We thank C Zhang for fish care. This work was supported by the National Natural Science Foundation of China (31171074, 31371099 and 31571067 to GP) and by the Pujiang Talent Project (09PJ1401900 to GP).

Zebrafish experiments were approved by the Fudan University Institutional Animal Care and Use Committee. Zebrafish were raised and bred according to standard procedures20.
1. Preparations
<ol>
	<li>Cultivate 17 dpf and 25 dpf larval zebrafish
	<ol>
		<li>Transfer 2 male and 2 female adult zebrafish (healthy, 3 to 6 months old, laboratory AB strain) to a crossing tank in the late afternoon before the crossing day. Separate the males and females with a barrier. The next morning, refresh the tank water and remove the barrier to allow them to mate. Collect eggs in 100 mm Petri dishes 1 to 2 h after fertilization.</li>
		<li>Keep about 40 embryos in a 100 mm plate with 40 mL embryo medium (EM) at 28.5 &#176;C during the early development period (4 days) and refresh the EM twice a day. Transfer larvae to 1 L tanks (40 larvae to 300 mL system water) and feed with live rotifers (full supply, twice a day) after 5 dpf. Feed live brine shrimp instead of rotifer diet after 10 dpf. Transfer the fish into re-circulating water system at 14 dpf21.</li>
		<li>Raise larval zebrafish in the re-circulating water system till 17 dpf or 25 dpf. Ensure the light/dark cycle is 14/10 h and pH value of system water is about 7.2. Measure the body length of 17 dpf (5.5 to 6.8 mm) and 25 dpf (8 to 11 mm) larvae22.</li>
	</ol>
	</li>
	<li>Prepare 2% agar plates for the dissection.
	<ol>
		<li>Add 4 g agar to 200 mL sterile water. Heat the mixture in a microwave oven until it turns transparent.</li>
		<li>Cool the agar solution for about 15 min, then pour it into 60 mm diameter Petri dishes (approximately 1/3 volume of the plate). Store the solidified agar plates at 4 &#176;C.</li>
	</ol>
	</li>
</ol>
2. Protocol 1: Dissect the Gonadal Tissue of 17 and 25 dpf Larvae
<ol>
	<li>Add crushed ice into the tank to anesthetize 17 dpf larvae. Transfer the anesthetized larvae to a 100 mm chilled Petri dish with 30 mL cold Ringer&#39;s solution. Keep the fish incubated in the chilled Ringer&#39;s solution for at least 15 min to fully anesthetize the larvae.</li>
	<li>Transfer the larvae to a precooled agar plate with a small plastic spoon. Submerge the entire fish body in 10 mL chilled Ringer&#39;s solution and gently lay it on its side.</li>
	<li>Do the following operations under the vision field of 25X stereo microscope. Clamp the fish trunk with tweezers for stabilization. Rip the abdomen longitudinally from the anus to the heart with another pair of tweezers. Gently remove the skin and muscles on one side of the body to expose the internal organs.</li>
	<li>Remove the mass of organs ventral to the swim bladder carefully. Avoid damaging the gonad attached to the swim bladder.</li>
	<li>Cut off the connection between the swim bladder and anterior body. Pull out the entire swim bladder and gonadal tissue gently. 
	NOTE: In most cases, the gonadal tissue at 17 dpf contains surrounding epithelial tissue and protonephridium. They are not easily separated from each other, but at 25 dpf it can be easily separated. The gonad is also connected to the anus. A junction with left and right gonad connected to each other at the anus will be clearly visible.</li>
	<li>Use tweezers to carefully separate the gonadal tissue from the swim bladder and clean up the surrounding adipose tissues.</li>
	<li>Immediately transfer the isolated gonadal tissue to a prechilled 1.5 mL centrifuge tube containing 200 &#181;L Ringer&#39;s solution. Keep the tube on ice until all gonadal tissues are separated from the larvae.</li>
	<li>Dissect the gonads of 25 dpf larvae as described in steps 2.1 -&#160; 2.7.</li>
</ol>
3. Protocol 2: Analyze Gene Expression of the Isolated Gonadal Tissues
<ol>
	<li>Extract total RNA from the larval gonadal tissues.
	<ol>
		<li>Transfer the isolated gonadal tissues to a new RNase-free 1.5 mL tube and remove Ringer&#39;s solution. Add 100 &#181;L lysis solution. Vortex until the tissues are completely lysed.</li>
		<li>Perform the total RNA extraction procedure according to the manufacturer&#39;s instructions.</li>
		<li>Add 1/10 volume of 10x DNase I buffer and 1 &#181;L of DNase I to the RNA solution and mix gently. Incubate for 20 min at 37 &#176;C.</li>
		<li>Add 1/10 volume DNase inactivation reagent to the RNA solution. Incubate for 10 min at 70 &#176;C. Measure the concentration of the total RNA using a spectrophotometer. Store at -20 &#176;C.</li>
	</ol>
	</li>
	<li>Perform first-strand cDNA synthesis
	<ol>
		<li>Use an oligo(dT)-linker primer to perform first-strand cDNA synthesis following the manufacture&#39;s protocol. Add 1 to 2 &#181;g of RNA to a total reaction volume to 20 &#181;L.</li>
		<li>Incubate the reaction solution for 90 min at 45 &#176;C. Terminate the reaction by heating at 70 &#176;C for 5 min.</li>
		<li>Add 1 &#181;L RNase H to the cDNA solution to remove the residual RNA. Mix gently and centrifuge for 10 s at ~ 13,000 x g. Incubate for 20 min at 37 &#176;C. Add 20 &#181;l nuclease free water. Store at -70 &#176;C.</li>
	</ol>
	</li>
	<li>Perform fluorescent quantitative PCR
	<ol>
		<li>Perform qPCR on a cycler system with a fluorescent dye. Use the following PCR cycling conditions: 35 cycles at 95 &#176;C for 15 s, Tm-5 &#176;C for 15 s, 68 &#176;C for 30 s. Use primer sequences as follows: amh (fwd: GTGGATGGCAGCAGTACGAC; rev: GCGGAGAGGTGGAAGAGAGAATG), cyp19a1a (fwd: GTCCTGTTGTCTCCTACTGTCG; rev: CATTTGAGTTGAATATGATGCCCTG), nanos3 (fwd: GCTCGGTGTACGCCAAATCAACAT; rev: CCAAGTGAAAACACAACACCAGTGC), vasa (fwd: ATCGCATAGGAAGAACTGGACGCT; rev: CCAAGTGAAAACACAACACCAGTGC) and &#946;-actin (fwd: AGTGCGACGTGGACATCCGTA; rev: GCACTTCCTGTGGACGATGGA)19.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Wilson, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wild+sex+in+zebrafish:+loss+of+the+natural+sex+determinant+in+domesticated+strains.">Wild sex in zebrafish: loss of the natural sex determinant in domesticated strains.</a> Genetics. 198 (3), 1291-1308 (2014).</li><li>Liew, W. C., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+sex:+a+complicated+affair.">Zebrafish sex: a complicated affair.</a> Genomics. 13 (2), 172-187 (2014).</li><li>Orban, L., Sreenivasan, R., Olsson, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+and+winding+roads:+Testis+differentiation+in+zebrafish.">Long and winding roads: Testis differentiation in zebrafish.</a> Mol. Cell. Endocrinol. 312 (1-2), 35-41 (2009).</li><li>Blaser, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transition+from+non-motile+behaviour+to+directed+migration+during+early+PGC+development+in+zebrafish.">Transition from non-motile behaviour to directed migration during early PGC development in zebrafish.</a> J. Cell Sci. 118, 4027-4038 (2005).</li><li>Wang, X. G., Orban, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anti-M&#252;llerian+hormone+and+11+&#946;-hydroxylase+show+reciprocal+expression+to+that+of+aromatase+in+the+transforming+gonad+of+zebrafish+males.">Anti-M&#252;llerian hormone and 11 &#946;-hydroxylase show reciprocal expression to that of aromatase in the transforming gonad of zebrafish males.