The authors would like to thank Prof. Sze-Bi Hsu and Ms. Zhenzhen for useful discussions and help in the theoretical analysis and numerical simulation. Y. T. Y. would like to acknowledge funding support from the Ministry of Science and Technology under grant numbers MOST 103-2220-E-007-026 and MOST 104-2220-E-007-011, and from the National Tsing Hua University under grant numbers 103N2042E1, 104N2042E1, and 105N518CE1.

1. הרכבה Pretesting של התקן Morbidostat <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> עצרת של Morbidostat <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> פונץ &#39;3 חורים על המכסה של בקבוקון התרבות עם מחט מזרק 18 G. חותכים שלוש חתיכות של צינורות פוליאתילן ~ 7 ס&quot;מ אורך. הכנס שלושת חלקים אלה של צינורות פוליאתילן על הכובע. </li><li style=";text-align:right;direction:rtl"> השתמש קלטת לעטוף את קצה הכובע לשמש בגבס תערובת polydimethylsiloxane (PDMS). מערבבים 5 גרם של רכיב ו -0.5 גרם של רכיב ב &#39;של PDMS במיכל פלסטיק 150 מ&quot;ל ידי ערבוב ידני עם קיסם. טען את התערובת לתוך מזרק 10 מ&quot;ל. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> יוצקים את התערובת PDMS על כובע עם מזרק. אופים את הכובע כולו כדי לרפא את PDMS עבור 8 שעות בתנור על 70 מעלות צלזיוס. </li></ol></li><li style=";text-align:right;direction:rtl"> הלחם את האנודה LED עם חוט 24 מד ואת קתודת LED עם נגד פחמן עם מלחם. הלחמת נגד פחמן 680 Ω עם חוט G 24. לבודד את חיבור תיל באמצעות הקלטת חשמל. </li><li style=";text-align:right;direction:rtl"> כךlder האספן של גלאי האור עם 24 חוט G ואת הפולט של photodetector עם נגד פחמן 100 קילו-אוהם. לבודד את חיבור תיל באמצעות הקלטת חשמל. </li><li style=";text-align:right;direction:rtl"> מניחים את דיודה פולטת אור במחזיק הבקבוקון תרבות. על ידי ביצוע דיאגרמת מעגל ב משלים איור 2, לחבר את אור דיודה וכוח זה עם ספק כוח של 5 V. ודא LED פועלת באמצעות מצלמה דיגיטלית שיכולה לזהות IR (למשל, מצלמת הטלפון הנייד). </li><li style=";text-align:right;direction:rtl"> מניח את גלאי האור במחזיק בקבוקון התרבות. על ידי ביצוע דיאגרמת המעגל ב משלים איור 2, לחבר את גלאי האור וכוח זה עם ספק כוח של 5 V. חבר את הכבל לשני הצדדים של נגדי photodetector למדוד את המתח על פני לוח הבקרה האלקטרוני. </li><li style=";text-align:right;direction:rtl"> מדביק מגנט על הפיר של מאוורר הקירור, אשר משמש כיחידת בוחש המגנטית. ראוי לציין, כי alignmאף אוזן גרון של הפיר של מאוורר בקבוקון התרבות, ואת המרווח בין בקבוקון תרבות המגנט הוא מאוד קריטי עבור פעילותו התקינה של היחידה בחישה המגנטית. </li><li style=";text-align:right;direction:rtl"> חבר כל חתיכה של צינורות פוליאתילן של בקבוקון התרבות לתוך חתיכת מקביל צינורות סיליקון עבור משאבות מייקרו, בקבוקים בינוניים, ובקבוק פסולת. הפעל את המשאבה למשך שעה 1 ולמדוד את הנפח הכולל נשאב מהבקבוק הבינוני עד בקבוקון התרבות לקבוע את שיעור המשאבה. ראוי לציין, כי קצב השאיבה הטיפוסי צריך להיות ~ 4 מיליליטר / שעה, אשר תואמת את שיעור הדילול D = 0.33 hr -1 עבור 12 מיליליטר עובד נפח של בקבוקון התרבות. </li><li style=";text-align:right;direction:rtl"> הנח את מכלול שלם על בינוניים חממה שייקר (34 ס&quot;מ x 34 ס&quot;מ x 43.5 ס&quot;מ). </li></ol></li><li style=";text-align:right;direction:rtl"> Pretesting Morbidostat <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מתח החשמל סט אוהד מגניב 5 V להתחיל המנוע שלה כדי לבדוק את בר בחישה מגנטית. ראוי לציין, כי פעולת הערבוב יכולה להיבדק חזותית. המתח שמניעשעות מנוע מאוורר הקירור לשלוט במדויק על ידי אפנון רוחב פולס (PWM). </li><li style=";text-align:right;direction:rtl"> הכינו סדרה של סוג בר E. דגימות coli עם צפיפות אופטית ב 600 בדרך כלל ננומטר החל 0.07 כדי 0.3 לכיול. מניחים מבחן E. מדגם coli בבקבוקון התרבות ולהקליט את מתח photodetector. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> מקום ~ 100 μl של המדגם הזהה אצל קורא הצלחת ולהקליט את הצפיפות האופטית. השתמש מתח photodetector לעומת נתוני צפיפות אופטיים להתוות את עקומת הכיול. שים לב שבדרך כלל שינוי יחיד אחת צפיפות אופטית מקביל ~ 7.6 V שינוי photodetector עם ערכת ההטיה משמשת כאן. </li></ol></li></ol></li></ol> 2. הרצת Morbidostat <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכנה לפני תחילת הניסוי היומי <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכן את בקבוקון התרבות עם שלושה tubings Tygon אולטרה-כימי עמיד עם אינץ פנימי בקוטר 1/32 ו- inch בקוטר 3/32 חיצוני עבור צריכת אוויר כדי ליצור את המכשיר כאמור בסעיף1.1 וב משלים איור 1. </li><li style=";text-align:right;direction:rtl"> הכן את המדיום מינימלי M9 (0.2% גלוקוז) וסרימתופרים (TMP) בינוני המכיל תרופה. לעקר את המדיום, הבקבוק הבינוני, בקבוק בינוני התרופה, בקבוק פסולת, ואת בקבוקון התרבות ב חיטוי ב 121 מעלות צלזיוס. הערה: TMP הוא פתרון המניות המשמש מאוחר יותר להשיג את הריכוזים בטבלה 1 והתרופה TMP המכיל בינוני אינו autoclaved. </li></ol></li><li style=";text-align:right;direction:rtl"> הרצת Morbidostat <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> ביום הראשון של הניסוי, להפשיר 1 מ&quot;ל של סוג בר קפוא E. coli MG1655 התאים למשך 5 דקות בטמפרטורת החדר ולהעביר 120 μl של תאים כדי בקבוקון תרבות המכילה ~ 12 מ&quot;ל של מדיום הגידול M9. אחרי היום הראשון, להפשיר 1 מ&quot;ל של E. קפוא coli תאים מן היום הקודם במשך 5 דקות ולהעביר 120 μl של תאים כדי בקבוקון תרבות חדשה המכילה ~ 12 מ&quot;ל של מדיום הגידול M9. </li><li style=";text-align:right;direction:rtl"> הפעל החממה שייקר ולהגדיר את בטמפה<html> rature עד 30 מעלות צלזיוס ללא רעד. </li><li style=";text-align:right;direction:rtl"> להתחיל את הפעולה morbidostat על ידי הפעלת משאבת מיקרו, היחידה בחישה מגנטית, ומדידת צפיפות אופטית. הערה: במהלך המבצע, אלגוריתם סף משוב משמש כדי לשלוט על הזרקת סמים. כאשר הצפיפות האופטית נמדדה עוברת סף שנקבע מראש, משאבת הזרקת התרופה הייתה להיות מופעל המשאבה הבינונית תהיה כבויה. אחרת, משאבת הזרקת התרופה נותרת כבויה ואת המשאבה הבינונית פועל. </li><li style=";text-align:right;direction:rtl"> לפקח על המתח מעת לעת כדי להבטיח שיש התפתחותם של חיידקים. הערה: בגלל מחזור הקפאת הפשרה, E. coli תאי תערוכת עיכוב של ~ 4 שעות במהלך כל זקן בן יום. </li><li style=";text-align:right;direction:rtl"> אחרי ~ 23 שעות, להפסיק את שאיבת מיקרו-ידי כיבוי מתח האספקה ​​שלה להוציא את הבקבוקון תרבות. הוסף 15% גליצרול לתוך בקבוקון התרבות ולהקפיא המדגם ב -80 מעלות צלזיוס לאחסון. </li><li style=";text-align:right;direction:rtl"> חזור על שלבים 2.2.1 עד 2.2.5. </li></ol></li></ol>le &quot;&gt; 3. מדידה רגישה לאנטיביוטיקה ב 96 פורמט ובכן הערה: בצע את מדידת קצב צמיחה קוראת צלחת עם פורמט 96 גם כדי לקבוע את רמת עמידות לאנטיביוטיקה. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> להפשיר את המדגם הקפוא היומי בטמפרטורת חדר למשך 5 דקות ולהעביר 15 μl של התא אל בקבוקון התרבות המכיל ~ 15 מיליליטר בינוני M9. ולאפשר להם לגדול עד הצפיפות האופטית ב 600 ננומטר מגיעה ~ 0.1. מחלקים את 15 מ&quot;ל לתוך 1 מ&quot;ל בקבוקים ולהוסיף התרופה TMP בשלב זה כדי לקבל את ריכוזי התרופה הרצויה כפי שמוצג בטבלה 1. </li><li style=";text-align:right;direction:rtl"> קח 200 μl של המדגם משלב 3.1 ומקום לבאר כל בקורא צלחת ולאפשר להם לגדול במשך 12 שעות 5. הצפיפות האופטית ב ננומטר אורך גל 600 נרשמה באופן אוטומטי בזמן המדידה. הערה: עבור כל נקודת נתונים, מדידות בשלושה עותקים נרשמות בממוצע כדי להבטיח עקביות של הנתונים. הנתונים על צפיפות אופטית לעומת הזמן יכול בדואר על מנת לקבל את שיעור הצמיחה. </li><li style=";text-align:right;direction:rtl"> מגרש את נתוני שיעור צמיחה לעומת ריכוז התרופה להשיג IC 50. שים לב IC 50 מוגדר ריכוז התרופה שבה שיעור הצמיחה הוא חמישים אחוזי שיעור הצמיחה המקסימאלי 5. </li></ol> מורפולוגיה 4. תא בודד ומדידה רגישה לאנטיביוטיקה ב מכשירי microfluidic <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בצע ייצור של מכשירי microfluidic באמצעות ליתוגרפיה multilayer הרכה מן PDMS כמתואר במקום אחר 15. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> השתמשו photolithography כדי להפוך את התבנית photoresist עבור שכבות שליטה וזרימה. שים לב כי עבור השכבה מלאה, השתמש photoresist שלילית (~ 15 מיקרומטר גובה) ו photoresist חיובי (~ 8 מיקרומטר גובה) לייצר עובש על פרוסות סיליקון חשוף. </li><li style=";text-align:right;direction:rtl"> הכן תערובות PDMS עם יחס לחצות קישור 5: 1 ו -20: 1 עבור ההשכבה מלאת השכבת הזרימה, בהתאמה. שים את התערובות לתוך ייבוש תחת ואקום כדי להסיר בועות, במשך שעה 1. </li><li style=";text-align:right;direction:rtl"> לחשוף את תבניות photoresist השכבה מלאה על פרוסות סיליקון כדי trimethylchlorosilane אדי (TMCS). הפוך את השכבה המלאה של ~ עובי מ&quot;מ 6 על ידי יציקה את תערובת PDMS (עם יחס לחצות קישור 5: 1) על פרוסות סיליקון על תבנית photoresist השכבה המלאה. אופים את השכבה מלאה במשך 40 דקות ב 80 מעלות צלזיוס במשך שעה 1. בתנור. </li><li style=";text-align:right;direction:rtl"> הפוך את שכבת זרימת ידי ספין ציפוי תערובת PDMS (עם 20 יחס לחצות קישור: 1, ספין מהירות 3,000 סל&quot;ד במשך 60 שניות) על תבנית photoresist שכבת הזרם. אופים את שכבת זרימת למשך 30 דקות ב 80 מעלות צלזיוס במשך שעה 1. בתנור. </li><li style=";text-align:right;direction:rtl"> השתמש סכין גילוח לחתוך את השכבה מלאה לתוך גודל השבב הרצוי (בדרך כלל 3 ס&quot;מ X 2 ס&quot;מ) ידני לקלף את השכבה מלאה. מניח את השכבה המלאה על גבי שכבת הזרימה וליישר אותם תחת סטראו. לרפא את המכלול מיושר על 80 מעלות צלזיוס למשך הלילה בתנור. לאחר מכן, יש להשרות את הרכבה ב 250 מ&quot;ל מים ללא יונים במיכל פלסטיק במשך 5 שעות כדי לפזר את TMCS שיורית. </li><li style=";text-align:right;direction:rtl"> בהמשך לכך, אגרוף החורים מפרצון עם 20 מחטים G והאג&quot;ח אלסטומר כולו לשקופית זכוכית מצופה בשכבה PDMS ריק (צלב PDMS המקשר יחס 5: 1, ספין מהירות 2,000 סל&quot;ד למשך 30 שניות) על ידי טיפול פלזמה אוויר במשך 40 שניות ב לחץ 1.2 אוויר Torr. </li><li style=";text-align:right;direction:rtl"> לבצע אפייה נרחבת במשך 36 שעות ב 80 מעלות צלזיוס כדי להפחית את ההשפעות ציטוטוקסיות מן PDMS. שים לב, שלב האפייה זה הוא קריטי כדי למזער את רעילות תאים חיידקיים. </li></ol></li><li style=";text-align:right;direction:rtl"> על שבב צמיחת ניסוי <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לפני הטעינה לתוך מכשיר microfluidic, יש לשטוף אותו עם מים ללא יונים 1 hr ובינוני M9 עבור שעה 1. </li><li style=";text-align:right;direction:rtl"> להפשיר את המדגם הקפוא היומי בטמפרטורת חדר למשך 5 דקות ולחסן מבחנה חדשה עם מדיום M9 טרי. הנח את הדוגמה חממה שייקר ב 37 מעלות צלזיוס למשך הלילה. </li><li style=";text-align:right;direction:rtl"> לדלל את הקיפול 10 מדגם חיידקים עם המדיום M9 ולטעון אותו לתוך המכשיר microfluidic על ידי הפעלת לחץ על מיכל מדגם חיידקים ב 5 psi. לאחר מכן טען את תרופת TMPמדיום לתוך השבב על ידי הפעלת לחץ על מיכל בינוני התרופה 5 psi. הפעל את הערבוב בין חיידק התרופה על ידי מפעילי שסתום micromechanical בין שני החדרים על שבב microfluidic במשך 15 דקות. </li><li style=";text-align:right;direction:rtl"> מניח את שבב microfluidic בחממת מיקרוסקופ רכובה על מיקרוסקופ ההפוכה. רוכש את תמונת התא בתא הצמיחה בכל שעה במשך 8 שעות עם מצלמת CCD רכוב על מיקרוסקופ ההפוכה. </li><li style=";text-align:right;direction:rtl"> השתמש תסריט התכנית האישית כדי לחשב את מספרי התא באמצעות אלגוריתם סף על נתוני תמונת תא 18. ראוי לציין כי הנתונים מספר הסלולרי הם ממוצעים בדרך כלל מעל שלושה תאי microfluidic. </li></ol></li></ol>

