונים בתאים A549 מגורה עם או בלי TGF-β1 ו-α TNF. α-טובולין שימש הבקרה הפנימית. תאי A549 היו בתרבית כמו באיור 1. N = 3 ניסויים בלתי תלויים. ** P &lt;0.01; ברי שגיאה מייצגים SEM. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53974/53974fig4large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <html> Iles / ftp_upload / 53,974 / 53974fig5.jpg &quot;/&gt; איור 5. תאים שעברו EMT הנרכשות התכווצות. תאי A549 היו מצופים בצפיפות של 1.0 x 10 6 תאים / תבשיל במנות 10 סנטימטרים וטופחו עם או בלי 5 ng / ml TGF-β1 ו -10 ng / ml TNF-α במשך 48 שעות. תאים נוצקו מכן לתוך 500 μl של מדיום המכיל 1.75 מ&quot;ג / קולגן ג&#39;ל מ&quot;ל בצפיפות של 3.0 × 10 5 תאים / גם בצלחת 24 גם. לאחר היווצרות קריש, הם נוספו בינוני עם או בלי 5 ng / ml TGF-β1 ו -10 TNF-α ng / ml ב 60 מנות מ&quot;מ וטופחו במשך 72 שעות ואחריו הדמיה (א). בגדלי ג&#39;ל נמדדו לאחר 0, 24, 48, ו -72 שעות באמצעות מערכת ניתוח תמונה. N = 9 ניסויים בלתי תלויים (B). ** P &lt;0.01; ברי שגיאה מייצגים SEM. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53974/53974fig5large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <table border="1" fo:k</html style=";text-align:right;direction:rtl"><html> יפ-together.within-page = &quot;1&quot; FO: keep-עם-next.within-page = &quot;תמיד&quot;&gt; <tbody><tr><td> ג&#39;ין שם </td><td colspan="2"> קדימה 5 &#39;→ 3&#39; </td><td colspan="2"> הפוך 5 &#39;→ 3&#39; </td></tr><tr><td> ACTA2 </td><td colspan="2"> GCACCCAGCACCATGAAGA </td><td colspan="2"> ACCGATCCAGACAGAGTATTT </td></tr><tr><td> GAPDH </td><td colspan="2"> GGTGAAGGTCGGAGTCAACGGA </td><td colspan="2"> GAGGGATCTCGCTCCTGGAAGA </td></tr><tr><td> מֶרֶץ </td><td colspan="2"> GACAATGCGTCTCTGGCACGTCTT </td><td colspan="2"> TTCTTCTGCCTCCTGCAGGTTCTT </td></tr><tr><td> CDH1 </td><td colspan="2"> CCCATCAGCTGCCCAGAAAATGAA </td><td colspan="2"> CTGTCACCTTCAGCCATCCTGTTT </td></tr></tbody></table> רצפים בטבלה 1. פריימר. רצפים פריימר המשמש qRT-PCR. GAPDH שמש בקרה פנימית. <table border="1" fo:keep-</html style=";text-align:right;direction:rtl">together.within-page = &quot;1&quot; FO: keep-עם-next.within-page = &quot;תמיד&quot;&gt; <tbody><tr><td> הצפת תמוגה: הצפת ריפה </td><td></td></tr><tr><td> 20 mM Tris-HCl pH 7.5 </td><td></td></tr><tr><td> 150 מ&quot;מ NaCl </td><td></td></tr><tr><td> 1 mM EDTA </td><td></td></tr><tr><td> 1% Polyoxyethylene (9) אתר octyiphenyl </td><td></td></tr><tr><td> 0.1% Na-deoxycholate </td><td></td></tr><tr><td> 0.1% SDS </td><td></td></tr><tr><td> חסימת הצפה </td><td></td></tr><tr><td> 1 מגיב חסימת% חיץ לשטוף </td><td></td></tr><tr><td> חיץ שטפי: חיץ TBST </td><td></td></tr><tr><td> NaCl </td><td> 45 גרם </td></tr><tr><td> 1 M טריס pH 7.4 </td><td> 50 מ&quot;ל </td></tr><tr><td> Polyoxyethylene (20) monolaurate Sorbitan </td><td> 2.5 מ&quot;ל </td></tr><tr><td> לזקק מים </td><td> להוסיף 5 L </td></tr><tr><td&gt; סה&quot;כ </td><td> 5 L </td></tr></tbody></table> טבלה 2. מרכיבי חוצצים משומשים. מרכיבי התפרקות חיץ חסימת חיץ לשטוף.

