אנו מודים C ג&#39;אנג לטיפול דגים. עבודה זו נתמכה על ידי הקרן הלאומית למדע הטבע של סין (31171074, 31371099 ו 31571067 כדי GP) ועל ידי פרויקט Talent ופאג&#39;יאנג (09PJ1401900 כדי GP).

ניסויים הזברה אושרו על ידי ועדת טיפול בבעלי חיים מוסדיים אוניברסיטת פודאן ושימוש. זברה הועלתה וגדלה על פי נהלים קבועים 20. 1. הכנות <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> טפחו 17 DPF ו 25 DPF דג הזברה הזחל <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> העברה 2 זכרים ו 2 דג זברה מבוגר נקבה (בריאה, 3 עד 6 חודשים, זן מעבדת AB) ועד טנק המעבר בשעות אחר הצהריים המאוחרים לפני יום המעבר. להפריד בין זכרים לנקבות עם מחסום. למחרת בבוקר, לרענן את המים במיכל ולהסיר את המחסום כדי לאפשר להם להזדווג. אסוף ביצים 100 מ&quot;מ פטרי מנות 1 עד 2 שעות לאחר ההפריה. </li><li style=";text-align:right;direction:rtl"> שמור על 40 העוברים בתוך צלחת 100 מ&quot;מ עם המדיום העובר 40 מ&quot;ל (EM) ב 28.5 מעלות צלזיוס במהלך תקופת ההתפתחות המוקדמת (4 ימים) ולרענן את EM פעמיים ביום. עבר זחלי 1 טנקי L (40 זחלים למי מערכה 300 מיליליטר) ולהאכיל עם rotifers החי (אספקה ​​מלאה, פעמים ביום) לאחר 5 DPF.Feed ארטמיה חיה במקום דיאטה rotifer לאחר 10 DPF. מעבירים את הדג לתוך מערכת המים במחזור מחדש ב 14 DPF 21. </li><li style=";text-align:right;direction:rtl"> תרים דג הזברה הזחל במערכת המים במחזור מחדש עד 17 DPF או 25 DPF. ודא מחזור אור / חושך הוא 14/10 h ו pH ערך של מים במערכת הוא על 7.2. מדדו את אורך הגוף של 17 DPF (5.5 כדי 6.8 מ&quot;מ) ו 25 DPF (8 עד 11 מ&quot;מ) זחלי 22. </li></ol></li><li style=";text-align:right;direction:rtl"> כן 2% צלחות אגרו לנתיחה. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הוספת אגר 4 גרם ל 200 מ&quot;ל מים סטריליים. מחממים את התערובת במיקרוגל עד שהוא הופך שקוף. </li><li style=";text-align:right;direction:rtl"> מצנן את הפתרון אגר במשך כ 15 דקות, ואז לשפוך אותו לתוך 60 מנות מ&quot;מ קוטר פטרי (כ 1/3 נפח של הצלחת). אחסן את הצלחות אגרו הקרושה ב 4 מעלות צלזיוס. </li></ol></li></ol> 2. פרוטוקול 1: לנתח את רקמת האשכים של 17 ו 25 DPF זחלים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> להוסיף קרח כתוש לתוך הטנק כדי להרדים 17 זחלי DPF. העברתזחלים הרדימו עד 100 מ&quot;מימ מקוררים צלחת פטרי עם 30 הפתרון של המ&quot;ל הקר Ringer. שמור את הדגים וטופחו על ידי פתרון של מקורר Ringer עבור 15 דקות לפחות כדי להרדים את זחלי במלואה. </li><li style=";text-align:right;direction:rtl"> מעבירים את הזחלים לצלחת אגר precooled בכפית פלסטיק קטנה. לצלול הגוף דג שלם 10 מ&quot;ל מקורר בתמיסת רינגר בעדינות ולהניח אותה על צדה. </li><li style=";text-align:right;direction:rtl"> לעשות את הפעולות הבאות מתחת לשדה הראייה של מיקרוסקופ סטריאו 25x. הצמד את תא המטען דגים עם פינצטה עבור ייצוב. תולשים את הבטן אורכית מפי הטבעת אל הלב עם זוג אחר של פינצטה. הסר בעדינות את העור והשרירים בצד אחד של הגוף על מנת לחשוף את האיברים הפנימיים. </li><li style=";text-align:right;direction:rtl"> הסר את מסת איברי גחון בשלפוחית ​​השחייה בזהירות. למנוע נזק שַׁחֲלָה המצורפת בשלפוחית ​​השחייה. </li><li style=";text-align:right;direction:rtl"> חותך את הקשר בין בשלפוחית ​​השחייה והגוף קדמי. משוך החוצה בשלפוחית ​​השחייה כולו רקמות האשכים בעדינות. הערה: ברוב המקרהים, רקמת האשכים ב 17 DPF מכיל לרקמות אפיתל protonephridium. הם אינם מופרדים בקלות זה מזה, אבל 25 DPF זה ניתן להפריד בקלות. אֶשֶׁך מחובר גם אל פי הטבעת. צומת עם אשך שמאל וימין מחוברים זה לזה על פי הטבעת תהיה גלויה בבירור. </li><li style=";text-align:right;direction:rtl"> להשתמש בפינצטה כדי להפריד את רקמת האשכים בקפידה מתוך בשלפוחית ​​השחייה ולנקות את רקמות השומן שמסביב. </li><li style=";text-align:right;direction:rtl"> מיד להעביר את רקמת האשכים מבודדת כדי צינור צנטריפוגות prechilled 1.5 מ&quot;ל המכיל 200 הפתרון של μL Ringer. שמור את הצינור על קרח עד שכל רקמות האשכים מופרדות מן הזחלים. </li><li style=";text-align:right;direction:rtl"> לנתח את בלוטות המין של 25 DPF זחלי כמתואר בשלבים 2.1 - 2.7. </li></ol> 3. פרוטוקול 2: לנתח ביטוי גנים של רקמות האשכים המבודדות <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> חלץ RNA הכולל רקמות אשכי הזחל. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> העברת רקמות אשכים המבודדות עד 1 חדש RNase חינם.5 מ&quot;ל צינור ולהסיר בתמיסת רינגר. להוסיף 100 פתרון תמס μL. וורטקס עד הרקמות הם lysed לחלוטין. </li><li style=";text-align:right;direction:rtl"> בצע את הליך חילוץ RNA הכולל על פי הוראות היצרן. </li><li style=";text-align:right;direction:rtl"> להוסיף 1/10 נפח DNase 10x ואני חיץ 1 μL של DNase אני לפתרון RNA ומערבבים בעדינות. דגירה של 20 דקות ב 37 מעלות צלזיוס. </li><li style=";text-align:right;direction:rtl"> הוספת ריאגנט איון DNase 1/10 נפח לפתרון RNA. דגירה של 10 דקות ב 70 מעלות צלזיוס. מדדו את הריכוז של RNA הכולל באמצעות ספקטרופוטומטר. חנות ב -20 מעלות צלזיוס. </li></ol></li><li style=";text-align:right;direction:rtl"> בצע סינתזה cDNA הראשון גדיל <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> השתמש אוליגו (DT) תחל -linker לבצע סינתזה cDNA הראשון גדיל בעקבות פרוטוקול של ייצור. להוסיף 1 עד 2 מיקרוגרם של RNA לנפח התגובה הכולל 20 μL. </li><li style=";text-align:right;direction:rtl"> דגירת פתרון התגובה עבור 90 דקות ב 45 מעלות צלזיוס. לסיים את התגובה על ידי חימום על 70 מעלות צלזיוס למשך 5 דקות. </li><li style=";text-align:right;direction:rtl"> להוסיף 1 μL RNase H אל cDNA כךlution להסרת RNA שיורית. מערבבים בעדינות צנטריפוגות במשך 10 שניות על ~ 13,000 g x. דגירה של 20 דקות ב 37 מעלות צלזיוס. להוסיף 20 μl מים חינם nuclease. חנות ב -70 מעלות צלזיוס. </li></ol></li><li style=";text-align:right;direction:rtl"> בצע פלורסנט PCR כמותי <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בצעו qPCR על מערכת Cycler עם צבע פלואורסצנטי. השתמש תנאי אופני PCR הבאים: 35 מחזורים ב 95 מעלות צלזיוס למשך 15 s, C ° TM-5 עבור 15 s, 68 מעלות צלזיוס למשך 30 s. השתמשו רצפים פריימר כדלקמן: AMH (FWD: GTGGATGGCAGCAGTACGAC; rev: GCGGAGAGGTGGAAGAGAGAATG), cyp19a1a (FWD: GTCCTGTTGTCTCCTACTGTCG; rev: CATTTGAGTTGAATATGATGCCCTG), nanos3 (FWD: GCTCGGTGTACGCCAAATCAACAT; rev: CCAAGTGAAAACACAACACCAGTGC), ושה (FWD: ATCGCATAGGAAGAACTGGACGCT; rev: CCAAGTGAAAACACAACACCAGTGC) ו β-אקטין (FWD: AGTGCGACGTGGACATCCGTA; rev: GCACTTCCTGTGGACGATGGA) 19. </li></ol></li></ol>