</a> Dev. Dynam. 236 (5), 1329-1338 (2007).</li><li>Siegfried, K. R., N&#252;sslein-Volhard, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+control+of+female+sex+determination+in+zebrafish.">Germ line control of female sex determination in zebrafish.</a> Dev. Biol. 324 (2), 277-287 (2008).</li><li>Uchida, D., Yamashita, M., Kitano, T., Iguchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oocyte+apoptosis+during+the+transition+from+ovary-like+tissue+to+testes+during+sex+differentiation+of+juvenile+zebrafish.">Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish.</a> J. Exp. Biol. 205 (Pt 6), 711-718 (2002).</li><li>Groh, K. J., Sch&#246;nenberger, R., Eggen, R. I. L., Segner, H., Suter, M. J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+protein+expression+in+zebrafish+during+gonad+differentiation+by+targeted+proteomics.">Analysis of protein expression in zebrafish during gonad differentiation by targeted proteomics.</a> Gen. Comp. Endocr. 193, 210-220 (2013).</li><li>Siegfried, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+search+of+determinants:+gene+expression+during+gonadal+sex+differentiation.">In search of determinants: gene expression during gonadal sex differentiation.</a> J. Fish Biol. 76 (8), 1879-1902 (2010).</li><li>Small, C. M., Carney, G. E., Mo, Q., Vannucci, M., Jones, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microarray+analysis+of+sex-+and+gonad-biased+gene+expression+in+the+zebrafish:+evidence+for+masculinization+of+the+transcriptome.">A microarray analysis of sex- and gonad-biased gene expression in the zebrafish: evidence for masculinization of the transcriptome.</a> BMC Genomics. 10, 579 (2009).</li><li>Chiang, E. F., Yan, Y. L., Guiguen, Y., Postlethwait, J., Chung, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+Cyp19+(P450+aromatase)+genes+on+duplicated+zebrafish+chromosomes+are+expressed+in+ovary+or+brain.">Two Cyp19 (P450 aromatase) genes on duplicated zebrafish chromosomes are expressed in ovary or brain.</a> Mol. Biol. Evol. 18 (4), 542-550 (2001).</li><li>Kishida, M., Callard, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+cytochrome+P450+aromatase+isoforms+in+zebrafish+(Danio+rerio)+brain+and+ovary+are+differentially+programmed+and+estrogen+regulated+during+early+development.">Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development.</a> Endocrinology. 142 (2), 740-750 (2001).</li><li>Rodr&#237;guez-Mar&#237;, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+and+expression+pattern+of+zebrafish+anti-M&#252;llerian+hormone+(amh)+relative+to+sox9a,+sox9b,+and+cyp19a1a,+during+gonad+development.">Characterization and expression pattern of zebrafish anti-M&#252;llerian hormone (amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development.</a> Gene Expr.Patterns. 5 (5), 655-667 (2005).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+a+vas::EGFP+transgene+in+primordial+germ+cells+of+the+zebrafish.">Expression of a vas::EGFP transgene in primordial germ cells of the zebrafish.</a> Mech Dev. 116 (1-2), 141-150 (2002).</li><li>Krovel, A. V., Olsen, L. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sexual+dimorphic+expression+pattern+of+a+splice+variant+of+zebrafish+vasa+during+gonadal+development.">Sexual dimorphic expression pattern of a splice variant of zebrafish vasa during gonadal development.</a> Dev. Biol. 271 (1), 190-197 (2004).</li><li>Tzung, K. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Early+depletion+of+primordial+germ+cells+in+zebrafish+promotes+testis+formation.">Early depletion of primordial germ cells in zebrafish promotes testis formation.</a> Stem Cell Reports. 4 (1), 61-73 (2015).</li><li>Hsiao, C., Tsai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenic+zebrafish+with+fluorescent+germ+cell:+a+useful+tool+to+visualize+germ+cell+proliferation+and+juvenile+hermaphroditism+in+vivo.">Transgenic zebrafish with fluorescent germ cell: a useful tool to visualize germ cell proliferation and juvenile hermaphroditism in vivo.</a> Dev. Biol. 262 (2), 313-323 (2003).</li><li>Jorgensen, A., Nielsen, J. E., Morthorst, J. E., Bjerregaard, P., Leffers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser+capture+microdissection+of+gonads+from+juvenile+zebrafish.">Laser capture microdissection of gonads from juvenile zebrafish.</a> Reprod Biol Endocrinol. 7, 97 (2009).</li><li>Chen, S., Zhang, H., Wang, F., Zhang, W., Peng, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=nr0b1+(DAX1)+mutation+in+zebrafish+causes+female-to-male+sex+reversal+through+abnormal+gonadal+proliferation+and+differentiation.">nr0b1 (DAX1) mutation in zebrafish causes female-to-male sex reversal through abnormal gonadal proliferation and differentiation.</a> Mol. Cell. Endocrinol. 433, 105-116 (2016).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Zebrafish Book: A Guide for The Laboratory Use of Zebrafish (Danio rerio). , (2000).</li><li>Liew, W. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polygenic+sex+determination+system+in+zebrafish.">Polygenic sex determination system in zebrafish.</a> PLoS One. 7 (4), e34397 (2012).</li><li>Parichy, D. M., Elizondo, M. R., Mills, M. G., Gordon, T. N., Engeszer, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Normal+table+of+postembryonic+zebrafish+development:+staging+by+externally+visible+anatomy+of+the+living+fish.">Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish.</a> Dev Dyn. 238 (12), 2975-3015 (2009).</li><li>Gupta, T., Mullins, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+Organs+from+the+Adult+Zebrafish.">Dissection of Organs from the Adult Zebrafish.</a> J. Vis Exp. (37), (2010).</li><li>Arnaout, R., Reischauer, S., Stainier, D. Y. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recovery+of+Adult+Zebrafish+Hearts+for+High-throughput+Applications.">Recovery of Adult Zebrafish Hearts for High-throughput Applications.</a> J. Vis Exp. (94), (2014).</li><li>Gerlach, G. F., Schrader, L. N., Wingert, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+the+Adult+Zebrafish+Kidney.">Dissection of the Adult Zebrafish Kidney.</a> J. Vis Exp. (54), (2011).</li><li>Yoon, C., Kawakami, K., Hopkins, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebrafish+vasa+homologue+RNA+is+localized+to+the+cleavage+planes+of+2-+and+4-cell-stage+embryos+and+is+expressed+in+the+primordial+germ+cells.">Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells.</a> Development. 124 (16), 3157-3165 (1997).</li><li>Braat, A. K., Speksnijder, J. E., Zivkovic, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germ+line+development+in+fishes.">Germ line development in fishes.</a> Int. J. Dev. Biol. 43 (7), 745-760 (1999).</li><li>Huang, H. Y., Ketting, R. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+zebrafish+gonads+for+RNA+isolation.">Isolation of zebrafish gonads for RNA isolation.</a> Methods Mol Biol. 1093, 183-194 (2014).</li></ol>

