The authors would like to acknowledge Hans de Graaf and Tomas Veenendaal for their technical assistance in culturing the ECs.

Etica dichiarazione: I vasi sanguigni utilizzati in questo studio sono state raccolte come materiale in eccesso ottenuti da cadaveri freschi canino (n = 4) da cani sani eutanasia per altre ricerche non correlate (politica Università 3R). vasi sanguigni aberranti (shunt porto intra- e extra-epatiche, n = 1 ciascuno) sono state raccolte post mortem dopo consenso informato dei proprietari di cani presentati alla clinica universitaria per Animali da Compagnia di Università di Utrecht. 1. Isolamento e la coltura di cellule primarie Canine endoteliali <ol><li> Pre-coat 6 pozzetti con 2 ml / pozzetto 0,5% w / v di gelatina e lasciare per 2 ore in un incubatore con atmosfera umidificata al 5% di CO 2 a 37 ° C. Rimuovere soluzione di gelatina in eccesso prima semina delle cellule primarie. </li><li> Asetticamente rimuovere il vaso sanguigno (s) di interesse (ad esempio, aorta, vena cava, vena porta) a partire da un fresco canino cadavere (Figura 1A). Mantenere l&#39;anatomia del sistema naveponendo pinze diritte su entrambe le estremità del vaso di interesse. Evitare manipolazioni inutili del tessuto con una pinza per evitare danni alle cellule endoteliali. <ol><li> Tagliare la nave bloccato su entrambe le estremità con le forbici chirurgiche e togliere dal cadavere. Trasporti in soluzione salina bilanciata di Hank (HBSS) su ghiaccio. NOTA: Una lunghezza imbarcazione di circa 5 cm è preferito per questa procedura, ma quelli che misurano 1 cm fornirà anche abbastanza cellule per la cultura. </li></ol></li><li> Trasferire il vaso sanguigno di una capsula di Petri riempite con HBSS ghiacciata. Utilizzando le forbici chirurgiche, rimuovere eventuali tessuti aderenti e grasso dall&#39;esterno del recipiente, mantenendo il recipiente stesso intatta (Figura 1B). Assicurarsi che il vaso è ben visibile in ogni momento durante il taglio: tirare a parte il tessuto circostante con un morsetto o pinze per la visualizzazione ottimale. <ol><li> Chiudere tutti i rami della nave con legature (ad esempio, Polyglactin 3-0) e, successivamente, rimuoverlicon le forbici chirurgiche o un bisturi. </li></ol></li><li> Immettere cautela un&#39;estremità recipiente con curve pinza zanzara Halsted, bloccare la punta della pinza all&#39;altra estremità della nave e quindi ritrarre, invertendo lentamente il serbatoio finché è completamente esterno (Figura 1C-G). L&#39;esterno ora consiste dello strato di cellule endoteliali. Se si incontra difficoltà sulla invertendo il vaso, immergerlo in HBSS nuovamente per ridurre l&#39;attrito. </li><li> Posizionare suture a borsa di entrambe le estremità della nave per chiuderla completamente e per evitare l&#39;esposizione di qualsiasi tessuto vascolare non-endoteliale alla procedura di digestione (Figura 1H). Utilizzare le estremità legatura di manipolare la nave rovesciata. </li><li> Se la digestione e la cultura viene eseguita in seguito, cryopreserve la nave rovesciata prima del protocollo di digestione (passo 1,7). <ol><li> Posizionare il vaso rovesciato in una provetta Microbank ™ e riempire con colture cellulari congelamento media. Antigelo fino a -80 ° C con una co congelamentontainer. Conservare a -80 ° C se i vasi devono essere utilizzati entro una settimana. Per la conservazione a lungo termine, luogo cryovials a -180 ° C. Quando si esegue l&#39;isolamento CE, scongelare i cryovials rapidamente in un bagno d&#39;acqua (37 ° C) e collocare immediatamente in ghiaccio freddo HBSS. Procedere come indicato in 1.7. NOTA: Prendere in considerazione che la resa totale di EC dopo l&#39;isolamento sarà inferiore a causa della perdita di vitalità durante il processo di congelamento. </li></ol></li><li> Trasferire la nave verso un tubo da 50 ml e lavare due volte in HBSS per rimuovere gli eritrociti (o medio congelamento residua in caso di scongelamento) (Figura 1I). </li><li> Digerire il vaso in un tubo da 50 ml con una soluzione di 30 ml di collagenasi di tipo II (0,15 U / ml) e dispasi (0,15 U / ml) in cellule Canine endoteliali Growth Medium (CECGM) per 1 ora a 37 ° C con intermittente delicato agitazione. </li><li> Rimuovere il recipiente dal tubo e centrifugare la sospensione cellulare per 5 minuti a 250 x g. </li><li> Risospendere il pellet di cellule in un CECGMND seme 2 sospensione cellulare ml per bene (1 - 3 pozzi a seconda delle dimensioni nave). Coltivare le cellule a 37 ° C in atmosfera umidificata con 5% di CO 2 in aria e cambiare il terreno di coltura due volte a settimana. </li><li> Passaggio delle cellule quando una confluenza di 70 - si raggiunge l&#39;80%. <ol><li> Lavare le cellule con HBSS preriscaldata per rimuovere le cellule morte o non iscritti. Aggiungere 200 ml ricombinante enzima cellulare-dissociazione (1x) per ciascun bene e mettere di nuovo in incubatrice per 5 minuti o fino a quando tutte le cellule sono staccati. </li><li> Trasferire le cellule in una provetta da 15 ml e fermare tripsinizzazione con l&#39;aggiunta di 10 ml di terreni di coltura (CEGM) di cui 10% siero fetale di vitello (FCS). Centrifugare per 5 min a 250 x g. Continuare la cultura in un piatto di gelatina pre-verniciato o pallone. </li></ol></li></ol> 2. Caratterizzazione <ol><li> Culture cellule endoteliali aortiche Canine (CnAOECs) e confrontare la morfologia delle linee cellulari primarie e commerciale due volte alla settimana con un microscopio. NOTA: Tegli tipico modello di crescita di cellule endoteliali in patch può essere meglio osservato quando viene raggiunta una confluenza di&gt; 70%. <ol><li> Culture CnAOECs in CECGM su una beuta T75 0,5% w / v di gelatina prerivestita. cellule Passage una volta alla settimana quando la confluenza è del 70 - 80%. <ol><li> Per passaging, lavare le cellule una volta con HBSS preriscaldata e aggiungere 1 ml ricombinante cella-dissociazione enzimatica (1x). Porre il pallone torna in incubatrice per 5 minuti o fino a quando tutte le cellule sono staccati. Inattivare tripsina con l&#39;aggiunta di mezzo di coltura 10 ml (CEGM) incluso 10% FCS. Centrifugare la sospensione cellulare per 5 minuti a 250 xg, scartare il surnatante e risospendere le cellule in terreno di coltura 1 ml. </li><li> Prendete una aliquota di 10 microlitri di sospensione cellulare e diluire 1: 1 con il 0,4% trypan blu. Contare le cellule utilizzando un contatore di cellule automatizzato, e piastra out 4.0 x 10 5 cellule vitali in un pallone nuovo T75. Aggiungere 10 ml di pre-riscaldato CECGM al pallone e coltura a 37 ° C in atmosfera umidificata con 5% di CO 2. </li></ol></li></ol></li><li> Isolare RNA dal passaggio 1 delle CaPECs coltivate e CnAOECs. <ol><li> Raccogliere almeno 1 x 10 3 cellule come pellet, aggiungere 20 ml di preparazione del campione reagente (SPR) e incubare per 1 min per lisare le cellule. Dopo l&#39;incubazione, raccogliere con attenzione il lisato cellulare contenente RNA totale e conservare a -70 ° C. </li></ol></li><li> Convertire mRNA in cDNA utilizzando un kit di sintesi di cDNA (ad esempio, iScript) seguendo le istruzioni del produttore. Conservare cDNA a 4 ° C fino a una settimana, oa -20 ° C per il lungo termine fino al momento di eseguire la qPCR. </li><li> Misurare l&#39;espressione del gene del CD31 marcatore endoteliale per confermare l&#39;origine delle cellule endoteliali. Eseguire l&#39;impostazione sperimentale e quantificazione utilizzando le linee guida precis MIQE 10. Per la normalizzazione, misurare l&#39;espressione di geni di riferimento GAPDH, RPS19, e B2MG 11. <ol><li> Preparare una diluizione di 10 volte del cDNA ottenuto in acqua priva di nucleasi. </li><li> Preparareuna diluizione di 4 volte da campioni di cDNA pool per la linea standard e utilizzare l&#39;acqua priva di nucleasi come un controllo non-modello. Diluire i campioni cinque volte per raggiungere una diluizione totale di 50 volte per le reazioni qPCR. Pipettare 10 microlitri reazioni in duplicato in un formato da 384 pozzetti con 4 ml di cDNA e 6 ml di fluoroforo mescolato con 20 pmol di retromarcia e primer forward (Tabella 1). </li><li> Impostare il programma a 95 ° C per 5 minuti per l&#39;attivazione polimerasi Taq, seguita da 39 cicli di 10 secondi a 95 ° C per la denaturazione, e 30 sec a Tm per la ricottura e l&#39;allungamento. La Tm di ogni primer è mostrato nella Tabella 1. </li><li> Eseguire la fusione curva di analisi eseguite dopo ogni corsa al fine di garantire un solo prodotto è amplificato. Normalizzare i livelli di espressione dei campioni con la quantità media relativa dei geni di riferimento, e calcolare il ΔCt se l&#39;efficienza reazione è compresa tra il 95% e il 105%. </li></ol></li><li> Valutare la funzionalità CE con un Angisaggio ogenesis. <ol><li> Aggiungere 10 ml di matrice extracellulare a ciascun pozzetto di una slitta pre-raffreddata angiogenesi e diffondere con un puntale per coprire la superficie del pozzetto. Mantenere la matrice extracellulare su ghiaccio ed evitare l&#39;introduzione di bolle d&#39;aria nel gel. Solidificare il gel ponendo il vetrino in una capsula di Petri con acqua imbevuto asciugamani di carta in un incubatore a 37 ° C con 5% di CO 2 per 30 min. </li><li> Aggiungere 1,0 x 10 4 primario EC in 50 microlitri Endothelial Growth medio per pozzetto. Incubare il vetrino per 6 ore a 37 ° C con 5% di CO 2. </li><li> Dopo 6 ore scattare fotografie con un ingrandimento 20x, avendo cura di includere l&#39;intera bene nell&#39;immagine. </li></ol></li></ol>