<ol>
	<li>Wilson, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wild+sex+in+zebrafish:+loss+of+the+natural+sex+determinant+in+domesticated+strains.">Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains.</a> Genetics. 198 (3), 1291-1308 (2014).</li><li>Liew, W. C., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+sex:+a+complicated+affair.">Zebrafish sex: a complicated affair.</a> Genomics. 13 (2), 172-187 (2014).</li><li>Orban, L., Sreenivasan, R., Olsson, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+and+winding+roads:+Testis+differentiation+in+zebrafish.">Long and winding roads: Testis differentiation in zebrafish.</a> Mol. Cell. Endocrinol. 312 (1-2), 35-41 (2009).</li><li>Blaser, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transition+from+non-motile+behaviour+to+directed+migration+during+early+PGC+development+in+zebrafish.">Transition from non-motile behaviour to directed migration during early PGC development in zebrafish.</a> J. Cell Sci. 118, 4027-4038 (2005).</li><li>Wang, X. G., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anti-M&#252;llerian+hormone+and+11+&#946;-hydroxylase+show+reciprocal+expression+to+that+of+aromatase+in+the+transforming+gonad+of+zebrafish+males.">Anti-M&#252;llerian hormone and 11 &#946;-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males.</a> Dev. Dynam. 236 (5), 1329-1338 (2007).</li><li>Siegfried, K. R., N&#252;sslein-Volhard, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+control+of+female+sex+determination+in+zebrafish.">Germ line control of female sex determination in zebrafish.</a> Dev. Biol. 324 (2), 277-287 (2008).</li><li>Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oocyte+apoptosis+during+the+transition+from+ovary-like+tissue+to+testes+during+sex+differentiation+of+juvenile+zebrafish.">Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish.</a> J. Exp. Biol. 205 (Pt 6), 711-718 (2002).</li><li>Groh, K. J., Sch&#246;nenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+protein+expression+in+zebrafish+during+gonad+differentiation+by+targeted+proteomics.">Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics.</a> Gen. Comp. Endocr. 193, 210-220 (2013).</li><li>Siegfried, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+search+of+determinants:+gene+expression+during+gonadal+sex+differentiation.">In search of determinants: gene expression during gonadal sex differentiation.</a> J. Fish Biol. 76 (8), 1879-1902 (2010).</li><li>Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microarray+analysis+of+sex-+and+gonad-biased+gene+expression+in+the+zebrafish:+evidence+for+masculinization+of+the+transcriptome.">A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome.</a> BMC Genomics. 10, 579 (2009).</li><li>Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+Cyp19+(P450+aromatase)+genes+on+duplicated+zebrafish+chromosomes+are+expressed+in+ovary+or+brain.">Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain.</a> Mol. Biol. Evol. 18 (4), 542-550 (2001).</li><li>Kishida, M., Callard, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+cytochrome+P450+aromatase+isoforms+in+zebrafish+(Danio+rerio)+brain+and+ovary+are+differentially+programmed+and+estrogen+regulated+during+early+development.">Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development.</a> Endocrinology. 142 (2), 740-750 (2001).</li><li>Rodr&#237;guez-Mar&#237;, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+and+expression+pattern+of+zebrafish+anti-M&#252;llerian+hormone+(amh)+relative+to+sox9a,+sox9b,+and+cyp19a1a,+during+gonad+development.">Characterization and expression pattern of zebrafish anti-M&#252;llerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development.</a> Gene Expr.Patterns. 5 (5), 655-667 (2005).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+a+vas::EGFP+transgene+in+primordial+germ+cells+of+the+zebrafish.">Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish.</a> Mech Dev. 116 (1-2), 141-150 (2002).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sexual+dimorphic+expression+pattern+of+a+splice+variant+of+zebrafish+vasa+during+gonadal+development.">Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development.</a> Dev. Biol. 271 (1), 190-197 (2004).</li><li>Tzung, K. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+depletion+of+primordial+germ+cells+in+zebrafish+promotes+testis+formation.">Early depletion of primordial germ cells in zebrafish promotes testis formation.</a> Stem Cell Reports. 4 (1), 61-73 (2015).</li><li>Hsiao, C., Tsai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenic+zebrafish+with+fluorescent+germ+cell:+a+useful+tool+to+visualize+germ+cell+proliferation+and+juvenile+hermaphroditism+in+vivo.">Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo.</a> Dev. Biol. 262 (2), 313-323 (2003).</li><li>Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser+capture+microdissection+of+gonads+from+juvenile+zebrafish.">Laser capture microdissection of gonads from juvenile zebrafish.</a> Reprod Biol Endocrinol. 7, 97 (2009).</li><li>Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=nr0b1+(DAX1)+mutation+in+zebrafish+causes+female-to-male+sex+reversal+through+abnormal+gonadal+proliferation+and+differentiation.">nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation.</a> Mol. Cell. Endocrinol. 433, 105-116 (2016).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). , (2000).</li><li>Liew, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polygenic+sex+determination+system+in+zebrafish.">Polygenic sex determination system in zebrafish.</a> PLoS One. 7 (4), e34397 (2012).</li><li>Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Normal+table+of+postembryonic+zebrafish+development:+staging+by+externally+visible+anatomy+of+the+living+fish.">Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish.</a> Dev Dyn. 238 (12), 2975-3015 (2009).</li><li>Gupta, T., Mullins, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+Organs+from+the+Adult+Zebrafish.">Dissection of Organs from the Adult Zebrafish.</a> J. Vis Exp. (37), (2010).</li><li>Arnaout, R., Reischauer, S., Stainier, D. Y. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recovery+of+Adult+Zebrafish+Hearts+for+High-throughput+Applications.">Recovery of Adult Zebrafish Hearts for High-throughput Applications.</a> J. Vis Exp. (94), (2014).</li><li>Gerlach, G. F., Schrader, L. N., Wingert, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+the+Adult+Zebrafish+Kidney.">Dissection of the Adult Zebrafish Kidney.</a> J. Vis Exp. (54), (2011).</li><li>Yoon, C., Kawakami, K., Hopkins, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+vasa+homologue+RNA+is+localized+to+the+cleavage+planes+of+2-+and+4-cell-stage+embryos+and+is+expressed+in+the+primordial+germ+cells.">Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells.</a> Development. 124 (16), 3157-3165 (1997).</li><li>Braat, A. K., Speksnijder, J. E., Zivkovic, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+development+in+fishes.">Germ line development in fishes.</a> Int. J. Dev. Biol. 43 (7), 745-760 (1999).</li><li>Huang, H. Y., Ketting, R. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+zebrafish+gonads+for+RNA+isolation.">Isolation of zebrafish gonads for RNA isolation.</a> Methods Mol Biol. 1093, 183-194 (2014).</li></ol>