<ol>
	<li>Levy, S. B., Marshall, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibiotic+resistance+worldwide:+causes,+challenges,+and+responses.">Antibiotic resistance worldwide: causes, challenges, and responses.</a> Nat. Med. 10, s122-s129 (2004).</li><li>Wang, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracking+the+in+vivo+evolution+of+multidrug+resistance+in+Staphylococus+aureus+by+whole+genome+sequencing.">Tracking the in vivo evolution of multidrug resistance in Staphylococus aureus by whole genome sequencing.</a> Pro. Natl. Acad. Sci. 104, 9451 (2007).</li><li>Dragosits, M., Mattanovich, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adaptive+laboratory+evolution+-+principles+and+applications+for+biotechnology.">Adaptive laboratory evolution - principles and applications for biotechnology.</a> Microbial Cell Factory. 12, 64 (2013).</li><li>Zhang, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acceleration+of+emergence+of+bacterial+antibiotic+resistance+in+connected+microenvironment.">Acceleration of emergence of bacterial antibiotic resistance in connected microenvironment.</a> Science. 333, 1764-1767 (2011).</li><li>Toprak, E., Veres, A., Michel, J. B., Chait, R., Hartl, D. L., Kishony, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+paths+to+antibiotic+resistance+under+dynamically+sustained+drug+selection.">Evolutionary paths to antibiotic resistance under dynamically sustained drug selection.</a> Nature Genetics. 44, 101-106 (2012).</li><li>Toprak, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Building+a+morbidostast:+an+automated+continuous+culture+device+for+studying+bacterial+drug+resistance+under+dynamically+sustained+drug+inhibition.">Building a morbidostast: an automated continuous culture device for studying bacterial drug resistance under dynamically sustained drug inhibition.</a> Nature Protocol. 8, 555-567 (2013).</li><li>Rosenthal, A. Z., Elowitz, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Following+evolution+of+bacterial+antibiotic+resistance+in+real+time.">Following evolution of bacterial antibiotic resistance in real time.</a> Nature Genetics. 44, 11-13 (2012).</li><li>Young, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+antibacterial+resistance+selection+and+quantitation.">In vitro antibacterial resistance selection and quantitation.</a> Curr Protoc Pharmacol. , (2006).</li><li>Novick, A., Szilard, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experiments+with+the+Chemostat+on+spontaneous+mutations+of+bacteria.">Experiments with the Chemostat on spontaneous mutations of bacteria.</a> Proc. Natl. Acad. Sci. U.S.A. 36, 708-719 (1950).</li><li>Balagadde, F. K., You, L., Hansen, C. L., Arnold, F. H., Quake, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+monitoring+of+bacteria+undergoing+programmed+population+control+in+a+microchemostat.">Long-term monitoring of bacteria undergoing programmed population control in a microchemostat.</a> Science. 309, 137-140 (2005).</li><li>Groisman, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microfluidic+chemostat+for+experiments+with+bacterial+and+yeast+cells.">A microfluidic chemostat for experiments with bacterial and yeast cells.</a> Nat. Methods. 2, 685-689 (2005).</li><li>Miller, A. W., Befort, C., Kerr, E. O., Dunham, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+Use+of+Multiplexed+Chemostat+Arrays.">Design and Use of Multiplexed Chemostat Arrays.</a> J. Vis. Exp. (72), e50262 (2013).</li><li>Takahashi, C. N., Miller, A. W., Ekness, F., Dunham, M. J., Klavins, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+low+cost,+customizable+turbidostat+for+use+in+synthetic+circuit+characterization.">A low cost, customizable turbidostat for use in synthetic circuit characterization.</a> ACS Synthetic Biology. , (2015).</li><li>Mohan, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+multiplexed+microfluidic+platform+for+rapid+antibiotic+susceptibility+testing.">A multiplexed microfluidic platform for rapid antibiotic susceptibility testing.</a> Biosens Bioelectrons. 49, 118-125 (2013).</li><li>Unger, M. A., Chou, H. P., Thorsen, T., Scherer, A., Quake, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monolithic+microfabricated+valves+and+pumps+by+multilayer+soft+lithography.">Monolithic microfabricated valves and pumps by multilayer soft lithography.</a> Science. 288, 113-116 (2000).</li><li>Kellogg, R. A., Gomez-Sjoberg, R., Leyrat, A. A., Tay, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Nat. Protocols. 9, 1713 (2014).</li><li>Gu, G. Y., Lee, Y. W., Chiang, C. C., Yang, Y. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nanoliter+microfluidic+serial+dilution+bioreactor.">A nanoliter microfluidic serial dilution bioreactor.</a> Biomicrofluidics. 9, 044126 (2015).</li><li>Gonzalez, R. C., Woods, R. E., Eddins, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Digital image using Matlab processing. , (2004).</li><li>Heikkila, E., Sundstrom, L., Huovinen, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trimethoprim+resistance+in+Escherichia+coli+isolates+from+a+geriatric+unit.">Trimethoprim resistance in Escherichia coli isolates from a geriatric unit.</a> Antimicrob. Agents Chemother. 34, 2013-2015 (1990).</li><li>Flensburg, J., Skold, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Massive+overproduction+of+dihydrofolate+reductase+in+bacteria+as+a+response+to+the+use+of+trimethoprim.">Massive overproduction of dihydrofolate reductase in bacteria as a response to the use of trimethoprim.</a> Eur. J. Biochem. 162, 473-476 (1987).</li><li>Ohmae, E., Sasaki, Y., Gekko, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+five-tryptophan+mutations+on+structure,+stability+and+function+of+Escherichia+coli+dihydrofolate+reductase.">Effects of five-tryptophan mutations on structure, stability and function of Escherichia coli dihydrofolate reductase.</a> J. Biochem. 130, 439-447 (2001).</li><li>Smith, D. R., Calvo, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleotide+sequence+of+dihydrofolate+reductase+genes+from+trimethoprim-resistant+mutants+of+Escherichia+coli.+Evidence+that+dihydrofolate+reductase+interacts+with+another+essential+gene+product.">Nucleotide sequence of dihydrofolate reductase genes from trimethoprim-resistant mutants of Escherichia coli. Evidence that dihydrofolate reductase interacts with another essential gene product.</a> Mol. Gen. Genet. 187, 72-78 (1982).</li><li>Okumus, B., Yildiz, S., Toprak, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluidic+and+microfluidic+tools+for+quantitative+systems+biology.">Fluidic and microfluidic tools for quantitative systems biology.</a> Curr Opin Biotech. 25, 30-38 (2014).</li><li>Cho, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+antimicrobial+susceptibility+test+based+on+single-cell+morphological+analysis.">A rapid antimicrobial susceptibility test based on single-cell morphological analysis.</a> Sci. Transl. Med. 17, 267 (2014).</li><li>Hsu, S. B., Waltman, P. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+a+model+of+two+competitors+in+a+chemostat+with+an+external+inhibitor.">Analysis of a model of two competitors in a chemostat with an external inhibitor.</a> SIAM J. Applied Math. , 528-540 (1992).</li><li>Fu, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maximizing+biomass+productivity+and+cell+density+of+Chlorella+vulgaris+by+using+light-emitting+diode-based+photobioreactor.">Maximizing biomass productivity and cell density of Chlorella vulgaris by using light-emitting diode-based photobioreactor.</a> J. Biotech. 161, 242-249 (2012).</li><li>Peabody, V. G. L., Winkler, J., Kao, K. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tools+for+developing+tolerance+to+toxic+chemicals+in+microbial+systems+and+perspectives+on+moving+the+field+forward+and+into+the+industrial+setting.">Tools for developing tolerance to toxic chemicals in microbial systems and perspectives on moving the field forward and into the industrial setting.</a> Curr Opin in Chem Eng. 6, 9-17 (2014).</li></ol>