The authors declare that they have no competing financial interests.

The zebrafish has become a powerful model and is extensively used in development and disease-related research. The methods for isolation of organs in adult zebrafish such as brain, heart, gonad, and kidney, have been well documented23,24,25. Due to the small size and dynamic remodeling of the gonadal tissues in the larval zebrafish, isolation of gonadal tissue is a challenging task. Previous studies used whole dissected trunk tissues or transgenic vasa: EGFP based cell sorting and laser microdissection to examine the larval gonads26. The modifications of chromosome 4 during domestication makes the sex determination a mystery in the domesticated zebrafish. Our method described here can provide relatively clean and early gonad preparations for further morphological and molecular examinations, which can be helpful to explore the sex-determining mechanisms.
It is not easy to separate the developing gonad from other structures at early the development stages. Our method describes how to perform the dissection. To successfully perform this protocol, some critical steps need to be noted. First, the growth condition of larval zebrafish is critical to yield expected results. The gonadal development of larval zebrafish is a highly dynamic process. The size and appearance of gonadal tissues are determined by the development stages of the animals27. It is important to maintain different batches of zebrafish in standardized condition. The factors that may influence the growth of larvae include population density, duration of light and dark cycles, food availability and feeding schedules. The standard length measurement of larval fish can be used as a guide to determine the growth status of the animals22. A second critical factor for successful gonadal tissue isolation is a good understanding of the relative position and morphological differences between the gonads and the surrounding tissues. Because the gonad is located to the ventral side of the swim bladder, it is convenient to initially isolate the gonads together with the swim bladder. In addition, the distal end of the gonads is tightly attached to the distal end of gut. So one has to be careful when removing the gut from the gonad at the distal ends. For subsequent gene expression analysis, it is essential to use pre-chilled media and agar plate, and perform the whole procedure quickly.
A similar method has successfully been utilized by R.F. Ketting et al.28. They applied the gonad isolation method for investigating the function of piRNAs and the PIWI pathway in 3-week-old larvae. Here, we dissected gonadal tissue from zebrafish larvae as early as 17 dpf to explore the molecular identity and gene expression profile of the developing zebrafish gonad. Future molecular analyses of the earlier isolated gonadal tissue may be performed to determine the transcriptome, methylome and histone acetylation patterns to elucidate the mechanisms underlying sex development in the zebrafish.