<ol>
	<li>Haidara, M. A., Assiri, A. S., Yassin, H. Z., Ammar, H. I., Obradovic, M. M., Isenovic, E. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heart+Failure+Models:+Traditional+and+Novel+Therapy.">Heart Failure Models: Traditional and Novel Therapy.</a> Curr. Vasc. Pharmacol. 13 (5), 658-669 (2015).</li><li>van Steenbeek, F. G., van den Bossche, L., Leegwater, P. A., Rothuizen, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inherited+liver+shunts+in+dogs+elucidate+pathways+regulating+embryonic+development+and+clinical+disorders+of+the+portal+vein.">Inherited liver shunts in dogs elucidate pathways regulating embryonic development and clinical disorders of the portal vein.</a> Mamm. Genome. 23 (1-2), 76-84 (2012).</li><li>Murai, A., Asa, S. A., Kodama, A., Hirata, A., Yanai, T., Sakai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Constitutive+phosphorylation+of+the+mTORC2/Akt/4E-BP1+pathway+in+newly+derived+canine+hemangiosarcoma+cell+lines.">Constitutive phosphorylation of the mTORC2/Akt/4E-BP1 pathway in newly derived canine hemangiosarcoma cell lines.</a> BMC Vet. Res. 8 (1), 128 (2012).</li><li>Boilson, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+circulating+progenitor+cells+in+left+ventricular+dysfunction.">Regulation of circulating progenitor cells in left ventricular dysfunction.</a> Circ. Heart Fail. 3 (5), 635-642 (2010).</li><li>Gonzalez-Miguel, J., Morchon, R., Siles-Lucas, M., Simon, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fibrinolysis+and+proliferative+endarteritis:+two+related+processes+in+chronic+infections?+The+model+of+the+blood-borne+pathogen+Dirofilaria+immitis.">Fibrinolysis and proliferative endarteritis: two related processes in chronic infections? The model of the blood-borne pathogen Dirofilaria immitis.</a> PLoS One. 10 (4), e0124445 (2015).</li><li>Sacks, T., Moldow, C. F., Craddock, P. R., Bowers, T. K., Jacob, H. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oxygen+radicals+mediate+endothelial+cell+damage+by+complement-stimulated+granulocytes.+An+in+vitro+model+of+immune+vascular+damage.">Oxygen radicals mediate endothelial cell damage by complement-stimulated granulocytes. An in vitro model of immune vascular damage.</a> J. Clin. Invest. 61 (5), 1161-1167 (1978).</li><li>Aranguren, X. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unraveling+a+novel+transcription+factor+code+determining+the+human+arterial-specific+endothelial+cell+signature.">Unraveling a novel transcription factor code determining the human arterial-specific endothelial cell signature.</a> Blood. 122 (24), 3982-3992 (2013).</li><li>van Balkom, B. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endothelial+cells+require+miR-214+to+secrete+exosomes+that+suppress+senescence+and+induce+angiogenesis+in+human+and+mouse+endothelial+cells.">Endothelial cells require miR-214 to secrete exosomes that suppress senescence and induce angiogenesis in human and mouse endothelial cells.</a> Blood. 121 (19), 3997-4006 (2013).</li><li>Crampton, S. P., Davis, J., Hughes, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+human+umbilical+vein+endothelial+cells+(HUVEC).">Isolation of human umbilical vein endothelial cells (HUVEC).</a> J. Vis. Exp. (3), e183 (2007).</li><li>Bustin, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MIQE+precis:+Practical+implementation+of+minimum+standard+guidelines+for+fluorescence-based+quantitative+real-time+PCR+experiments.">MIQE precis: Practical implementation of minimum standard guidelines for fluorescence-based quantitative real-time PCR experiments.</a> BMC Mol. Biol. 11, 74 (2010).</li><li>Brinkhof, B., Spee, B., Rothuizen, J., Penning, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+evaluation+of+canine+reference+genes+for+accurate+quantification+of+gene+expression.">Development and evaluation of canine reference genes for accurate quantification of gene expression.</a> Anal. Biochem. 356 (1), 36-43 (2006).</li><li>Heishima, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA-214+and+MicroRNA-126+Are+Potential+Biomarkers+for+Malignant+Endothelial+Proliferative+Diseases.">MicroRNA-214 and MicroRNA-126 Are Potential Biomarkers for Malignant Endothelial Proliferative Diseases.</a> Int. J. Mol. Sci. 16 (10), 25377-25391 (2015).</li><li>Liu, M. M., Flanagan, T. C., Lu, C. C., French, A. T., Argyle, D. J., Corcoran, B. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Culture+and+characterisation+of+canine+mitral+valve+interstitial+and+endothelial+cells.">Culture and characterisation of canine mitral valve interstitial and endothelial cells.</a> Vet. J. 204 (1), 32-39 (2015).</li><li>van den Bossche, L., van Steenbeek, F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Canine+congenital+portosystemic+shunts:+disconnections+dissected.">Canine congenital portosystemic shunts: disconnections dissected.</a> The Veterinary Journal. 211, 14-20 (2015).</li><li>Sobczynska-Rak, A., Polkowska, I., Silmanowicz, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elevated+Vascular+Endothelial+Growth+Factor+(VEGF)+levels+in+the+blood+serum+of+dogs+with+malignant+neoplasms+of+the+oral+cavity.">Elevated Vascular Endothelial Growth Factor (VEGF) levels in the blood serum of dogs with malignant neoplasms of the oral cavity.</a> Acta Vet. Hung. 62 (3), 362-371 (2014).</li><li>Zhang, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+and+in+vivo+study+of+hydralazine,+a+potential+anti-angiogenic+agent.">In vitro and in vivo study of hydralazine, a potential anti-angiogenic agent.</a> Eur. J. Pharmacol. 779, 138-146 (2016).</li></ol>