The authors have nothing to disclose.

מכשיר morbidostat נמוך טביעת רגל מרכיבים בעלות הנמוכה מודגם. העליות רמות עמידות לתרופות שנרשמו על ידי המכשיר הנן עקביות עם אלו של דוחות קודמים 5. עוצב עבור מחקרים אבולוציוניים של עמידות לתרופות, המכשיר הוא ישים פוטנציאל ניסויים רבים אחרים. ראשית, מסד נתונים מקיף של מוטציות-סמים ניתן לקבוע עבור קבוצה גדולה של אנטיביוטיקה משמעות קלינית. לדוגמה, מסלול אבולוציוני של עמידות לתרופות מרובות ניתן ללמוד רק על ידי הגדלת מספר התרופות השתמשו בניסוי. היתרון העיקרי של מודול דיווח כאן הוא קונפיגורציה הגמישה שלה, המאפשר בקנה מידה גדולה, ניסויים מקבילים תחת תנאי ניסויים שונים. למרות הרעיון הודגם מדידות מיקרופלואידיקה, כוח החקירה ניתן לשפר על ידי שילוב של מיקרופלואידיקה עם טכנולוגית fluidic 23. העלות לכלהמדידה (יתרון לגודל) מצטמצם באופן דרמטי על ידי צריכת מגיב הוריד עבודה מופחתת. כאן, נתוני מורפולוגיה תא בודד יכולים להיות מופקים פלטפורמת microfluidic. לאחרונה, בדיקות מורפולוגיה microfluidic של תאים בודדים יושמו בהצלחה במעבדות מיקרוביולוגיה קליניות, ומבצע דומה ל- בדיקות דילול סדרה מרק תקן 24. עם הזמינות הגוברת של מכשירי microfluidic, טכנולוגיות משולבות תאפשרנה ניסויי אבולוצית מעבדה בקנה מידה גדולה, תפוקה גבוהה. מספר צעדים חיוניים כדי להפעיל את morbidostat. ראשית, כי היחידה בחישה המגנטית נוצרה מן המגנטים מאווררים, חשוב כדי ליישר את הפיר של מאוורר בקבוקון התרבות. כמו כן, המרחק בין בקבוקון תרבות המגנט הוא מאוד קריטי כדי להבטיח פעולה יציבה. שנית, מעבר בקבוקון התרבות חדש בתחילת כל הניסוי של יום חשוב גםלמנוע היווצרות ביופילם. אחרת, היווצרות ביופילם יכול להתרחש בתוך 2 או 3 ימים. ושלישית, משום E. דגימות coli הם הפשירו יומי ממדגם קפוא במהלך כל הניסוי של יום על מנת להבטיח עקביות, חשוב להגדיר פרק זמן של איחור של שעה לפחות 4 כדי למנוע שטיפה מתוך מסגרת החיידקים. לחלופין, אפשר לבחור לא להקפיא E. דגימות coli וישירות להשתמש במדגם לחסן בקבוקון תרבות חדש להתחיל תרבות חדשה. בשנת הגדרה מעשית, תכנון המערכת הנוכחי חייב להתגבר על מגבלות כמה להאריך שימושים הפוטנציאליים שלה. ההיקף של המערכת כולה כיום מוגבל על ידי המדיום מאוכל ליום (במהלך מבצע chemostatic, בקבוקון תרבות אחת הצורכת כ -0.5 ליטר של מדיום ליום בשיעור הדילול הטיפוסי של 0.33 hr -1). כדי לצמצם את היקף העבודה, אופטימיזציה נוספת יכולה להיות מושגת על ידי סימולציה זהירה על הדינמיקה באוכלוסיית עכבות תרופה עם plumbing פרמטרים 25. לבסוף, morbidostat ניתנת להתאמה בקלות למגוון רחב של ניסויי התרבות חיידקים. לדוגמה, על ידי הצמדת דיודה פולטת אור, המערכת יכולה להיות מחדש בתור bioreactor-צילום, המאפשר ניטור האבולוציונית של אצות כחוליות או מיקרו 26. המודול יכול להתארך עד אנאירובי וטיפוח microaerobic במיכל הדוק גז עם adsorbents ידי אלחוטי הפעלת המכשיר במארז הסוללה. כדוגמא נוספת, הריכוז של טוקסין יכול להיות בהדרגה להנדס זנים עמידים בפני כימיים היעד 27.