The major female sex determinant in wild zebrafish chromosome 4 is lost or modified in the domesticated zebrafish (i.e. common lab strains)1. Instead, they have a polygenic sex determination system accompanied by environmental factors such as temperature, hypoxia, food availability and population density. The detailed mechanisms of zebrafish sex development are not fully understood. Fundamental questions such as when zebrafish sex determination occurs, what the primary sex determination signal(s) is/are, and which genes regulate the first step of gonad transformation remain to be answered2,3.
In the process of zebrafish sex development, several important stages have been recognized. In the early stage of development, starting from 4 hpf (hours post fertilization) primordial germ-cells (PGCs) undergo specification, migration to genital ridge and proliferation. PGC numbers and reciprocal interactions between germ cells and somatic cells are important for gonad differentiation4. At 13 dpf (days post fertilization), the gonads are in the undifferentiated stage. By 17 dpf, the gonads develop into bi-potential ovaries in both future females and males. The apoptosis-dependent transition from ovary to testis begin at 21 to 25 dpf and may continue for several weeks. By 35 dpf, the sex of the gonad has been determined and sex-specific gamete production is underway in both ovaries and testes5,6,7.
To date, diverse candidate genes and mechanisms of sex determination have been proposed. Proteomics and transcriptomic analysis have isolated many genes with sexually dimorphic expression and these genes have been utilized to study sex differentiation in zebrafish8,9,10. For example, in larval zebrafish, the cyp19a1a gene is specifically expressed in the ovary but not in the testis11,12. In addition, amh gene is weakly expressed in the ovarian follicle granulosa cells, but strongly in testis Sertoli cells13. In contrast, vasa gene is continuously expressed in the germ cells of both female and male zebrafish, making it a suitable gonad marker14,15.
Investigating gonadal gene expression levels is critical to understand the molecular mechanism of sex determination and differentiation especially in the bi-potential ovary stage3,9. However, the small size of larval zebrafish and correspondingly small gonads complicate the isolation of gonadal tissue for further molecular analysis. Previous studies used dissected whole trunk region between the opercula and anal pore16. This preparation, although containing gonads, consists of multiple tissues and organs. Alternatively, transgenic animals with gonad-specific GFP expression such as vasa: EGFP were used for gonadal tissue isolation via fluorescence activated cell sorting (FACS) and laser capture micro-dissection17,18. But their widespread application is limited. Here, we describe a simple procedure to isolate gonadal tissue from larval zebrafish at 17 dpf and 25 dpf. We demonstrate the position of the gonads with respect to other organs and isolate the morphologically intact gonads from the surrounding tissues. We further show the gonad-specific genes such as vasa and cyp19a1a are highly expressed in the isolated gonads compared with the trunk tissue through quantitative PCR (qPCR) analysis. The present protocol allows identification, isolation, RNA purification and amplification of gonadal specific genes from larval zebrafish, thereby enabling subsequent molecular analysis of gonadal tissue19.

<table border="0" cellpadding="0" cellspacing="0" width="975">
	<tbody>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Cell culture dish 100 mm</td>
			<td style="width:208px;">Corning</td>
			<td style="width:208px;">430167</td>
			<td style="width:351px;">For embryo incubation</td>
		</tr>
		<tr height="85">
			<td height="85" style="height:85px;width:208px;">20 X EM</td>
			<td style="width:208px;"></td>
			<td style="width:208px;"></td>
			<td style="width:351px;">For a 1 liter needed: add 17.5 g NaCl, 0.75 g KCl and 2.9 g CaCl.2H2O; then add 0.41 g KH2PO4, 0.412 g Na2HPO4 anhydrous and 4.9 g MgSO4. 7H2O.</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">1 X EM</td>
			<td style="width:208px;"></td>
			<td style="width:208px;"></td>
			<td style="width:351px;">Dilute 20 X EM in distilled water</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">AGAROSE G-10</td>
			<td style="width:208px;">Gene</td>
			<td style="width:208px;">121985</td>
			<td style="width:351px;">For preparing the 2% agar plates&#160;</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Trizol Reagent</td>
			<td style="width:208px;">Invitrogen</td>
			<td style="width:208px;">15596-026</td>
			<td style="width:351px;">For RNA isolation&#160;</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Meter glass</td>
			<td style="width:208px;">Shen Bo</td>
			<td style="width:208px;">250 ml</td>
			<td style="width:351px;">For preparing the 2% agar plates&#160;</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Microwave Oven</td>
			<td style="width:208px;">Midea</td>
			<td style="width:208px;">M1-211A</td>
			<td style="width:351px;">For heating the AGAR</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">TWEEZER DUMONT#5INOX</td>
			<td style="width:208px;">World Precision Instrument</td>
			<td style="width:208px;">500341</td>
			<td style="width:351px;">For dissection</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Stereomicroscope</td>
			<td style="width:208px;">Motic</td>
			<td style="width:208px;">SMZ168</td>
			<td style="width:351px;">For dissection</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Pure water equipment</td>
			<td style="width:208px;">Millipore</td>
			<td style="width:208px;"></td>
			<td style="width:351px;"></td>
		</tr>
		<tr height="81">
			<td height="81" style="height:81px;width:208px;">Ringer&#8217;s solution</td>
			<td style="width:208px;"></td>
			<td style="width:208px;"></td>
			<td style="width:351px;">For a 1 liter needed: Add 6.78g NaCl, 0.22 g KCl, 0.26 g CaCl2 and 1.19 g Hepes; then fill to 1 L; Adjust pH to 7.2. Sterilize by filtration and keep in an autoclaved clear polycarbonate container.</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Transfer pipette</td>
			<td style="width:208px;">Samco</td>
			<td style="width:208px;">202, 204</td>
			<td style="width:351px;"></td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Metal bath</td>
			<td style="width:208px;">QiLinbeier</td>
			<td style="width:208px;"></td>
			<td style="width:351px;">Model GL-150</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Microscope</td>
			<td style="width:208px;">Leica&#160;</td>
			<td style="width:208px;">M205 FA</td>
			<td style="width:351px;">For photomicrograph</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Centrifuge</td>
			<td style="width:208px;">Eppendorf</td>
			<td style="width:208px;">5417R</td>
			<td style="width:351px;"></td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Micro Scale RNA Isolation Kit&#160;</td>
			<td style="width:208px;">Ambion</td>
			<td style="width:208px;">AM1931</td>
			<td style="width:351px;">For RNA isolation from gonad tissues</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Dnase I&#160;</td>
			<td style="width:208px;">Sigma</td>
			<td style="width:208px;">AMPD1-1KT</td>
			<td style="width:351px;">For DNA digestion in the RNA solution&#160;</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">RevertAid First Strand cDNA Synthesis Kit</td>
			<td style="width:208px;">Thermo Scientific</td>
			<td style="width:208px;">#K1631</td>
			<td style="width:351px;">For&#160; first-strand cDNA synthesis</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Rnase H&#160;</td>
			<td style="width:208px;">Thermo Scientific</td>
			<td style="width:208px;">#EN0202</td>
			<td style="width:351px;">For digesting the residual RNA in the cDNA solution.</td>
		</tr>
		<tr height="98">
			<td height="98" style="height:98px;width:208px;">SYBR Green Realtime PCR Master Mix</td>
			<td style="width:208px;">TOYOBO</td>
			<td style="width:208px;">QPK-201</td>
			<td style="width:351px;">This product is a Taq DNA polymerase-based 2 x master mix for real-time PCR and&#160; applicable for intercalation assay with SYBR Green I.</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Spectrophotometer</td>
			<td style="width:208px;">Ne Drop</td>
			<td style="width:208px;">OD-2000+</td>
			<td>Measuring the concentration of the total RNA</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:44px;width:208px;">Mastercycler</td>
			<td style="width:208px;">Eppendorf</td>
			<td style="width:208px;">AG 22331 Hamburg</td>
			<td>gene expression profiling</td>
		</tr>
	</tbody>
</table>