Watch this Scientific Journal Video about Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition at JoVE.com

Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition

Here, we describe the development and application of a gel contraction assay for evaluating contractile function in mesenchymal cells that underwent epithelial-mesenchymal transition.

פיתוח של<em&gt; במבחנה</em&gt; Assay לאבחון תפקוד התכווצות של תאי mesenchymal שעבר אפיתל-mesenchymal מעבר

Fibrosis is often involved in the pathogenesis of various chronic progressive diseases such as interstitial pulmonary disease. Pathological hallmark is ...

development-an-vitro-assay-to-evaluate-contractile-function

Nanyang Technological University

Research

JoVE Journal

Developmental Biology

Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition

12.1K Views.  The University of Tokyo Hospital. Here, we describe the development and application of a gel contraction assay for evaluating contractile function in mesenchymal cells that underwent epithelial-mesenchymal transition.

Video: Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition

An Enzyme- and Serum-free Neural Stem Cell Culture Model for EMT Investigation Suited for Drug Discovery

Epithelial to mesenchymal transition (EMT) describes the process of epithelium transdifferentiating into mesenchyme. EMT is a fundamental process during embryonic development that also commonly occurs in glioblastoma, the most frequent malignant brain tumor. EMT has also been observed in multiple carcinomas outside the brain including breast cancer, lung cancer, colon cancer, gastric cancer. EMT is centrally linked to malignancy by promoting migration, invasion and metastasis formation. The mechanisms of EMT induction are not fully understood. Here we describe an in vitro system for standardized isolation of cortical neural stem cells (NSCs) and subsequent EMT-induction. This system provides the flexibility to use either single cells or explant culture. In this system, rat or mouse embryonic forebrain NSCs are cultured in a defined medium, devoid of serum and enzymes. The NSCs expressed Olig2 and Sox10, two transcription factors observed in oligodendrocyte precursor cells (OPCs). Using this system, interactions between FGF-, BMP- and TGF&#946;-signaling involving Zeb1, Zeb2, and Twist2 were observed where TGF&#946;-activation significantly enhanced cell migration, suggesting a synergistic BMP-/TGF&#946;-interaction. The results point to a network of FGF-, BMP- and TGF&#946;-signaling to be involved in EMT induction and maintenance. This model system is relevant to investigate EMT in vitro. It is cost-efficient and shows high reproducibility. It also allows for the comparison of different compounds with respect to their migration responses (quantitative distance measurement), and high-throughput screening of compounds to inhibit or enhance EMT (qualitative measurement). The model is therefore well suited to test drug libraries for substances affecting EMT.

Epithelial to mesenchymal transition (EMT) allows cancers to become invasive. To investigate EMT, a neural stem cell (NSC)-based in vitro model devoid of serum and enzymes is described. This standardized system allows quantitative and qualitative assessment of cell migration, gene and protein expression. The model is suited for drug discovery.

Enzyme- ואת הסרום ללא דגם תרבית תאי גזע עצבי לחקירות EMT המתאימים גילוי תרופות

Epithelial to mesenchymal transition (EMT) describes the process of epithelium transdifferentiating into mesenchyme. EMT is a fundamental process during ...

In vitro Mesothelial Clearance Assay that Models the Early Steps of Ovarian Cancer Metastasis