מאז כניסתה של פניצילין התרופה הראשון האנטיביוטי, עמידות לאנטיביוטיקה של חיידקים התפתחה עולמית בעיה בריאותית 1. למרות רכישת עמידות לאנטיביוטיקה ניתן ללמוד למפרע in vivo, התנאים של ניסויים אלה הם בדרך כלל לא מבוקרים לאורך האבולוציה כולה 2. לחלופין, אבולוצית מעבדת אדפטיבית יכולה לחשוף את האבולוציה המולקולרית של מינים של חיידקים תחת לחצים סביבתיים או לחץ ברירה מתרופת אנטיביוטיקת 3. לאחרונה, מבוקר היטב ניסויים רבים האבולוציונית של עמידות לתרופות אנטיביוטיות יש הבהיר את הופעתה של עמידות לתרופות אנטיביוטיות. לדוגמה, קבוצה של אוסטין הפגינו הופעתם המהירה בסביבה 4 מחולקים microfluidic מהונדסים כראוי. Morbidostat שפותח לאחרונה גורם מוטציות שיטתיות תחת לחץ ברירת תרופת 5,6. Morbidostat, תמיכה בבחירה מיקרוביאלימכשיר tion אשר מתאים את ריכוז האנטיביוטיקה ללא הרף כדי לשמור על אוכלוסייה קבועה כמעט, הוא התקדמות גדולה ממבחן התנודות בשימוש במיקרוביולוגיה 7,8. במבחן התנודות, תרופה אנטיביוטית מוזרקת בריכוז גבוה, ואת מוטנטים לשרוד מוקרנים ומנה. במקום זאת, חיידקים בתוך morbidostat מאותגרים כל הזמן צוברים מוטציות מרובות. Morbidostat פועלת בדומה chemostat, מכשיר התרבות הומצא על ידי נוביק ו Szliard בשנת 1950, אשר שומר אוכלוסייה קבועה על ידי אספקת חומרים מזינים באופן רציף תוך דילול אוכלוסיית החיידקים 9. מאז השקתו, את chemostat כבר מתקדמת ומשופרת. chemostats microfluidic הנוכחי הגיע nanoliter וקיבולות תא בודד. עם זאת, מכשירים אלה אינם מתאימים לניסויי אבולוציה אדפטיבית, הדורשים אוכלוסיית תא גדולה עם אירועים רבים מוטציה 10,11. לאחרונה, מיניchemostats עם כרכים עובדים של ~ 10 מיליליטר גם פותח כדי למלא את הפער בין מתקני גידול בהיקף ליטר ואת 12,13 microfluidic chemostat. כאן אנו מציגים את העיצוב ושימוש של בעלות נמוכה, morbidostat אוטומטית מחקר עמידות לתרופות אנטיביוטי. המודול המוצע יכול להיות מועסק בתוך חממה שייקר במעבדה למיקרוביולוגיה עם דרישת חומרה מינימאלית. הקושחה הקוד הפתוח גם מותאם בקלות ליישומים ספציפיים של התפתחות אדפטיבית, כגון הנדסה מטבולית 3. לבסוף, morbidostat משתלבת פלטפורמת microfluidic מרובבת עבור בדיקות רגישות לאנטיביוטיקה 14.