dissection of larval zebrafish gonadal tissue

Although wild zebrafish possess a ZZ/ZW sex-determination system, domesticated zebrafish have lost the sex chromosome. They utilize a polygenic sex determination system, where several genes distributed throughout the genome collectively determine the sex identities of individual fish. Currently, the genes involved in regulating gonad development and how they work remain elusive. Normally, isolating gonadal tissue is the first step to examine the sex developmental processes. Here, we present a procedure to isolate gonadal tissue from 17 dpf (days post fertilization) and 25 dpf zebrafish larvae. The isolated gonadal tissue may be subsequently examined by morphology and gene expression profiling.

Dissections of the gonads were performed on AB strain larval zebrafish. Figure 1 shows typical gonadal tissue of larval zebrafish at 17 dpf and 25 dpf. Firstly, the skin and muscles of one side of the abdomen is cut to expose the internal organs. After removing the mass of internal organs, the swim bladder together with the gonad remain in the trunk. The gonad was attached to the ventral side of swim bladder (arrow in Figure 1B&#39;). At 17 dpf, the gonad was in the bi-potential ovary stage. The isolated gonad contained the left and the right gonad and was translucent (Figure 1C). In most cases, it was surrounded by epithelial tissue and protonephridium (arrow in Figure 1C). At 25 dpf the gonad was often wrapped by adipose tissues (Figure 1D). At this development stage, either big or small gonad may be observed. The immature ovary is big as the development of the secondary oocytes, and follicle cells increase the gonad volume (Figure 1E). The immature testis is small because of degeneration and apoptosis of the larval ovary (Figure 1F).
To analyze the molecular properties of the isolated gonadal tissues, we first examined gene expression levels of amh, cyp19a1a, nanos3 and vasa, four gonad markers in zebrafish, by qPCR. Total RNA was extracted from larval gonadal tissues (n = 35) using a RNA isolation kit. In addition, we removed the head and tail of 17 dpf larva, and used the trunk tissue (between the structure of the heart and anal pore) to extract RNA as the control group (n = 15). The trunk tissue included skin, muscle, bone (vertebrae and ribs), swim bladder, kidney and gonad. Oligo dT-primed cDNA was used for qPCR. The qPCR result showed increases in amh, cyp19a1a, nanos3 and vasa expression levels in 17 dpf isolated gonadal tissue by approximately 397, 342, 45 and 170-fold, respectively (Figure 2).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/55294/55294fig1.jpg" /> 
Figure 1. Microphotographs of Typical Gonadal Tissues in Larval Zebrafish at 17 dpf and 25 dpf. (A) Rip the skin and muscles of one side of the abdomen to expose the internal organs under a 25X stereo microscope. (B) After removing the mass of internal organs, the swim bladder and the gonad remain attached to the trunk. (B&#39;) Amplified view of the red box in panel B to show the relative position of the swim bladder and the gonad. The gonad is indicated by the arrow. (C) Isolated gonadal tissue at 17 dpf. The black tissues in the picture (arrows) are the endothelial tissue and protonephridium attached to gonad. (D-E) A big gonad before and after adipose tissue removal at 25 dpf. (F) A small gonad at 25 dpf. Scale bars: 200 &#181;m. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55294/55294fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/55294/55294fig2.jpg" /> 
Figure 2. Normalized Gene Expression Levels of amh, cyp19ala, nanos3 and vasa in the Trunks and Isolated Gonads at 17 dpf. Numbers of animals used: control group, n = 15; gonad group, n = 35. The trunk tissues in the control group are without the head and the tail structures. Gonad group refers to the isolated gonadal tissues. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55294/55294fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Dissection of Larval Zebrafish Gonadal Tissue at JoVE.com

Dissection of Larval Zebrafish Gonadal Tissue

Here, we present a protocol for isolating gonadal tissue of larval zebrafish, which will facilitate investigations of zebrafish sex differentiation and maintenance.