החוקרים מצהירים כי אין להם אינטרסים כלכליים מתחרים.

דג הזברה הפכה מודל עוצמה והוא משמש באופן נרחב בפיתוח ומחקר הקשורות למחלה. השיטות לבידוד איברי דג זברה מבוגרת כגון מוח, לב, בלוטת מין, ו בכליות, תועדו היטב 23, 24, 25. בשל גודלו הקטן שיפוץ דינמי של הרקמות האשכים של דג הזברה הזחל, הבידוד של רקמת האשכים היא משימה מאתגרת. מחקרים קודמים השתמשו ברקמות גזע גזור כולו או ושה מהונדס: תא המבוססת EGFP מיון microdissection לייזר לבחון את בלוטות המין הזחל 26. השינויים של כרומוזום 4 במהלך הביות מקבלים את החלטת מין תעלומה של דג הזברה המבויתת. השיטה שלנו המתואר כאן יכול לספק יחסית נקי מוקדם בהכנות שַׁחֲלָה לבדיקות מורפולוגיים ומולקולריים נוספת, אשר יכול להיות מועיל כדי לחקור את mech בקביעת מיןanisms. זה לא קל להפריד את בלוטת המין בפיתוח ממבנים אחרים בבית מוקדם בשלבי הפיתוח. השיטה שלנו מתארת ​​כיצד לבצע את הנתיחה. כדי לבצע זאת בפרוטוקול בהצלחה, כמה צעדים קריטיים צריכים לציין. ראשית, מצב הצמיחה של דג זברת זחל הוא קריטי תוצאות צפויות תשואה. התפתחות האשכים של דג הזברה הזחל היא תהליך דינמי מאוד. הגודל והמראה של רקמות אשכים נקבעים לפי שלבי ההתפתחות של בעלי החיים 27. חשוב לשמור על קבוצות שונות של דג זברה במצב סטנדרטי. הגורמים שעשויים להשפיע על הצמיחה של זחלים כוללים צפיפות אוכלוסייה, משך אור מחזורים כהים, זמינויות מזון ולוחות זמני האכלה. המדידה באורך הסטנדרטית של דגי זחל יכולה לשמש כמדריך כדי לקבוע את מצב הגידול של בעלי החיים 22. גורם קריטי שני עבור בידוד ע רקמת אשכים המוצלחיון הוא הבנה טובה של המיקום היחסי ואת הבדלים מורפולוגיים בין בלוטות המין לבין הרקמות הסובבות. מכיוון שַׁחֲלָה ממוקמת בצד הגחון של בשלפוחית ​​השחייה, זה נוח בתחילה לבודד את בלוטות המין יחד עם בשלפוחית ​​השחייה. בנוסף, בקצה הדיסטלי של בלוטות המין מחובר בחוזקה אל הקצה הדיסטלי של בטן. אז צריך להיזהר בעת הוצאת המעיים מן שַׁחֲלָה בקצוות דיסטלי. עבור ניתוח ביטוי גנים לאחר מכן, חשוב להשתמש במדיה טרום צוננים צלחת אגרה, ולבצע את ההליך כולו במהירות. שיטה דומה נוצלה בהצלחה על ידי RF Ketting ואח. 28. הם יישמו את שיטת הבידוד שַׁחֲלָה על חקירת הפונקציה של piRNAs ואת מסלול PIWI זחלי 3 שבועות בן. הנה, נתחנו רקמת אשכים מן זחלי דג זברה מוקדם ככל 17 DPF לחקור את פרופיל הביטוי זהה גן המולקולרי של develoשַׁחֲלָה דג הזברה פינג. ניתוחים מולקולריים העתיד של רקמת האשכים מבודדת מוקדם עשוי להתבצע כדי לקבוע את transcriptome, methylome ו acetylation היסטון דפוסים כדי להבהיר את המנגנונים שבבסיס התפתחות המין של דג הזברה.