<table border="0" cellpadding="0" cellspacing="0" width="797">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Environmental Shaker Incubator</td>
			<td style="width:135px;">BioSan</td>
			<td style="width:163px;">ES-20</td>
			<td style="width:227px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Arduino Leonardo board</td>
			<td style="width:135px;">Arduino</td>
			<td style="width:163px;">Leonardo</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">680 Ohm Carbon Resistor</td>
			<td style="width:135px;">Digikey</td>
			<td style="width:163px;"></td>
			<td>Bias resistor for LED</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">100k Ohm Carbon resistor</td>
			<td style="width:135px;">Digikey</td>
			<td style="width:163px;"></td>
			<td>Bias resistor for phototransistor</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">940 nm light emitting diode</td>
			<td style="width:135px;">Bright LED Electronic</td>
			<td style="width:163px;">BIR-BM13E4G-2</td>
			<td>Optical density measurement</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">940 nm phototransistor</td>
			<td style="width:135px;">Kodenshi&#160;</td>
			<td style="width:163px;">ST-2L2B</td>
			<td>Optical density measurement</td>
		</tr>
		<tr height="57">
			<td height="57" style="height:57px;">Darlington pair IC Toshiba</td>
			<td style="width:135px;">Mouser</td>
			<td style="width:163px;">ULN2803APG</td>
			<td style="width:227px;">&#160;this IC drives micropumps and magnetic stirring unit</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:275px;">5V DC brushless fan&#160;</td>
			<td style="width:135px;">ADDA</td>
			<td style="width:163px;">AD0405LX-G70</td>
			<td style="width:227px;">spec: 5V supply voltage and 80mA available www.jameco.com</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Piezoelectric micropump</td>
			<td style="width:135px;">CurieJet</td>
			<td style="width:163px;">PS15I-FT-5L</td>
			<td>Pressure &#62;3kPa&#160; Flow rate &#62;5 ml/min</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Tygon 3350 Tuning</td>
			<td style="width:135px;">Saint Gobain</td>
			<td style="width:163px;">ABW00001</td>
			<td>ID: 1/32&#34; OD: 3/32&#34; L:50&#39;&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Magnetic Stir bar</td>
			<td style="width:135px;">COWIE</td>
			<td style="width:163px;"></td>
			<td>tapered shape dim: 10 mm x 4mm</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Glass scintillation 20ml vial</td>
			<td style="width:135px;">DGS</td>
			<td style="width:163px;"></td>
			<td>Pyrex glass 28mm(dia.)x 61 mm(h)</td>
		</tr>
		<tr height="48">
			<td height="48" style="height:48px;width:275px;">Culture vial holder</td>
			<td style="width:135px;"></td>
			<td style="width:163px;"></td>
			<td>Custom made from Polyformaldehyde&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Silicone&#160;</td>
			<td style="width:135px;">Dow Corning</td>
			<td style="width:163px;">Sylgald 184</td>
			<td>used to seal the glass vial</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Medium bottle</td>
			<td style="width:135px;">VWR</td>
			<td style="width:163px;">66022-065</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Difco M9 minimal salt 5x</td>
			<td style="width:135px;">BD</td>
			<td style="width:163px;"></td>
			<td>Medium</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Cadamino Acid</td>
			<td style="width:135px;">BD</td>
			<td style="width:163px;"></td>
			<td>Medium</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">glucose</td>
			<td style="width:135px;">Sigma</td>
			<td style="width:163px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Agar Bateriological</td>
			<td style="width:135px;">Oxoid</td>
			<td style="width:163px;"></td>
			<td>for agar plate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Luria Bertani medium</td>
			<td style="width:135px;"></td>
			<td style="width:163px;"></td>
			<td></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:275px;">Inverted microscope</td>
			<td style="width:135px;">Leica Microsystems</td>
			<td style="width:163px;">Leica DMI-LED</td>
			<td style="width:227px;">used for microfluidic measurement Use X40 objective NA=0.55</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:275px;">Microscope Incubator</td>
			<td style="width:135px;">Live Cell Instrument</td>
			<td style="width:163px;">CU-109</td>
			<td>used for microfluidic measurement</td>
		</tr>
		<tr height="49">
			<td height="49" style="height:49px;width:275px;">Solenoidal valves</td>
			<td style="width:135px;">Pneumadyne</td>
			<td style="width:163px;">S10MM-31-12-3</td>
			<td>Normally open 1.3 Watt 12 Vdc</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">USB interface card</td>
			<td style="width:135px;">Hobby Engineering</td>
			<td>USBIO24-R Digital I/O Module&#160;</td>
			<td>for microfluidics measurement</td>
		</tr>
		<tr height="45">
			<td height="45" style="height:45px;width:275px;">Air compressor</td>
			<td style="width:135px;">Rocker Scientific</td>
			<td style="width:163px;">ROCKER 440</td>
			<td style="width:227px;">Pressure source for microfluidcs Max. Pressure 80 Psi</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Male luer-lock fittings to 1/8&#34; barb</td>
			<td>ValuePlastics.com</td>
			<td style="width:163px;">MTLL230-1</td>
			<td>used for microfluidic control</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1/8&#34; barb to 10-32 threaded port</td>
			<td>ValuePlastics.com</td>
			<td style="width:163px;">B-1</td>
			<td>used for microfluidic control</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Female luer-lock fittings to 10-32 threaded port</td>
			<td>ValuePlastics.com</td>
			<td style="width:163px;">KFTL-1</td>
			<td>used for microfluidic control</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NPN darlington transistor 500mA, 40V (2N6427)</td>
			<td>DigiKey.com</td>
			<td>2N6427GOS-ND</td>
			<td>used for microfluidic control</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">10kOhm, carbon film resistor, 0.25W</td>
			<td>DigiKey.com</td>
			<td>P10KBACT-ND</td>
			<td>used for microfluidic control</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tantalum capacitor, 10uF, 25V, 10%</td>
			<td>DigiKey.com</td>
			<td>478-1841-ND</td>
			<td>used for microfluidic control</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Andor CCD camera</td>
			<td style="width:135px;">Andor</td>
			<td style="width:163px;">Zyla 4.2 Plus SCMOS</td>
			<td>used for microfluidic on chip imaging</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">ELISA plate reader</td>
			<td style="width:135px;"></td>
			<td style="width:163px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">two component Silicone&#160;</td>
			<td style="width:135px;">Momentive</td>
			<td style="width:163px;">RTV 615</td>
			<td>used for microfluidic chip fabrication</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">SU-8 photoresist</td>
			<td style="width:135px;">Micrchem</td>
			<td style="width:163px;">SU8 2015</td>
			<td>used for microfluidic chip fabrication</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">AZ4620 photoresist</td>
			<td style="width:135px;">Clariant</td>
			<td style="width:163px;">AZ 4620</td>
			<td>used for microfluidic chip fabrication</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Plasma cleaner</td>
			<td style="width:135px;">Harrick Plasma</td>
			<td style="width:163px;">PDC 32G</td>
			<td>used for microfluidic chip fabrication</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">20 Gauge Syringe Needle</td>
			<td style="width:135px;">BD</td>
			<td style="width:163px;"></td>
			<td>used for microfluidic chip fabrication</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Labcycler</td>
			<td style="width:135px;">Sensoquest</td>
			<td style="width:163px;">Labcycler</td>
			<td>PCR&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">DNA polymerase</td>
			<td style="width:135px;">Toyobo</td>
			<td style="width:163px;">KDO Plus</td>
			<td>PCR amplification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Trimethoprim</td>
			<td style="width:135px;">Sigma</td>
			<td style="width:163px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:275px;">Plate reader</td>
			<td style="width:135px;">Biotek</td>
			<td style="width:163px;">Synergy H1 hybrid&#160;</td>
			<td>antibiotic resistane measurement</td>
		</tr>
	</tbody>
</table>

design and use of a low cost, automated morbidostat for adaptive evolution of bacteria under antibiotic drug selection

אנו מתארים בעלות נמוכה, morbidostat להגדרה לאפיון נתיב אבולוציוני של עמידות לאנטיביוטיקה. Morbidostat הוא מכשיר תרבית חיידקים מנטרים התפתחות חיידקים ברציפות ומתאימה באופן דינמי את ריכוז התרופה לקרוא תיגר על חיידקי זמן כפי שהם מתפתחים לרכוש עמידות לתרופות. המכשיר כולל נפח עבודה של ~ 10 מיליליטר הוא אוטומטי לחלוטין ומצויד מדידת צפיפות אופטית ו-משאבות מייקרו בינוני משלוח סמים. כדי לאמת את הפלטפורמה, מדדנו את הרכישה בשלבים של התנגדות trimethoprim ב coli Escherichia MG 1655, ומשולב המכשיר עם פלטפורמת microfluidic מרובבת לחקור מורפולוגיה תאי רגישות לאנטיביוטיקה. הגישה יכול להיות עד-לשנותם כדי במחקרי מעבדה של עמידות לתרופות אנטיביוטיות, והוא extendible כדי אדפטיבית האבולוציה לשיפורים זן בהנדסה מטבולית וניסויים התרבות חיידקים אחרים.