Ovarian cancer is the fifth leading cause of cancer related deaths in the United States1. Despite a positive initial response to therapies, 70 to 90 percent of women with ovarian cancer develop new metastases, and the recurrence is often fatal2. It is, therefore, necessary to understand how secondary metastases arise in order to develop better treatments for intermediate and late stage ovarian cancer. Ovarian cancer metastasis occurs when malignant cells detach from the primary tumor site and disseminate throughout the peritoneal cavity. The disseminated cells can form multicellular clusters, or spheroids, that will either remain unattached, or implant onto organs within the peritoneal cavity3 (Figure 1, Movie 1). 
All of the organs within the peritoneal cavity are lined with a single, continuous, layer of mesothelial cells4-6 (Figure 2). However, mesothelial cells are absent from underneath peritoneal tumor masses, as revealed by electron micrograph studies of excised human tumor tissue sections3,5-7 (Figure 2). This suggests that mesothelial cells are excluded from underneath the tumor mass by an unknown process. 
Previous in vitro experiments demonstrated that primary ovarian cancer cells attach more efficiently to extracellular matrix than to mesothelial cells8, and more recent studies showed that primary peritoneal mesothelial cells actually provide a barrier to ovarian cancer cell adhesion and invasion (as compared to adhesion and invasion on substrates that were not covered with mesothelial cells)9,10. This would suggest that mesothelial cells act as a barrier against ovarian cancer metastasis. The cellular and molecular mechanisms by which ovarian cancer cells breach this barrier, and exclude the mesothelium have, until recently, remained unknown. 
Here we describe the methodology for an in vitro assay that models the interaction between ovarian cancer cell spheroids and mesothelial cells in vivo (Figure 3, Movie 2). Our protocol was adapted from previously described methods for analyzing ovarian tumor cell interactions with mesothelial monolayers8-16, and was first described in a report showing that ovarian tumor cells utilize an integrin &#x2013;dependent activation of myosin and traction force to promote the exclusion of the mesothelial cells from under a tumor spheroid17. This model takes advantage of time-lapse fluorescence microscopy to monitor the two cell populations in real time, providing spatial and temporal information on the interaction. The ovarian cancer cells express red fluorescent protein (RFP) while the mesothelial cells express green fluorescent protein (GFP). RFP-expressing ovarian cancer cell spheroids attach to the GFP-expressing mesothelial monolayer. The spheroids spread, invade, and force the mesothelial cells aside creating a hole in the monolayer. This hole is visualized as the negative space (black) in the GFP image. The area of the hole can then be measured to quantitatively analyze differences in clearance activity between control and experimental populations of ovarian cancer and/ or mesothelial cells. This assay requires only a small number of ovarian cancer cells (100 cells per spheroid X 20-30 spheroids per condition), so it is feasible to perform this assay using precious primary tumor cell samples. Furthermore, this assay can be easily adapted for high throughput screening.

In vitro Mesothelial Clearance Assay that Models the Early Steps of Ovarian Cancer Metastasis

The mesothelial clearance assay described here takes advantage of fluorescently labeled cells and time-lapse video microscopy to visualize and quantitatively measure the interactions of ovarian cancer multicellular spheroids and mesothelial cell monolayers. This assay models the early steps of ovarian cancer metastasis.

ב Assay עמילות חוץ גופית mesothelial כי מודלים השלבים המוקדמים של גרורות סרטן השחלות

Ovarian cancer is the fifth leading cause of cancer related deaths in the United States1. Despite a positive initial response to therapies, 70 to 90 ...

Medicine

The Aortic Ring Co-culture Assay: A Convenient Tool to Assess the Angiogenic Potential of Mesenchymal Stromal Cells In Vitro

Angiogenesis is a complex, highly regulated process responsible for providing and maintaining adequate tissue perfusion. Insufficient vasculature maintenance and pathological malformations can result in severe ischemic diseases, while overly abundant vascular development is associated with cancer and inflammatory disorders. A promising form of pro-angiogenic therapy is the use of angiogenic cell sources, which can provide regulatory factors as well as physical support for newly developing vasculature.
Mesenchymal Stromal Cells (MSCs) are extensively investigated candidates for vascular regeneration due to their paracrine effects and their ability to detect and home to ischemic or inflamed tissues. In particular, first trimester human umbilical cord perivascular cells (FTM HUCPVCs) are a highly promising candidate due to their pericyte-like properties, high proliferative and multilineage potential, immune-privileged properties, and robust paracrine profile. To effectively evaluate potentially angiogenic regenerative cells, it is a requisite to test them in reliable and &#34;translatable&#34; pre-clinical assays. The aortic ring assay is an ex vivo angiogenesis model that allows for easy quantification of tubular endothelial structures, provides accessory supportive cells and extracellular matrix (ECM) from the host, excludes inflammatory components, and is fast and inexpensive to set up. This is advantageous when compared to in vivo models (e.g., corneal assay, Matrigel plug assay); the aortic ring assay can track the administered cells and observe intercellular interactions while avoiding xeno-immune rejection.
We present a protocol for a novel application of the aortic ring assay, which includes human MSCs in co-cultures with developing rat aortic endothelial networks. This assay allows for the analysis of the MSC contribution to tube formation and development through physical pericyte-like interactions and of their potency for actively migrating to sites of angiogenesis, and for evaluating their ability to perform and mediate ECM processing. This protocol provides further information on changes in MSC phenotype and gene expression following co-culture.

