Agradecemos a C Zhang para el cuidado de los peces. Este trabajo fue apoyado por la Fundación Nacional de Ciencias Naturales de China (31171074, 31371099 y 31571067 a GP) y por el Proyecto Talento Pujiang (09PJ1401900 a GP).

experimentos de pez cebra fueron aprobados por el Comité Institucional de Cuidado y Uso de Animales de la Universidad de Fudan. El pez cebra se plantearon y criado de acuerdo con procedimientos estándar de 20. 1. Preparativos <ol><li> Cultivar 17 dpf y 25 dpf larvas de pez cebra <ol><li> Transfer 2 hombres y 2 mujeres adultos de pez cebra (sana, de 3 a 6 meses de edad, de laboratorio AB strain) a un tanque de cruce en la tarde antes del día de travesía. Separar los machos y las hembras con una barrera. A la mañana siguiente, refrescar el agua del tanque y eliminar la barrera para que puedan aparearse. Recoger los huevos en 100 mm placas de Petri de 1 a 2 horas después de la fertilización. </li><li> Mantener aproximadamente 40 embriones en una placa de 100 mm con 40 ml de medio de embrión (EM) a 28,5 ° C durante el período de desarrollo de la primera (4 días) y actualizar la EM dos veces al día. Transferencia de las larvas a 1 tanques de L (40 larvas a 300 ml de agua del sistema) y alimentar con rotíferos vivos (suministro completo, dos veces al día) después de 5 dpf.Alimentar artemia viva en lugar de la dieta de rotíferos después de 10 dpf. Transferir el pescado en recirculante sistema de agua a 14 dpf 21. </li><li> Elevar larvas de pez cebra en el sistema de recirculación de agua hasta 17 dpf o 25 dpf. Asegúrese de que el ciclo de luz / oscuridad es 14/10 h y pH valor de agua del sistema es de aproximadamente 7,2. Medir la longitud corporal de 17 dpf (5.5 hasta 6.8 mm) y 25 dpf (8 a 11 mm) larvas 22. </li></ol></li><li> Preparar 2% placas de agar para la disección. <ol><li> Añadir 4 g de agar a 200 ml de agua estéril. Calentar la mezcla en un horno microondas hasta que se vuelve transparente. </li><li> Se enfría la solución de agar durante aproximadamente 15 min, luego se vierte en 60 mm de diámetro placas de Petri (aproximadamente 1/3 de volumen de la placa). Almacenar las placas de agar solidificado a 4 ° C. </li></ol></li></ol> 2. Protocolo 1: diseccionar el tejido gonadal de 17 y 25 dpf larvas <ol><li> Añadir hielo picado en el tanque para anestesiar a 17 larvas dpf. la transferencia de lalarvas anestesiado a un 100 mm refrigerados placa de Petri con una solución de 30 ml de Ringer frío. Mantener el pescado se incubaron en la solución de Ringer enfriada durante al menos 15 min para anestesiar completamente las larvas. </li><li> Transferir las larvas a una placa de agar previamente enfriada con una pequeña cuchara de plástico. Sumergir todo el cuerpo de los peces en 10 ml refrigerados solución de Ringer y suavemente ponerla en su lado. </li><li> Realizar las siguientes operaciones bajo el campo de visión del microscopio estereoscópico 25X. Sujetar el cuerpo del pez con pinzas para la estabilización. Rip el abdomen longitudinalmente desde el ano hasta el corazón con otro par de pinzas. eliminar suavemente la piel y los músculos de un lado del cuerpo para exponer los órganos internos. </li><li> Retire la masa de órganos ventrales a la vejiga natatoria con cuidado. Evitar daños en la gónada unido a la vejiga natatoria. </li><li> Cortar la conexión entre la vejiga natatoria y la parte anterior del cuerpo. Tire de toda la vejiga natatoria y el tejido gonadal suavemente. NOTA: En la mayoría de casoss, el tejido gonadal en 17 dpf contiene tejido circundante epitelial y protonephridium. Ellos no se separan fácilmente unos de otros, pero a 25 dpf que se pueden separar fácilmente. La gónada también está conectado con el ano. Una unión con las gónadas izquierda y derecha conectadas entre sí en el ano será claramente visible. </li><li> Use pinzas para separar cuidadosamente el tejido gonadal de la vejiga natatoria y limpiar los tejidos adiposos de los alrededores. </li><li> Transferir inmediatamente el tejido gonadal aislado a un tubo de centrífuga preenfriado 1,5 ml que contenía la solución de 200 l Ringer. Mantenga el tubo en hielo hasta que todos los tejidos gonadales se separan de las larvas. </li><li> Diseccionar las gónadas de 25 dpf larvas como se describe en los pasos 2.1 - 2.7. </li></ol> 3. Protocolo 2: analizar la expresión génica de los tejidos gonadales aislados <ol><li> Extraer el ARN total de los tejidos gonadales larvales. <ol><li> La transferencia de los tejidos gonadales aislados a un nuevo libre de RNasa 1.5 ml tubo y remover la solución de Ringer. Añadir 100 l solución de lisis. Vortex hasta que los tejidos están completamente lisadas. </li><li> Realice el procedimiento de extracción de RNA total de acuerdo con las instrucciones del fabricante. </li><li> Añadir 1/10 volumen de 10x DNasa I buffer y 1 l de DNasa I a la solución de ARN y mezclar suavemente. Incubar durante 20 min a 37 ° C. </li><li> Añadir reactivo DNasa inactivación 1/10 de volumen a la solución de ARN. Incubar durante 10 min a 70 ° C. Medir la concentración del ARN total usando un espectrofotómetro. Almacenar a -20 ° C. </li></ol></li><li> Realizar la síntesis de ADNc de primera cadena <ol><li> Utilice un oligo (dT) primer enlazador para llevar a cabo la síntesis de primera cadena de ADNc siguiendo el protocolo del fabricante. Añadir 1 a 2 g de ARN hasta un volumen total de reacción de 20! L. </li><li> Incubar la solución de reacción durante 90 min a 45 ° C. Terminar la reacción por calentamiento a 70 ° C durante 5 min. </li><li> Añadir 1 l de RNasa H a la cDNA tanlución para eliminar el ARN residual. Mezclar suavemente y centrifugar durante 10 s a ~ 13.000 x g. Incubar durante 20 min a 37 ° C. Añadir 20 l de agua libre de nucleasa. Almacenar a -70 ° C. </li></ol></li><li> Realizar PCR cuantitativa fluorescente <ol><li> Realizar qPCR en un sistema ciclador con un colorante fluorescente. Use las siguientes condiciones de ciclado de PCR: 35 ciclos a 95 ° C durante 15 s, Tm-5 ° C durante 15 s, 68 ° C durante 30 s. Utilice secuencias de los cebadores de la siguiente manera: AMH (fwd: GTGGATGGCAGCAGTACGAC; rev: GCGGAGAGGTGGAAGAGAGAATG), cyp19a1a (fwd: GTCCTGTTGTCTCCTACTGTCG; rev: CATTTGAGTTGAATATGATGCCCTG), nanos3 (fwd: GCTCGGTGTACGCCAAATCAACAT; rev: CCAAGTGAAAACACAACACCAGTGC), vasa (fwd: ATCGCATAGGAAGAACTGGACGCT; rev: CCAAGTGAAAACACAACACCAGTGC) y β-actina (fwd: AGTGCGACGTGGACATCCGTA; rev: GCACTTCCTGTGGACGATGGA) 19. </li></ol></li></ol>