Morbidostat המתואר לעיל הוא schematized באיור 1. פעילות morbidostat המשותפת, לרבות התפתחות ניסיונית, מבחן רגישות לאנטיביוטיקה ובדיקת מורפולוגיה תא, אושש בבית E. תרבות MG1655 coli נחשף וסרימתופרים (TMP), תרופה אנטיביוטית נפוץ 5,6. TMP גורם עליות בשלבים ייחודיות מאוד עמידים לתרופות, ואת מוטציות מקובצים סביב דיהידרופולאט רדוקטאז (DHFR) הגן. לכן, TMP הוא סם תקן יעיל מאוד עבור אימות מבצע morbidostat. כל יום, החיידק צפוי לגדול מעל הסף שנקבע מראש צפיפות האופטית הדק הזרקת הסמים כפי שמוצג באיור 2a. זריקת התרופה צפויה לעכב את הצמיחה וכתוצאה מכך, להקטין את הצפיפות האופטית. פיילוטים כמה עשוי להיות נחוץ כדי לקבוע את ריכוז התרופה האופטימלית. ככלל אצבע, אנו increasדואר הריכוז של מדיום התרופה על ידי פי 5 לאחר שמצא כי מדיום התרופה נכשל לדכא את הצמיחה. לאחר כל מהלך הניסוי, דגימות קפואות יומיות הם הפשירו והשתמשו לקבוע IC 50, מדד כמותי של רמת עמידות לתרופות. העלילה איור 2b מראה את הגידול הזמני עמידות לתרופות אנטיביוטיות. התנגדות הסמים עלתה כ -1,500 לקפל ~ 1,000 מיקרוגרם / מיליליטר מעל ~ 12 ימים, עולים בקנה אחד עם ממצאים קודמים באבולוצית מעבדת 5 וקליניים מבודדים 19. מוטציות נקודת DHFR של המוטציה האחרון היום נמדדו על ידי רצף סנגר ו מפורטות בטבלה 2. מוטציה אחד נמצאת הממוקמת על אזור האמרגן ומציינת כי מוטציה נקודתית אחת באזור האמרגן יכולה לשנות את רמת הביטוי משמעותית של DHFR אנזים 20. עוד מוטציה במיקום 49,910 ממוקמת באזור הגן של DHFR והוא קרוב המעשהאתר ive של DHFR אנזים 21. רכישת עמידות לתרופות עם מוטציות רבות מוכיחה את התועלת של morbidostat, כמו הבחירה על תרופה המכילה צלחת אגרה נוטה להעניק את המוטציה היחידה בלבד. כתוצאת הודעה רגישה יותר של מורפולוגיה התאים, בדיקת מורפולוגיה התא הבודד עם רגישות לאנטיביוטיקה מתבצעת במקביל, פלטפורמת microfluidic מרובבת 14. איור 3 מציג את העיצוב של שבב microfluidic המרובב. Micrographs של תאים חיידקיים (איור 5) לגלות שינויים במורפולוגיה בשני סוג בר זנים מוטנטים תחת ריכוזים תת-המעכבת של TMP. זני סוג ברים להראות filamentation ניכר בעוד זן מוטנטי לא מראה filamentation משמעותי. שינוי המורפולוגיה זה ברמה תא בודד יכול לשמש לאבחון מהיר של עמידות לאנטיביוטיקה. איור 4 מציג את על-צ&#39;יעקומות גדילה p בריכוזים שונים של TMP. המדגם מוטציה, ניכר גידול משמעותי עמידות לתרופות אנטיביוטיות. נתוני הצמיחה על-שבב באיור 4 עולה בקנה אחד גם עם הערך 50 IC מקורא צלחת מוצג איור 2b. <img alt="איור 1" src="/files/ftp_upload/54426/54426fig1.jpg" /> איור 1:. סכמטי של morbidostat morbidostat הוא מכשיר תרבות רציף אשר מודד את הצפיפות האופטית של אוכלוסיית החיידקים, ובהתאם לכך מתאים את ריכוז התרופה. המכשיר פועל במצב סמים בהזרקה ומצב סמי דילול. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/54426fig1large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 2" src="/files/ftp_upload/54426/54426fig2.jpg"/&gt; איור 2: עקומת הצמיחה והגדלת רמת עמידות לתרופות אנטיביוטיות (א) עקומת הצמיחה נציג תחת משוב.. הצמיחה של החיידקים מעוכבות על ידי תרופת האנטיביוטיקה, זריקה אשר מופעל על ידי אלגוריתם סף. כאשר שיעור הצמיחה החיובי מעלה את הצפיפות האופטית מעל הסף שנקבע מראש (OD TH = 0.086), המכשיר למצב סמים בהזרקה. אחרת, המכשיר פועל במצב סמי דילול. האדום סגול החצים מצביעים מיתוג לתוך מצבי הזרקת סמים ודילול סמים, בהתאמה. (ב) התנגדות ברמה של התאים במהלך 12 ימים של חשיפת trimethoprim. IC 50 מראה גידול בשלבים ברורים של עמידות לתרופות אנטיביוטיות. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/54426fig2large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img al<html> t = &quot;איור 3&quot; src = &quot;/ files / ftp_upload / 54,426 / 54426fig3.jpg&quot; /&gt; איור 3: התקני microfluidic חוקר מורפולוגיה תאים על-שבב רגישות לאנטיביוטיקה (א) מיקרוסקופ של פריסת השבב.. מדורים ירוק וכחול הם תאי הגידול ובינוניים סמים, בהתאמה, ואת פריסת האדומה מציינת את השכבה מלאה. הממדים של חדר הצמיחה הם 450 מיקרומטר (אורך) x 400 מיקרומטר (w) x 8 מיקרומטר (ח). תא הצמיחה טעון עם החיידקים, ובית נבחרי התרופה עמוס TMP. סרגל קנה מידה הוא 1 ס&quot;מ. (ב) יתגדל לאור באותו השבב. סרגל קנה מידה = 500 מיקרומטר. (ג) מוגדל לאור שני התאים לפני ואחרי הערבוב. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/54426fig3large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> &quot;Src =&quot; / files / ftp_upload / 54,426 / 54426fig4.jpg &quot;/&gt; איור 4: על שבב עקומות גדילה של E. coli נחשפו לריכוזים שונים של TMP: (א) זן קדמון wild-type ו (ב) זן מוטנטי (ביום 12). המדגם מוטציה, ניכר גידול משמעותי עמידות לתרופות אנטיביוטיות. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/54426fig4large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 5" src="/files/ftp_upload/54426/54426fig5.jpg" /> איור 5: מורפולוגיות מתא בודד (א - ד) תמונות שדה מוארת של התא לאחר טיפול עם רמות תת-המעכבת של TMP. שים לב filamentation המשמעותי של תאים מהסוג בר ב (ב), אשר נעדר מוטנטים (ד </s<html> טרונג&gt;). פנלים (ה - ח) הם תמונות דיגיטליות של (א - ד). כל התמונות חיידקי נלקחו על ידי מצלמת CCD עם מטרה בהגדלה 40X. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/54426fig5large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> איור 1 משלים:. המידות וההרכבה של בעל בקבוקון התרבות <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/Supplemental_Figure_1.pdf" target="_blank">אנא לחץ כאן כדי להוריד את הקובץ.</a> איור 2 משלים:. התרשים מעגל עבור LED ו photodetector <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/Supplementary_Figure_2.PNG" target="_blank">אנא לחץ כאן כדי להוריד את הקובץ.</a> דק-page = &quot;1&quot;&gt; קוד משלים:. תסריט מותאם אישית לספור את המספר הסלולרי מתמונות תא רכש מן השבבים microfluidic <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54426/renamed_40eb7.pdf" target="_blank">אנא לחץ כאן כדי להוריד את הקובץ.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td colspan="2"> לִטעוֹם </td><td colspan="11"> והתרופות TMP (מיקרוגרם / מ&quot;ל) </td></tr><tr><td colspan="2"> יום 1-3 </td><td> 0 </td><td> 0.06 </td><td> 0.12 </td><td> 0.25 </td><td> 0.5 </td><td> 1 </td><td> 2 </td><td> 4 </td><td> 8 </td><td> 16 </td><td> 32 </td></tr><tr><td colspan="2"> יום 4 </td><td> 0 </td><td> 1 </td><td> 2 </td><td> 3 </td><td> 5 </td><td> 10 </td><td> 20 </td><td> 40 </td><td> 80 </td><td> 160 </td><td> 320 </td></tr><tr><td colspan="2"> יום 5-7 </td><td> 0 </td><td> 2 </td><td> 4 </td><td> 8 </td> &lt;td&gt; 15 </td><td> 30 </td><td> 60 </td><td> 120 </td><td> 240 </td><td> 480 </td><td> 960 </td></tr><tr><td colspan="2"> יום 8-12 </td><td> 0 </td><td> 3 </td><td> 7 </td><td> 15 </td><td> 30 </td><td> 60 </td><td> 125 </td><td> 250 </td><td> 500 </td><td> 1,000 </td><td> 2,000 </td></tr></tbody></table> טבלת 1:. ריכוז תרופה המשמש לקביעת IC 50 במדידה קוראת צלחת ריכוזי התרופה ביחידה של מיקרוגרם / מיליליטר מוצגת למדגם הקפוא היומי. כאשר התאים לפתח עמידות לתרופות גבוהה, ריכוזי התרופה המשמשת גדלו בהתאם. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> לא </td><td> מקום </td><td> SNP </td><td> הערה </td></tr><tr><td> 1 </td><td> 49,894 </td><td> C-&gt; T </td><tד&gt; גן DHFR </td></tr><tr><td> 2 </td><td> 49,910 </td><td> T-&gt; </td><td> גן DHFR </td></tr><tr><td> 3 </td><td> 49,795 </td><td> C-&gt; T </td><td> אמרגן DHFR </td></tr></tbody></table> טבלה 2:. מוטצית DHFR המזוהית על ידי רצף סנגר נתוני רצף הנציג להראות שלוש מוטציות נקודתיות DHFR של המוטציה האחרונה היום (יום 12). אזורי אמרגן הגנים מכילים SNPs אחד ו -2, בהתאמה. פריימרים קדימה הפוכה המשמשים PCR היו 3&#39;TCTAGAGAGATCATTACCGA GGACCGCGAACATCTGTCAT5 &#39;ו 3&#39;ACTAGT TTACCGCCGCTC CAGAATCTCAA AGCAATAGCTG5&#39;.

Watch this Scientific Journal Video about Design and Use of a Low Cost, Automated Morbidostat for Adaptive Evolution of Bacteria Under Antibiotic Drug Selection at JoVE.com

Design and Use of a Low Cost, Automated Morbidostat for Adaptive Evolution of Bacteria Under Antibiotic Drug Selection

We describe a low cost, configurable morbidostat that enables the characterization of antibiotic drug resistance by dynamically adjusting the drug concentration. The device can be integrated with a multiplexed microfluidic platform. The approach can be scaled up for laboratory antibiotic drug resistance studies.

עיצוב ושימוש בעלות נמוכה, אוטומטי Morbidostat עבור Adaptive אבולוציה מהירה של חיידקים תחת אנטיביוטי והתרופות בחירה

We describe a low cost, configurable morbidostat for characterizing the evolutionary pathway of antibiotic resistance. The morbidostat is a bacterial ...

design-use-low-cost-automated-morbidostat-for-adaptive-evolution

Nanyang Technological University

Research

JoVE Journal

Genetics

9.6K Views.  National Tsing Hua University. We describe a low cost, configurable morbidostat that enables the characterization of antibiotic drug resistance by dynamically adjusting the drug concentration. The device can be integrated with a multiplexed microfluidic platform. The approach can be scaled up for laboratory antibiotic drug resistance studies.