Although wild zebrafish possess a ZZ/ZW sex-determination system, domesticated zebrafish have lost the sex chromosome. They utilize a polygenic sex ...

dissection-of-larval-zebrafish-gonadal-tissue

Nanyang Technological University

Research

JoVE Journal

Developmental Biology

10.2K Views.  Fudan University. Here, we present a protocol for isolating gonadal tissue of larval zebrafish, which will facilitate investigations of zebrafish sex differentiation and maintenance.

Video: Dissection of Larval Zebrafish Gonadal Tissue

Large-scale Zebrafish Embryonic Heart Dissection for Transcriptional Analysis

The zebrafish embryonic heart is composed of only a few hundred cells, representing only a small fraction of the entire embryo. Therefore, to prevent the cardiac transcriptome from being masked by the global embryonic transcriptome, it is necessary to collect sufficient numbers of hearts for further analyses. Furthermore, as zebrafish cardiac development proceeds rapidly, heart collection and RNA extraction methods need to be quick in order to ensure homogeneity of the samples. Here, we present a rapid manual dissection protocol for collecting functional/beating hearts from zebrafish embryos. This is an essential prerequisite for subsequent cardiac-specific RNA extraction to determine cardiac-specific gene expression levels by transcriptome analyses, such as quantitative real-time polymerase chain reaction (RT-qPCR). The method is based on differential adhesive properties of the zebrafish embryonic heart compared with other tissues; this allows for the rapid physical separation of cardiac from extracardiac tissue by a combination of fluidic shear force disruption, stepwise filtration and manual collection of transgenic fluorescently labeled hearts.

To analyse cardiac gene expression profiles during zebrafish heart development, total RNA has to be extracted from isolated hearts. Here, we present a protocol for collecting functional/beating hearts by rapid manual dissection from zebrafish embryos to obtain cardiac-specific mRNA.

The zebrafish embryonic heart is composed of only a few hundred cells, representing only a small fraction of the entire embryo. Therefore, to prevent the ...

Live Imaging of Innate Immune and Preneoplastic Cell Interactions Using an Inducible Gal4/UAS Expression System in Larval Zebrafish Skin

Here we describe a method to conditionally induce epithelial cell transformation by the use of the 4-Hydroxytamoxifen (4-OHT) inducible KalTA4-ERT2/UAS expression system1 in zebrafish larvae, and the subsequent live imaging of innate immune cell interaction with HRASG12V expressing skin cells. The KalTA4-ERT2/UAS system is both inducible and reversible which allows us to induce cell transformation with precise temporal/spatial resolution in vivo. This provides us with a unique opportunity to live image how individual preneoplastic cells interact with host tissues as soon as they emerge, then follow their progression as well as regression. Recent studies in zebrafish larvae have shown a trophic function of innate immunity in the earliest stages of tumorigenesis2,3. Our inducible system would allow us to live image the onset of cellular transformation and the subsequent host response, which may lead to important insights on the underlying mechanisms for the regulation of oncogenic trophic inflammatory responses. We also discuss how one might adapt our protocol to achieve temporal and spatial control of ectopic gene expression in any tissue of interest.

Studying the earliest events of preneoplastic cell progression and innate immune cell interaction is pivotal to understand and treat cancer. Here we describe a method to conditionally induce epithelial cell transformations and the subsequent live imaging of innate immune cell interaction with HRASG12V expressing skin cells in zebrafish larvae.

Here we describe a method to conditionally induce epithelial cell transformation by the use of the 4-Hydroxytamoxifen (4-OHT) inducible KalTA4-ERT2/UAS ...

Capturing Tissue Repair in Zebrafish Larvae with Time-lapse Brightfield Stereomicroscopy

The zebrafish larval tail fin is ideal for studying tissue regeneration due to the simple architecture of the larval fin-fold, which comprises of two layers of skin that enclose undifferentiated mesenchyme, and because the larval tail fin regenerates rapidly within 2-3 days. Using this system, we demonstrate a method for capturing the repair dynamics of the amputated tail fin with time-lapse video brightfield stereomicroscopy. We demonstrate that fin amputation triggers a contraction of the amputation wound and extrusion of cells around the wound margin, leading to their subsequent clearance. Fin regeneration proceeds from proximal to distal direction after a short delay. In addition, developmental growth of the larva can be observed during all stages. The presented method provides an opportunity for observing and analyzing whole tissue-scale behaviors such as fin development and growth in a simple microscope setting, which is easily adaptable to any stereomicroscope with time-lapse capabilities.

We present a protocol for capturing the dynamics of zebrafish larval tail fin regeneration on a whole-tissue scale using brightfield-based stereomicroscopy. This technique enables capturing the regeneration dynamics with single cell resolution. This methodology can be adapted to any stereomicroscope equipped with a CCD camera and time-lapse software.

The zebrafish larval tail fin is ideal for studying tissue regeneration due to the simple architecture of the larval fin-fold, which comprises of two ...