קובע המין הנשי המרכזי כרומוזום דג זברה פרא 4 אבד או שונה של דג הזברה המבויתת (זני מעבדה הנפוצים כלומר) 1. במקום זאת, יש להם מערכת קביעת הזוויג polygenic בליווי גורמים סביבתיים כגון טמפרטורה, היפוקסיה, זמינות המזון וצפיפות האוכלוסייה. המנגנונים המפורטים של התפתחות מין דג זברה אינם מובנים במלואם. שאלות יסוד כגון כאשר קביעת הזוויג דג זברה מתרחשת, מה אות קביעת המין העיקרית (ים) היא / הם, ואשר גנים להסדיר את הצעד הראשון של טרנספורמציה שַׁחֲלָה להישאר ייענה 2, 3. בתהליך פיתוח מין דג זברה, בכמה שלבים חשובים הוכרו. בשלב מוקדם של הפיתוח, החל 4 hpf (הפריה פוסט שעות)-תאי נבט בראשיתי (PGCs) עוברים המפרט, הגירה אל הרכס גניטלישִׂגשׂוּג. מספרים PGC ואינטראקציות גומלין בין תאי הנבט תאים סומטיים חשובים בידול שַׁחֲלָה 4. בשעה 13 DPF (הפריה פוסט ימים), בלוטות המין נמצאים בשלב מובחן. עד 17 DPF, בלוטות המין להתפתח דו-פוטנציאל שחלות הן נקבות וזכרים בעתיד. המעבר תלוי-אפופטוזיס מן השחלה אל האשכים מתחילים בגיל 21 כדי 25 DPF ועשוי להימשך מספר שבועות. עד 35 DPF, המין של בלוטת המין נקבע וייצור תא מין ספציפי מין מתנהל בשני השחלות ואשכים 5, 6, 7. נכון להיום, גנים ומנגנוני מועמד מגוונים של קביעת הזוויג הוצעו. פרוטאומיקה וניתוח transcriptomic הצליחו לבודד גנים רבים עם הביטוי דימורפית מינית גנים אלה נוצלו כדי ללמוד בידול מין דג הזברה 8, </sup&gt; 9, 10. לדוגמה, ב דג הזברה הזחל, הגן cyp19a1a מתבטא במיוחד בשחלה אך לא את האשך 11, 12. בנוסף, גן AMH מתבטא בחולשה בתאי granulosa הזקיק בשחלה, אבל מאוד בתאי testis Sertoli 13. לעומת זאת, הגן ושה מתבטא באופן רציף בתאי הרבייה של שני דג הזברה הנשית והגברית, מה שהופך אותו סמן שַׁחֲלָה מתאים 14, 15. חקירת רמות ביטוי הגנים האשכים הוא קריטי כדי להבין את המנגנון המולקולרי של קביעת הזוויג והבחנה במיוחד בשלב הדו-פוטנציאל השחלה 3, 9. עם זאת, גודלו הקטן של דג הזברה הזחל והאשכים קטנים בהתאמה לסבך את הבידוד של gonadal רקמות לניתוח מולקולרי נוסף. מחקרים קודמים השתמשו גזורים באזור תא מטען כולו בין opercula ואת הנקבוביות אנאליות 16. הכנה זו, למרות בלוטות מין המכיל, מורכבת של רקמות ואיברים מרובים. לחלופין, חיות טרנסגניות עם הביטוי GFP שַׁחֲלָה ספציפיים כגון ושה: EGFP שימשו לבידוד רקמת האשכים באמצעות תא מופעל הקרינה מיון (FACS) ו ללכוד לייזר דיסקציה מיקרו 17, 18. אבל היישום הנרחב שלהם מוגבל. כאן, אנו מתארים תהליך פשוט לבודד רקמת האשכים מן דג הזברה הזחל ב 17 DPF ו 25 DPF. אנחנו מדגימים את המיקום של בלוטות המין ביחס לאיברים אחרים ולבודד את בלוטות המין ללא פגע מורפולוגית הרקמות הסובבות. אנחנו מראים עוד את הגנים ספציפיים שַׁחֲלָה כגון ושה cyp19a1a מבוטאים מאוד בלוטות המין המבודדות לעומת רקמת תא המטען באמצעות PCR כמוני (ניתוח qPCR). הפרוטוקול הנוכחי מאפשר זיהוי, בידוד, טיהור RNA והגברה של גנים ספציפיים אשכים מן דג זברת זחל, ובכך מאפשר ניתוח מולקולרי הבא של רקמת אשכי 19.