The Aortic Ring Co-culture Assay: A Convenient Tool to Assess the Angiogenic Potential of Mesenchymal Stromal Cells In Vitro

Here, we present a novel application of the aortic ring assay where prelabelled mesenchymal cells are co-cultured with rat aorta-derived endothelial networks. This novel method allows visualization of Mesenchymal Stromal Cells (MSCs) homing and integration with endothelial networks, quantification of network properties, and evaluation of MSC immunophenotypes and gene expression.

וזמינותו תרבות משותפת הטבעת אבי העורקים: כלי נוח כדי להעריך את הפוטנציאל אנגיוגנזה של תאי סטרומה Mesenchymal במבחנה

Angiogenesis is a complex, highly regulated process responsible for providing and maintaining adequate tissue perfusion. Insufficient vasculature ...

Utilization of Microscale Silicon Cantilevers to Assess Cellular Contractile Function In Vitro

The development of more predictive and biologically relevant in vitro assays is predicated on the advancement of versatile cell culture systems which facilitate the functional assessment of the seeded cells. To that end, microscale cantilever technology offers a platform with which to measure the contractile functionality of a range of cell types, including skeletal, cardiac, and smooth muscle cells, through assessment of contraction induced substrate bending. Application of multiplexed cantilever arrays provides the means to develop moderate to high-throughput protocols for assessing drug efficacy and toxicity, disease phenotype and progression, as well as neuromuscular and other cell-cell interactions. This manuscript provides the details for fabricating reliable cantilever arrays for this purpose, and the methods required to successfully culture cells on these surfaces. Further description is provided on the steps necessary to perform functional analysis of contractile cell types maintained on such arrays using a novel laser and photo-detector system. The representative data provided highlights the precision and reproducible nature of the analysis of contractile function possible using this system, as well as the wide range of studies to which such technology can be applied. Successful widespread adoption of this system could provide investigators with the means to perform rapid, low cost functional studies in vitro, leading to more accurate predictions of tissue performance, disease development and response to novel therapeutic treatment.

Utilization of Microscale Silicon Cantilevers to Assess Cellular Contractile Function In Vitro

This protocol describes the use of microscale silicon cantilevers as pliable culture surfaces for measuring the contractility of muscle cells in vitro. Cellular contraction causes cantilever bending, which can be measured, recorded, and converted into readouts of force, providing a non-invasive and scalable system for measuring contractile function in vitro.

ניצול של זיזי סיליקון המיקרוסקופים כדי להעריך את התפקוד נייד התכווצות<em&gt; במבחנה</em

The development of more predictive and biologically relevant in vitro assays is predicated on the advancement of versatile cell culture systems which ...

Bioengineering

High Throughput Traction Force Microscopy Using PDMS Reveals Dose-Dependent Effects of Transforming Growth Factor-&#946; on the Epithelial-to-Mesenchymal Transition

Cellular contractility is essential in diverse aspects of biology, driving processes that range from motility and division, to tissue contraction and mechanical stability, and represents a core element of multi-cellular animal life. In adherent cells, acto-myosin contraction is seen in traction forces that cells exert on their substrate. Dysregulation of cellular contractility appears in a myriad of pathologies, making contractility a promising target in diverse diagnostic approaches using biophysics as a metric. Moreover, novel therapeutic strategies can be based on correcting the apparent malfunction of cell contractility. These applications,&#160;however, require direct quantification of these forces.
We have developed silicone elastomer-based traction force microscopy (TFM) in a parallelized multi-well format. Our use of a silicone rubber, specifically polydimethylsiloxane (PDMS), rather than the commonly employed hydrogel polyacrylamide (PAA) enables us to make robust and inert substrates with indefinite shelf-lives requiring no specialized storage conditions. Unlike pillar-PDMS based approaches that have a modulus in the GPa range, the PDMS used here is very compliant, ranging from approximately 0.4 kPa to 100 kPa. We create a high-throughput platform for TFM by partitioning these large monolithic substrates spatially into biochemically independent wells, creating a multi-well platform for traction force screening that is compatible with existing multi-well systems.
In this manuscript, we use this multi-well traction force system to examine the Epithelial to Mesenchymal Transition (EMT); we induce EMT in NMuMG cells by exposing them to TGF-&#946;, and to quantify the biophysical changes during EMT. We measure the contractility as a function of concentration and duration of TGF-&#946; exposure. Our findings here demonstrate the utility of parallelized TFM in the context of disease biophysics.