Visualizing the Interrenal Steroidogenic Tissue and Its Vascular Microenvironment in Zebrafish

This protocol introduces how to detect differentiated interrenal steroidogenic cells through a simple whole-mount enzymatic activity assay. Identifying differentiated steroidogenic tissues through chromogenic histochemical staining of 3-&#946;-Hydroxysteroid dehydrogenase /&#916;5-4 isomerase (3&#946;-Hsd) activity-positive cells is critical for monitoring the morphology and differentiation of adrenocortical and interrenal tissues in mammals and teleosts, respectively. In the zebrafish model, the optical transparency and tissue permeability of the developing embryos and larvae allow for whole-mount staining of 3&#946;-Hsd activity. This staining protocol, as performed on transgenic fluorescent reporter lines marking the developing pronephric and endothelial cells, enables the detection of the steroidogenic interrenal tissue in addition to the kidney and neighboring vasculature. In combination with vibratome sectioning, immunohistochemistry, and confocal microscopy, we can visualize and assay the vascular microenvironment of interrenal steroidogenic tissues. The 3&#946;-Hsd activity assay is essential for studying the cell biology of the zebrafish interrenal gland because to date, no suitable antibody is available for labeling zebrafish steroidogenic cells. Furthermore, this assay is rapid and simple, thus providing a powerful tool for mutant screens targeting adrenal (interrenal) genetic disorders as well as for determining disruption effects of chemicals on steroidogenesis in pharmaceutical or toxicological studies.

The interrenal gland in zebrafish is the teleostean counterpart of the mammalian adrenal gland. This protocol introduces how to perform the 3-&#946;-hydroxysteroid dehydrogenase (&#916;5-4 isomerase; 3&#946;-Hsd) enzymatic activity assay, which detects differentiated steroidogenic cells in the developing zebrafish.

This protocol introduces how to detect differentiated interrenal steroidogenic cells through a simple whole-mount enzymatic activity assay. Identifying ...

Establishment of Larval Zebrafish as an Animal Model to Investigate Trypanosoma cruzi Motility In Vivo

Chagas disease is a parasitic infection caused by Trypanosoma cruzi, whose motility is not only important for localization, but also for cellular binding and invasion. Current animal models for the study of T. cruzi allow limited observation of parasites in vivo, representing a challenge for understanding parasite behavior during the initial stages of infection in humans. This protozoan has a flagellar stage in both vector and mammalian hosts, but there are no studies describing its motility in vivo.The objective of this project was to establish a live vertebrate zebrafish model to evaluate T. cruzi motility in the vascular system. Transparent zebrafish larvae were injected with fluorescently labeled trypomastigotes and observed using light sheet fluorescence microscopy (LSFM), a noninvasive method to visualize live organisms with high optical resolution. The parasites could be visualized for extended periods of time due to this technique&#39;s relatively low risk of photodamage compared to confocal or epifluorescence microscopy. T. cruzi parasites were observed traveling in the circulatory system of live zebrafish in different-sized blood vessels and the yolk. They could also be seen attached to the yolk sac wall and to the atrioventricular valve despite the strong forces associated with heart contractions. LSFM of T. cruzi-inoculated zebrafish larvae is a valuable method that can be used to visualize circulating parasites and evaluate their tropism, migration patterns, and motility in the dynamic environment of the cardiovascular system of a live animal.

Establishment of Larval Zebrafish as an Animal Model to Investigate Trypanosoma cruzi Motility In Vivo

In this protocol, fluorescently labeled T. cruzi&#160;were injected into transparent zebrafish larvae, and parasite motility was observed in vivo using light sheet fluorescence microscopy.

Chagas disease is a parasitic infection caused by Trypanosoma cruzi, whose motility is not only important for localization, but also for cellular binding ...

Dissection and Staining of Drosophila Pupal Ovaries

Unlike adult Drosophila ovaries, pupal ovaries are relatively difficult to access and examine due to their small size, translucence, and encasing within a pupal case. The challenge of dissecting pupal ovaries also lies in their physical location within the pupa: the ovaries are surrounded by fat body cells inside the pupal abdomen, and these fat cells must be removed to allow for proper antibody staining. To overcome these challenges, this protocol utilizes customized Pasteur pipets to extract fat body cells from the pupal abdomen. Moreover, a chambered coverglass is used in place of a microcentrifuge tube during the staining process to improve visibility of the pupae. However, despite these and other advantages of the tools used in this protocol, successful execution of these techniques may still involve several days of practice due to the small size of pupal ovaries. The techniques outlined in this protocol could be applied to time course experiments in which ovaries are analyzed at various stages of pupal development.

Dissection and Staining of Drosophila Pupal Ovaries

The Drosophila ovary is an excellent model system for studying stem cell niche development. Though methods for dissecting larval and adult ovaries have been published, pupal ovary dissections require different techniques that have not been published in detail. Here we outline a protocol for dissecting, staining, and mounting pupal ovaries.

Unlike adult Drosophila ovaries, pupal ovaries are relatively difficult to access and examine due to their small size, translucence, and encasing within a ...

Following Endocardial Tissue Movements via Cell Photoconversion in the Zebrafish Embryo

During embryogenesis, cells undergo dynamic changes in cell behavior, and deciphering the cellular logic behind these changes is a fundamental goal in the field of developmental biology. The discovery and development of photoconvertible proteins have greatly aided our understanding of these dynamic changes by providing a method to optically highlight cells and tissues. However, while photoconversion, time-lapse microscopy, and subsequent image analysis have proven to be very successful in uncovering cellular dynamics in organs such as the brain or the eye, this approach is generally not used in the developing heart due to challenges posed by the rapid movement of the heart during the cardiac cycle. This protocol consists of two parts. The first part describes a method for photoconverting and subsequently tracking endocardial cells (EdCs) during zebrafish atrioventricular canal (AVC) and atrioventricular heart valve development. The method involves temporally stopping the heart with a drug in order for accurate photoconversion to take place. Hearts are allowed to resume beating upon removal of the drug and embryonic development continues normally until the heart is stopped again for high-resolution imaging of photoconverted EdCs at a later developmental time point. The second part of the protocol describes an image analysis method to quantify the length of a photoconverted or non-photoconverted region in the AVC in young embryos by mapping the fluorescent signal from the three-dimensional structure onto a two-dimensional map. Together, the two parts of the protocol allows one to examine the origin and behavior of cells that make up the zebrafish AVC and atrioventricular heart valve, and can potentially be applied for studying mutants, morphants, or embryos that have been treated with reagents that disrupt AVC and/or valve development.