<table border="0" cellpadding="0" cellspacing="0" width="975">
	<tbody>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Cell culture dish 100 mm</td>
			<td style="width:208px;">Corning</td>
			<td style="width:208px;">430167</td>
			<td style="width:351px;">For embryo incubation</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:208px;">20 X EM</td>
			<td style="width:208px;"></td>
			<td style="width:208px;"></td>
			<td style="width:351px;">For a 1 liter needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl.2H2O; then add 0.41 g KH2PO4, 0.412 g Na2HPO4 anhydrous and 4.9 g MgSO4. 7H2O.</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">1 X EM</td>
			<td style="width:208px;"></td>
			<td style="width:208px;"></td>
			<td style="width:351px;">Dilute 20 X EM in distilled water</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">AGAROSE G-10</td>
			<td style="width:208px;">Gene</td>
			<td style="width:208px;">121985</td>
			<td style="width:351px;">For preparing the 2% agar plates&#160;</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Trizol Reagent</td>
			<td style="width:208px;">Invitrogen</td>
			<td style="width:208px;">15596-026</td>
			<td style="width:351px;">For RNA isolation&#160;</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Meter glass</td>
			<td style="width:208px;">Shen Bo</td>
			<td style="width:208px;">250 ml</td>
			<td style="width:351px;">For preparing the 2% agar plates&#160;</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Microwave Oven</td>
			<td style="width:208px;">Midea</td>
			<td style="width:208px;">M1-211A</td>
			<td style="width:351px;">For heating the AGAR</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">TWEEZER DUMONT#5INOX</td>
			<td style="width:208px;">World Precision Instrument</td>
			<td style="width:208px;">500341</td>
			<td style="width:351px;">For dissection</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Stereomicroscope</td>
			<td style="width:208px;">Motic</td>
			<td style="width:208px;">SMZ168</td>
			<td style="width:351px;">For dissection</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Pure water equipment</td>
			<td style="width:208px;">Millipore</td>
			<td style="width:208px;"></td>
			<td style="width:351px;"></td>
		</tr>
		<tr height="81">
			<td height="81" style="height:81px;width:208px;">Ringer&#8217;s solution</td>
			<td style="width:208px;"></td>
			<td style="width:208px;"></td>
			<td style="width:351px;">For a 1 liter needed: Add 6.78g NaCl, 0.22 g KCl, 0.26 g CaCl2 and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Transfer pipette</td>
			<td style="width:208px;">Samco</td>
			<td style="width:208px;">202, 204</td>
			<td style="width:351px;"></td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Metal bath</td>
			<td style="width:208px;">QiLinbeier</td>
			<td style="width:208px;"></td>
			<td style="width:351px;">Model GL-150</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Microscope</td>
			<td style="width:208px;">Leica&#160;</td>
			<td style="width:208px;">M205 FA</td>
			<td style="width:351px;">For photomicrograph</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Centrifuge</td>
			<td style="width:208px;">Eppendorf</td>
			<td style="width:208px;">5417R</td>
			<td style="width:351px;"></td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Micro Scale RNA Isolation Kit&#160;</td>
			<td style="width:208px;">Ambion</td>
			<td style="width:208px;">AM1931</td>
			<td style="width:351px;">For RNA isolation from gonad tissues</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Dnase I&#160;</td>
			<td style="width:208px;">Sigma</td>
			<td style="width:208px;">AMPD1-1KT</td>
			<td style="width:351px;">For DNA digestion in the RNA solution&#160;</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">RevertAid First Strand cDNA Synthesis Kit</td>
			<td style="width:208px;">Thermo Scientific</td>
			<td style="width:208px;">#K1631</td>
			<td style="width:351px;">For&#160; first-strand cDNA synthesis</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Rnase H&#160;</td>
			<td style="width:208px;">Thermo Scientific</td>
			<td style="width:208px;">#EN0202</td>
			<td style="width:351px;">For digesting the residual RNA in the cDNA solution.</td>
		</tr>
		<tr height="98">
			<td height="98" style="height:98px;width:208px;">SYBR Green Realtime PCR Master Mix</td>
			<td style="width:208px;">TOYOBO</td>
			<td style="width:208px;">QPK-201</td>
			<td style="width:351px;">This product is a Taq DNA polymerase-based 2 x master mix for real-time PCR and&#160; applicable for intercalation assay with SYBR Green I.</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Spectrophotometer</td>
			<td style="width:208px;">Ne Drop</td>
			<td style="width:208px;">OD-2000+</td>
			<td>Measuring the concentration of the total RNA</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Mastercycler</td>
			<td style="width:208px;">Eppendorf</td>
			<td style="width:208px;">AG 22331 Hamburg</td>
			<td>gene expression profiling</td>
		</tr>
	</tbody>
</table>

dissection of larval zebrafish gonadal tissue

למרות דג זברה פרא להחזיק מערכת ZZ / ZW מין להגדרה, דג זברה מבוית אבדה את כרומוזום המין. הם מנצלים מערכת קביעת הזוויג polygenic, שבו מספר גנים מופצים ברחבי הגנום קולקטיבי לקבוע את זהותם המין של דגים בודדים. נכון לעכשיו, את הגנים מעורבים בויסות התפתחות בלוטת מין וכיצד הם פועלים להישאר חמקמקים. בדרך כלל, לבודד רקמת אשכים הוא הצעד הראשון כדי לבחון את התהליכים ההתפתחותיים מין. כאן, אנו מציגים הליך לבודד רקמת אשכים מן 17 DPF (הפריה פוסט ימים) ו 25 DPF זחלי דג זברה. רקמת האשכים המבודדת עשויה להיבחן לאחר מכן על ידי פרופיל ביטוי מורפולוגיה גן.

והניתוחים של בלוטות המין בוצעו על דג הזברה הזחל זן AB. איור 1 מציג רקמת האשכים טיפוסית של דג הזברה הזחל ב 17 DPF ו 25 DPF. ראשית, העור והשרירים של צד אחד של הבטן הוא חתכו לחשוף את האיברים הפנימיים. לאחר הסרת המסה של איברים פנימיים, בשלפוחית ​​השחייה יחד עם האשך להישאר בתא המטען. שַׁחֲלָה צורף בצד הגחון של שלפוחית השחייה (החץ באיור 1B &#39;). בשעה 17 DPF, את בלוטת המין היה בשלב הדו-פוטנציאל השחלה. אֶשֶׁך המבודד כלול שמאל ואת בלוטת המין הנכון היה שקוף (איור 1C). ברוב המקרים, זה היה מוקף ברקמת אפיתל protonephridium (החץ באיור 1C). בשעה 25 DPF אֶשֶׁך נעטף לעתים קרובות על ידי רקמות השומן (איור 1D). בשלב התפתחות זו stגיל, או אשך גדול או קטן אפשר לראות. השחלה בשלה היא גדולה כמו ההתפתחות של הביציות המשניות, ותאי זקיק להגדיל את נפח בלוטת המין (איור 1E). לאשכים בשלה הוא קטן בגלל ניוון אפופטוזיס של השחלה הזחל (איור 1F). כדי לנתח את המאפיינים המולקולריים של רקמות האשכים המבודדות, בדקו ראשון רמות ביטוי גנים של AMH, cyp19a1a, nanos3 וושה, ארבעה סמני אֶשֶׁך דג זברה, על ידי qPCR. RNA סה&quot;כ היה שחולץ מן רקמות אשכי זחל (n = 35) באמצעות ערכת בידוד RNA. בנוסף, הסרנו את הראש והזנב של 17 DPF זחל, ומשתמש רקמת תא המטען (בין מבנה הלב ואת הנקבוביות אנאליות) כדי לחלץ RNA כחלק מקבוצת הביקורת (n = 15). רקמת תא המטען כללה עור, שריר, עצם (חוליות וצלעות), לשחות שלפוחית ​​שתן, כליות בלוטת מין. אוליגו DT-pשוליה cDNA שימש qPCR. התוצאה qPCR הראה עליות AMH, cyp19a1a, nanos3 ורמות ושה ביטוי 17 רקמת האשכים מבודדת DPF בכ 397, 342, 45 ו 170 של פי, בהתאמה (איור 2). <img alt="איור 1" class="xfigimg" src="/files/ftp_upload/55294/55294fig1.jpg" /> איור 1. Microphotographs של רקמות אשכים אופייניות זחל דג זברת 17 DPF ו 25 DPF. (א) תולשים את העור והשרירים של צד אחד של הבטן כדי לחשוף את האיברים הפנימיים תחת מיקרוסקופ סטריאו 25x. (ב) לאחר הסרת המסה של האיברים הפנימיים, בשלפוחית השחייה ואת בלוטת המין נשארים מחוברים תא המטען. (ב &#39;) מוגבר לאור התיבה האדומה B פאנל להראות את המיקום היחסי של בשלפוחית השחייה ואת בלוטת המין. אֶשֶׁך הוא מסומן בחץ. (ג) Iso<html> lated רקמת האשכים ב 17 DPF. הרקמות השחורות בתמונה (חיצים) הנן רקמת האנדותל protonephridium המצורפת אֶשֶׁך. (DE) A שַׁחֲלָה גדול לפני ואחרי הסרת רקמת שומן ב 25 DPF. (ו) שַׁחֲלָה קטן 25 DPF. ברי סולם: 200 מיקרומטר. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55294/55294fig1large.jpg" target="_blank">אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.</a> <img alt="איור 2" class="xfigimg" src="/files/ftp_upload/55294/55294fig2.jpg" /> איור 2. רמות Gene Expression מנורמלות של AMH, cyp19ala, nanos3 וושה בגזעים והאשכים מבודדים 17 DPF. מספרים של בעלי חיים המשמשים: קבוצת ביקורת, n = 15; קבוצת אֶשֶׁך, n = 35. רקמות הגזע בקבוצת הביקורת הנן ללא ראש מבני הזנב. הקבוצה שַׁחֲלָה מתייחסת רקמות האשכים המבודדות./files/ftp_upload/55294/55294fig2large.jpg&quot; target = &#39;_ blank&#39;&gt; אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