<ol>
	<li>Wilson, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wild+sex+in+zebrafish:+loss+of+the+natural+sex+determinant+in+domesticated+strains.">Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains.</a> Genetics. 198 (3), 1291-1308 (2014).</li><li>Liew, W. C., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+sex:+a+complicated+affair.">Zebrafish sex: a complicated affair.</a> Genomics. 13 (2), 172-187 (2014).</li><li>Orban, L., Sreenivasan, R., Olsson, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+and+winding+roads:+Testis+differentiation+in+zebrafish.">Long and winding roads: Testis differentiation in zebrafish.</a> Mol. Cell. Endocrinol. 312 (1-2), 35-41 (2009).</li><li>Blaser, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transition+from+non-motile+behaviour+to+directed+migration+during+early+PGC+development+in+zebrafish.">Transition from non-motile behaviour to directed migration during early PGC development in zebrafish.</a> J. Cell Sci. 118, 4027-4038 (2005).</li><li>Wang, X. G., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anti-M&#252;llerian+hormone+and+11+&#946;-hydroxylase+show+reciprocal+expression+to+that+of+aromatase+in+the+transforming+gonad+of+zebrafish+males.">Anti-M&#252;llerian hormone and 11 &#946;-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males.</a> Dev. Dynam. 236 (5), 1329-1338 (2007).</li><li>Siegfried, K. R., N&#252;sslein-Volhard, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+control+of+female+sex+determination+in+zebrafish.">Germ line control of female sex determination in zebrafish.</a> Dev. Biol. 324 (2), 277-287 (2008).</li><li>Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oocyte+apoptosis+during+the+transition+from+ovary-like+tissue+to+testes+during+sex+differentiation+of+juvenile+zebrafish.">Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish.</a> J. Exp. Biol. 205 (Pt 6), 711-718 (2002).</li><li>Groh, K. J., Sch&#246;nenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+protein+expression+in+zebrafish+during+gonad+differentiation+by+targeted+proteomics.">Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics.</a> Gen. Comp. Endocr. 193, 210-220 (2013).</li><li>Siegfried, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+search+of+determinants:+gene+expression+during+gonadal+sex+differentiation.">In search of determinants: gene expression during gonadal sex differentiation.</a> J. Fish Biol. 76 (8), 1879-1902 (2010).</li><li>Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microarray+analysis+of+sex-+and+gonad-biased+gene+expression+in+the+zebrafish:+evidence+for+masculinization+of+the+transcriptome.">A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome.</a> BMC Genomics. 10, 579 (2009).</li><li>Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+Cyp19+(P450+aromatase)+genes+on+duplicated+zebrafish+chromosomes+are+expressed+in+ovary+or+brain.">Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain.</a> Mol. Biol. Evol. 18 (4), 542-550 (2001).</li><li>Kishida, M., Callard, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+cytochrome+P450+aromatase+isoforms+in+zebrafish+(Danio+rerio)+brain+and+ovary+are+differentially+programmed+and+estrogen+regulated+during+early+development.">Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development.</a> Endocrinology. 142 (2), 740-750 (2001).</li><li>Rodr&#237;guez-Mar&#237;, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+and+expression+pattern+of+zebrafish+anti-M&#252;llerian+hormone+(amh)+relative+to+sox9a,+sox9b,+and+cyp19a1a,+during+gonad+development.">Characterization and expression pattern of zebrafish anti-M&#252;llerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development.</a> Gene Expr.Patterns. 5 (5), 655-667 (2005).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+a+vas::EGFP+transgene+in+primordial+germ+cells+of+the+zebrafish.">Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish.</a> Mech Dev. 116 (1-2), 141-150 (2002).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sexual+dimorphic+expression+pattern+of+a+splice+variant+of+zebrafish+vasa+during+gonadal+development.">Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development.</a> Dev. Biol. 271 (1), 190-197 (2004).</li><li>Tzung, K. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+depletion+of+primordial+germ+cells+in+zebrafish+promotes+testis+formation.">Early depletion of primordial germ cells in zebrafish promotes testis formation.</a> Stem Cell Reports. 4 (1), 61-73 (2015).</li><li>Hsiao, C., Tsai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenic+zebrafish+with+fluorescent+germ+cell:+a+useful+tool+to+visualize+germ+cell+proliferation+and+juvenile+hermaphroditism+in+vivo.">Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo.</a> Dev. Biol. 262 (2), 313-323 (2003).</li><li>Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser+capture+microdissection+of+gonads+from+juvenile+zebrafish.">Laser capture microdissection of gonads from juvenile zebrafish.</a> Reprod Biol Endocrinol. 7, 97 (2009).</li><li>Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=nr0b1+(DAX1)+mutation+in+zebrafish+causes+female-to-male+sex+reversal+through+abnormal+gonadal+proliferation+and+differentiation.">nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation.</a> Mol. Cell. Endocrinol. 433, 105-116 (2016).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). , (2000).</li><li>Liew, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polygenic+sex+determination+system+in+zebrafish.">Polygenic sex determination system in zebrafish.</a> PLoS One. 7 (4), e34397 (2012).</li><li>Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Normal+table+of+postembryonic+zebrafish+development:+staging+by+externally+visible+anatomy+of+the+living+fish.">Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish.</a> Dev Dyn. 238 (12), 2975-3015 (2009).</li><li>Gupta, T., Mullins, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+Organs+from+the+Adult+Zebrafish.">Dissection of Organs from the Adult Zebrafish.</a> J. Vis Exp. (37), (2010).</li><li>Arnaout, R., Reischauer, S., Stainier, D. Y. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recovery+of+Adult+Zebrafish+Hearts+for+High-throughput+Applications.">Recovery of Adult Zebrafish Hearts for High-throughput Applications.</a> J. Vis Exp. (94), (2014).</li><li>Gerlach, G. F., Schrader, L. N., Wingert, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+the+Adult+Zebrafish+Kidney.">Dissection of the Adult Zebrafish Kidney.</a> J. Vis Exp. (54), (2011).</li><li>Yoon, C., Kawakami, K., Hopkins, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+vasa+homologue+RNA+is+localized+to+the+cleavage+planes+of+2-+and+4-cell-stage+embryos+and+is+expressed+in+the+primordial+germ+cells.">Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells.</a> Development. 124 (16), 3157-3165 (1997).</li><li>Braat, A. K., Speksnijder, J. E., Zivkovic, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+development+in+fishes.">Germ line development in fishes.</a> Int. J. Dev. Biol. 43 (7), 745-760 (1999).</li><li>Huang, H. Y., Ketting, R. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+zebrafish+gonads+for+RNA+isolation.">Isolation of zebrafish gonads for RNA isolation.</a> Methods Mol Biol. 1093, 183-194 (2014).</li></ol>