Video: Design and Use of a Low Cost, Automated Morbidostat for Adaptive Evolution of Bacteria Under Antibiotic Drug Selection

Procedure for Adaptive Laboratory Evolution of Microorganisms Using a Chemostat

Natural evolution involves genetic diversity such as environmental change and a selection between small populations. Adaptive laboratory evolution (ALE) refers to the experimental situation in which evolution is observed using living organisms under controlled conditions and stressors; organisms are thereby artificially forced to make evolutionary changes. Microorganisms are subject to a variety of stressors in the environment and are capable of regulating certain stress-inducible proteins to increase their chances of survival. Naturally occurring spontaneous mutations bring about changes in a microorganism's genome that affect its chances of survival. Long-term exposure to chemostat culture provokes an accumulation of spontaneous mutations and renders the most adaptable strain dominant. Compared to the colony transfer and serial transfer methods, chemostat culture entails the highest number of cell divisions and, therefore, the highest number of diverse populations. Although chemostat culture for ALE requires more complicated culture devices, it is less labor intensive once the operation begins. Comparative genomic and transcriptome analyses of the adapted strain provide evolutionary clues as to how the stressors contribute to mutations that overcome the stress. The goal of the current paper is to bring about accelerated evolution of microorganisms under controlled laboratory conditions.

Here, we present a protocol to obtain adaptive laboratory evolution of microorganisms under conditions using chemostat culture. Also, genomic analysis of the evolved strain is discussed.

נוהל מסתגל מעבדת האבולוציה של מיקרואורגניזמים שימוש Chemostat

Natural evolution involves genetic diversity such as environmental change and a selection between small populations. Adaptive laboratory evolution (ALE) ...

Testing the Role of Multicopy Plasmids in the Evolution of Antibiotic Resistance

Multicopy plasmids are extremely abundant in prokaryotes but their role in bacterial evolution remains poorly understood. We recently showed that the increase in gene copy number per cell provided by multicopy plasmids could accelerate the evolution of plasmid-encoded genes. In this work, we present an experimental system to test the ability of multicopy plasmids to promote gene evolution. Using simple molecular biology methods, we constructed a model system where an antibiotic resistance gene can be inserted into Escherichia coli MG1655, either in the chromosome or on a multicopy plasmid. We use an experimental evolution approach to propagate the different strains under increasing concentrations of antibiotics and we measure survival of bacterial populations over time. The choice of the antibiotic molecule and the resistance gene is so that the gene can only confer resistance through the acquisition of mutations. This &#34;evolutionary rescue&#34; approach provides a simple method to test the potential of multicopy plasmids to promote the acquisition of antibiotic resistance. In the next step of the experimental system, the molecular bases of antibiotic resistance are characterized. To identify mutations responsible for the acquisition of antibiotic resistance we use deep DNA sequencing of samples obtained from whole populations and clones. Finally, to confirm the role of the mutations in the gene under study, we reconstruct them in the parental background and test the resistance phenotype of the resulting strains.

Here we present an experimental method to test the role of multicopy plasmids in the evolution of antibiotic resistance.

בוחן את התפקיד של פלסמידים Multicopy באבולוציה של עמידות לאנטיביוטיקה

Multicopy plasmids are extremely abundant in prokaryotes but their role in bacterial evolution remains poorly understood. We recently showed that the ...

Genome-wide Surveillance of Transcription Errors in Eukaryotic Organisms

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that control the fidelity of transcription. To fill this gap in scientific knowledge, we recently optimized the circle-sequencing assay to detect transcription errors throughout the transcriptome of Saccharomyces cerevisiae, Drosophila melanogaster, and Caenorhabditis elegans. This protocol will provide researchers with a powerful new tool to map the landscape of transcription errors in eukaryotic cells so that the mechanisms that control the fidelity of transcription can be elucidated in unprecedented detail.

This protocol provides researchers with a new tool to monitor the fidelity of transcription in multiple model organisms.

מעקב ברמת הגנום של שגיאות תיעתוק היצורים האיקריוטים

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that ...

Producing Gene Deletions in Escherichia coli by P1 Transduction with Excisable Antibiotic Resistance Cassettes

A first approach to study the function of an unknown gene in bacteria is to create a knock-out of this gene. Here, we describe a robust and fast protocol for transferring gene deletion mutations from one Escherichia coli strain to another by using generalized transduction with the bacteriophage P1. This method requires that the mutation be selectable (e.g., based on gene disruptions using antibiotic cassette insertions). Such antibiotic cassettes can be mobilized from a donor strain and introduced into a recipient strain of interest to quickly and easily generate a gene deletion mutant. The antibiotic cassette can be designed to include flippase recognition sites that allow the excision of the cassette by a site-specific recombinase to produce a clean knock-out with only a ~100-base-pair-long scar sequence in the genome. We demonstrate the protocol by knocking out the tamA gene encoding an assembly factor involved in autotransporter biogenesis and test the effect of this knock-out on the biogenesis and function of two trimeric autotransporter adhesins. Though gene deletion by P1 transduction has its limitations, the ease and speed of its implementation make it an attractive alternative to other methods of gene deletion.

Producing Gene Deletions in Escherichia coli by P1 Transduction with Excisable Antibiotic Resistance Cassettes

Here we present a protocol for the use of pre-existing antibiotic resistance-cassette deletion constructs as a basis for making deletion mutants in other E. coli strains. Such deletion mutations can be mobilized and inserted into the corresponding locus of a recipient strain using P1 bacteriophage transduction.

הפקת ג'ין מחיקות ב- Escherichia coli מאת P1 התמרה חושית עם קלטות עמידות לאנטיביוטיקה ניתן לניתוח

A first approach to study the function of an unknown gene in bacteria is to create a knock-out of this gene. Here, we describe a robust and fast protocol ...

qKAT: Quantitative Semi-automated Typing of Killer-cell Immunoglobulin-like Receptor Genes

Killer cell immunoglobulin-like receptors (KIRs) are a set of inhibitory and activating immune receptors, on natural killer (NK) and T cells, encoded by a polymorphic cluster of genes on chromosome 19. Their best-characterized ligands are the human leukocyte antigen (HLA) molecules that are encoded within the major histocompatibility complex (MHC) locus on chromosome 6. There is substantial evidence that they play a significant role in immunity, reproduction, and transplantation, making it crucial to have techniques that can accurately genotype them. However, high-sequence homology, as well as allelic and copy number variation, make it difficult to design methods that can accurately and efficiently genotype all KIR genes. Traditional methods are usually limited in the resolution of data obtained, throughput, cost-effectiveness, and the time taken for setting up and running the experiments. We describe a method called quantitative KIR semi-automated typing (qKAT), which is a high-throughput multiplex real-time polymerase chain reaction method that can determine the gene copy numbers for all genes in the KIR locus. qKAT is a simple high-throughput method that can provide high-resolution KIR copy number data, which can be further used to infer the variations in the structurally polymorphic haplotypes that encompass them. This copy number and haplotype data can be beneficial for studies on large-scale disease associations, population genetics, as well as investigations on expression and functional interactions between KIR and HLA.

Quantitative killer cell immunoglobulin-like receptor (KIR) semi-automated typing (qKAT) is a simple, high-throughput, and cost-effective method to copy number type KIR genes for their application in population and disease association studies.

qKAT: Semi-automated כמותיים הקלדה של הרוצח-תא גנים קולטני דמוי נוגדן

Killer cell immunoglobulin-like receptors (KIRs) are a set of inhibitory and activating immune receptors, on natural killer (NK) and T cells, encoded by a ...

Genetic Engineering of Dictyostelium discoideum Cells Based on Selection and Growth on Bacteria

Dictyostelium discoideum is an intriguing model organism for the study of cell differentiation processes during development, cell signaling, and other important cellular biology questions. The technologies available to genetically manipulate Dictyostelium cells are well-developed. Transfections can be performed using different selectable markers and marker re-cycling, including homologous recombination and insertional mutagenesis. This is supported by a well-annotated genome. However, these approaches are optimized for axenic cell lines growing in liquid cultures and are difficult to apply to non-axenic wild-type cells, which feed only on bacteria. The mutations that are present in axenic strains disturb Ras signaling, causing excessive macropinocytosis required for feeding, and impair cell migration, which confounds the interpretation of signal transduction and chemotaxis experiments in those strains. Earlier attempts to genetically manipulate non-axenic cells have lacked efficiency and required complex experimental procedures. We have developed a simple transfection protocol that, for the first time, overcomes these limitations. Those series of large improvements to Dictyostelium molecular genetics allow wild-type cells to be manipulated as easily as standard laboratory strains. In addition to the advantages for studying uncorrupted signaling and motility processes, mutants that disrupt macropinocytosis-based growth can now be readily isolated. Furthermore, the entire transfection workflow is greatly accelerated, with recombinant cells that can be generated in days rather than weeks. Another advantage is that molecular genetics can further be performed with freshly isolated wild-type Dictyostelium samples from the environment. This can help to extend the scope of approaches used in these research areas.