Watch this Scientific Journal Video about Dissection of Larval Zebrafish Gonadal Tissue at JoVE.com

Dissection of Larval Zebrafish Gonadal Tissue

כאן, אנו מציגים פרוטוקול לבידוד רקמת האשכים של דג הזברה הזחל, אשר יקל על חקירות של בידול מין דג הזברה ותחזוקה.

דיסקציה של רקמות הזחל דג הזברה האשכים

Although wild zebrafish possess a ZZ/ZW sex-determination system, domesticated zebrafish have lost the sex chromosome. They utilize a polygenic sex ...

dissection-of-larval-zebrafish-gonadal-tissue

Nanyang Technological University

Research

JoVE Journal

Developmental Biology

10.2K Views.  Fudan University.  כאן, אנו מציגים פרוטוקול לבידוד רקמת האשכים של דג הזברה הזחל, אשר יקל על חקירות של בידול מין דג הזברה ותחזוקה. 

Video: Dissection of Larval Zebrafish Gonadal Tissue

Large-scale Zebrafish Embryonic Heart Dissection for Transcriptional Analysis

The zebrafish embryonic heart is composed of only a few hundred cells, representing only a small fraction of the entire embryo. Therefore, to prevent the cardiac transcriptome from being masked by the global embryonic transcriptome, it is necessary to collect sufficient numbers of hearts for further analyses. Furthermore, as zebrafish cardiac development proceeds rapidly, heart collection and RNA extraction methods need to be quick in order to ensure homogeneity of the samples. Here, we present a rapid manual dissection protocol for collecting functional/beating hearts from zebrafish embryos. This is an essential prerequisite for subsequent cardiac-specific RNA extraction to determine cardiac-specific gene expression levels by transcriptome analyses, such as quantitative real-time polymerase chain reaction (RT-qPCR). The method is based on differential adhesive properties of the zebrafish embryonic heart compared with other tissues; this allows for the rapid physical separation of cardiac from extracardiac tissue by a combination of fluidic shear force disruption, stepwise filtration and manual collection of transgenic fluorescently labeled hearts.

To analyse cardiac gene expression profiles during zebrafish heart development, total RNA has to be extracted from isolated hearts. Here, we present a protocol for collecting functional/beating hearts by rapid manual dissection from zebrafish embryos to obtain cardiac-specific mRNA.

בקנה מידה גדולה דג הזברה עוברי לב Dissection לניתוח תעתיק

The zebrafish embryonic heart is composed of only a few hundred cells, representing only a small fraction of the entire embryo. Therefore, to prevent the ...

Live Imaging of Innate Immune and Preneoplastic Cell Interactions Using an Inducible Gal4/UAS Expression System in Larval Zebrafish Skin

Here we describe a method to conditionally induce epithelial cell transformation by the use of the 4-Hydroxytamoxifen (4-OHT) inducible KalTA4-ERT2/UAS expression system1 in zebrafish larvae, and the subsequent live imaging of innate immune cell interaction with HRASG12V expressing skin cells. The KalTA4-ERT2/UAS system is both inducible and reversible which allows us to induce cell transformation with precise temporal/spatial resolution in vivo. This provides us with a unique opportunity to live image how individual preneoplastic cells interact with host tissues as soon as they emerge, then follow their progression as well as regression. Recent studies in zebrafish larvae have shown a trophic function of innate immunity in the earliest stages of tumorigenesis2,3. Our inducible system would allow us to live image the onset of cellular transformation and the subsequent host response, which may lead to important insights on the underlying mechanisms for the regulation of oncogenic trophic inflammatory responses. We also discuss how one might adapt our protocol to achieve temporal and spatial control of ectopic gene expression in any tissue of interest.

Studying the earliest events of preneoplastic cell progression and innate immune cell interaction is pivotal to understand and treat cancer. Here we describe a method to conditionally induce epithelial cell transformations and the subsequent live imaging of innate immune cell interaction with HRASG12V expressing skin cells in zebrafish larvae.

הדמיה חיה של אינטראקציות תא של מערכת חיסון המולדת וPreneoplastic שימוש מערכת ביטוי / כטב&quot;מ העין מתנהלת Gal4 בעור הזחל דג הזברה

Here we describe a method to conditionally induce epithelial cell transformation by the use of the 4-Hydroxytamoxifen (4-OHT) inducible KalTA4-ERT2/UAS ...