Los autores declaran que no tienen intereses financieros en competencia.

El pez cebra se ha convertido en un modelo de gran alcance y se utiliza ampliamente en el desarrollo y la investigación relacionada con la enfermedad. Los métodos para el aislamiento de los órganos en el pez cebra adultos, tales como cerebro, corazón, gónadas, y el riñón, se han documentado bien 23, 24, 25. Debido al pequeño tamaño y remodelación dinámica de los tejidos gonadales en el larvas de pez cebra, el aislamiento de tejido gonadal es una tarea difícil. Estudios previos utilizan enteros diseccionado los tejidos del tronco o vasa transgénico: a base de células EGFP clasificación y microdisección por láser para examinar las gónadas larvales 26. Las modificaciones del cromosoma 4 durante la domesticación hace que la determinación del sexo un misterio en el pez cebra domesticado. Nuestro método descrito aquí puede proporcionar preparaciones gónadas relativamente limpias y principios para otros exámenes morfológicos y moleculares, que puede ser útil para explorar el mech determinante del sexomeca-. No es fácil separar la gónada en desarrollo de otras estructuras en las primeras etapas de desarrollo. Nuestro método se describe cómo realizar la disección. Para realizar con éxito este protocolo, algunos pasos críticos deben tenerse en cuenta. En primer lugar, la condición de crecimiento de larvas de pez cebra es crítico para los resultados de rendimiento esperado. El desarrollo gonadal de larvas de pez cebra es un proceso muy dinámico. El tamaño y la apariencia de los tejidos gonadales están determinados por las etapas de desarrollo de los animales 27. Es importante mantener diferentes lotes de pez cebra en condiciones estandarizadas. Los factores que pueden influir en el crecimiento de las larvas incluyen la densidad de población, la duración de ciclos de luz y oscuridad, la disponibilidad de alimentos y los horarios de alimentación. La medición de la longitud estándar de las larvas de peces puede ser utilizado como una guía para determinar el estado de crecimiento de los animales 22. Un segundo factor crítico para el éxito de isolat tejido gonadalde iones es una buena comprensión de la posición relativa y las diferencias morfológicas entre las gónadas y los tejidos circundantes. Debido a la gónada se encuentra en el lado ventral de la vejiga natatoria, es conveniente aislar inicialmente las gónadas junto con la vejiga natatoria. Además, el extremo distal de las gónadas está estrechamente unido al extremo distal del intestino. Así que uno tiene que tener cuidado al retirar la tripa de la gónada en los extremos distales. Para el análisis de la expresión génica posterior, es esencial utilizar medios pre-refrigerados y la placa de agar, y llevar a cabo todo el procedimiento rápidamente. Un método similar con éxito ha sido utilizado por RF Ketting et al. 28. Ellos aplicaron el método de aislamiento de las gónadas para la investigación de la función de piRNAs y la vía PIWI en larvas de 3 semanas de edad. Aquí, hemos diseccionado tejido gonadal de larvas de pez cebra tan temprano como 17 dpf para explorar el perfil de expresión de identidad y el gen molecular de la Develode ping gónadas del pez cebra. análisis moleculares futuras del tejido gonadal aislado anteriormente se pueden realizar para determinar los patrones de transcriptoma, metiloma y acetilación de histonas para dilucidar los mecanismos subyacentes desarrollo sexual en el pez cebra.