The authors have no competing financial interests.

In studi incentrati sul canino EC linea primaria CnAOEC viene utilizzato per modellare le linee endoteliali del cane 3, 12, 13. Negli studi umani, la cultura HUVEC è ancora considerato il gold standard. Chiaramente, concentrandosi solo sulla EC derivate da cordone ombelicale è una restrizione fermo nella ricerca cardiovascolare. Le cellule endoteliali hanno una specifica pattern di espressione genica che determina le specifiche artero-venosa. Per tenere conto di queste differenze di vasi postnatale presentiamo questo metodo di isolamento romanzo base alla posizione anatomica specifica delle cellule endoteliali. I metodi comunemente usati per l&#39;isolamento CE primaria sono il lavaggio del recipiente con una soluzione enzimatica o tritare la nave prima della digestione, due metodi che entrambi hanno un rischio di contaminazione con i non-EC. Abbiamo stabilito una tecnica per l&#39;isolamento delle cellule endoteliali Canine primario (CaPECs) con minori possibilità di contaminazione che può essere utilizzato anche su piccole imbarcazioni. Questo isolamento metodo di cellule endoteliali si basa sull&#39;inversione della nave, che evita la digestione di tutti gli altri tipi di cellule nave. È importante rimuovere i vasi asettico, come illustrato nella Figura 1A, per prevenire la contaminazione batterica o fungina delle culture endoteliali. In caso di crescita batterica un agente antimicrobico aggiuntivo (ad esempio, gentamicina) può essere aggiunto al mezzo di coltura. In caso di trattamento di infezione fungina non è spesso successo nella nostra esperienza. Affinché l&#39;inversione di successo, è fondamentale per ottenere un vaso che è di circa 5 cm di lunghezza. Un secondo passo importante per facilitare l&#39;inversione del vaso sanguigno è la rimozione di qualsiasi tessuto aderente e il grasso con le forbici chirurgiche. Invertendo il recipiente è fatto con attenzione serrando la pinza all&#39;estremità opposta e invertendo lentamente il vaso. Quando si posiziona la borsa-string suture assicurarsi di toccare lo strato endoteliale il meno possibile. Damage dell&#39;endotelio può provocare scarsa resa di cellule endoteliali vitali e accesso dei mezzi di digestione al tessuto sottostante. Questo può succedere anche se la nave non è completamente chiuso. Il vaso può essere facilmente da raccoglierlo al termine di una legatura. In determinati casi una modifica della tecnica può essere applicata. In vasi sanguigni di piccolo diametro è talvolta impossibile inserire una pinza Mosquito per invertire il recipiente. Una soluzione consiste nel posizionare soggiorno suture su un&#39;estremità del recipiente e spingere le legature attraverso il vaso sanguigno usando le pinze. All&#39;altra estremità possono poi essere fissati con una pinza Mosquito e tirato, invertendo così la nave. A volte la nave strappare in conseguenza delle suture supplementari, quindi questa modifica non è l&#39;approccio preferito. Un altro problema che può sorgere è quando molti eritrociti sono presenti nelle piastre di coltura su semina delle cellule primarie. Questo può essere il risultato diInsufficiente lavaggio del vaso sanguigno prima della digestione. Quando si verifica ciò, il lavaggio dei pozzetti giorno 2 con HBSS caldo è spesso sufficiente a rimuovere la maggior parte degli eritrociti. In ogni caso, gli eritrociti non persisteranno nella cultura e sono perso su passaging dei CaPECs. I CaPECs isolato espressi CD31, indicando che la popolazione di cellule che è stato digerito dal vaso sanguigno è infatti di origine endoteliale. Come recentemente pubblicato, questo indicatore è anche espresso in cellule endoteliali dalla valvola mitrale canino 14. La formazione di colonie in coltura indica le culture partono sia da singole cellule o da piccoli gruppi di cellule. La rapida crescita su un supporto specifico endoteliale è anche indicativo del corretto tipo di cellula. Le cellule primarie possono essere coltivate da otto passaggi, dopo di che le culture cessano di espansione. Ciò è indice di senescenza e rende meno probabile che le cellule staminali / progenitrici sono coltivate presente protocol. In un saggio di angiogenesi, CaPECs da aorta, vena cava e vena porta ha mostrato ramificazione entro 6 ore. Questa funzionalità endoteliale fornisce la prova solida per la loro origine. In base alla disponibilità unico materiale canino è stato studiato, ma il metodo di isolamento ha possibili applicazioni per l&#39;isolamento delle cellule endoteliali primarie umane o cellule endoteliali da altri organismi. La tecnica è possibile anche per piccoli vasi (lunghezza 1 cm), ma produrrà cellule meno isolate. Per questo motivo CaPECs ottenuti da piccoli vasi richiederanno un passaggio aggiuntivo prima di aver raggiunto un numero sufficiente per esperimenti. La possibilità di eseguire il metodo isolamento su piccoli vasi è un grande vantaggio per gli studi in malattia vascolare. EC potrebbe essere isolato dal vasi malati o aberranti come shunt porto. Questi sono vasi comunicanti vena porta e la circolazione sistemica che provoca sangue per bypassare il fegato 2 </sup&gt;. Lo shunt stessa può essere piccolo come 1 cm. Confrontando la EC da una nave shunt con cellule provenienti da un sano cavale vena e vena porta potrebbe dare nuove informazioni rilevanti per lo shunt-sviluppo dal momento che la patogenesi non è ancora completamente noto. Inoltre, i nuovi geni angiogenici potrebbero essere indagati a livello funzionale, effettuando modificazioni genetiche come silenziamento genico siRNA mediata. In conclusione, questo metodo di isolamento romanzo può essere un potente modello per lo studio (congenita) malattie cardiovascolari, malattie di modellazione, e (tumorali) angiogenesi 15, 16.