Genetic Engineering of Dictyostelium discoideum Cells Based on Selection and Growth on Bacteria

Dictyostelium discoideum is a popular model organism to study complex cellular processes such as cell migration, endocytosis, and development. The utility of the organism is dependent on the feasibility of genetic manipulation. Here, we present methods to transfect Dictyostelium discoideum cells that overcome existing limitations of culturing cells in liquid media.

הנדסה גנטית של Dictyostelium discoideum תאים בהתבסס על הבחירה וצמיחה על חיידקים

Dictyostelium discoideum is an intriguing model organism for the study of cell differentiation processes during development, cell signaling, and other ...

Designing Automated, High-throughput, Continuous Cell Growth Experiments Using eVOLVER

Continuous culture methods enable cells to be grown under quantitatively controlled environmental conditions, and are thus broadly useful for measuring fitness phenotypes and improving our understanding of how genotypes are shaped by selection. Extensive recent efforts to develop and apply niche continuous culture devices have revealed the benefits of conducting new forms of cell culture control. This includes defining custom selection pressures and increasing throughput for studies ranging from long-term experimental evolution to genome-wide library selections and synthetic gene circuit characterization. The eVOLVER platform was recently developed to meet this growing demand: a continuous culture platform with a high degree of scalability, flexibility, and automation. eVOLVER provides a single standardizing platform that can be (re)-configured and scaled with minimal effort to perform many different types of high-throughput or multi-dimensional growth selection experiments. Here, a protocol is presented to provide users of the eVOLVER framework a description for configuring the system to conduct a custom, large-scale continuous growth experiment. Specifically, the protocol guides users on how to program the system to multiplex two selection pressures &#8212; temperature and osmolarity &#8212; across many eVOLVER vials in order to quantify fitness landscapes of Saccharomyces cerevisiae mutants at fine resolution. We show how the device can be configured both programmatically, through its open-source web-based software, and physically, by arranging fluidic and hardware layouts. The process of physically setting up the device, programming the culture routine, monitoring and interacting with the experiment in real-time over the internet, sampling vials for subsequent offline analysis, and post experiment data analysis are detailed. This should serve as a starting point for researchers across diverse disciplines to apply eVOLVER in the design of their own complex and high-throughput cell growth experiments to study and manipulate biological systems.

The eVOLVER framework enables high-throughput continuous microbial culture with high resolution and dynamic control over experimental parameters. This protocol demonstrates how to apply the system to conduct a complex fitness experiment, guiding users on programming automated control over many individual cultures, measuring, collecting, and interacting with experimental data in real-time.

עיצוב אוטומטי, תפוקה גבוהה, ניסויים בגידול תאים רציפים באמצעות הפיתוח

Continuous culture methods enable cells to be grown under quantitatively controlled environmental conditions, and are thus broadly useful for measuring ...

Use of Frozen Tissue in the Comet Assay for the Evaluation of DNA Damage

The comet assay is gaining popularity as a means to assess DNA damage in cultured cells and tissues, particularly following exposure to chemicals or other environmental stressors. Use of the comet assay in regulatory testing for genotoxic potential in rodents has been driven by adoption of an Organisation for Economic Co-operation and Development (OECD) test guideline in 2014. Comet assay slides are typically prepared from fresh tissue at the time of necropsy; however, freezing tissue samples can avoid logistical challenges associated with simultaneous preparation of slides from multiple organs per animal and from many animals per study. Freezing also enables shipping samples from the exposure facility to a different laboratory for analysis, and storage of frozen tissue facilitates deferring a decision to generate DNA damage data for a given organ. The alkaline comet assay is useful for detecting exposure-related DNA double- and single-strand breaks, alkali-labile lesions, and strand breaks associated with incomplete DNA excision repair. However, DNA damage can also result from mechanical shearing or improper sample processing procedures, confounding the results of the assay. Reproducibility in collection and processing of tissue samples during necropsies may be difficult to control due to fluctuating laboratory personnel with varying levels of experience in harvesting tissues for the comet assay. Enhancing consistency through refresher training or deployment of mobile units staffed with experienced laboratory personnel is costly and may not always be feasible. To optimize consistent generation of high quality samples for comet assay analysis, a method for homogenizing flash frozen cubes of tissue using a customized tissue mincing device was evaluated. Samples prepared for the comet assay by this method compared favorably in quality to fresh and frozen tissue samples prepared by mincing during necropsy. Moreover, low baseline DNA damage was measured in cells from frozen cubes of tissue following prolonged storage.

This protocol describes several procedures for preparing high quality frozen tissue samples at the time of necropsy for use in the comet assay to assess DNA damage: 1) minced tissue, 2) scraped epithelial cells from the gastrointestinal tract, and 3) cubed tissue samples, requiring homogenization using a tissue mincing device.

שימוש ברקמות קפואות בתוך שיטת שביט להערכת נזק לדנ א

The comet assay is gaining popularity as a means to assess DNA damage in cultured cells and tissues, particularly following exposure to chemicals or other ...

Use of Drosophila S2 Cells for Live Imaging of Cell Division

Drosophila S2 cells are an important tool in studying mitosis in tissue culture, providing molecular insights into this fundamental cellular process in a rapid and high-throughput manner. S2 cells have proven amenable to both fixed- and live-cell imaging applications. Notably, live-cell imaging can yield valuable information about how loss or knockdown of a gene can affect the kinetics and dynamics of key events during cell division, including mitotic spindle assembly, chromosome congression, and segregation, as well as overall cell cycle timing. Here we utilize S2 cells stably transfected with fluorescently tagged mCherry:&#945;-tubulin to mark the mitotic spindle and GFP:CENP-A (referred to as &#8216;CID&#8217; gene in Drosophila) to mark the centromere to analyze the effects of key mitotic genes on the timing of cell divisions, from prophase (specifically at Nuclear Envelope Breakdown; NEBD) to the onset of anaphase. This imaging protocol also allows for the visualization of the spindle microtubule and chromosome dynamics throughout mitosis. Herein, we aim to provide a simple yet comprehensive protocol that will allow readers to easily adapt S2 cells for live imaging experiments. Results obtained from such experiments should expand our understanding of genes involved in the cell division by defining their role in several simultaneous and dynamic events. Observations made in this cell culture system can be validated and further investigated in vivo using the impressive toolkit of genetic approaches in flies.

Use of Drosophila S2 Cells for Live Imaging of Cell Division

Cell divisions can be visualized in real time using fluorescently tagged proteins and time-lapse microscopy. Using the protocol presented here, users can analyze cell division timing dynamics, mitotic spindle assembly, and chromosome congression and segregation. Defects in these events following RNA interference (RNAi)-mediated gene knockdown can be assessed and quantified.

שימוש ב- Drosophila ילה S2 תאים עבור הדמיה חיה של חטיבת התא

Drosophila S2 cells are an important tool in studying mitosis in tissue culture, providing molecular insights into this fundamental cellular process in a ...

A FACS-based Protocol to Isolate RNA from the Secondary Cells of Drosophila Male Accessory Glands

To understand the function of an organ, it is often useful to understand the role of its constituent cell populations. Unfortunately, the rarity of individual cell populations often makes it difficult to obtain enough material for molecular studies. For example, the accessory gland of the Drosophila male reproductive system contains two distinct secretory cell types. The main cells make up 96% of the secretory cells of the gland, while the secondary cells (SC) make up the remaining 4% of cells (about 80 cells per male). Although both cell types produce important components of the seminal fluid, only a few genes are known to be specific to the SCs. The rarity of SCs has, thus far, hindered transcriptomic analysis study of this important cell type. Here, a method is presented that allows for the purification of SCs for RNA extraction and sequencing. The protocol consists in first dissecting glands from flies expressing a SC-specific GFP reporter and then subjecting these glands to protease digestion and mechanical dissociation to obtain individual cells. Following these steps, individual, living, GFP-marked cells are sorted using a fluorescent activated cell sorter (FACS) for RNA purification. This procedure yields SC-specific RNAs from ~40 males per condition for downstream RT-qPCR and/or RNA sequencing in the course of one day. The rapidity and simplicity of the procedure allows for the transcriptomes of many different flies, from different genotypes or environmental conditions, to be determined in a short period of time.

A FACS-based Protocol to Isolate RNA from the Secondary Cells of Drosophila Male Accessory Glands

Here, we present a protocol to dissociate and sort a specific cell population from the Drosophila male accessory glands (secondary cells) for RNA sequencing and RT-qPCR. Cell isolation is accomplished through FACS purification of GFP-expressing secondary cells after a multistep-dissociation process requiring dissection, proteases digestion and mechanical dispersion.

פרוטוקול מבוסס FACS כדי לבודד RNA מן התאים המשניים של דרוזוהילה בלוטות אביזר זכר

To understand the function of an organ, it is often useful to understand the role of its constituent cell populations. Unfortunately, the rarity of ...