El principal determinante del sexo femenino en salvaje cromosoma pez cebra 4 se pierde o se modifica en el pez cebra domesticado (es decir, las cepas de laboratorio comunes) 1. En cambio, tienen un sistema de determinación del sexo poligénica acompañado por factores ambientales como la temperatura, la hipoxia, la disponibilidad de alimentos y la densidad de población. Los mecanismos detallados del desarrollo sexual del pez cebra no se entienden completamente. Las preguntas fundamentales tales como cuando se produce la determinación del sexo de pez cebra, lo que es la señal de la determinación del sexo primario (s) / son, y que los genes regulan la primera etapa de transformación gónada siguen sin respuesta 2, 3. En el proceso del desarrollo sexual de pez cebra, varias etapas importantes han sido reconocidos. En la etapa temprana de desarrollo, a partir de 4 hpf (horas después de la fecundación) germinales células primordiales (PGCs) someterse especificación, la migración a cresta genital yproliferación. Números PGC y las interacciones recíprocas entre las células germinales y las células somáticas son importantes para la diferenciación de las gónadas 4. A los 13 dpf (días después de la fertilización), las gónadas están en la etapa indiferenciada. Por 17 dpf, las gónadas se desarrollan en los ovarios bi-potenciales en las hembras y los machos futuras. La transición apoptosis dependiente de ovario al testículo comienzan a las 21 a 25 dpf y puede continuar durante varias semanas. Por 35 dpf, el sexo de la gónada se ha determinado y la producción de gametos específico del sexo está en marcha en ambos ovarios y testículos 5, 6, 7. Hasta la fecha, se han propuesto diversos genes y mecanismos de determinación del sexo candidatos. Proteómica y análisis transcriptomic han aislado muchos genes con expresión dimorfismo sexual y estos genes se han utilizado para estudiar la diferenciación sexual en el pez cebra 8, </sup&gt; 9, 10. Por ejemplo, en larvas de pez cebra, el gen cyp19a1a se expresa específicamente en el ovario pero no en el testículo 11, 12. Además, el gen AMH se expresa débilmente en las células del folículo de la granulosa de ovarios, pero fuertemente en los testículos células de Sertoli 13. En contraste, el gen vasa se expresa continuamente en las células germinales de ambos pez cebra hembra y macho, por lo que es un marcador gónada adecuado 14, 15. Investigando gonadales niveles de expresión génica es fundamental para comprender el mecanismo molecular de la determinación del sexo y diferenciación especialmente en la etapa de ovario bi-potencial 3, 9. Sin embargo, el pequeño tamaño de larvas de pez cebra y correspondientemente pequeñas gónadas complicar el aislamiento de gónadal de tejido para análisis molecular más. Estudios previos utilizados diseccionaron región del tronco entero entre los opérculos y poro anal 16. Esta preparación, aunque gónadas contienen, consiste en múltiples tejidos y órganos. Alternativamente, los animales transgénicos con la expresión de GFP-gónada específica tales como vasa: EGFP se utilizaron para el aislamiento de tejido gonadal a través de células activadas por fluorescencia (FACS) y captura por láser micro-disección 17, 18. Sin embargo, su aplicación generalizada es limitado. A continuación, describimos un procedimiento simple para aislar el tejido gonadal de larvas de pez cebra a las 17 dpf y 25 dpf. Se demuestra la posición de las gónadas con respecto a otros órganos y aislar las gónadas morfológicamente intactas de los tejidos circundantes. Además, muestran los genes-gónadas específicos tales como vasa y cyp19a1a son altamente expresado en las gónadas aisladas en comparación con el tejido del tronco a través de PCR cuantitativa (qPCR) análisis. El presente protocolo permite la identificación, aislamiento, purificación de ARN y amplificación de genes específicos gonadales de larvas de pez cebra, permitiendo de este modo posterior análisis molecular de tejido gonadal 19.

<table border="0" cellpadding="0" cellspacing="0" width="975">
	<tbody>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Cell culture dish 100 mm</td>
			<td style="width:208px;">Corning</td>
			<td style="width:208px;">430167</td>
			<td style="width:351px;">For embryo incubation</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:208px;">20 X EM</td>
			<td style="width:208px;"></td>
			<td style="width:208px;"></td>
			<td style="width:351px;">For a 1 liter needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl.2H2O; then add 0.41 g KH2PO4, 0.412 g Na2HPO4 anhydrous and 4.9 g MgSO4. 7H2O.</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">1 X EM</td>
			<td style="width:208px;"></td>
			<td style="width:208px;"></td>
			<td style="width:351px;">Dilute 20 X EM in distilled water</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">AGAROSE G-10</td>
			<td style="width:208px;">Gene</td>
			<td style="width:208px;">121985</td>
			<td style="width:351px;">For preparing the 2% agar plates&#160;</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Trizol Reagent</td>
			<td style="width:208px;">Invitrogen</td>
			<td style="width:208px;">15596-026</td>
			<td style="width:351px;">For RNA isolation&#160;</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Meter glass</td>
			<td style="width:208px;">Shen Bo</td>
			<td style="width:208px;">250 ml</td>
			<td style="width:351px;">For preparing the 2% agar plates&#160;</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Microwave Oven</td>
			<td style="width:208px;">Midea</td>
			<td style="width:208px;">M1-211A</td>
			<td style="width:351px;">For heating the AGAR</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">TWEEZER DUMONT#5INOX</td>
			<td style="width:208px;">World Precision Instrument</td>
			<td style="width:208px;">500341</td>
			<td style="width:351px;">For dissection</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Stereomicroscope</td>
			<td style="width:208px;">Motic</td>
			<td style="width:208px;">SMZ168</td>
			<td style="width:351px;">For dissection</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Pure water equipment</td>
			<td style="width:208px;">Millipore</td>
			<td style="width:208px;"></td>
			<td style="width:351px;"></td>
		</tr>
		<tr height="81">
			<td height="81" style="height:81px;width:208px;">Ringer&#8217;s solution</td>
			<td style="width:208px;"></td>
			<td style="width:208px;"></td>
			<td style="width:351px;">For a 1 liter needed: Add 6.78g NaCl, 0.22 g KCl, 0.26 g CaCl2 and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Transfer pipette</td>
			<td style="width:208px;">Samco</td>
			<td style="width:208px;">202, 204</td>
			<td style="width:351px;"></td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Metal bath</td>
			<td style="width:208px;">QiLinbeier</td>
			<td style="width:208px;"></td>
			<td style="width:351px;">Model GL-150</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Microscope</td>
			<td style="width:208px;">Leica&#160;</td>
			<td style="width:208px;">M205 FA</td>
			<td style="width:351px;">For photomicrograph</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Centrifuge</td>
			<td style="width:208px;">Eppendorf</td>
			<td style="width:208px;">5417R</td>
			<td style="width:351px;"></td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Micro Scale RNA Isolation Kit&#160;</td>
			<td style="width:208px;">Ambion</td>
			<td style="width:208px;">AM1931</td>
			<td style="width:351px;">For RNA isolation from gonad tissues</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Dnase I&#160;</td>
			<td style="width:208px;">Sigma</td>
			<td style="width:208px;">AMPD1-1KT</td>
			<td style="width:351px;">For DNA digestion in the RNA solution&#160;</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">RevertAid First Strand cDNA Synthesis Kit</td>
			<td style="width:208px;">Thermo Scientific</td>
			<td style="width:208px;">#K1631</td>
			<td style="width:351px;">For&#160; first-strand cDNA synthesis</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Rnase H&#160;</td>
			<td style="width:208px;">Thermo Scientific</td>
			<td style="width:208px;">#EN0202</td>
			<td style="width:351px;">For digesting the residual RNA in the cDNA solution.</td>
		</tr>
		<tr height="98">
			<td height="98" style="height:98px;width:208px;">SYBR Green Realtime PCR Master Mix</td>
			<td style="width:208px;">TOYOBO</td>
			<td style="width:208px;">QPK-201</td>
			<td style="width:351px;">This product is a Taq DNA polymerase-based 2 x master mix for real-time PCR and&#160; applicable for intercalation assay with SYBR Green I.</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Spectrophotometer</td>
			<td style="width:208px;">Ne Drop</td>
			<td style="width:208px;">OD-2000+</td>
			<td>Measuring the concentration of the total RNA</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Mastercycler</td>
			<td style="width:208px;">Eppendorf</td>
			<td style="width:208px;">AG 22331 Hamburg</td>
			<td>gene expression profiling</td>
		</tr>
	</tbody>
</table>