I cani vengono utilizzati come grande modello animale per la ricerca sulle malattie cardiovascolari e possono anche soffrire di innata (genetici) anomalie vascolari 1, 2. Per studiare queste malattie linee di cellule endoteliali commerciali sono spesso utilizzati per valutare la funzionalità delle cellule endoteliali (CE). Per i cani c&#39;è una linea commerciale delle cellule endoteliali a disposizione (CnAOEC), derivato da dell&#39;aorta canino. Questa linea cellulare è usato soprattutto in studi come normale controllo EC 3-5. Nella ricerca cardiovascolare umano linee di cellule endoteliali più comunemente usati sono cellule ombelicale Vena endoteliali (HUVEC) e ombelicale umano Arteria cellule endoteliali (HUAECs) derivate dalla vena umana cordone ombelicale e delle arterie, rispettivamente. HUVECs sono stati usati come il golden standard nel campo della ricerca vascolare dal 1980 6. Essi sono considerati essere il sistema modello classico per studiare la funzione endoteliale e adattamento malattia. Le cellule endoteliali isolate da diversi vasi sanguigni variano in appearancE e funzionalità a causa di background genetico e l&#39;esposizione al microambiente 7. Inoltre, HUVEC e HUAECs derivano dal cordone ombelicale, una struttura vascolare sviluppo che potrebbero non pienamente mimici vasi sanguigni adulto rispetto alle condizioni a cui sono esposti e la risposta alla malattia. Quindi, traducendo Risultati trovati in HUVECs e HUAECs per le malattie cardiovascolari, in generale, è inadeguata. Quando si studia l&#39;adattamento e il comportamento degli adulti EC, EC primari dal vaso di interesse dovrebbero essere usati come un approccio più diretto. Per isolare queste cellule, sono stati riportati diversi metodi. Un metodo ampiamente descritto, che è anche usato per HUVEC, sta eliminando il recipiente con una soluzione digestione enzimatica 8. Questo si traduce spesso in contaminazione con non-EC come le cellule muscolari lisce e fibroblasti 9. Un altro metodo frequentemente utilizzato per l&#39;isolamento è la digestione enzimatica del tessuto nave tritato seguito da fluorescence-cellule attivate (FACS) basato su endoteliali Cluster indicatore di cella di differenziazione (CD) 31 7, 8. FACS ordinamento e successiva coltura cellulare richiede quantità relativamente elevate di cellule e non è quindi adatto per l&#39;isolamento di endotelio da piccoli vasi sanguigni. Abbiamo quindi finalizzata allo sviluppo di un nuovo metodo robusto per isolare una popolazione di cellule endoteliali puro da vari vasi sanguigni canine con elevata purezza. Per verificare l&#39;efficacia del nuovo metodo di isolamento, abbiamo isolato e ottenuto colture pure Canine endoteliali primarie cellulare (CAPEC) da diverse arterie e vene canini, grandi e piccoli. Questo metodo consente anche la cultura di cellule endoteliali provenienti da malati e / o vasi aberranti come innate shunt porto intra o extra-epatiche, una malattia comune nei cani 2. Il metodo permette l&#39;isolamento di altri tipi di cellule competenti della stessa nave, come le cellule muscolari lisce vascolari poiché la maggior parte della nave rimane intagire durante la procedura.

<table border="0" cellpadding="0" cellspacing="0" width="904">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Collagenase type II</td>
			<td style="width:164px;">Life Technologies</td>
			<td style="width:211px;">17101-015</td>
			<td style="width:201px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dispase</td>
			<td style="width:164px;">Life Technologies</td>
			<td style="width:211px;">17105-041</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">DMEM (1X) + GlutaMAX</td>
			<td style="width:164px;">Life Technologies</td>
			<td style="width:211px;">31966-021</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Hank&#39;s Balanced Salt Solution</td>
			<td style="width:164px;">Life Technologies</td>
			<td style="width:211px;">14025-050</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Canine Endothelial Cells Growth Medium&#160;</td>
			<td style="width:164px;">Cell Applications</td>
			<td style="width:211px;">Cn211-500</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">CnAOECs</td>
			<td style="width:164px;">Cell Applications</td>
			<td>Cn304-05</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Fetal Calf Serum (FCS)&#160;</td>
			<td style="width:164px;">GE Healthcare</td>
			<td style="width:211px;">16000-044</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TrypLE Express</td>
			<td style="width:164px;">Life Technologies</td>
			<td style="width:211px;">12604-013</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">SPR</td>
			<td style="width:164px;">Bio-Rad</td>
			<td>170-8898</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">iScript synthesis kit</td>
			<td style="width:164px;">Bio-Rad</td>
			<td style="width:211px;">170-8891</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">SYBR green super mix</td>
			<td style="width:164px;">Bio-Rad</td>
			<td style="width:211px;">170-8886</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Recovery Cell Freezing Medium</td>
			<td style="width:164px;">Gibco/Life Technologies</td>
			<td style="width:211px;">12648-010</td>
			<td>Keep on ice prior to use</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Freezing container, Nalgene Mr. Frosty</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:211px;">C1562</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Gelatin</td>
			<td style="width:164px;">Sigma-Aldrich</td>
			<td style="width:211px;">G1890</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Surgical scissors (Mayo or Metzenbaum)</td>
			<td style="width:164px;">B. Braun Medical</td>
			<td style="width:211px;">BC555R</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Mosquito forceps&#160;</td>
			<td style="width:164px;">B. Braun Medical</td>
			<td style="width:211px;">FB440R</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Mosquito forceps curved</td>
			<td style="width:164px;">B. Braun Medical</td>
			<td style="width:211px;">FB441R</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">polyglactin 3-0</td>
			<td style="width:164px;">Ethicon</td>
			<td style="width:211px;">VCP311H</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Trypan blue</td>
			<td style="width:164px;">Bio-Rad</td>
			<td style="width:211px;">145-0013</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Automated counting chamber</td>
			<td style="width:164px;">Bio-Rad</td>
			<td style="width:211px;">145-0102</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Counting Slides, Dual Chamber</td>
			<td style="width:164px;">Bio-Rad</td>
			<td style="width:211px;">145-0011</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Matrigel</td>
			<td style="width:164px;">BD Biosciences</td>
			<td style="width:211px;">BD356231</td>
			<td>Slowly thaw on ice</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">&#181;-Slide Angiogenesis</td>
			<td style="width:164px;">Ibidi</td>
			<td style="width:211px;">81501</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">Endothelial Growth Medium</td>
			<td style="width:164px;">Lonza</td>
			<td style="width:211px;">CC-3156</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:328px;">EGM-2 SingleQuot Kit&#160;</td>
			<td style="width:164px;">Lonza</td>
			<td style="width:211px;">CC-4176</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation and culture of primary endothelial cells from canine arteries and veins