This protocol describes a method for the photoconversion of Kaede fluorescent protein in endocardial cells of the living zebrafish embryo that enables the tracking of endocardial cells during atrioventricular canal and atrioventricular heart valve development.

During embryogenesis, cells undergo dynamic changes in cell behavior, and deciphering the cellular logic behind these changes is a fundamental goal in the ...

Adult Zebrafish Injury Models to Study the Effects of Prednisolone in Regenerating Bone Tissue

Zebrafish are able to regenerate various organs, including appendages (fins) after amputation. This involves the regeneration of bone, which regrows within roughly two weeks after injury. Furthermore, zebrafish are able to heal bone rapidly after trepanation of the skull, and repair fractures that can be easily introduced into zebrafish bony fin rays. These injury assays represent feasible experimental paradigms to test the effect of administered drugs on rapidly forming bone. Here, we describe the use of these 3 injury models and their combined use with systemic glucocorticoid treatment, which exerts bone inhibitory and immunosuppressive effects. We provide a workflow on how to prepare for immunosuppressive treatment in adult zebrafish, illustrate how to perform fin amputation, trepanation of calvarial bones, and fin fractures, and describe how the use of glucocorticoids affects both bone forming osteoblasts and cells of the monocyte/macrophage lineage as part of innate immunity in bone tissue.

Here, we describe 3 adult zebrafish injury models and their combined use with immunosuppressive drug treatment. We provide guidance on imaging of regenerating tissues and on detecting bone mineralization therein.

Zebrafish are able to regenerate various organs, including appendages (fins) after amputation. This involves the regeneration of bone, which regrows ...

Electroretinogram Recording in Larval Zebrafish using A Novel Cone-Shaped Sponge-tip Electrode

The zebrafish (Danio rerio) is commonly used as a vertebrate model in developmental studies and is particularly suitable for visual neuroscience. For functional measurements of visual performance, electroretinography (ERG) is an ideal non-invasive method, which has been well established in higher vertebrate species. This approach is increasingly being used for examining the visual function in zebrafish, including during the early developmental larval stages. However, the most commonly used recording electrode for larval zebrafish ERG to date is the glass micropipette electrode, which requires specialized equipment for its manufacture, presenting a challenge for laboratories with limited resources. Here, we present a larval zebrafish ERG protocol using a cone-shaped sponge-tip electrode. The novel electrode is easier to manufacture and handle, more economical, and less likely to damage the larval eye than the glass micropipette. Like previously published ERG methods, the current protocol can assess outer retinal function through photoreceptor and bipolar cell responses, the a- and b-wave, respectively. The protocol can clearly illustrate the refinement of visual function throughout the early development of zebrafish larvae, supporting the utility, sensitivity, and reliability of the novel electrode. The simplified electrode is particularly useful when establishing a new ERG system or modifying existing small-animal ERG apparatus for zebrafish measurement, aiding researchers in the visual neurosciences to use the zebrafish model organism.

Here, we present a protocol that simplifies the measurement of light evoked electroretinogram responses from larval zebrafish. A novel cone-shaped sponge-tip electrode can help to make the study of visual development in larval zebrafish using the electroretinogram ERG easier to achieve with reliable outcomes and lower cost.

The zebrafish (Danio rerio) is commonly used as a vertebrate model in developmental studies and is particularly suitable for visual neuroscience. For ...

Quantifying Liver Size in Larval Zebrafish Using Brightfield Microscopy

In several transgenic zebrafish models of hepatocellular carcinoma (HCC), hepatomegaly can be observed during early larval stages. Quantifying larval liver size in zebrafish HCC models provides a means to rapidly assess the effects of drugs and other manipulations on an oncogene-related phenotype. Here we show how to fix zebrafish larvae, dissect the tissues surrounding the liver, photograph livers using bright-field microscopy, measure liver area, and analyze results. This protocol enables rapid, precise quantification of liver size. As this method involves measuring liver area, it may underestimate differences in liver volume, and complementary methodologies are required to differentiate between changes in cell size and changes in cell number. The dissection technique described herein is an excellent tool to visualize the liver, gut, and pancreas in their natural positions for myriad downstream applications including immunofluorescence staining and in situ hybridization. The described strategy for quantifying larval liver size is applicable to many aspects of liver development and regeneration.

Here we demonstrate a method for quantifying liver size in larval zebrafish, providing a way to assess the effects of genetic and pharmacologic manipulations on liver growth and development.

In several transgenic zebrafish models of hepatocellular carcinoma (HCC), hepatomegaly can be observed during early larval stages. Quantifying larval ...

Dissection of Larval Zebrafish Gonadal Tissue

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

Large-scale Zebrafish Embryonic Heart Dissection for Transcriptional Analysis

Live Imaging of Innate Immune and Preneoplastic Cell Interactions Using an Inducible Gal4/UAS Expression System in Larval Zebrafish Skin

Capturing Tissue Repair in Zebrafish Larvae with Time-lapse Brightfield Stereomicroscopy

Visualizing the Interrenal Steroidogenic Tissue and Its Vascular Microenvironment in Zebrafish

Establishment of Larval Zebrafish as an Animal Model to Investigate Trypanosoma cruzi Motility In Vivo

Dissection and Staining of Drosophila Pupal Ovaries

Following Endocardial Tissue Movements via Cell Photoconversion in the Zebrafish Embryo

Adult Zebrafish Injury Models to Study the Effects of Prednisolone in Regenerating Bone Tissue

Electroretinogram Recording in Larval Zebrafish using A Novel Cone-Shaped Sponge-tip Electrode

Quantifying Liver Size in Larval Zebrafish Using Brightfield Microscopy