dissection of larval zebrafish gonadal tissue

Aunque el pez cebra salvaje poseen un sistema de determinación del sexo / ZW ZZ, pez cebra domesticado han perdido el cromosoma sexual. Ellos utilizan un sistema de determinación del sexo poligénica, donde varios genes distribuidos en todo el genoma determinar colectivamente las identidades sexuales de peces individuales. Actualmente, los genes implicados en la regulación del desarrollo de las gónadas y cómo funcionan siendo difícil de alcanzar. Normalmente, el aislamiento de tejido gonadal es el primer paso para examinar los procesos de desarrollo de sexo. A continuación, presentamos un procedimiento para aislar el tejido gonadal de 17 dpf (días después de la fertilización) y 25 dpf larvas de pez cebra. El tejido gonadal aislado puede ser examinada posteriormente por la morfología y la expresión de genes de perfiles.

Las disecciones de las gónadas se realizaron en AB strain larvas de pez cebra. La figura 1 muestra de tejido gonadal típico de larvas de pez cebra a las 17 dpf y 25 dpf. En primer lugar, la piel y los músculos de un lado del abdomen se corta para exponer los órganos internos. Después de retirar la masa de los órganos internos, la vejiga natatoria, junto con la gónada permanecen en el maletero. La gónada estaba unido a la parte ventral de vejiga natatoria (flecha en la Figura 1B &#39;). A los 17 dpf, la gónada estaba en la etapa de ovario bi-potencial. La gónada aislado contenía la izquierda y la gónada derecha y era translúcida (Figura 1C). En la mayoría de los casos, que estaba rodeado por tejido epitelial y protonephridium (flecha en la Figura 1C). En 25 dpf la gónada fue a menudo envuelto por los tejidos adiposos (Figura 1D). En este desarrollo stla edad, se puede observar las gónadas ya sea grande o pequeño. El ovario inmaduro es grande como el desarrollo de los ovocitos secundarios, y las células del folículo aumentar el volumen de las gónadas (Figura 1E). El testículo inmaduro es pequeño debido a la degeneración y apoptosis del ovario larval (Figura 1F). Para analizar las propiedades moleculares de los tejidos gonadales aislados, examinamos primero de genes niveles de expresión de AMH, cyp19a1a, nanos3 y vasa, cuatro marcadores de las gónadas en el pez cebra, por qPCR. ARN total fue extraído a partir de tejidos de larvas gonadales (n = 35) utilizando un kit de aislamiento de ARN. Además, hemos eliminado la cabeza y la cola de 17 dpf larva, y utilizamos el tejido tronco (entre la estructura del corazón y de poro anal) para extraer el ARN como el grupo de control (n = 15). El tejido tronco incluye la piel, músculo, hueso (vértebras y costillas), vejiga natatoria, riñón y gónadas. Oligo dT-primed cDNA se utilizó para la qPCR. El resultado qPCR mostraron aumentos en los niveles de AMH, cyp19a1a, nanos3 y de expresión de los vasos en 17 tejido gonadal dpf aislado en aproximadamente 397, 342, 45 y 170 veces, respectivamente (Figura 2). <img alt="Figura 1" class="xfigimg" src="/files/ftp_upload/55294/55294fig1.jpg" /> Figura 1. microfotografías de típicos tejidos gonadales en larvas de pez cebra en 17 dpf y 25 dpf. (A) Extraer la piel y los músculos de un lado del abdomen para exponer los órganos internos bajo un microscopio estéreo de 25X. (B) Después de retirar la masa de los órganos internos, la vejiga natatoria y la gónada permanecen unidos al tronco. (B &#39;) vista de la caja roja amplificado en el panel B para mostrar la posición relativa de la vejiga natatoria y la gónada. La gónada se indica por la flecha. (C) Iso<html> lated tejido gonadal en 17 dpf. Los tejidos negros en la imagen (flechas) son el tejido endotelial y protonephridium unido a las gónadas. (DE) Un gran gónada antes y después de la eliminación del tejido adiposo en 25 dpf. (F) Un pequeño gónada a 25 dpf. Barras de escala: 200 m. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55294/55294fig1large.jpg" target="_blank">Haga clic aquí para ver una versión más grande de esta figura.</a> <img alt="Figura 2" class="xfigimg" src="/files/ftp_upload/55294/55294fig2.jpg" /> Figura 2. niveles de expresión génica normalizadas de AMH, cyp19ala, nanos3 y vasa en los troncos y las gónadas aisló al 17 dpf. Número de animales utilizados: grupo de control, n = 15; grupo gónada, n = 35. Los tejidos del tronco en el grupo de control son sin la cabeza y las estructuras de la cola. grupo Gónada se refiere a los tejidos gonadales aisladas./files/ftp_upload/55294/55294fig2large.jpg&quot; target = &#39;_ blank&#39;&gt; Haga clic aquí para ver una versión más grande de esta figura.