We present a high throughput traction force assay fabricated with silicone rubber (PDMS). This novel assay is suitable for studying physical changes in cell contractility during various biological and biomedical processes and diseases. We demonstrate this method's utility by measuring a TGF-&#946; dependent increase in contractility during the epithelial-to-mesenchymal transition.

תפוקה גבוהה המתיחה כוח מיקרוסקופ באמצעות PDMS מגלה השפעות תלויי מינון של שינוי מקדם הצמיחה-β על המעבר אפיתל-to-מעבר משנה

Cellular contractility is essential in diverse aspects of biology, driving processes that range from motility and division, to tissue contraction and ...

An Explant Assay for Assessing Cellular Behavior of the Cranial Mesenchyme

The central nervous system is derived from the neural plate that undergoes a series of complex morphogenetic movements resulting in formation of the neural tube in a process known as neurulation. During neurulation, morphogenesis of the mesenchyme that underlies the neural plate is believed to drive neural fold elevation. The cranial mesenchyme is comprised of the paraxial mesoderm and neural crest cells. The cells of the cranial mesenchyme form a pourous meshwork composed of stellate shaped cells and intermingling extracellular matrix (ECM) strands that support the neural folds. During neurulation, the cranial mesenchyme undergoes stereotypical rearrangements resulting in its expansion and these movements are believed to provide a driving force for neural fold elevation. However, the pathways and cellular behaviors that drive cranial mesenchyme morphogenesis remain poorly studied. Interactions between the ECM and the cells of the cranial mesenchyme underly these cell behaviors. Here we describe a simple ex vivo explant assay devised to characterize the behaviors of these cells. This assay is amendable to pharmacological manipulations to dissect the signaling pathways involved and live imaging analyses to further characterize the behavior of these cells. We present a representative experiment demonstrating the utility of this assay in characterizing the migratory properties of the cranial mesenchyme on a variety of ECM components.

The cranial mesenchyme undergoes dramatic morphogenic movements that likely provides a driving force for elevation of the neural folds1,2. Here we describe a simple ex vivo explant assay to characterize the cellular behaviors of the cranial mesenchyme during neurulation. This assay has numerous applications including being amenable to pharmacological manipulations and live imaging analyses.

Assay Explant להערכת התנהגות ניידת של mesenchyme הגולגולת

The central nervous system is derived from the neural plate that undergoes a series of complex morphogenetic movements resulting in formation of the ...

Biology

Simplified, High-throughput Analysis of Single-cell Contractility using Micropatterned Elastomers

Cellular contractile force generation is a fundamental trait shared by virtually all cells. These contractile forces are crucial to proper development, function at both the cellular and tissue levels,and regulate the mechanical systems in the body. Numerous biological processes are force-dependent, including motility, adhesion, and division of single-cells, as well as contraction and relaxation of organs such as the heart, bladder, lungs, intestines, and uterus. Given its importance in maintaining proper physiological function, cellular contractility can also drive disease processes when exaggerated or disrupted. Asthma, hypertension, preterm labor, fibrotic scarring, and underactive bladder are all examples of mechanically driven disease processes that could potentially be alleviated with proper control of cellular contractile force. Here, we present a comprehensive protocol for utilizing a novel microplate-based contractility assay technology known as fluorescently labeled elastomeric contractible surfaces (FLECS), that provides simplified and intuitive analysis of single-cell contractility in a massively scaled manner. Herein, we provide a step-wise protocol for obtaining two six-point dose-response curves describing the effects of two contractile inhibitors on the contraction of primary human bladder smooth muscle cells in a simple procedure utilizing just a single FLECS assay microplate, to demonstrate proper technique to users of the method. Using FLECS Technology, all researchers with basic biological laboratories and fluorescent microscopy systems gain access to studying this fundamental but difficult-to-quantify functional cell phenotype, effectively lowering the entry barrier into the field of force biology and phenotypic screening of contractile cell force.

This work presents a flexible protocol for utilizing fluorescently labeled elastomeric contractible surfaces (FLECS) Technology in microwell format for simplified, hands-off quantification of single-cell contractile forces based on visualized displacements of fluorescent protein micropatterns.

ניתוח פשוט בעל תפוקה גבוהה של התכווצות של תאים חד-תאיים באמצעות אלסטומרים מיקרו-מרופדים

Cellular contractile force generation is a fundamental trait shared by virtually all cells. These contractile forces are crucial to proper development, ...