Cardiovascular disease is studied in both human and veterinary medicine. Endothelial cells have been used extensively as an in vitro model to study vasculogenesis, (tumor) angiogenesis, and atherosclerosis. The current standard for in vitro research on human endothelial cells (ECs) is the use of Human Umbilical Vein Endothelial Cells (HUVECs) and Human Umbilical Artery Endothelial Cells (HUAECs). For canine endothelial research, only one cell line (CnAOEC) is available, which is derived from canine aortic endothelium. Although currently not completely understood, there is a difference between ECs originating from either arteries or veins. For a more direct approach to in vitro functionality studies on ECs, we describe a new method for isolating Canine Primary Endothelial Cells (CaPECs) from a variety of vessels. This technique reduces the chance of contamination with fast-growing cells such as fibroblasts and smooth muscle cells, a problem that is common in standard isolation methods such as flushing the vessel with enzymatic solutions or mincing the vessel prior to digestion of the tissue containing all cells. The technique we describe was optimized for the canine model, but can easily be utilized in other species such as human.

Diversi vasi sanguigni sono stati sottoposti con successo al protocollo descritto isolamento (Figura 2). Era possibile sezionare e invertire aorta, vena cava, vena porta, e l&#39;arteria coronaria da cani sani (tutte le navi da ciascun cane, n = 4). Con le stesse EC approccio sono stati isolati da due shunt porto congenite (extraepatica e intraepatica, n = 1 ciascuno). Anche se dell&#39;aorta era facilmente invertita, segmenti dell&#39;aorta toracica sono stati più impegnativo di aorta addominale. Nei segmenti toracici aorta ha molte arterie intercostali ramificano da esso, che devono essere ligati individualmente per garantire l&#39;esposizione strettamente endoteliale alla soluzione di digestione. Il segmento sezionato della vena cava caudale incluso nel punto di diramazione delle vene renali, che dovevano essere legata prima inversione. Per la vena porta il ramo attivo della gastroduodenalis vena stato ligato prima inversione del vaso sanguigno. il coronary arteria nei cani è un vaso molto più piccola di sangue (circa 1 - 2 mm di diametro in un cane di medie dimensioni), da cui escisso un segmento del ramo circonflesso. Perché ha un diametro ridotto, si è rivelato essere più facile da invertire una piuttosto breve segmento di 1 cm, perché le pinze Mosquito non potevano essere inseriti molto più in là. dopo di isolamento delle cellule aderito Un giorno erano visibili nella piastra di coltura. Nella cultura, CaPECs aveva una forma poligonale e visualizzata una tendenza a crescere in patch come mostrato nella figura 3 possono essere osservate numerose colonie di cellule endoteliali 3 -. 6 giorni dopo l&#39;isolamento. Dopo circa 10 giorni di coltura una confluenza del 80% è stato raggiunto e cellule potrebbe essere superato. In media le colture endoteliali primarie potrebbero essere mantenuti per un massimo di 8 passaggi (una volta alla settimana ad un tasso di divisione di 1: 4) al punto che essi smesso di crescere. Isolacellule endoteliali ted espressi endoteliali CD31 indicatore di cella come indicato da qPCR (Figura 4). L&#39;espressione in cellule endoteliali derivate da aorta, vena cava e vena porta da quattro cani è stato confrontato con una coltura di controllo di CnAOECs. Le cellule primarie in coltura aveva un&#39;espressione CD31 paragonabile con il controllo EC (Kruskall-Wallis, p = 0,856). CaPECs derivati da aorta, vena cava e vena porta mostrato ramificazione dopo 6 ore di incubazione sulla diapositiva angiogenesi come mostrato in Figura 5. <img alt="Figura 1" src="/files/ftp_upload/54786/54786fig1.jpg" /> Figura 1: dissezione e Inversione vasi sanguigni per l&#39;isolamento delle cellule endoteliali. A) Il vaso sanguigno di interesse è asetticamente rimosso da un cadavere canino fresco. B) tessuti aderenti e / o di grasso che circonda la nave dovrebbe essere REMOVEd attenzione con le forbici chirurgiche senza danneggiare la nave stessa (canino vena cava, segmento addominale 5 cm). C) con una curvi pinza Halsted Mosquito, la nave può essere inserito senza perforare lo strato endoteliale. DG) Fissare le pinze dall&#39;altra fine del vaso sanguigno e delicatamente retrarre, così completamente invertendo il vaso sanguigno. Lo strato endoteliale è ora sulla parte esterna del recipiente. H) suture a borsa sono poste alle estremità di chiusura dalla superficie non-endoteliale del vaso invertita. I) Il vaso sanguigno viene trasferito in un tubo da 50 ml per il lavaggio e successiva digestione. Barre di scala indicano 2 cm. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54786/54786fig1large.jpg" target="_blank">Cliccate qui per vedere una versione più grande di questa figura.</a> <img alt="figura 2" src="/files/ftp_upload/54786/54786fig2.jpg" /> <strong&gt; Figura 2: vasi invertiti di diversa origine. A) Un segmento di aorta invertita (cane sano). B) Una vena porta invertita (cane sano). C) Un segmento di vena cava invertita (cane sano). D) Un segmento di arteria coronaria invertita (cane sano). E) Un invertita extraepatica shunt porto derivato da un terrier Cairn (età: 6 settimane). F) un invertito shunt porto intraepatica derivato da un lupo irlandese (età: 8 settimane di vita). Barre di scala indicano 2 cm. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54786/54786fig2large.jpg" target="_blank">Cliccate qui per vedere una versione più grande di questa figura.</a> <img alt="Figura 3" src="/files/ftp_upload/54786/54786fig3.jpg" /> Figura 3:.. La morfologia cellulare foto sono state scattate due settimane dopo la digestione dei vasi fr) EC derivatoom dell&#39;aorta canino nel passaggio 2. B) EC derivato dal canino vena cava nel passaggio 2. C) EC derivati da canino vena porta nel passaggio 2. Tutte le immagini sono prese con 4X ingrandimento originale. Barre di scala indicano 500 micron. Inserire mostra 10X di ingrandimento. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54786/54786fig3large.jpg" target="_blank">Clicca qui per vedere una versione più grande di questa figura.</a> <img alt="Figura 4" src="/files/ftp_upload/54786/54786fig4.jpg" /> Figura 4: Espressione genica di CD31. L&#39;espressione di CD31 in cellule endoteliali in passaggio 1 derivati ​​da aorta, vena cava e vena porta (n = 4 cani). Non sono state osservate significative differenze di espressione tra il CaPECs e la CnAOECs. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54786/54786fig4large.jpg" target="_blank">Cliccate qui per vedere una versione più grande di questa figura.</a> <pclass = &quot;jove_content&quot; fo: keep-together.within-page = &quot;1&quot;&gt; <img alt="Figura 5" src="/files/ftp_upload/54786/54786fig5.jpg" /> Figura 5: L&#39;angiogenesi. Fotografie di CnAOECs e CaPECs da aorta, vena cava e vena porta, dopo 6 ore di incubazione su uno scivolo angiogenesi (20X di ingrandimento). Formazione Branch è visibile dopo 6 ore in B) CaPECs cultura. A) CnAOECs. Derivate da dell&#39;aorta. C) CaPECs derivati dalla vena cava. D) CaPECs derivato da vena porta. Tutte le cellule erano in passaggio 3. Barre di scala indicano 1 mm. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54786/54786fig5large.jpg" target="_blank">Clicca qui per vedere una versione più grande di questa figura.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> GOI </td><td> Direzione </td><td colspan="2"> 5&#39;-Sequence-3 &#39; </strong&gt; </td><td> Tm ricottura </td><td> Dimensioni del prodotto (bp) </td><td> numero di banca genetica </td></tr><tr><td> CD31 </td><td> Inoltrare </td><td colspan="2"> GTTCTGCGTGTCAAGGTG </td><td> 59 ° C </td><td> 85 </td><td> XM_005624261.1 </td></tr><tr><td></td><td> Inverso </td><td colspan="2"> TGTCCTTCCCAAACTCCA </td><td></td><td></td><td></td></tr><tr><td> beta-actina </td><td> Inoltrare </td><td colspan="2"> GATATCGCTGCGCTTGTGGTC </td><td> 58 ° C </td><td> 384 </td><td> NM_001195845 </td></tr><tr><td></td><td> Inverso </td><td colspan="2"> GGCTGGGGTGTTGAAAGTCTC </td><td></td><td></td><td></td></tr><tr><td> RPS19 </td><td> Inoltrare </td><td colspan="2"> CCTTCCTCAAAAAGTCTGGG </td><td> 63 ° C </td><td> 95 </td><td> XM_005616513 </td></tr><tr><td></td><td> Inverso </td><td colspan="2"> GTTCTCATCGTAGGGAGCAAG </td><td></td><td></td><td></td></tr><tr><td> B2MG </td><td> Inoltrare </td><td colspan="2"> TCCTCATCCTCCTCGCT </td><td> 63 ° C </td><td> 85 </td><td> AB745507 </td></tr><tr><td></td><td> Inverso </td><td colspan="2"> TTCTCTGCTGGGTGTCG </td><td></td><td></td><td></td></tr></tbody></table> Tabella 1: qPCR Primer Imposta primer qPCR per i geni di riferimento canini e CD31..