Watch this Scientific Journal Video about Dissection of Larval Zebrafish Gonadal Tissue at JoVE.com

Dissection of Larval Zebrafish Gonadal Tissue

Aquí, se presenta un protocolo para el aislamiento de tejido gonadal de larvas de pez cebra, que facilitará las investigaciones de la diferenciación sexual de pez cebra y el mantenimiento.

La disección de las larvas de pez cebra de tejidos gonadales

Although wild zebrafish possess a ZZ/ZW sex-determination system, domesticated zebrafish have lost the sex chromosome. They utilize a polygenic sex ...

dissection-of-larval-zebrafish-gonadal-tissue

Nanyang Technological University

Research

JoVE Journal

Developmental Biology

10.2K vistas.  Fudan University.  Aquí, se presenta un protocolo para el aislamiento de tejido gonadal de larvas de pez cebra, que facilitará las investigaciones de la diferenciación sexual de pez cebra y el mantenimiento. 

Video: Dissection of Larval Zebrafish Gonadal Tissue

Large-scale Zebrafish Embryonic Heart Dissection for Transcriptional Analysis

The zebrafish embryonic heart is composed of only a few hundred cells, representing only a small fraction of the entire embryo. Therefore, to prevent the cardiac transcriptome from being masked by the global embryonic transcriptome, it is necessary to collect sufficient numbers of hearts for further analyses. Furthermore, as zebrafish cardiac development proceeds rapidly, heart collection and RNA extraction methods need to be quick in order to ensure homogeneity of the samples. Here, we present a rapid manual dissection protocol for collecting functional/beating hearts from zebrafish embryos. This is an essential prerequisite for subsequent cardiac-specific RNA extraction to determine cardiac-specific gene expression levels by transcriptome analyses, such as quantitative real-time polymerase chain reaction (RT-qPCR). The method is based on differential adhesive properties of the zebrafish embryonic heart compared with other tissues; this allows for the rapid physical separation of cardiac from extracardiac tissue by a combination of fluidic shear force disruption, stepwise filtration and manual collection of transgenic fluorescently labeled hearts.

To analyse cardiac gene expression profiles during zebrafish heart development, total RNA has to be extracted from isolated hearts. Here, we present a protocol for collecting functional/beating hearts by rapid manual dissection from zebrafish embryos to obtain cardiac-specific mRNA.

A gran escala de pez cebra embrionario del corazón Disección de Análisis transcripcional

The zebrafish embryonic heart is composed of only a few hundred cells, representing only a small fraction of the entire embryo. Therefore, to prevent the ...

Investigación

Biología del Desarrollo

Live Imaging of Innate Immune and Preneoplastic Cell Interactions Using an Inducible Gal4/UAS Expression System in Larval Zebrafish Skin

Here we describe a method to conditionally induce epithelial cell transformation by the use of the 4-Hydroxytamoxifen (4-OHT) inducible KalTA4-ERT2/UAS expression system1 in zebrafish larvae, and the subsequent live imaging of innate immune cell interaction with HRASG12V expressing skin cells. The KalTA4-ERT2/UAS system is both inducible and reversible which allows us to induce cell transformation with precise temporal/spatial resolution in vivo. This provides us with a unique opportunity to live image how individual preneoplastic cells interact with host tissues as soon as they emerge, then follow their progression as well as regression. Recent studies in zebrafish larvae have shown a trophic function of innate immunity in the earliest stages of tumorigenesis2,3. Our inducible system would allow us to live image the onset of cellular transformation and the subsequent host response, which may lead to important insights on the underlying mechanisms for the regulation of oncogenic trophic inflammatory responses. We also discuss how one might adapt our protocol to achieve temporal and spatial control of ectopic gene expression in any tissue of interest.

Studying the earliest events of preneoplastic cell progression and innate immune cell interaction is pivotal to understand and treat cancer. Here we describe a method to conditionally induce epithelial cell transformations and the subsequent live imaging of innate immune cell interaction with HRASG12V expressing skin cells in zebrafish larvae.

Imágenes en vivo de inmune innata y preneoplásicas Interacciones de celda que utilizan un sistema de expresión / UAS Inducible Gal4 en larvas de pez cebra de la piel

Here we describe a method to conditionally induce epithelial cell transformation by the use of the 4-Hydroxytamoxifen (4-OHT) inducible KalTA4-ERT2/UAS ...

Capturing Tissue Repair in Zebrafish Larvae with Time-lapse Brightfield Stereomicroscopy

The zebrafish larval tail fin is ideal for studying tissue regeneration due to the simple architecture of the larval fin-fold, which comprises of two layers of skin that enclose undifferentiated mesenchyme, and because the larval tail fin regenerates rapidly within 2-3 days. Using this system, we demonstrate a method for capturing the repair dynamics of the amputated tail fin with time-lapse video brightfield stereomicroscopy. We demonstrate that fin amputation triggers a contraction of the amputation wound and extrusion of cells around the wound margin, leading to their subsequent clearance. Fin regeneration proceeds from proximal to distal direction after a short delay. In addition, developmental growth of the larva can be observed during all stages. The presented method provides an opportunity for observing and analyzing whole tissue-scale behaviors such as fin development and growth in a simple microscope setting, which is easily adaptable to any stereomicroscope with time-lapse capabilities.

We present a protocol for capturing the dynamics of zebrafish larval tail fin regeneration on a whole-tissue scale using brightfield-based stereomicroscopy. This technique enables capturing the regeneration dynamics with single cell resolution. This methodology can be adapted to any stereomicroscope equipped with a CCD camera and time-lapse software.