Induction and Analysis of Epithelial to Mesenchymal Transition

Epithelial to mesenchymal transition (EMT) is essential for proper morphogenesis during development. Misregulation of this process has been implicated as a key event in fibrosis and the progression of carcinomas to a metastatic state. Understanding the processes that underlie EMT is imperative for the early diagnosis and clinical control of these disease states. Reliable induction of EMT in vitro is a useful tool for drug discovery as well as to identify common gene expression signatures for diagnostic purposes. Here we demonstrate a straightforward method for the induction of EMT in a variety of cell types. Methods for the analysis of cells pre- and post-EMT induction by immunocytochemistry are also included. Additionally, we demonstrate the effectiveness of this method through antibody-based array analysis and migration/invasion assays.

A straightforward method is described for the induction of epithelial to mesenchymal transition (EMT) in a variety of cell types. Methods for the analysis of cells in EMT states by immunocytochemistry are included.

אינדוקציה וניתוח של אפיתל לmesenchymal מעבר

Epithelial  to mesenchymal transition (EMT) is essential for proper morphogenesis during  development. Misregulation of this  process has been implicated ...

In Vitro Assessment of Cardiac Function Using Skinned Cardiomyocytes

In this article, we describe the steps required to isolate a single permeabilized (&#34;skinned&#34;) cardiomyocyte and attach it to a force-measuring apparatus and a motor to perform functional studies. These studies will allow measurement of cardiomyocyte stiffness (passive force) and its activation with different calcium (Ca2+)-containing solutions to determine, amongst others: maximum force development, myofilament Ca2+-sensitivity (pCa50), cooperativity (nHill) and the rate of force redevelopment (ktr). This method also enables determination of the effects of drugs acting directly on myofilaments and of the expression of exogenous recombinant proteins on both active and passive properties of cardiomyocytes. Clinically, skinned cardiomyocyte studies highlight the pathophysiology of many myocardial diseases and allow in vitro assessment of the impact of therapeutic interventions targeting the myofilaments. Altogether, this technique enables the clarification of cardiac pathophysiology by investigating correlations between in vitro and in vivo parameters in animal models and human tissue obtained during open heart or transplant surgery.

This protocol aims to describe step-by-step the technique of extraction and assessment of cardiac function using skinned cardiomyocytes. This methodology allows measurement and acutemodulation of myofilament function using small frozen biopsies that can be collected from different cardiac locations, from mice to men.

להערכת ויטרו של תפקוד הלב באמצעות קרדיומיוציטים עור

In this article, we describe the steps required to isolate a single permeabilized (&#34;skinned&#34;) cardiomyocyte and attach it to a force-measuring ...

Isolation of Primary Patient-specific Aortic Smooth Muscle Cells and Semiquantitative Real-time Contraction Measurements In Vitro

Smooth muscle cells (SMCs) are the predominant cell type in the aortic media. Their contractile machinery is important for the transmission of force in the aorta and regulates vasoconstriction and vasodilation. Mutations in genes encoding for the SMC contractile apparatus proteins are associated with aortic diseases, such as thoracic aortic aneurysms. Measuring SMC contraction in vitro is challenging, especially in a high-throughput manner, which is essential for screening patient material. Currently available methods are not suitable for this purpose. This paper presents a novel method based on electric cell-substrate impedance sensing (ECIS). First, an explant protocol is described to isolate patient-specific human primary SMCs from aortic biopsies and patient-specific human primary dermal fibroblasts for the study of aortic aneurysms. Next, a detailed description of a new contraction method is given to measure the contractile response of these cells, including the subsequent analysis and suggestion for comparing different groups. This method can be used to study the contraction of adherent cells in the context of translational (cardiovascular) studies and patient and drug screening studies.

Isolation of Primary Patient-specific Aortic Smooth Muscle Cells and Semiquantitative Real-time Contraction Measurements In Vitro

This paper describes an explant culture-based method for the isolation and culturing of primary, patient-specific human aortic smooth muscle cells and dermal fibroblasts. Furthermore, a novel method is presented for measuring cell contraction and subsequent analysis, which can be used to study patient-specific differences in these cells.

בידוד של תאי שריר חלק אבי העורקים העיקריים הספציפיים למטופל ומדידות כיווץ חצי-קוונטיטיביות בזמן אמת במבחנה

Smooth muscle cells (SMCs) are the predominant cell type in the aortic media. Their contractile machinery is important for the transmission of force in ...

פיתוח של

Summary

Explore More Videos

Chapters in this video