Watch this Scientific Journal Video about Isolation and Culture of Primary Endothelial Cells from Canine Arteries and Veins at JoVE.com

Isolation and Culture of Primary Endothelial Cells from Canine Arteries and Veins

Novel isolation methods of primary endothelial cells from blood vessels are needed. This protocol describes a new technique that completely inverts blood vessels of interest, exposing only the endothelial side to enzymatic digestion. The resulting pure endothelial cell culture can be used to study cardiovascular diseases, disease modelling, and angiogenesis.

Isolamento e coltura di cellule endoteliali primarie dalle arterie e vene Canine

Cardiovascular disease is studied in both human and veterinary medicine. Endothelial cells have been used extensively as an in vitro model to study ...

isolation-culture-primary-endothelial-cells-from-canine-arteries

Nanyang Technological University

Research

JoVE Journal

Medicine

11.2K Views.  Utrecht University. Novel isolation methods of primary endothelial cells from blood vessels are needed. This protocol describes a new technique that completely inverts blood vessels of interest, exposing only the endothelial side to enzymatic digestion. The resulting pure endothelial cell culture can be used to study cardiovascular diseases, disease modelling, and angiogenesis.

Video: Isolation and Culture of Primary Endothelial Cells from Canine Arteries and Veins

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human pulp-derived stem cells (hDPSCs) possess high proliferation potential with multi-lineage differentiation capacity compare to the ordinary source of adult stem cells1-8; therefore, hDPSCs could be the good candidates for autologous transplantation in tissue engineering and regenerative medicine. Along with these benefits, possessing the mesenchymal stem cells (MSC) features, such as immunolodulatory effect, make hDPSCs more valuable, even in the case of allograft transplantation6,9,10. Therefore, the primary step for using this source of stem cells is to select the best protocol for isolating hDPSCs from pulp tissue. In order to achieve this goal, it is crucial to investigate the effect of various isolation conditions on different cellular behaviors, such as their common surface markers &amp; also their differentiation capacity.
Thus, here we separate human pulp tissue from impacted third molar teeth, and then used both existing protocols based on literature, for isolating hDPSCs,11-13 i.e. enzymatic dissociation of pulp tissue (DPSC-ED) or outgrowth from tissue explants (DPSC-OG). In this regards, we tried to facilitate the isolation methods by using dental diamond disk. Then, these cells characterized in terms of stromal-associated Markers (CD73, CD90, CD105 &amp; CD44), hematopoietic/endothelial Markers (CD34, CD45 &amp; CD11b), perivascular marker, like CD146 and also STRO-1. Afterwards, these two protocols were compared based on the differentiation potency into odontoblasts by both quantitative polymerase chain reaction (QPCR) &amp; Alizarin Red Staining. QPCR were used for the assessment of the expression of the mineralization-related genes (alkaline phosphatase; ALP, matrix extracellular phosphoglycoprotein; MEPE &amp; dentin sialophosphoprotein; DSPP).14

The method described isolation and characterization of human Dental Pulp Stem Cells (hDPSCs) by using either enzymatic dissociation of pulp (DPSC-ED) or direct outgrowth of stem cells from pulp tissue explants (DPSC-OG). Then followed by in vitro comparative differentiation of both types of hDPSCs into odontoblasts.

Differenziazione Isolamento, caratterizzazione e comparata delle cellule umane Dental Pulp staminali derivate da denti permanenti mediante due diversi metodi

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Ricerca

Medicina

Patient Derived Cell Culture and Isolation of CD133+ Putative Cancer Stem Cells from Melanoma

Despite improved treatments options for melanoma available today, patients with advanced malignant melanoma still have a poor prognosis for progression-free and overall survival. Therefore, translational research needs to provide further molecular evidence to improve targeted therapies for malignant melanomas. In the past, oncogenic mechanisms related to melanoma were extensively studied in established cell lines. On the way to more personalized treatment regimens based on individual genetic profiles, we propose to use patient-derived cell lines instead of generic cell lines. Together with high quality clinical data, especially on patient follow-up, these cells will be instrumental to better understand the molecular mechanisms behind melanoma progression.
Here, we report the establishment of primary melanoma cultures from dissected fresh tumor tissue. This procedure includes mincing and dissociation of the tissue into single cells, removal of contaminations with erythrocytes and fibroblasts as well as primary culture and reliable verification of the cells' melanoma origin.
Recent reports revealed that melanomas, like the majority of tumors, harbor a small subpopulation of cancer stem cells (CSCs), which seem to exclusively fuel tumor initiation and progression towards the metastatic state. One of the key markers for CSC identification and isolation in melanoma is CD133. To isolate CD133+ CSCs from primary melanoma cultures, we have modified and optimized the Magnetic-Activated Cell Sorting (MACS) procedure from Miltenyi resulting in high sorting purity and viability of CD133+ CSCs and CD133- bulk, which can be cultivated and functionally analyzed thereafter.