La captura de Reparación de Tejidos en pez cebra larvas con Time-lapse Brightfield Estereomicroscopía

The zebrafish larval tail fin is ideal for studying tissue regeneration due to the simple architecture of the larval fin-fold, which comprises of two ...

Visualizing the Interrenal Steroidogenic Tissue and Its Vascular Microenvironment in Zebrafish

This protocol introduces how to detect differentiated interrenal steroidogenic cells through a simple whole-mount enzymatic activity assay. Identifying differentiated steroidogenic tissues through chromogenic histochemical staining of 3-&#946;-Hydroxysteroid dehydrogenase /&#916;5-4 isomerase (3&#946;-Hsd) activity-positive cells is critical for monitoring the morphology and differentiation of adrenocortical and interrenal tissues in mammals and teleosts, respectively. In the zebrafish model, the optical transparency and tissue permeability of the developing embryos and larvae allow for whole-mount staining of 3&#946;-Hsd activity. This staining protocol, as performed on transgenic fluorescent reporter lines marking the developing pronephric and endothelial cells, enables the detection of the steroidogenic interrenal tissue in addition to the kidney and neighboring vasculature. In combination with vibratome sectioning, immunohistochemistry, and confocal microscopy, we can visualize and assay the vascular microenvironment of interrenal steroidogenic tissues. The 3&#946;-Hsd activity assay is essential for studying the cell biology of the zebrafish interrenal gland because to date, no suitable antibody is available for labeling zebrafish steroidogenic cells. Furthermore, this assay is rapid and simple, thus providing a powerful tool for mutant screens targeting adrenal (interrenal) genetic disorders as well as for determining disruption effects of chemicals on steroidogenesis in pharmaceutical or toxicological studies.

The interrenal gland in zebrafish is the teleostean counterpart of the mammalian adrenal gland. This protocol introduces how to perform the 3-&#946;-hydroxysteroid dehydrogenase (&#916;5-4 isomerase; 3&#946;-Hsd) enzymatic activity assay, which detects differentiated steroidogenic cells in the developing zebrafish.

La visualización del Tejido Interrenal androgénica, y su microambiente vascular en el pez cebra

This protocol introduces how to detect differentiated interrenal steroidogenic cells through a simple whole-mount enzymatic activity assay. Identifying ...

Establishment of Larval Zebrafish as an Animal Model to Investigate Trypanosoma cruzi Motility In Vivo

Chagas disease is a parasitic infection caused by Trypanosoma cruzi, whose motility is not only important for localization, but also for cellular binding and invasion. Current animal models for the study of T. cruzi allow limited observation of parasites in vivo, representing a challenge for understanding parasite behavior during the initial stages of infection in humans. This protozoan has a flagellar stage in both vector and mammalian hosts, but there are no studies describing its motility in vivo.The objective of this project was to establish a live vertebrate zebrafish model to evaluate T. cruzi motility in the vascular system. Transparent zebrafish larvae were injected with fluorescently labeled trypomastigotes and observed using light sheet fluorescence microscopy (LSFM), a noninvasive method to visualize live organisms with high optical resolution. The parasites could be visualized for extended periods of time due to this technique&#39;s relatively low risk of photodamage compared to confocal or epifluorescence microscopy. T. cruzi parasites were observed traveling in the circulatory system of live zebrafish in different-sized blood vessels and the yolk. They could also be seen attached to the yolk sac wall and to the atrioventricular valve despite the strong forces associated with heart contractions. LSFM of T. cruzi-inoculated zebrafish larvae is a valuable method that can be used to visualize circulating parasites and evaluate their tropism, migration patterns, and motility in the dynamic environment of the cardiovascular system of a live animal.

Establishment of Larval Zebrafish as an Animal Model to Investigate Trypanosoma cruzi Motility In Vivo

In this protocol, fluorescently labeled T. cruzi&#160;were injected into transparent zebrafish larvae, and parasite motility was observed in vivo using light sheet fluorescence microscopy.

Establecimiento de pez cebra Larval como modelo Animal para investigar Trypanosoma cruzi motilidad En Vivo

Chagas disease is a parasitic infection caused by Trypanosoma cruzi, whose motility is not only important for localization, but also for cellular binding ...

Dissection and Staining of Drosophila Pupal Ovaries

Unlike adult Drosophila ovaries, pupal ovaries are relatively difficult to access and examine due to their small size, translucence, and encasing within a pupal case. The challenge of dissecting pupal ovaries also lies in their physical location within the pupa: the ovaries are surrounded by fat body cells inside the pupal abdomen, and these fat cells must be removed to allow for proper antibody staining. To overcome these challenges, this protocol utilizes customized Pasteur pipets to extract fat body cells from the pupal abdomen. Moreover, a chambered coverglass is used in place of a microcentrifuge tube during the staining process to improve visibility of the pupae. However, despite these and other advantages of the tools used in this protocol, successful execution of these techniques may still involve several days of practice due to the small size of pupal ovaries. The techniques outlined in this protocol could be applied to time course experiments in which ovaries are analyzed at various stages of pupal development.

Dissection and Staining of Drosophila Pupal Ovaries

The Drosophila ovary is an excellent model system for studying stem cell niche development. Though methods for dissecting larval and adult ovaries have been published, pupal ovary dissections require different techniques that have not been published in detail. Here we outline a protocol for dissecting, staining, and mounting pupal ovaries.

Disección y la coloración de los ovarios Pupal de Drosophila

Unlike adult Drosophila ovaries, pupal ovaries are relatively difficult to access and examine due to their small size, translucence, and encasing within a ...