Capturing Tissue Repair in Zebrafish Larvae with Time-lapse Brightfield Stereomicroscopy

The zebrafish larval tail fin is ideal for studying tissue regeneration due to the simple architecture of the larval fin-fold, which comprises of two layers of skin that enclose undifferentiated mesenchyme, and because the larval tail fin regenerates rapidly within 2-3 days. Using this system, we demonstrate a method for capturing the repair dynamics of the amputated tail fin with time-lapse video brightfield stereomicroscopy. We demonstrate that fin amputation triggers a contraction of the amputation wound and extrusion of cells around the wound margin, leading to their subsequent clearance. Fin regeneration proceeds from proximal to distal direction after a short delay. In addition, developmental growth of the larva can be observed during all stages. The presented method provides an opportunity for observing and analyzing whole tissue-scale behaviors such as fin development and growth in a simple microscope setting, which is easily adaptable to any stereomicroscope with time-lapse capabilities.

We present a protocol for capturing the dynamics of zebrafish larval tail fin regeneration on a whole-tissue scale using brightfield-based stereomicroscopy. This technique enables capturing the regeneration dynamics with single cell resolution. This methodology can be adapted to any stereomicroscope equipped with a CCD camera and time-lapse software.

לכידת תיקון רקמות דג הזברה זחלים עם הזמן לשגות Brightfield stereomicroscopy

The zebrafish larval tail fin is ideal for studying tissue regeneration due to the simple architecture of the larval fin-fold, which comprises of two ...

Visualizing the Interrenal Steroidogenic Tissue and Its Vascular Microenvironment in Zebrafish

This protocol introduces how to detect differentiated interrenal steroidogenic cells through a simple whole-mount enzymatic activity assay. Identifying differentiated steroidogenic tissues through chromogenic histochemical staining of 3-&#946;-Hydroxysteroid dehydrogenase /&#916;5-4 isomerase (3&#946;-Hsd) activity-positive cells is critical for monitoring the morphology and differentiation of adrenocortical and interrenal tissues in mammals and teleosts, respectively. In the zebrafish model, the optical transparency and tissue permeability of the developing embryos and larvae allow for whole-mount staining of 3&#946;-Hsd activity. This staining protocol, as performed on transgenic fluorescent reporter lines marking the developing pronephric and endothelial cells, enables the detection of the steroidogenic interrenal tissue in addition to the kidney and neighboring vasculature. In combination with vibratome sectioning, immunohistochemistry, and confocal microscopy, we can visualize and assay the vascular microenvironment of interrenal steroidogenic tissues. The 3&#946;-Hsd activity assay is essential for studying the cell biology of the zebrafish interrenal gland because to date, no suitable antibody is available for labeling zebrafish steroidogenic cells. Furthermore, this assay is rapid and simple, thus providing a powerful tool for mutant screens targeting adrenal (interrenal) genetic disorders as well as for determining disruption effects of chemicals on steroidogenesis in pharmaceutical or toxicological studies.

The interrenal gland in zebrafish is the teleostean counterpart of the mammalian adrenal gland. This protocol introduces how to perform the 3-&#946;-hydroxysteroid dehydrogenase (&#916;5-4 isomerase; 3&#946;-Hsd) enzymatic activity assay, which detects differentiated steroidogenic cells in the developing zebrafish.

לדמיין את רקמות Interrenal Steroidogenic ו microenvironment הדם שלה דג הזברה

This protocol introduces how to detect differentiated interrenal steroidogenic cells through a simple whole-mount enzymatic activity assay. Identifying ...

Establishment of Larval Zebrafish as an Animal Model to Investigate Trypanosoma cruzi Motility In Vivo

Chagas disease is a parasitic infection caused by Trypanosoma cruzi, whose motility is not only important for localization, but also for cellular binding and invasion. Current animal models for the study of T. cruzi allow limited observation of parasites in vivo, representing a challenge for understanding parasite behavior during the initial stages of infection in humans. This protozoan has a flagellar stage in both vector and mammalian hosts, but there are no studies describing its motility in vivo.The objective of this project was to establish a live vertebrate zebrafish model to evaluate T. cruzi motility in the vascular system. Transparent zebrafish larvae were injected with fluorescently labeled trypomastigotes and observed using light sheet fluorescence microscopy (LSFM), a noninvasive method to visualize live organisms with high optical resolution. The parasites could be visualized for extended periods of time due to this technique&#39;s relatively low risk of photodamage compared to confocal or epifluorescence microscopy. T. cruzi parasites were observed traveling in the circulatory system of live zebrafish in different-sized blood vessels and the yolk. They could also be seen attached to the yolk sac wall and to the atrioventricular valve despite the strong forces associated with heart contractions. LSFM of T. cruzi-inoculated zebrafish larvae is a valuable method that can be used to visualize circulating parasites and evaluate their tropism, migration patterns, and motility in the dynamic environment of the cardiovascular system of a live animal.

Establishment of Larval Zebrafish as an Animal Model to Investigate Trypanosoma cruzi Motility In Vivo

In this protocol, fluorescently labeled T. cruzi&#160;were injected into transparent zebrafish larvae, and parasite motility was observed in vivo using light sheet fluorescence microscopy.

הקמתה של הזחל דג זברה כמודל חיה כדי Investigate Trypanosoma cruzi תנועתיות Vivo ב

Chagas disease is a parasitic infection caused by Trypanosoma cruzi, whose motility is not only important for localization, but also for cellular binding ...

Dissection and Staining of Drosophila Pupal Ovaries

Unlike adult Drosophila ovaries, pupal ovaries are relatively difficult to access and examine due to their small size, translucence, and encasing within a pupal case. The challenge of dissecting pupal ovaries also lies in their physical location within the pupa: the ovaries are surrounded by fat body cells inside the pupal abdomen, and these fat cells must be removed to allow for proper antibody staining. To overcome these challenges, this protocol utilizes customized Pasteur pipets to extract fat body cells from the pupal abdomen. Moreover, a chambered coverglass is used in place of a microcentrifuge tube during the staining process to improve visibility of the pupae. However, despite these and other advantages of the tools used in this protocol, successful execution of these techniques may still involve several days of practice due to the small size of pupal ovaries. The techniques outlined in this protocol could be applied to time course experiments in which ovaries are analyzed at various stages of pupal development.

Dissection and Staining of Drosophila Pupal Ovaries

The Drosophila ovary is an excellent model system for studying stem cell niche development. Though methods for dissecting larval and adult ovaries have been published, pupal ovary dissections require different techniques that have not been published in detail. Here we outline a protocol for dissecting, staining, and mounting pupal ovaries.

חיתוך, צביעה של השחלות הגולמי דרוזופילה

Unlike adult Drosophila ovaries, pupal ovaries are relatively difficult to access and examine due to their small size, translucence, and encasing within a ...