Patient Derived Cell Culture and Isolation of CD133+ Putative Cancer Stem Cells from Melanoma

This article describes the preparation of freshly obtained melanoma tissue into primary cell cultures, and how to remove contaminations of erythrocytes and fibroblasts from the tumor cells. Finally, we describe how CD133+ putative melanoma stem cells are sorted from the CD133- bulk using Magnetic Activated Cell Sorting (MACS).

Paziente coltura cellulare derivato e isolamento di CD133<sup&gt; +</sup&gt; Putativi staminali alle cellule tumorali di melanoma

Despite improved treatments options for melanoma available today, patients with advanced malignant melanoma still have a poor prognosis for ...

Primary Culture of Human Vestibular Schwannomas

Vestibular schwannomas (VSs) represent Schwann cell (SC) tumors of the vestibular nerve, compromising 10% of all intracranial neoplasms. VSs occur in either sporadic or familial (neurofibromatosis type 2, NF2) forms, both associated with inactivating defects in the NF2 tumor suppressor gene. Treatment for VSs is generally surgical resection or radiosurgery, however the morbidity of such procedures has driven investigations into less invasive treatments. Historically, lack of access to fresh tissue specimens and the fact that schwannoma cells are not immortalized have significantly hampered the use of primary cultures for investigation of schwannoma tumorigenesis. To overcome the limited supply of primary cultures, the immortalized HEI193 VS cell line was generated by transduction with HPV E6 and E7 oncogenes. This oncogenic transduction introduced significant molecular and phenotypic alterations to the cells, which limit their use as a model for human schwannoma tumors. We therefore illustrate a simplified, reproducible protocol for culture of primary human VS cells. This easily mastered technique allows for molecular and cellular investigations that more accurately recapitulate the complexity of VS disease.

Vestibular Schwannomas (VSs) are non-malignant tumors of Schwann cell (SC) origin, associated with mutations in the NF2 tumor suppressor gene. We report a reproducible, efficient protocol for primary human VS cell culture that allows for molecular and cellular experimental manipulation and analysis and recapitulates the heterogeneous nature of human disease.

Cultura primario di Human vestibolare Schwannomi

Vestibular schwannomas (VSs) represent Schwann cell (SC) tumors of the vestibular nerve, compromising 10% of all intracranial neoplasms. VSs occur in ...

Method for Obtaining Primary Ovarian Cancer Cells From Solid Specimens

Reliable tools for investigating ovarian cancer initiation and progression are urgently needed. While the use of ovarian cancer cell lines remains a valuable tool for understanding ovarian cancer, their use has many limitations. These include the lack of heterogeneity and the plethora of genetic alterations associated with extended in vitro passaging.&#160;Here we describe a method that allows for rapid establishment of primary ovarian cancer cells form solid clinical specimens collected at the time of surgery. The method consists of subjecting clinical specimens to enzymatic digestion for 30 min. The isolated cell suspension is allowed to grow and can be used for downstream application including drug screening. The advantage of primary ovarian cancer cell lines over established ovarian cancer cell lines is that they are representative of the original specific clinical specimens they are derived from and can be derived from different sites whether primary or metastatic ovarian cancer.

This study describes a detailed method for isolation and characterization of primary ovarian cancer cells from solid clinical specimens. Ovarian cancer clinical specimens are subjected to enzymatic digestion to obtain viable, fibroblast-free epithelial ovarian cancer (EOC) cells highly suitable for downstream applications.

Metodo per ottenere primarie cellule tumorali ovariche da campioni solidi

Reliable tools for investigating ovarian cancer initiation and progression are urgently needed. While the use of ovarian cancer cell lines remains a ...

Isolation, Cryopreservation and Culture of Human Amnion Epithelial Cells for Clinical Applications

Human amnion epithelial cells (hAECs) derived from term or pre-term amnion membranes have attracted attention from researchers and clinicians as a potential source of cells for regenerative medicine. The reason for this interest is evidence that these cells have highly multipotent differentiation ability, low immunogenicity, and anti-inflammatory functions. These properties have prompted researchers to investigate the potential of hAECs to be used to treat a variety of diseases and disorders in pre-clinical animal studies with much success.
hAECs have found widespread application for the treatment of a range of diseases and disorders. Potential clinical applications of hAECs include the treatment of stroke, multiple sclerosis, liver disease, diabetes and chronic and acute lung diseases. Progressing from pre-clinical animal studies into clinical trials requires a higher standard of quality control and safety for cell therapy products. For safety and quality control considerations, it is preferred that cell isolation protocols use animal product-free reagents. 
We have developed protocols to allow researchers to isolate, cryopreserve and culture hAECs using animal product-free reagents. The advantage of this method is that these cells can be isolated, characterized, cryopreserved and cultured without the risk of delivering potentially harmful animal pathogens to humans, while maintaining suitable cell yields, viabilities and growth potential. For researchers moving from pre-clinical animal studies to clinical trials, these methodologies will greatly accelerate regulatory approval, decrease risks and improve the quality of their therapeutic cell population.

We describe a protocol to isolate and culture human amnion epithelial cells (hAECs) using animal product-free reagents in accordance with current good manufacturing practices (cGMP) guidelines.

Isolamento, Crioconservazione e Cultura umani Cellule epiteliali Amnion per le applicazioni cliniche

Human amnion epithelial cells (hAECs) derived from term or pre-term amnion membranes have attracted attention from researchers and clinicians as a ...

Isolation of Human Lymphatic Endothelial Cells by Multi-parameter Fluorescence-activated Cell Sorting

Lymphatic system disorders such as primary lymphedema, lymphatic malformations and lymphatic tumors are rare conditions that cause significant morbidity but little is known about their biology. Isolating highly pure human lymphatic endothelial cells (LECs) from diseased and healthy tissue would facilitate studies of the lymphatic endothelium at genetic, molecular and cellular levels. It is anticipated that these investigations may reveal targets for new therapies that may change the clinical management of these conditions. A protocol describing the isolation of human foreskin LECs and lymphatic malformation lymphatic endothelial cells (LM LECs) is presented. To obtain a single cell suspension tissue was minced and enzymatically treated using dispase II and collagenase II. The resulting single cell suspension was then labelled with antibodies to cluster of differentiation (CD) markers CD34, CD31, Vascular Endothelial Growth Factor-3 (VEGFR-3) and PODOPLANIN. Stained viable cells were sorted on a fluorescently activated cell sorter (FACS) to separate the CD34LowCD31PosVEGFR-3PosPODOPLANINPos LM LEC population from other endothelial and non-endothelial cells. The sorted LM LECs were cultured and expanded on fibronectin-coated flasks for further experimental use.