Following Endocardial Tissue Movements via Cell Photoconversion in the Zebrafish Embryo

During embryogenesis, cells undergo dynamic changes in cell behavior, and deciphering the cellular logic behind these changes is a fundamental goal in the field of developmental biology. The discovery and development of photoconvertible proteins have greatly aided our understanding of these dynamic changes by providing a method to optically highlight cells and tissues. However, while photoconversion, time-lapse microscopy, and subsequent image analysis have proven to be very successful in uncovering cellular dynamics in organs such as the brain or the eye, this approach is generally not used in the developing heart due to challenges posed by the rapid movement of the heart during the cardiac cycle. This protocol consists of two parts. The first part describes a method for photoconverting and subsequently tracking endocardial cells (EdCs) during zebrafish atrioventricular canal (AVC) and atrioventricular heart valve development. The method involves temporally stopping the heart with a drug in order for accurate photoconversion to take place. Hearts are allowed to resume beating upon removal of the drug and embryonic development continues normally until the heart is stopped again for high-resolution imaging of photoconverted EdCs at a later developmental time point. The second part of the protocol describes an image analysis method to quantify the length of a photoconverted or non-photoconverted region in the AVC in young embryos by mapping the fluorescent signal from the three-dimensional structure onto a two-dimensional map. Together, the two parts of the protocol allows one to examine the origin and behavior of cells that make up the zebrafish AVC and atrioventricular heart valve, and can potentially be applied for studying mutants, morphants, or embryos that have been treated with reagents that disrupt AVC and/or valve development.

This protocol describes a method for the photoconversion of Kaede fluorescent protein in endocardial cells of the living zebrafish embryo that enables the tracking of endocardial cells during atrioventricular canal and atrioventricular heart valve development.

Siguientes movimientos de tejido endocárdico vía Photoconversion de la célula en el embrión de pez cebra

During embryogenesis, cells undergo dynamic changes in cell behavior, and deciphering the cellular logic behind these changes is a fundamental goal in the ...

Adult Zebrafish Injury Models to Study the Effects of Prednisolone in Regenerating Bone Tissue

Zebrafish are able to regenerate various organs, including appendages (fins) after amputation. This involves the regeneration of bone, which regrows within roughly two weeks after injury. Furthermore, zebrafish are able to heal bone rapidly after trepanation of the skull, and repair fractures that can be easily introduced into zebrafish bony fin rays. These injury assays represent feasible experimental paradigms to test the effect of administered drugs on rapidly forming bone. Here, we describe the use of these 3 injury models and their combined use with systemic glucocorticoid treatment, which exerts bone inhibitory and immunosuppressive effects. We provide a workflow on how to prepare for immunosuppressive treatment in adult zebrafish, illustrate how to perform fin amputation, trepanation of calvarial bones, and fin fractures, and describe how the use of glucocorticoids affects both bone forming osteoblasts and cells of the monocyte/macrophage lineage as part of innate immunity in bone tissue.

Here, we describe 3 adult zebrafish injury models and their combined use with immunosuppressive drug treatment. We provide guidance on imaging of regenerating tissues and on detecting bone mineralization therein.

Pez cebra adulto lesión modelos para estudiar los efectos de la prednisolona en regeneración de tejido óseo

Zebrafish are able to regenerate various organs, including appendages (fins) after amputation. This involves the regeneration of bone, which regrows ...

Electroretinogram Recording in Larval Zebrafish using A Novel Cone-Shaped Sponge-tip Electrode

The zebrafish (Danio rerio) is commonly used as a vertebrate model in developmental studies and is particularly suitable for visual neuroscience. For functional measurements of visual performance, electroretinography (ERG) is an ideal non-invasive method, which has been well established in higher vertebrate species. This approach is increasingly being used for examining the visual function in zebrafish, including during the early developmental larval stages. However, the most commonly used recording electrode for larval zebrafish ERG to date is the glass micropipette electrode, which requires specialized equipment for its manufacture, presenting a challenge for laboratories with limited resources. Here, we present a larval zebrafish ERG protocol using a cone-shaped sponge-tip electrode. The novel electrode is easier to manufacture and handle, more economical, and less likely to damage the larval eye than the glass micropipette. Like previously published ERG methods, the current protocol can assess outer retinal function through photoreceptor and bipolar cell responses, the a- and b-wave, respectively. The protocol can clearly illustrate the refinement of visual function throughout the early development of zebrafish larvae, supporting the utility, sensitivity, and reliability of the novel electrode. The simplified electrode is particularly useful when establishing a new ERG system or modifying existing small-animal ERG apparatus for zebrafish measurement, aiding researchers in the visual neurosciences to use the zebrafish model organism.

Here, we present a protocol that simplifies the measurement of light evoked electroretinogram responses from larval zebrafish. A novel cone-shaped sponge-tip electrode can help to make the study of visual development in larval zebrafish using the electroretinogram ERG easier to achieve with reliable outcomes and lower cost.

Grabación de electroretinograma en larvas de pez cebra con electrodo de punta de esponja en forma de un cono de novela

The zebrafish (Danio rerio) is commonly used as a vertebrate model in developmental studies and is particularly suitable for visual neuroscience. For ...

Quantifying Liver Size in Larval Zebrafish Using Brightfield Microscopy

In several transgenic zebrafish models of hepatocellular carcinoma (HCC), hepatomegaly can be observed during early larval stages. Quantifying larval liver size in zebrafish HCC models provides a means to rapidly assess the effects of drugs and other manipulations on an oncogene-related phenotype. Here we show how to fix zebrafish larvae, dissect the tissues surrounding the liver, photograph livers using bright-field microscopy, measure liver area, and analyze results. This protocol enables rapid, precise quantification of liver size. As this method involves measuring liver area, it may underestimate differences in liver volume, and complementary methodologies are required to differentiate between changes in cell size and changes in cell number. The dissection technique described herein is an excellent tool to visualize the liver, gut, and pancreas in their natural positions for myriad downstream applications including immunofluorescence staining and in situ hybridization. The described strategy for quantifying larval liver size is applicable to many aspects of liver development and regeneration.

Here we demonstrate a method for quantifying liver size in larval zebrafish, providing a way to assess the effects of genetic and pharmacologic manipulations on liver growth and development.

Cuantificación del tamaño del hígado en el pez cebra larvario mediante la microscopía Brightfield

In several transgenic zebrafish models of hepatocellular carcinoma (HCC), hepatomegaly can be observed during early larval stages. Quantifying larval ...