Following Endocardial Tissue Movements via Cell Photoconversion in the Zebrafish Embryo

During embryogenesis, cells undergo dynamic changes in cell behavior, and deciphering the cellular logic behind these changes is a fundamental goal in the field of developmental biology. The discovery and development of photoconvertible proteins have greatly aided our understanding of these dynamic changes by providing a method to optically highlight cells and tissues. However, while photoconversion, time-lapse microscopy, and subsequent image analysis have proven to be very successful in uncovering cellular dynamics in organs such as the brain or the eye, this approach is generally not used in the developing heart due to challenges posed by the rapid movement of the heart during the cardiac cycle. This protocol consists of two parts. The first part describes a method for photoconverting and subsequently tracking endocardial cells (EdCs) during zebrafish atrioventricular canal (AVC) and atrioventricular heart valve development. The method involves temporally stopping the heart with a drug in order for accurate photoconversion to take place. Hearts are allowed to resume beating upon removal of the drug and embryonic development continues normally until the heart is stopped again for high-resolution imaging of photoconverted EdCs at a later developmental time point. The second part of the protocol describes an image analysis method to quantify the length of a photoconverted or non-photoconverted region in the AVC in young embryos by mapping the fluorescent signal from the three-dimensional structure onto a two-dimensional map. Together, the two parts of the protocol allows one to examine the origin and behavior of cells that make up the zebrafish AVC and atrioventricular heart valve, and can potentially be applied for studying mutants, morphants, or embryos that have been treated with reagents that disrupt AVC and/or valve development.

This protocol describes a method for the photoconversion of Kaede fluorescent protein in endocardial cells of the living zebrafish embryo that enables the tracking of endocardial cells during atrioventricular canal and atrioventricular heart valve development.

הפרקים הבאים רקמה Endocardial ויה Photoconversion תאים של העובר דג זברה

During embryogenesis, cells undergo dynamic changes in cell behavior, and deciphering the cellular logic behind these changes is a fundamental goal in the ...

Adult Zebrafish Injury Models to Study the Effects of Prednisolone in Regenerating Bone Tissue

Zebrafish are able to regenerate various organs, including appendages (fins) after amputation. This involves the regeneration of bone, which regrows within roughly two weeks after injury. Furthermore, zebrafish are able to heal bone rapidly after trepanation of the skull, and repair fractures that can be easily introduced into zebrafish bony fin rays. These injury assays represent feasible experimental paradigms to test the effect of administered drugs on rapidly forming bone. Here, we describe the use of these 3 injury models and their combined use with systemic glucocorticoid treatment, which exerts bone inhibitory and immunosuppressive effects. We provide a workflow on how to prepare for immunosuppressive treatment in adult zebrafish, illustrate how to perform fin amputation, trepanation of calvarial bones, and fin fractures, and describe how the use of glucocorticoids affects both bone forming osteoblasts and cells of the monocyte/macrophage lineage as part of innate immunity in bone tissue.

Here, we describe 3 adult zebrafish injury models and their combined use with immunosuppressive drug treatment. We provide guidance on imaging of regenerating tissues and on detecting bone mineralization therein.

דג זברה בוגרת מודלים פציעה ללמוד את השפעות Prednisolone רגנרציה רקמת העצם

Zebrafish are able to regenerate various organs, including appendages (fins) after amputation. This involves the regeneration of bone, which regrows ...

Electroretinogram Recording in Larval Zebrafish using A Novel Cone-Shaped Sponge-tip Electrode

The zebrafish (Danio rerio) is commonly used as a vertebrate model in developmental studies and is particularly suitable for visual neuroscience. For functional measurements of visual performance, electroretinography (ERG) is an ideal non-invasive method, which has been well established in higher vertebrate species. This approach is increasingly being used for examining the visual function in zebrafish, including during the early developmental larval stages. However, the most commonly used recording electrode for larval zebrafish ERG to date is the glass micropipette electrode, which requires specialized equipment for its manufacture, presenting a challenge for laboratories with limited resources. Here, we present a larval zebrafish ERG protocol using a cone-shaped sponge-tip electrode. The novel electrode is easier to manufacture and handle, more economical, and less likely to damage the larval eye than the glass micropipette. Like previously published ERG methods, the current protocol can assess outer retinal function through photoreceptor and bipolar cell responses, the a- and b-wave, respectively. The protocol can clearly illustrate the refinement of visual function throughout the early development of zebrafish larvae, supporting the utility, sensitivity, and reliability of the novel electrode. The simplified electrode is particularly useful when establishing a new ERG system or modifying existing small-animal ERG apparatus for zebrafish measurement, aiding researchers in the visual neurosciences to use the zebrafish model organism.

Here, we present a protocol that simplifies the measurement of light evoked electroretinogram responses from larval zebrafish. A novel cone-shaped sponge-tip electrode can help to make the study of visual development in larval zebrafish using the electroretinogram ERG easier to achieve with reliable outcomes and lower cost.

הקלטת Electroretinogram דג זברה זחל באמצעות אלקטרודה ספוג-טיפ בצורת חרוט הרומן A

The zebrafish (Danio rerio) is commonly used as a vertebrate model in developmental studies and is particularly suitable for visual neuroscience. For ...

Quantifying Liver Size in Larval Zebrafish Using Brightfield Microscopy

In several transgenic zebrafish models of hepatocellular carcinoma (HCC), hepatomegaly can be observed during early larval stages. Quantifying larval liver size in zebrafish HCC models provides a means to rapidly assess the effects of drugs and other manipulations on an oncogene-related phenotype. Here we show how to fix zebrafish larvae, dissect the tissues surrounding the liver, photograph livers using bright-field microscopy, measure liver area, and analyze results. This protocol enables rapid, precise quantification of liver size. As this method involves measuring liver area, it may underestimate differences in liver volume, and complementary methodologies are required to differentiate between changes in cell size and changes in cell number. The dissection technique described herein is an excellent tool to visualize the liver, gut, and pancreas in their natural positions for myriad downstream applications including immunofluorescence staining and in situ hybridization. The described strategy for quantifying larval liver size is applicable to many aspects of liver development and regeneration.

Here we demonstrate a method for quantifying liver size in larval zebrafish, providing a way to assess the effects of genetic and pharmacologic manipulations on liver growth and development.

בדיקת גודל הכבד בזחל זברה באמצעות מיקרוסקופ ברייטפילד

In several transgenic zebrafish models of hepatocellular carcinoma (HCC), hepatomegaly can be observed during early larval stages. Quantifying larval ...