The goal of this protocol is to isolate lymphatic endothelial cells lining human lymphatic malformation cyst-like vessels and foreskins using fluorescence-activated cell sorting (FACS). Subsequent cell culturing and expansion of these cells permits a new level of experimental sophistication for genetic, proteomic, functional and cell differentiation studies.

Isolamento di cellule umane endoteliali linfatico da Multi-parametro fluorescenza-attivato cell sorting

Lymphatic system disorders such as primary lymphedema, lymphatic malformations and lymphatic tumors are rare conditions that cause significant morbidity ...

Isolation and Propagation of Circulating Tumor Cells from a Mouse Cancer Model

Cancer metastasis is the foremost cause of cancer-associated deaths. Recent studies have shown that circulating tumor cells (CTCs) are important in cancer metastasis. Indeed, the number of CTCs correlates with tumor size. Here, a detailed description is provided of a methodology for isolation and propagation of CTCs from a syngeneic mouse model of hepatocellular carcinoma (HCC) which allows for downstream analysis of potentially important molecular mechanisms of solid organ tumor metastasis. This method is efficient and reproducible. It is a non-invasive technique and, therefore, has potential to replace the invasive biopsy of tissues from humans which may be associated with complications. Therefore, the method discussed here allows for the isolation and propagation of CTCs from whole blood samples such that they can be examined and characterized. This has potential for future adaptation for clinical applications such as diagnosis, and personalized targeted therapy.

Circulating tumor cells (CTCs) have been shown to play an important role in tumor metastasis. Here, a method for the isolation and propagation of CTCs from the whole blood of a syngeneic mouse tumor model of hepatocellular carcinoma (HCC) metastasis is described.

Isolamento e propagazione di cellule tumorali circolanti da un mouse cancro modello

Cancer metastasis is the foremost cause of cancer-associated deaths. Recent studies have shown that circulating tumor cells (CTCs) are important in cancer ...

Isolation and Culture Expansion of Tumor-specific Endothelial Cells

Freshly isolated tumor-specific endothelial cells (TEC) can be used to explore molecular mechanisms of tumor angiogenesis and serve as an in vitro model for developing new angiogenesis inhibitors for cancer. However, long-term in vitro expansion of murine endothelial cells (EC) is challenging due to phenotypic drift in culture (endothelial-to-mesenchymal transition) and contamination with non-EC. This is especially true for TEC which are readily outcompeted by co-purified fibroblasts or tumor cells in culture. Here, a high fidelity isolation method that takes advantage of immunomagnetic enrichment coupled with colony selection and in vitro expansion is described. This approach generates pure EC fractions that are entirely free of contaminating stromal or tumor cells. It is also shown that lineage-traced Cdh5cre:ZsGreenl/s/l reporter mice, used with the protocol described herein, are a valuable tool to verify cell purity as the isolated EC colonies from these mice show durable and brilliant ZsGreen fluorescence in culture.

We report a reliable method to isolate and culture primary tumor-specific endothelial cells from genetically engineered mouse models.

Isolamento e cultura espansione delle cellule endoteliali tumore-specifici

Freshly isolated tumor-specific endothelial cells (TEC) can be used to explore molecular mechanisms of tumor angiogenesis and serve as an in vitro model ...

Isolation of Endothelial Progenitor Cells from Healthy Volunteers and Their Migratory Potential Influenced by Serum Samples After Cardiac Surgery

Endothelial progenitor cells (EPCs) are recruited from the bone marrow under pathological conditions like hypoxia and are crucially involved in the neovascularization of ischemic tissues. The origin, classification and characterization of EPCs are complex; notwithstanding, two prominent sub-types of EPCs have been established: so-called &#34;early&#34; EPCs (subsequently referred to as early-EPCs) and late-outgrowth EPCs (late-EPCs). They can be classified by biological properties as well as by their appearance during in vitro culture. While &#34;early&#34; EPCs appear in less than a week after culture of peripheral blood-derived mononuclear cells in EC-specific media, late-outgrowth EPCs can be found after 2-3 weeks. Late-outgrowth EPCs have been recognized to be directly involved in neovascularization, mainly through their ability to differentiate into mature endothelial cells, whereas &#34;early&#34; EPCs express various angiogenic factors as endogenous cargo to promote angiogenesis in a paracrine manner. During myocardial ischemia/reperfusion (I/R), various factors control the homing of EPCs to regions of blood vessel formation.
Macrophage migration inhibitory factor (MIF) is a chemokine-like pro-inflammatory and ubiquitously expressed cytokine and was recently described to function as key regulator of EPCs migration at physiological concentrations1. Interestingly, MIF is stored in intracellular pools and can rapidly be released into the blood stream after several stimuli (e.g. myocardial infarction). 
This protocol describes a method for the reliable isolation and culture of early-EPCs from adult human peripheral blood based on CD34-positive selection with subsequent culture in medium containing endothelial growth factors on fibronectin-coated plates for use in in vitro migration assays against serum samples of cardiac surgical patients. Furthermore, the migratory influence of MIF on chemotaxis of EPCs compared to other well-known angiogenesis-stimulating cytokines is demonstrated.

Endothelial progenitor cells (EPCs) are crucially involved in the neovascularization of ischemic tissues. This method describes the isolation of human EPCs from peripheral blood, as well as the identification of their migratory potential against serum samples of cardiac surgical patients.

L&#39;isolamento di cellule progenitrici endoteliali da volontari sani e il loro potenziale migratori influenzato dal siero campioni dopo cardiochirurgia

Endothelial progenitor cells (EPCs) are recruited from the bone marrow under pathological conditions like hypoxia and are crucially involved in the ...

A Cell Culture Model of Resistance Arteries

The myoendothelial junction (MEJ), a unique signaling microdomain in small diameter resistance arteries, exhibits localization of specific proteins and signaling processes that can control vascular tone and blood pressure. As it is a projection from either the endothelial or smooth muscle cell, and due to its small size (on average, an area of ~1 &#181;m2), the MEJ is difficult to study in isolation. However, we have developed a cell culture model called the vascular cell co-culture (VCCC) that allows for in vitro MEJ formation, endothelial cell polarization, and dissection of signaling proteins and processes in the vascular wall of resistance arteries. The VCCC has a multitude of applications and can be adapted to suit different cell types. The model consists of two cell types grown on opposite sides of a filter with 0.4 &#181;m pores in which the in vitro MEJs can form. Here we describe how to create the VCCC via plating of cells and isolation of endothelial, MEJ, and smooth muscle fractions, which can then be used for protein isolation or activity assays. The filter with intact cell layers can be fixed, embedded, and sectioned for immunofluorescent analysis. Importantly, many of the discoveries from this model have been confirmed using intact resistance arteries, underscoring its physiological relevance.

A cell culture model of resistance arteries is described, allowing for the dissection of signaling pathways in endothelium, smooth muscle, or between endothelium and smooth muscle (the myoendothelial junction). The selective application of agonists or protein isolation, electron microscopy, or immunofluorescence can be utilized using this cell culture model.

Un modello di coltura cellulare di arterie di resistenza

The myoendothelial junction (MEJ), a unique signaling microdomain in small diameter resistance arteries, exhibits localization of specific proteins and ...